DOCSLIB.ORG

MASARYK UNIVERSITY Faculty of Science

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MASARYK UNIVERSITY Faculty of Science MASARYK UNIVERSITY Faculty of Science Regional Centre for Applied Molecular Oncology (RECAMO) INVESTIGATION OF AGR3 PROTEIN FUNCTION AND MECHANISMS TRIGGERING ITS EXPRESSION IN CANCER CELL Dissertation Joanna Obacz Supervisor: Roman Hrstka, Ph.D. Brno 2015 Bibliography Author’s name and surname: Joanna Obacz, M.Sc. Dissertation title (Czech): Studium funkce proteinu AGR3 a mechanism ů zodpov ědných za regulaci jeho exprese v nádorové bu ňce. Dissertation title: Investigation of AGR3 protein function and mechanisms triggering its expression in cancer cell. Study programme: Biochemistry Field of study: Genomics and Proteomics Supervisor: Roman Hrstka, Ph.D. Year of defence: 2016 Key words (Czech): AGR3, AGR2, biomarker, karcinom mlé čné žlázy, extracelulární protein Key words: AGR3, AGR2, biomarker, breast cancer, extracellular protein © Joanna Obacz, Masaryk University, 2015 Acknowledgments I would like to thank my supervisor Roman Hrstka, Ph.D., for the guidance through the years, and the vital critique of this work; as well as Borivoj Vojtesek, DrSc., for giving me the opportunity to carry out this work in his lab and for many valuable advice. I express my gratitude to prof. Silvia Pastorekova for co-supervision and broad expertise in the field, creating a family atmosphere during my stays in Bratislava and constant supply of encouragement. I would like to express special thanks to Veronika Brychtova, Ph.D., Martina Takacova, Ph.D. and Filippo Iuliano, Ph.D., for friendly and fruitful collaboration in the lab and publications writing. Moreover, I would like to acknowledge all the colleagues from RECAMO and collaborating lab in Bratislava for various ways of helping during my Ph.D. studies, especially Paulina Orzol, Lucia Sommerova, Martin Benej, Ivana Vidlickova and Stela Lausova. Lastly, I would like to thank my family and friends from all over the world for constant support. This work was supported by the project MEYS – NPS I – LO1413 and European Regional Development Fund and the state budget of the Czech Republic for Regional Centre for Applied Molecular Oncology – RECAMO (CZ.1.05/2.1.00/03.0101). I hereby declare that this dissertation is my own independent work. I have only used the given sources and materials and I have cited others’ work appropriately. …………………………....... Abstrakt Úvod: Anterior gradient protein (AGR) 3 je blízce p říbuzným homologem proonkogenního proteinu AGR2. AGR3 je taxonomicky řazen do rodiny protein disulfid izomeráz. Přestože byla p řítomnost AGR3 detekována u řady malignit, v četn ě nádor ů mlé čné žlázy, vaje čník ů, prostaty a jater, zůstává funkce tohoto proteinu v tumorigenezi stále ne zcela prozkoumána. Cílem p ředložené práce bylo popsat úlohu AGR3 v nádorové buňce, p ředevším pak mechanismy regulující hladinu AGR3, analyzovat vztah mezi proteiny AGR3 a AGR2 a stanovit prognostický význam exprese AGR3 u karcinom ů mlé čné žlázy. Metody: Funkce proteinu AGR3 byla studována na bun ěč ných liniích MCF-7 a T-47D odvozených od karcinomu mlé čné žlázy a H1299 odvozených od karcinomu plic, pomocí jak 2D tak i 3D modelových bun ěč ných systém ů. Vliv extracelulárního proteinu AGR3 na chování nádorové bu ňky byl studován pomocí monitorování bun ěč né proliferace v reálném čase, testu adhezivity, metody zacelování rýhy a β-galaktozidázovým testem. Interakce mezi AGR3 a AGR2 byla analyzována pomocí tzv. „proximity ligation assay“ a imunoprecipitace. Imunohistochemie a kvantitativní PCR byly využity ke stanovení AGR3 exprese u kohorty 129 primárních karcinom ů mlé čné žlázy. Ke statistickým analýzám v četn ě stanovení potenciálního prognostického významu proteinu AGR3 byly použity Fisher ův test, Pearson ův chí-kvadrát test a Breslow ův test. Výsledky: AGR3 přispívá k přežívání nádorových bun ěk b ěhem r ůzných stresových podmínek, v četn ě poškození DNA, a to jak závisle, tak i nezávisle na proteinu p53. V případ ě sekrece tohoto proteinu do extracelulárního prostoru, AGR3 přispívá k bun ěč né adhezi a migraci pravd ěpodobn ě díky modifikaci signálních drah, které se významn ě uplat ňují v nádorových bu ňkách. In silico analýzy odhalily, že AGR3 regulované i regulující signální dráhy se mohou podílet na regulaci bun ěč né proliferace, diferenciace, metastazování a celkového p řežití. Dále bylo zjišt ěno, že protein AGR3 nejen že může p římo interagovat s proteinem AGR2, ale u řady nádorových ale i normálních tkání je jeho expresní profil velmi podobný AGR2. Immunohistochemická analýza u karcinom ů mlé čné žlázy potvrdila korelaci mezi AGR3 expresí a estrogenovými receptory, progesteronovými receptory a nízkým grade. Ačkoli zvýšená exprese AGR3 predikovala lepší bezp říznakové p řežití, vícerozm ěrná statistická analýza