Transcriptional Regulation of Photoreceptor Development in the Zebrafish Retina Karen Alvarez-Delfin

Florida State University Libraries

Electronic Theses, Treatises and Dissertations The Graduate School

2011 Transcriptional Regulation of Photoreceptor Development in the Zebrafish Retina Karen Alvarez-Delfin

Follow this and additional works at the FSU Digital Library. For more information, please contact [email protected] THE FLORIDA STATE UNIVERSITY

COLLEGE OF ARTS AND SCIENCES

TRANSCRIPTIONAL REGULATION OF PHOTORECEPTOR DEVELOPMENT

IN THE ZEBRAFISH RETINA

KAREN ALVAREZ-DELFIN

A Dissertation submitted to the Department of Biological Science in partial fulfillment of the requirements for the degree of Doctor of Philosophy

Degree Awarded: Summer Semester, 2011

The members of the committee approve the Dissertation of Karen Alvarez-Delfin defended on June 23th, 2011.

______James M. Fadool Professor Directing Dissertation

______Michael Blaber University Representative

______Lloyd M. Epstein Committee Member

______Wu-min Deng Committee Member

______Laura R. Keller Committee Member

Approved:

______P. Bryant Chase, Chair, Department of Biological Science

The Graduate School has verified and approved the above-named committee members. ii

To my parents and Amalia María

iii

ACKNOWLEDGEMENTS

I would like to sincerely acknowledge the following: The funding sources through all graduate school: NIH Grant IY017753, pre-doctoral Kirschstein NRSA from the National Eye Institute, the Department of Biological Science for financial support and Publication and M. Menzel awards, the National Eye Institute for full support to attend the Vision Course in the MBL, the Association for Research in Vision and Ophthalmology (ARVO) for travel grant, FSU for the Dissertation Research Grant and the Leslie N. Wilson-Delores Auzenne Assistanship, and the Bryan W. Robinson Endowment for the Neurosciences of the Tallahassee Memorial Foundation. The zebrafish and retina scientific communities for sharing reagents and fish lines. The FSU Biological Science Department; Kimberly A. Riddle and Thomas J. Fellers from the Biological Science Imaging Facility for great assistance; Cheryl Pye, Brian Washburn, Rani Dhanarajan and Steve Miller from the Core Facility for assisting with cloning, sequencing and good advising; Ms. Judy Bowers for invaluable help and guidance; the Clerical Office, especially to Ms. Linda Sims, Ms. Bobbie Weston and Ms. Virginia Hellman; Ms Anne B. Thistle for manuscript editing; Charles Badland for friendship and wonderful assistance with art work and photography; Dr. Debra Fadool, Dr. Hank Bass and Dr. Lisa Lyons and their lab members for being great neighbors and supporters; Dr. Fanxiu Zhu and his lab members for assistance with the reporter experiments, especially the PhD student Qiming Liang; my officemates, all the CMB, MOB, Biomedical and Neuroscience graduate student for the friendship. My major professor and advisor Dr. James M. Fadool for his excellent guidance and support, also for the understanding and patience. Thanks for always encourage me to take on new challenges, but also letting me be independent. The members of my doctoral committee: Dr. Laura Keller, Dr. Lloyd Epstein, Dr. Wu-min Deng and Dr. Michael Blaber for their valuable comments, suggestions and advising. All members of the J.M. Fadool’s laboratory for friendship and support; the former members: Dr. Ann C. Morris, Gina Johnson, Katie Loughlin, Jamal Barlett, Haley Robinson and Alex Csizinszky; the current members, Madison Grant, Orly Guerra, Liz Ball, Tyler Scott, especially to my friends Mailin Sotolongo and Carole Saade for their help, support and for sharing good and bad times. My family and all my friends, some of them have been far geographically, but always very encouraging and enthusiastic about my success. I greatly thank my parents Rosa María Delfín and Rafael Alvarez for always give me inspiration to accomplish my goals, for the unconditional love and support through my life and especially during these years in graduate school.

