ARP1 Antibody Cat
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Seq2pathway Vignette
seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway. -
Defining Functional Interactions During Biogenesis of Epithelial Junctions
ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. -
Datasheet: VPA00532KT Product Details
Datasheet: VPA00532KT Description: BETA-CENTRACTIN ANTIBODY WITH CONTROL LYSATE Specificity: BETA-CENTRACTIN Format: Purified Product Type: PrecisionAb™ Polyclonal Isotype: Polyclonal IgG Quantity: 2 Westerns Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Mouse Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation 20μl Rabbit polyclonal antibody purified by affinity chromatography Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers 2% Sucrose Immunogen Synthetic peptide directed towards the C terminal region of human beta-centractin External Database Links UniProt: P42025 Related reagents Entrez Gene: 10120 ACTR1B Related reagents Synonyms CTRN2 Page 1 of 3 Specificity Rabbit anti Human beta-centractin antibody recognizes beta-centractin also known as actin- related protein 1B or ACTR1B. The ACTR1B gene encodes a 42.3 kDa subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kDa. -
Physical and Linkage Mapping of Mammary-Derived Expressed Sequence Tags in Cattle
Genomics 83 (2004) 148–152 www.elsevier.com/locate/ygeno Physical and linkage mapping of mammary-derived expressed sequence tags in cattle E.E. Connor,a,* T.S. Sonstegard,a J.W. Keele,b G.L. Bennett,b J.L. Williams,c R. Papworth,c C.P. Van Tassell,a and M.S. Ashwella a U.S. Beltsville Agricultural Research Center, ARS, U.S. Department of Agriculture, 10300 Baltimore Avenue, Beltsville, MD 20705, USA b U.S. Meat Animal Research Center, ARS, U.S. Department of Agriculture, P.O. Box 166, Clay Center, NE 68933-0166, USA c Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, Scotland, United Kingdom Received 2 June 2003; accepted 5 July 2003 Abstract This study describes the physical and linkage mapping of 42 gene-associated markers developed from mammary gland-derived expressed sequence tags to the cattle genome. Of the markers, 25 were placed on the USDA reference linkage map and 37 were positioned on the Roslin 3000-rad radiation hybrid (RH) map, with 20 assignments shared between the maps. Although no novel regions of conserved synteny between the cattle and the human genomes were identified, the coverage was extended for bovine chromosomes 3, 7, 15, and 29 compared with previously published comparative maps between human and bovine genomes. Overall, these data improve the resolution of the human–bovine comparative maps and will assist future efforts to integrate bovine RH and linkage map data. Crown Copyright D 2003 Published by Elsevier Inc. All rights reserved. Keywords: RH mapping; Linkage mapping; SNP; Cattle; EST Selection of positional candidate genes controlling eco- pig [4,5], and cattle [6], and serve as a resource for nomically important traits in cattle requires a detailed candidate gene identification. -
Supplemental Information
Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig. -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
Mutation Analysis of Genes Within the Dynactin Complex in a Cohort of Hereditary Peripheral Neuropathies
Clin Genet 2016: 90: 127–133 © 2015 John Wiley & Sons A/S. Printed in Singapore. All rights reserved Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12712 Original Article Mutation analysis of genes within the dynactin complex in a cohort of hereditary peripheral neuropathies a a Tey S., Ahmad-Annuar A., Drew A.P., Shahrizaila N., Nicholson G.A., S. Tey , A. Ahmad-Annuar , Kennerson M.L. Mutation analysis of genes within the dynactin complex in A.P. Drewb, N. Shahrizailac, , a cohort of hereditary peripheral neuropathies. G.A. Nicholsonb d and Clin Genet 2016: 90: 127–133. © John Wiley & Sons A/S. Published by M.L. Kennersonb,d John Wiley & Sons Ltd, 2015 aDepartment of Biomedical Science, The cytoplasmic dynein–dynactin genes are attractive candidates for Faculty of Medicine, University of Malaya, b neurodegenerative disorders given their functional role in retrograde Kuala Lumpur, Malaysia, Northcott transport along neurons. The cytoplasmic dynein heavy chain (DYNC1H1) Neuroscience Laboratory, ANZAC Research Institute, and Sydney Medical gene has been implicated in various neurodegenerative disorders, and School, University of Sydney, Sydney, dynactin 1 (DCTN1) genes have been implicated in a wide spectrum of Australia, cDepartment of Medicine, disorders including motor neuron disease, Parkinson’s disease, spinobulbar Faculty of Medicine, University of Malaya, muscular atrophy and hereditary spastic paraplegia. However, the Kuala Lumpur, Malaysia, and dMolecular involvement of other dynactin genes with inherited peripheral neuropathies Medicine Laboratory, Concord Hospital, (IPN) namely, hereditary sensory neuropathy, hereditary motor neuropathy Sydney, Australia and Charcot–Marie–Tooth disease is under reported. We screened eight genes; DCTN1-6 and ACTR1A and ACTR1B in 136 IPN patients using Key words: Charcot–Marie–Tooth – whole-exome sequencing and high-resolution melt (HRM) analysis. -