nepotvrdila AGR3 jako nezávislý prognostický faktor. Záv ěr: AGR3 představuje potenciální tká ňový a sérový biomarker, který se m ůže podílet respektive p římo ovliv ňovat fenotyp nádorových bun ěk a s tím spojené projevy nádorového onemocn ění. Abstract Background: Anterior gradient protein (AGR) 3 is a highly related homologue of pro- oncogenic AGR2 and belongs to the family of protein disulphide isomerases. Although AGR3 was found in breast, ovary, prostate, and liver cancer, it remains of poorly defined function in tumourigenesis. The aim of this study was to elucidate AGR3 role in cancer and mechanisms responsible for its induction in tumour cell, to study putative AGR3- AGR2 cross-talk, and to determine the prognostic significance of AGR3 expression in breast carcinomas. Methods: AGR3 function was studied on breast carcinoma cell lines MCF-7 and T-47D and lung cancer cell line H1299 using both 2D and 3D models. The effect of extracellular AGR3 on cancer cell behaviour was assessed using Real-Time cell proliferation monitoring, detachment, wound-healing and β-galactosidase assays. The interaction between AGR3 and AGR2 was determined using proximity ligation assay and co-immunoprecipitation. Immunohistochemistry and qPCR were used to study AGR3 expression in a cohort of 129 primary breast carcinomas. Statistical analyses used for the determination of AGR3 prognostic significance included the Fisher’s exact, Pearson`s chi-square and Breslow tests. Results: AGR3 promotes survival of tumour cells upon DNA damage and microenvironmantal stresses both in p53-dependent and p53-independent manner. When secreted into extracellular space, it promotes cell adhesion and migration, possibly through the modification of tumour-associated signalling pathways. In silico analyses revealed that AGR3 upstream and downstream signalling may coordinate among others cell proliferation, differentiation, metastasis and survival. Furthermore, AGR3 directly binds to AGR2 and when compared to the latter is expressed in a similar manner in diverse carcinomas and normal tissues. Immunohistochemical analysis of breast cancer specimens showed that AGR3 expression correlated with oestrogen receptor and progesterone receptor positivity, as well as low tumour grade. Although in the whole cohort AGR3 positivity was associated with better progression free survival, the multivariate survival analysis did not found AGR3 as an independent prognostic factor for breast cancer patients outcome. Conclusions: AGR3 is a potential tissue and serum biomarker which modifies tumour- associated phenotype in a context-dependent manner. Table of contents 1 Introduction ...................................................................................................................... 10 1.1 AGR protein family ....................................................................................................... 10 1.1.1 AGR proteins in lower vertebrates ..................................................................... 10 1.1.2 Human AGR proteins ......................................................................................... 11 1.2 AGR proteins as PDI family members .......................................................................... 12 1.2.1 General features of the PDI family ..................................................................... 12 1.2.2 Evidence for the belonging of AGR proteins to PDI family .............................. 13 1.3 AGR proteins expression in human tissues ................................................................... 15 1.3.1 AGRs expression in healthy tissues ................................................................... 15 1.3.2 AGRs expression in pathologic conditions ........................................................ 16 1.4 Role of AGR proteins in tumour biology ...................................................................... 16 1.5 AGR proteins as components of tumour-associated pathways ..................................... 18 1.6 Prognostic significance of AGR2 and AGR3 expression in carcinomas ...................... 20 1.6.1 Significance of AGRs tissue expression ............................................................. 20 1.6.2 AGRs as secreted biomarkers ............................................................................. 22 2 Aims ................................................................................................................................. 24 3 Materials and methods ...................................................................................................... 25 3.1 Cell cultures and drug treatments .................................................................................. 25 3.1.1 2D models ..........................................................................................................