TABLE OF CONTENTS

List of Tables ...... vii List of Figures...... viii Abbreviations...... x Abstract...... xi

1. CHAPTER ONE-INTRODUCTION...... 1 1.1 Zebrafish as Animal Model ...... 1 1.2 Eye Development...... 3 1.2.1 Retinal Development ...... 3 1.2.2 Retinal Development in Zebrafish...... 4 1.2.3 Photoreceptor Cell Type Specification and Regulation of Gene Expression ....6 1.3 T-box Family of Genes in Development ...... 10 1.3.1 Tbx2 in Retinal Development...... 12 1.4 Six Genes in Development...... 13 1.4.1 Six Genes in Eye and Retinal Development...... 14 1.4.2 The Six3/6 Subfamily in Zebrafish ...... 16

2. CHAPTER TWO-TBX2B IS REQUIRED FOR ULTRAVIOLET PHOTORECEPTOR CELL SPECIFICATION DURING ZEBRAFISH RETINAL DEVELOPMENT...... 19 2.1 Introduction...... 19 2.2 Material and Methods ...... 20 Zebrafish Maintenance...... 20 Polymerase Chain Reaction (PCR), cloning and sequencing ...... 20 Immunochemistry...... 21 Whole-mount in situ Hybridization ...... 22 Cell Transplantation...... 22 Optokinetic Response Assay (OKR) ...... 22 Mapping...... 22 Cell Quantification...... 22 Cell Death ...... 23 2.3 Results...... 23 2.4 Discussion...... 35

3. CHAPTER THREE-TRANSCRIPTIONAL REGULATION OF PHOTORECPETOR GENES...... 39 3.1 Introduction...... 39 3.2 Material and Methods ...... 41 Plasmids...... 41 Cell Culture...... 42

Luciferase Reporter Assay...... 42 3.3 Results...... 42 3.4 Discussion...... 47

4. CHAPTER FOUR-THE TRANSCRIPTION FACTOR SIX7 REGULATES ROD NUMBER DURING ZEBRAFISH RETINAL DEVELOPMENT ...... 50 4.1 Introduction...... 50 4.2 Material and Methods ...... 53 Zebrafish Maintenance...... 53 Cloning and Sequencing...... 53 Embryo Injections...... 53 RT-PCR...... 53 Whole-mount in situ Hybridization ...... 54 Cell Quantification...... 54 Mapping...... 54 Immunochemistry...... 55 Cell Death ...... 55 4.3 Results...... 56 4.4 Discussion...... 78

APENDIX A-ACUC PROTOCOL APPROVAL ...... 83 REFERENCES ...... 84

BIOGRAPHICAL SKETCH ...... 97

LIST OF TABLES

Table 1 Number of UV cones and rods in WT and lorp25bbtl mutant retinas...... 30

Table 2 Summary of the rod phenotype observed for different genetic backgrounds...... 77

vii

LIST OF FIGURES

Figure 1 The vertebrate retina...... 2

Figure 2 Development of the zebrafish eye ...... 5

Figure 3 The transcription factor network that regulates photoreceptor subtype specification...... 8

Figure 4 lorp25bbtl mutants display increased labeling for rods ...... 24

Figure 5 tbx2b expression is reduced in lor p25bbtl mutant embryos ...... 26

Figure 6 Reduced expression of UV opsin in lorp25bbtl mutant larvae ...... 27

Figure 7 Increased rod number and fewer UV cones in lorp25bbtl and fbyc144 mutants...... 29

Figure 8 Maintenance of the photoreceptor mosaic in tbx2bp25bbtl mutant adults...... 31

Figure 9 tbx2bp25bbtl acts cell-autonomously...... 33

Figure 10 Persistent Nr2e3 expression in lor p25bbtl...... 34

Figure 11 tbx2b represses rhodopsin promoter activity ...... 44

Figure 12 tbx2b represses several versions of the rhodopsin promoter...... 45

Figure 13 tbx2b demonstrated modest repression on the SWS1 promoter activity...... 46

Figure 14 The ljrp23ahub mutant demonstrates an increase in rod number...... 57

Figure 15 Linkage analysis placed ljrp23ahub in an interval on chromosome 7...... 58

Figure 16 Rods appear precociously in ljrp23ahub...... 59

Figure 17 Larval photoreceptor mosaic is conserved in ljrp23ahub retina ...... 61