ACTR1A (NM 005736) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG200738 ACTR1A (NM_005736) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ACTR1A (NM_005736) Human Tagged ORF Clone Tag: TurboGFP Symbol: ACTR1A Synonyms: ARP1; Arp1A; CTRN1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG200738 representing NM_005736 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGTCCTACGATGTGATCGCCAACCAGCCTGTCGTGATCGACAACGGATCCGGTGTGATTAAAGCTG GTTTTGCTGGTGATCAGATCCCCAAATACTGCTTTCCAAACTATGTGGGCCGACCCAAGCACGTTCGTGT CATGGCAGGAGCCCTTGAAGGCGACATCTTCATTGGCCCCAAAGCTGAGGAGCACCGAGGGCTGCTTTCA ATCCGCTATCCCATGGAGCATGGCATCGTCAAGGATTGGAACGACATGGAACGCATTTGGCAATATGTCT ATTCTAAGGACCAGCTGCAGACTTTCTCAGAGGAGCATCCTGTGCTCCTGACTGAGGCGCCTTTAAACCC ACGAAAAAACCGGGAACGAGCTGCCGAAGTTTTCTTCGAGACCTTCAATGTGCCCGCTCTTTTCATCTCC ATGCAAGCTGTACTCAGCCTTTACGCTACAGGCAGGACCACAGGGGTGGTGCTGGATTCTGGGGATGGAG TCACCCATGCTGTGCCCATCTATGAGGGCTTTGCCATGCCCCACTCCATCATGCGCATCGACATCGCGGG CCGGGACGTCTCTCGCTTCCTGCGCCTCTACCTGCGTAAGGAGGGCTACGACTTCCACTCATCCTCTGAG TTTGAGATTGTCAAGGCCATAAAAGAAAGAGCCTGTTACCTATCCATAAACCCCCAAAAGGATGAGACGC TAGAGACAGAGAAAGCTCAGTACTACCTGCCTGATGGCAGCACCATTGAGATTGGTCCTTCCCGATTCCG GGCCCCTGAGTTGCTCTTCAGGCCAGATTTGATTGGAGAGGAGAGTGAAGGCATCCACGAGGTCCTGGTG TTCGCCATTCAGAAGTCAGACATGGACCTGCGGCGCACGCTTTTCTCTAACATTGTCCTCTCAGGAGGCT -
Dynein Activators and Adaptors at a Glance Mara A
© 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs227132. doi:10.1242/jcs.227132 CELL SCIENCE AT A GLANCE Dynein activators and adaptors at a glance Mara A. Olenick and Erika L. F. Holzbaur* ABSTRACT ribonucleoprotein particles for BICD2, and signaling endosomes for Cytoplasmic dynein-1 (hereafter dynein) is an essential cellular motor Hook1. In this Cell Science at a Glance article and accompanying that drives the movement of diverse cargos along the microtubule poster, we highlight the conserved structural features found in dynein cytoskeleton, including organelles, vesicles and RNAs. A long- activators, the effects of these activators on biophysical parameters, standing question is how a single form of dynein can be adapted to a such as motor velocity and stall force, and the specific intracellular wide range of cellular functions in both interphase and mitosis. functions they mediate. – Recent progress has provided new insights dynein interacts with a KEY WORDS: BICD2, Cytoplasmic dynein, Dynactin, Hook1, group of activating adaptors that provide cargo-specific and/or Microtubule motors, Trafficking function-specific regulation of the motor complex. Activating adaptors such as BICD2 and Hook1 enhance the stability of the Introduction complex that dynein forms with its required activator dynactin, leading Microtubule-based transport is vital to cellular development and to highly processive motility toward the microtubule minus end. survival. Microtubules provide a polarized highway to facilitate Furthermore, activating adaptors mediate specific interactions of the active transport by the molecular motors dynein and kinesin. While motor complex with cargos such as Rab6-positive vesicles or many types of kinesins drive transport toward microtubule plus- ends, there is only one major form of dynein, cytoplasmic dynein-1, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104, which drives the trafficking of a wide array of minus-end-directed USA. -
Drosophila and Human Transcriptomic Data Mining Provides Evidence for Therapeutic
Drosophila and human transcriptomic data mining provides evidence for therapeutic mechanism of pentylenetetrazole in Down syndrome Author Abhay Sharma Institute of Genomics and Integrative Biology Council of Scientific and Industrial Research Delhi University Campus, Mall Road Delhi 110007, India Tel: +91-11-27666156, Fax: +91-11-27662407 Email: [email protected] Nature Precedings : hdl:10101/npre.2010.4330.1 Posted 5 Apr 2010 Running head: Pentylenetetrazole mechanism in Down syndrome 1 Abstract Pentylenetetrazole (PTZ) has recently been found to ameliorate cognitive impairment in rodent models of Down syndrome (DS). The mechanism underlying PTZ’s therapeutic effect is however not clear. Microarray profiling has previously reported differential expression of genes in DS. No mammalian transcriptomic data on PTZ treatment however exists. Nevertheless, a Drosophila model inspired by rodent models of PTZ induced kindling plasticity has recently been described. Microarray profiling has shown PTZ’s downregulatory effect on gene expression in fly heads. In a comparative transcriptomics approach, I have analyzed the available microarray data in order to identify potential mechanism of PTZ action in DS. I find that transcriptomic correlates of chronic PTZ in Drosophila and DS counteract each other. A significant enrichment is observed between PTZ downregulated and DS upregulated genes, and a significant depletion between PTZ downregulated and DS dowwnregulated genes. Further, the common genes in PTZ Nature Precedings : hdl:10101/npre.2010.4330.1 Posted 5 Apr 2010 downregulated and DS upregulated sets show enrichment for MAP kinase pathway. My analysis suggests that downregulation of MAP kinase pathway may mediate therapeutic effect of PTZ in DS. Existing evidence implicating MAP kinase pathway in DS supports this observation.