Load more

Recommended publications
  • Identification of Genes Concordantly Expressed with Atoh1 During Inner Ear Development
    Original Article doi: 10.5115/acb.2011.44.1.69 pISSN 2093-3665 eISSN 2093-3673 Identification of genes concordantly expressed with Atoh1 during inner ear development Heejei Yoon, Dong Jin Lee, Myoung Hee Kim, Jinwoong Bok Department of Anatomy, Brain Korea 21 Project for Medical Science, College of Medicine, Yonsei University, Seoul, Korea Abstract: The inner ear is composed of a cochlear duct and five vestibular organs in which mechanosensory hair cells play critical roles in receiving and relaying sound and balance signals to the brain. To identify novel genes associated with hair cell differentiation or function, we analyzed an archived gene expression dataset from embryonic mouse inner ear tissues. Since atonal homolog 1a (Atoh1) is a well known factor required for hair cell differentiation, we searched for genes expressed in a similar pattern with Atoh1 during inner ear development. The list from our analysis includes many genes previously reported to be involved in hair cell differentiation such as Myo6, Tecta, Myo7a, Cdh23, Atp6v1b1, and Gfi1. In addition, we identified many other genes that have not been associated with hair cell differentiation, including Tekt2, Spag6, Smpx, Lmod1, Myh7b, Kif9, Ttyh1, Scn11a and Cnga2. We examined expression patterns of some of the newly identified genes using real-time polymerase chain reaction and in situ hybridization. For example, Smpx and Tekt2, which are regulators for cytoskeletal dynamics, were shown specifically expressed in the hair cells, suggesting a possible role in hair cell differentiation or function. Here, by re- analyzing archived genetic profiling data, we identified a list of novel genes possibly involved in hair cell differentiation.
    [Show full text]
  • Preclinical Evaluation of Protein Disulfide Isomerase Inhibitors for the Treatment of Glioblastoma by Andrea Shergalis
    Preclinical Evaluation of Protein Disulfide Isomerase Inhibitors for the Treatment of Glioblastoma By Andrea Shergalis A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Medicinal Chemistry) in the University of Michigan 2020 Doctoral Committee: Professor Nouri Neamati, Chair Professor George A. Garcia Professor Peter J. H. Scott Professor Shaomeng Wang Andrea G. Shergalis [email protected] ORCID 0000-0002-1155-1583 © Andrea Shergalis 2020 All Rights Reserved ACKNOWLEDGEMENTS So many people have been involved in bringing this project to life and making this dissertation possible. First, I want to thank my advisor, Prof. Nouri Neamati, for his guidance, encouragement, and patience. Prof. Neamati instilled an enthusiasm in me for science and drug discovery, while allowing me the space to independently explore complex biochemical problems, and I am grateful for his kind and patient mentorship. I also thank my committee members, Profs. George Garcia, Peter Scott, and Shaomeng Wang, for their patience, guidance, and support throughout my graduate career. I am thankful to them for taking time to meet with me and have thoughtful conversations about medicinal chemistry and science in general. From the Neamati lab, I would like to thank so many. First and foremost, I have to thank Shuzo Tamara for being an incredible, kind, and patient teacher and mentor. Shuzo is one of the hardest workers I know. In addition to a strong work ethic, he taught me pretty much everything I know and laid the foundation for the article published as Chapter 3 of this dissertation. The work published in this dissertation really began with the initial identification of PDI as a target by Shili Xu, and I am grateful for his advice and guidance (from afar!).