Figure 18 ljrp23ahub and WT embryos demonstrate similar pattern of retinal cell markers ...... 62

Figure 19 BrdU incorporation is similar in WT and ljrp23ahub mutants...... 63

Figure 20 ljrp23ahub and WT retinas demonstrate similar mitotic cell index at 48 hpf ...... 64

Figure 21 six7 morphants phenocopy the increase in the rod number observed in ljrp23ahub ...... 66

viii

Figure 22 Control and MOsix7 embryos demonstrate similar expression of the cone opsins...... 67

Figure 23 ljrp23ahub mutant demonstrates an increase in apoptotic cell number...... 69

Figure 24 six7 morphants demonstrate an increase in apoptotic cell number ...... 70

Figure 25 six7 over-expression promotes anterior-dorsal structures leading to retinal and brain overgrowth...... 71

Figure 26 six7 is expressed in the outer nuclear layer (ONL) ...... 73

Figure 27 six7 MO injection in lorp25bbtl does not affect rod number ...... 74

Figure 28 six7 MO injected ljrp23ahub mutant embryos demonstrated a slight increase in rod number ...... 75

Figure 29 six7 is over-expressed in the ljrp23ahub mutant...... 76

Figure 30 Proposed model ...... 79

ABBREVIATIONS bp base pair BMP bone morphogenetic protein BrdU bromodeoxyuridine cDNA complementary deoxyribonucleic acid ChIP chromatin immunoprecipitation CMZ ciliary marginal zone Crx cone and rod homeobox transcription factor DAPI 4, 6-diamidino-2-phenylindole DNA deoxyribonucleic acid dpf days post fertilization ENU ethyl-nitrosourea GCL ganglion cell layer GFP green flourescent protein HEK293T human embryonic kidney 293T cells hpf hours post fertilization INL inner nuclear layer MO Morpholino Nrl neural retina leuzine zipper transcription factor ONL outer nuclear layer PCR polymerase chain reaction PH3 phospho-histone 3 RNA ribonucleic acid RT-PCR reverse transcribed polymerase chain reaction SD standard deviation TBE T-box binding element TUNEL terminal deoxynucleotide transferase (TdT)-mediated dUTP nick-end labeling UTR untranslated region UV ultraviolet WT wild-type XOPS-GFP Xenopus rhodopsin promoter driving GFP

ABSTRACT

Many of the genes that regulate eye and retinal development have been identified based upon mutant analysis in animal models or human diseases. Taking advantage of the mosaic organization of the photoreceptor in zebrafish our laboratory undertook a genetic screen to identify genes essential for photoreceptor patterning and survival. I isolated two loci that affected the rod cell number in the larval retina. The first locus, lots-of-rods (lorp25bbtl), constituted an allele of the T-box transcription factor tbx2b. The increase in the rod number in tbx2bp25bbtl mutant larvae was the result of a cell fate change with UV cone precursors differentiating as rods. I proposed that tbx2b could be suppressing the rod fate by negatively regulating rod-specific genes. Subsequently, promoter reporter assay in vitro showed that tbx2b strongly repressed the activation of the rhodopsin promoter by previously described activators Crx and Nrl. The second locus, lots-of-rods-junior (ljrp23ahub) also displayed an increase in the number of rods, but the UV cone number was not affected. ljrp23ahub was mapped to an interval that includes the gene encoding the transcription factor six7. six7 belongs to the Six family of transcription factors with prominent roles in eye development. Morpholino knock down of six7 resulted in similar phenotype to the ljrp23ahub mutant. My data identified previously unknown roles for two transcription factors in photoreceptor development, and demonstrated the first successful screen for alterations in photoreceptor patterning in a vertebrate model.