    [Show full text]
  • The Genetics of Human Skin and Hair Pigmentation
    GG20CH03_Pavan ARjats.cls July 31, 2019 17:4 Annual Review of Genomics and Human Genetics The Genetics of Human Skin and Hair Pigmentation William J. Pavan1 and Richard A. Sturm2 1Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland 20892, USA; email: [email protected] 2Dermatology Research Centre, The University of Queensland Diamantina Institute, The University of Queensland, Brisbane, Queensland 4102, Australia; email: [email protected] Annu. Rev. Genom. Hum. Genet. 2019. 20:41–72 Keywords First published as a Review in Advance on melanocyte, melanogenesis, melanin pigmentation, skin color, hair color, May 17, 2019 genome-wide association study, GWAS The Annual Review of Genomics and Human Genetics is online at genom.annualreviews.org Abstract https://doi.org/10.1146/annurev-genom-083118- Human skin and hair color are visible traits that can vary dramatically Access provided by University of Washington on 09/02/19. For personal use only. 015230 within and across ethnic populations. The genetic makeup of these traits— Annu. Rev. Genom. Hum. Genet. 2019.20:41-72. Downloaded from www.annualreviews.org Copyright © 2019 by Annual Reviews. including polymorphisms in the enzymes and signaling proteins involved in All rights reserved melanogenesis, and the vital role of ion transport mechanisms operating dur- ing the maturation and distribution of the melanosome—has provided new insights into the regulation of pigmentation. A large number of novel loci involved in the process have been recently discovered through four large- scale genome-wide association studies in Europeans, two large genetic stud- ies of skin color in Africans, one study in Latin Americans, and functional testing in animal models.
    [Show full text]
  • 1 Mucosal Effects of Tenofovir 1% Gel 1 Florian Hladik1,2,5*, Adam
    1 Mucosal effects of tenofovir 1% gel 2 Florian Hladik1,2,5*, Adam Burgener8,9, Lamar Ballweber5, Raphael Gottardo4,5,6, Lucia Vojtech1, 3 Slim Fourati7, James Y. Dai4,6, Mark J. Cameron7, Johanna Strobl5, Sean M. Hughes1, Craig 4 Hoesley10, Philip Andrew12, Sherri Johnson12, Jeanna Piper13, David R. Friend14, T. Blake Ball8,9, 5 Ross D. Cranston11,16, Kenneth H. Mayer15, M. Juliana McElrath2,3,5 & Ian McGowan11,16 6 Departments of 1Obstetrics and Gynecology, 2Medicine, 3Global Health, 4Biostatistics, University 7 of Washington, Seattle, USA; 5Vaccine and Infectious Disease Division, 6Public Health Sciences 8 Division, Fred Hutchinson Cancer Research Center, Seattle, USA; 7Vaccine and Gene Therapy 9 Institute-Florida, Port St. Lucie, USA; 8Department of Medical Microbiology, University of 10 Manitoba, Winnipeg, Canada; 9National HIV and Retrovirology Laboratories, Public Health 11 Agency of Canada; 10University of Alabama, Birmingham, USA; 11University of Pittsburgh 12 School of Medicine, Pittsburgh, USA; 12FHI 360, Durham, USA; 13Division of AIDS, NIAID, NIH, 13 Bethesda, USA; 14CONRAD, Eastern Virginia Medical School, Arlington, USA; 15Fenway Health, 14 Beth Israel Deaconess Hospital and Harvard Medical School, Boston, USA; 16Microbicide Trials 15 Network, Magee-Women’s Research Institute, Pittsburgh, USA. 16 Adam Burgener and Lamar Ballweber contributed equally to this work. 17 *Corresponding author E-mail: [email protected] 18 Address reprint requests to Florian Hladik at [email protected] or Ian McGowan at 19 [email protected]. 20 Abstract: 150 words. Main text (without Methods): 2,603 words. Methods: 3,953 words 1 21 ABSTRACT 22 Tenofovir gel is being evaluated for vaginal and rectal pre-exposure prophylaxis against HIV 23 transmission.
    [Show full text]
  • Snp Associations with Tuberculosis Susceptibility in a Ugandan
    SNP ASSOCIATIONS WITH TUBERCULOSIS SUSCEPTIBILITY IN A UGANDAN HOUSEHOLD CONTACT STUDY by ALLISON REES BAKER Submitted in partial fulfillment of the requirements For the degree of Master of Science Thesis Advisor: Dr. Catherine M. Stein Department of Epidemiology and Biostatistics CASE WESTERN RESERVE UNIVERSITY August, 2010 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of ______________________________________________________ candidate for the ________________________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. Table of Contents Table of Contents...............................................................................................................iii List of Tables ..................................................................................................................... iv Acknowledgements............................................................................................................. v List of Commonly Used Abbreviations ............................................................................. vi Chapter 1: Literature
    [Show full text]
  • AGR2, Erp57/GRP58, and Some Other Human Protein Disulfide Isomerases
    ISSN 0006-2979, Biochemistry (Moscow), 2013, Vol. 78, No. 13, pp. 1415-1430. © Pleiades Publishing, Ltd., 2013. Original Russian Text © S. S. Shishkin, L. S. Eremina, L. I. Kovalev, M. A. Kovaleva, 2013, published in Uspekhi Biologicheskoi Khimii, 2013, Vol. 53, pp. 81-120. REVIEW AGR2, ERp57/GRP58, and Some Other Human Protein Disulfide Isomerases S. S. Shishkin*, L. S. Eremina, L. I. Kovalev, and M. A. Kovaleva Bach Institute of Biochemistry, Russian Academy of Sciences, Leninsky pr. 33, 119071 Moscow, Russia; E-mail: [email protected] Received July 25, 2013 Abstract—This review considers the major features of human proteins AGR2 and ERp57/GRP58 and of other members of the protein disulfide isomerase (PDI) family. The ability of both AGR2 and ERp57/GRP58 to catalyze the formation of disulfide bonds in proteins is the parameter most important for assigning them to a PDI family. Moreover, these proteins and also other members of the PDI family have specific structural features (thioredoxin-like domains, special C-terminal motifs characteristic for proteins localized in the endoplasmic reticulum, etc.) that are necessary for their assignment to a PDI family. Data demonstrating the role of these two proteins in carcinogenesis are analyzed. Special attention is given to data indicating the presence of biomarker features in AGR2 and ERp57/GRP58. It is now thought that there is sufficient reason for studies of AGR2 and ERp57/GRP58 for possible use of these proteins in diagnosis of tumors. There are also prospects for studies on AGR2 and ERp57/GRP58 leading to developments in chemotherapy. Thus, we suppose that further studies on different members of the PDI family using modern postgenomic technologies will broaden current concepts about func- tions of these proteins, and this will be helpful for solution of urgent biomedical problems.
    [Show full text]
  • Ranking Variable Combinations to Characterize Breast Cancer Subtypes Using the IBIF-RF Metric
    EPiC Series in Computing Volume 70, 2020, Pages 11{20 Proceedings of the 12th International Conference on Bioinformatics and Computational Biology Ranking Variable Combinations to Characterize Breast Cancer Subtypes using the IBIF-RF Metric Isis Narvaez-Bandera and Wandaliz Torres-Garc´ıa University of Puerto Rico, Mayag¨uezCampus, PR, 00681 USA [email protected] and [email protected] Abstract Gene interactions play a fundamental role in the proneness to cancer. However, detect- ing and ranking these interactions is a complex problem due to the high dimensionality of genomic data. Hence, we aim to find patterns composed of multiple features to molecu- larly characterize breast cancer subtypes from the integration of different omics datasets using a data mining approach. To retrieve biological understanding from these compu- tational results, we developed IBIF-RF (Importance Between Interactive Features using Random Forest), a new metric capable of assessing and holistically ranking the importance of genomic interactions without any prior knowledge of key feature combinations. A set of 247 top-performing features from transcriptomic, proteomic, methylation, and clinical data were used to investigate interactive patterns to classify breast cancer subtypes us- ing over 1150 samples. IBIF-RF metric allowed the extraction of 154312, 190481, and 463917 combinations of variables for TCGA, GSE20685, and GSE21653 datasets. Single genes, MLPH and FOXA1, were the most frequently identified variables across all datasets followed by some two-gene interactions such as CEP55-FOXA1 and FOXC1-THSD4. More- over, IBIF-RF metric allowed the definition of two sets of genes frequently found together (1: FOXA1, MLPH, and SIDT1, and 2: CEP55, ASPM, CENPL, AURKA, ESPL1, TTK, UBE2T, NCAPG, GMPS, NDC80, MYBL2, KIF18B, and EXO1).