CHAPTER ONE

INTRODUCTION

1. 1 Zebrafish as Animal Model. The use of zebrafish (Danio rerio) in biological research largely began with the pioneering work of George Streisinger, from the University of Oregon. Streisinger recognized several advantages in zebrafish as a vertebrate model for developmental and genetic studies (Streisinger G et al., 1981). This fresh water teleost is easily reared in the laboratory and is able to produce more than 200 fertilized eggs per weekly mating. Development is very rapid: larva demonstrates robust visual behaviors by 5 days post fertilization (dpf) and fish reach reproductive maturity in 2-3 months. The egg and the embryo are transparent, facilitating visual observation. Very efficient forward genetic screen protocols for chemical mutagenesis and large-scale genetic screens have been successfully used to isolate recessive mutations affecting embryonic development and visual system function (Goldsmith P & Harris WA, 2003; Dosch R et al., 2004; Morris AC & Fadool JM, 2005). Genomic and molecular tools are available for zebrafish research: the genomic sequence is nearing completion, methods for positional mapping, transgenesis, TILLING (Targeted Induced Local Lesions in Genomes) (Wienholds E et al., 2003) and other reverse genetic tools have been developed, for example, morpholino (MO) antisense injection for knocking down expression of specific gene (Heasman J., 2002), and microarray resources are available. Teleost fish underwent genome duplication. It has been suggested that for at least 20% of human genes, the zebrafish has preserved two orthologues (Postlethwait J et al., 2004). This fact raised the perception that the presence of two functional copies of a gene would hide the effects of mutations in one of them. In fact, many of the genes studied in zebrafish have demonstrated subfunctionalization: the spatial or temporal pattern of expression of both copies is necessary to fulfill the function of the ancestral gene. This has enabled the advantage in zebrafish of dissecting each subfunction independently, and also increased the chances of isolating viable mutants that otherwise would be lethal in other vertebrate models (Fadool JM & Dowling JE, 2008).

Figure 1. The vertebrate retina. The retina is composed of three nuclear layers: the ganglion cell layer, containing the ganglion cells (green); the inner nuclear layer, composed of the interneurons, bipolar cells (garnet), horizontal cells (blue), and amacrine cells (dark grey); and the outer nuclear layer that is composed of the photoreceptor cones (magenta) and rods (light grey). Müller glial cells are not shown in this picture (Dowling JE & Boycott BB, 1966). Light passes through the three retinal layers to be sensed by the photoreceptors and converted into a chemical signal. That information is relayed and integrated through the interneurons to the ganglion cells that convey the signal via the optic nerve to the brain.

1.2 Eye Development. The eye develops from three embryological tissues: neuroectoderm, which gives rise to the neural retina, pigmented epithelium, optic stalk and ciliary margin; skin ectoderm, which is induced to form the lens and subsequently the cornea; and head mesenchyme of neural crest cells origin that forms some minimal, but essential tissue in the cornea and sclera. Eye development is highly conserved in most vertebrates, mostly due to the conserved nature of the vision process. During gastrulation, the conserved expression and complex interplay between the transcription factors Six3, Six6, Lhx2, Rx1 and Pax6 in the anterior neural plate specify the ocular tissue; consequently the ectopic expression or mutations in those genes severely affect eye determination in several animal models (Oliver G et al., 1996; Mathers PH et al., 1997; Loosli F et al., 1999; 2001; Zuber ME et al., 2003; Inbal A et al., 2007). In zebrafish, eyes evaginate from the forebrain as a bilateral paddle-shaped mass of cells (Schmitt EA & Dowling JE, 1994). Comparable with other vertebrates, the inner layer continues to proliferate and produces the neural retina, whereas the outer layer gives rise to the retinal pigmented epithelia. Lens in zebrafish develops by delamination of the lens placode to form a solid mass of cells rather than through invagination and formation of lens vesicle, as in other vertebrates (Schmitt EA & Dowling JE, 1994). Interestingly, many of the genes that take part in early eye specification events, such as Pax6, Rx1, Six3, and Six6 have demonstrated subsequent roles in regulation of proliferation and retinal cell specification at late stages of eye development (Pan Y et al., 2006; Nelson SM et al., 2008, Conte I et al., 2010; Manavathi B et al., 2007; Pan Y et al., 2010). Consequently, promoter analysis of Six3, Rx1 and Pax6 has revealed differential transcriptional regulation driving earlier versus later expression in the eye (Plaza S et al., 1995; Wargelius A et al., 2003; Martinez-de Lima RI et al., 2010). 1.2.1 Retinal Development The retina is the photosensitive tissue lining the back of the eye (Figure (Fig.) 1). During vertebrate development, multipotent progenitor cells give rise to seven major cell types of the retina organized in three cellular layers. The ganglion cell layer contains the ganglion cells, the inner nuclear layer (INL) is comprised of bipolar, amacrine, and horizontal interneurons, and the outer nuclear layer or photoreceptor layer (ONL), where rod and cone photoreceptors are located. The Müller glial cells span all three layers of the retina (Masland

RH, 2001). The different cell types are generated in a stereotypical order that approximately follows an inner to outer order. The photoreceptors are unique sensory neurons that are specialized in capturing light quanta. Cones detect bright light and rods dim light. Photoreceptors express a large amount of light sensitive proteins, the opsins. The chemical output of photoreceptors is integrated and processed by interneurons (bipolar, amacrine and horizontal cells) and transmitted to the visual centers in the brain by ganglion cells and their projections that make the optic nerve. Müller glial cells are supporting cells and also act as dormant stem cells that can trans-differentiate to generate diverse retinal cell types after injury (Yurco P & Cameron DA, 2005). How do the retinal progenitor cells acquire such dissimilar fates? The current model for vertebrate retinal development proposes that multipotent progenitor cells pass through a series of competence states, such that at a specific time, cells can adopt only one or few particular cell fates in response to extrinsic signals or internal cues (Cepko CL et al., 1996). In this process progenitors are gradually restricted in lineage choices and then become committed to a particular fate. According to this model it has been demonstrated that individual retinal progenitor cells display extensive heterogeneity of gene expression (Trimarchi JM et al., 2008). Some of the external cues that modulate progenitor competence are circulating hormones. The regulated expression of specific transcription factors constitutes important internal cues (Reh TA & Cagan RL, 1994). 1.2.2 Retinal Development in Zebrafish Zebrafish retinal development demonstrates a great deal of conservation with other vertebrates (Schmitt EA & Dowling JE, 1996). Transcription factor expression, as well as cell birth order of the different retinal cells are also fairly conserved across species (Goldsmith P & Harris WA, 2003; Schmitt EA & Dowling JE, 1999). Retinal lamination is evident by 52 hours post fertilization (hpf) (Fig. 2B), and by 72 hpf most of the cell types can be detected by immunolabeling or morphology (Fig. 2). The first cells to differentiate are the ganglion cells at 28-32 hpf, followed by amacrine and horizontal cells, and bipolar cells. By 50 hpf in the outer retina, rod opsin and red and green cone opsin can be detected in the ventral patch, a region of precocious retinal development and differentiation. The expression of the four types of cone opsins and cone differentiation expands in a wave-like fashion from ventral to dorsal, followed by asymmetric differentiation of rods (Raymond PA et al., 1993). Müller glia cells are amongst

Figure 2. Development of the zebrafish eye. Plastic sections of wild-type (WT) zebrafish eyes at the indicated developmental times. Note the progressive lamination of the retina following approximately an “inside to outside” pattern, and differentiation of the lens fibers. At 36 hpf (A) only the ganglion cell layer (gcl) is evident; at 52 hpf (B) all the retinal layers are formed; and at 120 hpf (C) all layers are better defined and the outer nuclear layer (onl) or photoreceptor layer is thicker due to enlargement of the photoreceptor outer segments (hpf, hours post fertilization; inl, inner nuclear layer; L, lens; on, optic nerve). (Picture courtesy of Fadool, JM)