    [Show full text]
  • A Systematic Genome-Wide Association Analysis for Inflammatory Bowel Diseases (IBD)
    A systematic genome-wide association analysis for inflammatory bowel diseases (IBD) Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Christian-Albrechts-Universität zu Kiel vorgelegt von Dipl.-Biol. ANDRE FRANKE Kiel, im September 2006 Referent: Prof. Dr. Dr. h.c. Thomas C.G. Bosch Koreferent: Prof. Dr. Stefan Schreiber Tag der mündlichen Prüfung: Zum Druck genehmigt: der Dekan “After great pain a formal feeling comes.” (Emily Dickinson) To my wife and family ii Table of contents Abbreviations, units, symbols, and acronyms . vi List of figures . xiii List of tables . .xv 1 Introduction . .1 1.1 Inflammatory bowel diseases, a complex disorder . 1 1.1.1 Pathogenesis and pathophysiology. .2 1.2 Genetics basis of inflammatory bowel diseases . 6 1.2.1 Genetic evidence from family and twin studies . .6 1.2.2 Single nucleotide polymorphisms (SNPs) . .7 1.2.3 Linkage studies . .8 1.2.4 Association studies . 10 1.2.5 Known susceptibility genes . 12 1.2.5.1 CARD15. .12 1.2.5.2 CARD4. .15 1.2.5.3 TNF-α . .15 1.2.5.4 5q31 haplotype . .16 1.2.5.5 DLG5 . .17 1.2.5.6 TNFSF15 . .18 1.2.5.7 HLA/MHC on chromosome 6 . .19 1.2.5.8 Other proposed IBD susceptibility genes . .20 1.2.6 Animal models. 21 1.3 Aims of this study . 23 2 Methods . .24 2.1 Laboratory information management system (LIMS) . 24 2.2 Recruitment. 25 2.3 Sample preparation. 27 2.3.1 DNA extraction from blood. 27 2.3.2 Plate design .
    [Show full text]
  • Homozygous Deletions Implicate Non-Coding Epigenetic Marks In
    www.nature.com/scientificreports OPEN Homozygous deletions implicate non‑coding epigenetic marks in Autism spectrum disorder Klaus Schmitz‑Abe1,2,3,4, Guzman Sanchez‑Schmitz3,5, Ryan N. Doan1,3, R. Sean Hill1,3, Maria H. Chahrour1,3, Bhaven K. Mehta1,3, Sarah Servattalab1,3, Bulent Ataman6, Anh‑Thu N. Lam1,3, Eric M. Morrow7, Michael E. Greenberg6, Timothy W. Yu1,3*, Christopher A. Walsh1,3,4,8,9* & Kyriacos Markianos1,3,4,10* More than 98% of the human genome is made up of non‑coding DNA, but techniques to ascertain its contribution to human disease have lagged far behind our understanding of protein coding variations. Autism spectrum disorder (ASD) has been mostly associated with coding variations via de novo single nucleotide variants (SNVs), recessive/homozygous SNVs, or de novo copy number variants (CNVs); however, most ASD cases continue to lack a genetic diagnosis. We analyzed 187 consanguineous ASD families for biallelic CNVs. Recessive deletions were signifcantly enriched in afected individuals relative to their unafected siblings (17% versus 4%, p < 0.001). Only a small subset of biallelic deletions were predicted to result in coding exon disruption. In contrast, biallelic deletions in individuals with ASD were enriched for overlap with regulatory regions, with 23/28 CNVs disrupting histone peaks in ENCODE (p < 0.009). Overlap with regulatory regions was further demonstrated by comparisons to the 127‑epigenome dataset released by the Roadmap Epigenomics project, with enrichment for enhancers found in primary brain tissue and neuronal progenitor cells. Our results suggest a novel noncoding mechanism of ASD, describe a powerful method to identify important noncoding regions in the human genome, and emphasize the potential signifcance of gene activation and regulation in cognitive and social function.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name anterior gradient protein 3 homolog precursor Gene Symbol Agr3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001106724 UniGene ID Rn.28998 Ensembl Gene ID ENSRNOG00000004994 Entrez Gene ID 298959 Assay Information Unique Assay ID qRnoCEP0025562 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000006652 Amplicon Context Sequence TTACCTGTACCTATAGCAAAGAGAGTTTTCATGAGCTCACAGTTGCTATGCTTTG CATGTGCAATGTCTCCCCTGCCTCATGTCTTGATGGCTTGCTTCTCAGATAGTAA AGAACTTCTGGTAACTTTAGAAGGTGGCATCTAGCT Amplicon Length (bp) 116 Chromosome Location 6:65039508-65039653 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 98 R2 0.9989 cDNA Cq 30.62 cDNA Tm (Celsius) 82 gDNA Cq 25.31 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Agr3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Novel Cell Types and Developmental Lineages Revealed by Single-Cell
    RESEARCH ARTICLE Novel cell types and developmental lineages revealed by single-cell RNA-seq analysis of the mouse crista ampullaris Brent A Wilkerson1,2†, Heather L Zebroski1,2, Connor R Finkbeiner1,2, Alex D Chitsazan1,2,3‡, Kylie E Beach1,2, Nilasha Sen1, Renee C Zhang1, Olivia Bermingham-McDonogh1,2* 1Department of Biological Structure, University of Washington, Seattle, United States; 2Institute for Stem Cells and Regenerative Medicine, University of Washington, Seattle, United States; 3Department of Biochemistry, University of Washington, Seattle, United States Abstract This study provides transcriptomic characterization of the cells of the crista ampullaris, sensory structures at the base of the semicircular canals that are critical for vestibular function. We performed single-cell RNA-seq on ampullae microdissected from E16, E18, P3, and P7 mice. Cluster analysis identified the hair cells, support cells and glia of the crista as well as dark cells and other nonsensory epithelial cells of the ampulla, mesenchymal cells, vascular cells, macrophages, and melanocytes. Cluster-specific expression of genes predicted their spatially restricted domains of *For correspondence: gene expression in the crista and ampulla. Analysis of cellular proportions across developmental [email protected] time showed dynamics in cellular composition. The new cell types revealed by single-cell RNA-seq Present address: †Department could be important for understanding crista function and the markers identified in this study will of Otolaryngology-Head and enable the examination of their dynamics during development and disease. Neck Surgery, Medical University of South Carolina, Charleston, United States; ‡CEDAR, OHSU Knight Cancer Institute, School Introduction of Medicine, Portland, United States The vertebrate inner ear contains mechanosensory organs that sense sound and balance.
    [Show full text]
  • Oncogenic HPV Promotes the Expression of the Long Noncoding RNA Lnc-FANCI-2 Through E7 and YY1
    Oncogenic HPV promotes the expression of the long noncoding RNA lnc-FANCI-2 through E7 and YY1 Haibin Liua,1, Junfen Xua,b,1, Yanqin Yangc, Xiaohong Wanga, Ethan Wua, Vladimir Majerciaka, Tingting Zhanga,d, Renske D. M. Steenbergene, Hsu-Kun Wangf,2, Nilam S. Banerjeef, Yang Lib, Weiguo Lub, Craig Meyersg, Jun Zhuc, Xing Xieb, Louise T. Chowf,3, and Zhi-Ming Zhenga,3 aTumor Virus RNA Biology Section, HIV Dynamics and Replication Program, National Cancer Institute, National Institutes of Health, Frederick, MD 21702; bDepartment of Gynecologic Oncology, Women’s Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310006, China; cGenome Technology Laboratory, Systems Biology Center, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892; dStomatological Hospital of Tianjin Medical University, Tianjin 300070, China; eAmsterdam Universitair Medische Centra, Pathology, Cancer Center Amsterdam, Vrije Universiteit Amsterdam, 1081 HV Amsterdam, The Netherlands; fDepartment of Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, AL 35294; and gDepartment of Microbiology and Immunology, Penn State University College of Medicine, Hershey, PA 17033 Contributed by Louise T. Chow, November 23, 2020 (sent for review July 7, 2020; reviewed by Lawrence Banks and Haifan Lin) Long noncoding RNAs (lncRNAs) play diverse roles in biological one class of noncoding RNAs in the size range of 19 to 23 nts (7), processes, but their expression profiles and functions in cervical in HPV-infected cells and cervical tissues and reported that a carcinogenesis remain unknown. By RNA-sequencing (RNA-seq) anal- subset of miRNAs are regulated by HR-HPV infections (8–13) yses of 18 clinical specimens and selective validation by RT-qPCR anal- and may serve as biomarkers for HR-HPV infections and cervical yses of 72 clinical samples, we provide evidence that, relative to cancer progression (12, 13).
    [Show full text]