5 the last to express the mature antigens in many species including zebrafish (Peterson RE et al., 2001). The first synapses are completed by 3 dpf and some visual behavioral responses can be elicited in the larva at 5 -6 dpf (Schmitt EA & Dowling JE, 1996; Raymond PA et al., 1995; Larison KD & Bremiller R, 1990). The zebrafish retina possesses rods and four types of cones, each with a distinct morphology and expressing a unique opsin. The long double cones are composed of paired red (LWS)- and green (Rh2)-sensitive cones. The long single cones are blue (SWS2)-sensitive, and the short single cones are ultraviolet (SWS1)-sensitive (Schmitt EA & Dowling JE, 1996; Raymond PA et al., 1995; Raymond PA et al., 1993; Larison KD & Bremiller R, 1990; Branchek T, 1984; Branchek T & Bremiller R, 1984). The laminar organization of the retina is complemented by a mosaic organization of the neuronal population in each of the layers. In the fish retina this arrangement is most evident in the ONL where the position of each cone type is precisely arranged relative to the others (Fadool JM, 2003; Robinson J et al., 1993). Rows of long double cones, composed of paired red- and green-sensitive cones, alternate in turn with rows of blue-sensitive long single cones and ultraviolet-sensitive (UV) short single cones. Zebrafish retina exhibits persistent neurogenesis. Similar to amphibians, zebrafish continue to grow during their life; accordingly, the eyes and retina also keep growing (Fernald RD, 1990). One way new neurons are added to the growing retina is from a population of mitotic progenitor cells that reside at the junction between the retina and the iris, called the cilliary marginal zone (CMZ). The new neurons are integrated into the retina in an annular fashion (Otteson DC & Hitchcock PF, 2003). The other mechanism of retinal growth in zebrafish is the insertion of new rods into the central retina to overcome the gradual loss of visual sensitivity as a consequence of the retina stretching as growing. These post-embryonic rods come from another population of mitotically active progenitors, called the rod progenitor cells. These cells derive from Müller cells in the INL that de-differentiate and migrate to the ONL. The rod progenitor cells are also able to differentiate into other retinal neurons in response to retinal damage (Johns PR & Fernald RD, 1981). 1.2.3 Photoreceptor Cell Type Specification and Regulation of Gene Expression Several transcription factors are involved in vertebrate photoreceptor specification (Fig. 3); many were initially identified based upon mutations that cause retinal degenerative diseases

6 in humans or murine models. The mouse retina, in addition to numerous rods, has two cone subtypes, distributed in inverse gradients in the retina. M-cones are located in highest density in dorsal retina, and S-cones are mostly localized ventrally. In the region where these two gradients overlap, many cones express both photopigments (Applebury ML et al., 2000). The presumptive photoreceptor progenitors express the transcription factors Otx2 (Orthodenticle homologous 2) and Crx (cone and rod homeobox) (Freud CL et al., 1997; Furukawa T et al., 1997; Nishida A et al., 2003; Chen S et al., 1997). Mutations in human CRX result in an autosomal dominant form of cone-rod dystrophy, retinitis pigmentosa, and Leber congenital amaurosis (Hennig AK et al., 2008), while in mouse the Crx deficiency lead to photoreceptors that fail to express phototransduction genes and eventually degenerate (Furukawa T et al., 1999). Rod specification requires the additional expression of Nrl (neural retina leucine zipper protein) (Mears AJ et al., 2001), and its downstream target, the orphan nuclear receptor Nr2e3 (Chen J at al., 2005; Cheng H et al., 2004). Targeted disruption of Nrl in mouse leads to a transformation of rod precursors into S-cones (Mears AJ et al., 2001; Akimoto M et al., 2006). The disruption of NR2E3, which is observed in enhanced S-cone syndrome in humans and the rd7 mouse, is associated with the increased expression of S-cone genes but not a complete absence of rod gene expression (Haider NB et al., 2000; Akhmedov NB et al., 2000). It has been proposed that Nrl acts as a molecular switch during the specification of photoreceptor cell fate and in its absence, bipotential precursors adopt the default S-cone fate (Mears AJ et al., 2001; Akimoto M et al., 2006). Consistent with this proposal, over- or mis-expression of Nrl transforms most if not all cone precursors into functional rods (Oh EC et al., 2007; McIlvain VA & Knox BE, 2007). In the developmental pathway of cones, the deletion of the bHLH transcription factor NeuroD1 or its downstream target the nuclear receptor Trβ2 (thyroid receptor β2) causes S-cones to replace the M-cones in mice (Ng L et al., 2001; Liu H et al., 2008). Similarly, deletion of the nuclear receptor Rxr (retinoid X receptor ) results in S-opsin expression in all cones in the retina (Roberts MR et al., 2005). Accordingly, it is likely that Trβ2 and Rxr form a heterodimer to suppress S-cone-specific genes. Based upon these data the S-cone has been positioned as the default photoreceptor cell fate (Swaroop A et al., 2010). The above mentioned transcription factors directly regulate expression of photoreceptor genes (Fig 3). Otx2 directly binds the Crx promoter to activate transcription (Nishida A et al., 2003). Additionally, Otx2 bind to the promoters of photoreceptor-specific genes, such as rod

Figure 3. The transcription factor network that regulates photoreceptor subtype specification. Largely from mouse and human studies, it has been proposed that retinal progenitor cells expressing the transcription factors Otx2 and Crx are committed to the photoreceptor fate. Tr2 represses the S-cone fate and positively regulates the M-cone fate. Rod progenitors express Nrl, which activates Nr2e3 expression and both repress S-cone genes and activate rod-specific genes. tbx2b regulates the fate decision between rods and UV cones in the zebrafish retina (Alvarez-Delfin K et al., 2009; this dissertation). Figure modified from Hennig AK et al. (2008).

8 and cone opsins as well as other phototransduction genes (Peng GH & Chen S, 2005). Crx is a trans-activator for many photoreceptor genes most likely by interacting with other transcriptional regulators and by promoting chromatin remodeling in target genes (Chen S et al., 1997; Hennig AK et al., 2008). Nrl and Crx act synergistically in the activation of rhodopsin and several other rod-specific genes; Nr2e3 potentiates this activation if present (Chen S et al., 1997; Mitton KP et al., 2000; Cheng H et al., 2004; Whitaker SL & Knox BE, 2004; Peng GH et al., 2005; Liu Y et al., 2001). Nrl moderately represses cone-specific genes but the main repressor for cone transcripts in rods is Nr2e3 (Peng GH et al., 2005; Oh EC et al., 2007). Nr2e3 demonstrates a dual function activating rod-specific genes and repressing cone genes (Chen J et al., 2005; Oh EC et al., 2008). Tr2 seems to act also as a dual transcription regulator; in the presence of thyroid hormone Tr2 activates M-opsin transcription, and inhibits Crx-mediated transcription of S-opsin (Ng L et al., 2001; Yanagi Y et al., 2002). The Ror (retinoid-related orphan receptor ) activates the expression of the S-opsin gene with Crx as transactivator in cones (Srinivas M et al., 2006). Interestingly, Ror also genetically lies upstream of the rod-specific lineage transcription factor Nrl during rod development (Jia L et al., 2009), placing this nuclear receptor as dual regulator in both rod and cone differentiation. Another nuclear receptor, Ror (retinoid-related orphan receptor ) in mouse seems to regulate terminal differentiation of cones by promoting expression of S-, M-opsin and cone arrestin genes, similarly acting synergistically with Crx (Fujieda H et al., 2009). Interestingly, chromatin immunoprecipitation (ChiP) analysis by Hennig AK et al. (2008) demonstrated that Crx, Nrl, Nr2e3 and Tr2 bind to their own promoters as well as to rod and cone target genes. This suggests potential opposite roles for all those transcription factors as activators and repressors of gene expression in different cell subtypes. The dual regulatory role of Nr2e3 may be due to differential SUMOylation by the transcriptional co-regulator and E3 SUMO ligase Pias3, in rods versus cones (Onishi A et al., 2009). This finding opens the question whether reversible modifications in other photoreceptor transcription factors regulate their dual roles as transcription repressor or activators. Some of the photoreceptor-specific transcription factors have been described in zebrafish. Zebrafish Crx orthologue is expressed in photoreceptors and pinealocytes (Liu Y et al., 2001). In vitro, the protein demonstrated modest activation of a bovine rhodopsin promoter in reporter transfection assays, although it exhibited a more robust activation in synergy with

9 mammalian Nrl (Liu Y et al., 2001). Analysis of Crx morphants unveiled distinct earlier roles in zebrafish, such as demarcating the optic primordia and promoting cell differentiation throughout the retina, in addition to photoreceptors (Shen YC & Raymond PA, 2004). Nr2e3 expression in zebrafish has demonstrated a slightly different pattern than in other vertebrates; the transcript and protein accumulates transiently in all developing photoreceptors, and t later it is restricted exclusively to rod progenitors (Chen J et al., 2005). A putative and phylogenetically distant orthologue of Nrl has been identified in zebrafish (Coolen M et al., 2005); the expression pattern includes lens and adult ONL, and in the embryo is expressed in newly differentiated rods and in the cone precursors (Nelson SM et al., 2008).

1.3 T-box Family of Genes in Development T-box family of transcription factors fulfill crucial roles in embryogenesis, such as limb and digit identity, heart, hypothalamus, melanocytes, mammary gland and brain development (Isaac A et al., 1998; Harrelson Z et al., 2004; Snelson CD et al., 2008; Papaioannou VE, 2001; Manning et al., 2006; Carreira S et al., 1998; 2000). The founder of the family, Brachyury, was identified in 1990 as the gene affected in a short tail mouse phenotype, demonstrating an essential role in mesoderm induction (Herrmann BG et al., 1990). Subsequently, numerous members have been identified in most animal species (Papaioannou VE, 2001); for example human and mice possess 17 Tbx genes (Naiche LA et al., 2005). Tbx proteins share a highly conserved 180-nucleotide DNA binding domain, the T-box. Human genetic disorders, such as DiGeorge, Ulnar-mammary, and Holt-Oram syndromes as well as some forms of cleft palate have been linked to mutations in T-box genes (Packham EA & Brook JD, 2003). Interestingly, T-box genes frequently exhibit dose-sensitive roles; as a result haplo-insuficiency is also associated with human congenital diseases (Naiche LA et al., 2005). The T-box binding element (TBE) is the sequence recognized by T-box transcription factors in target promoters to mediate repression or activation. Binding can occur as homodimer to palindromic TBE, or as a monomer to the half of the site; different orientations and spacing have been described (Plageman TF,Jr & Yutzey KE, 2005; Naiche LA et al., 2005). Evidence from heart studies suggests that some T-box transcription factors form heterodimers with tissue-specific transcription factors to regulate gene expression (Bruneau BG, 2002; Christoffels VM et al., 2004; Habets PE et al., 2001). Most of the T-box proteins have been

10 described as transcription activators. Tbx2, Tbx3 and Tbx20 are the only repressors in the family, but weak activation domains have been suggested in some studies (Plageman TF,Jr & Yutzey KE, 2005; Chen J et al., 2001; Paxton C et al., 2002). Additionally, transcriptional regulation can be achieved by interaction with chromatin remodeling complexes, histone modifying enzymes and transcriptional co-repressors (Boogerd CJ et al., 2009). Some of the most extensive studies on T-box genes and their seminal roles during development have been achieved in the heart, where Tbx20, Tbx18, Tbx5, Tbx3, Tbx2 and Tbx1 are expressed (reviewed by Greulich F et al., 2011). Briefly, Tbx1 and Tbx18 ensure anterior- posterior elongation of the cardiac tube, while Tbx5 and Tbx20 independently activate the chamber myocardial gene program; in contrast, Tbx2 and Tbx3 favor cardiac tube septation by repressing the chamber program. (Plageman TF,Jr & Yutzey KE, 2005; Bruneau BG, 2002; Christoffels VM et al., 2004; Greulich F et al., 2011). Tbx2 is required to suppress the heart chamber differentiation program in the atrioventricular canal by repressing chamber-specific genes, such as atrial natriuretic factor (ANF), conexin 40 and conexin 43. It has been demostrated that Tbx2 forms a complex with the homeobox transcription factor Nkx2.5 to repress the ANF promoter in non-chamber tissues (Habets PE et al., 2001). In contrast, Tbx5 and Nkx2.5 form an activator complex for chamber gene transcription. The proposed mechanism is that Tbx2 competes for the binding site and inhibits Tbx5-mediated transactivation (Bruneau BG et al., 2001; Habets PE et al., 2001). Subsequently, targeted mutagenesis of Tbx2 in mice caused severe cardiac defects and led to embryonic lethality (Harrelson Z et al., 2004). Regulation of T-box gene expression in different tissues is a subject of intensive study. The BMP (bone morphogenetic protein) pathway directly activates Tbx20 expression in heart (Plageman TF,Jr & Yutzey KE, 2005; Mandel EM et al., 2010); similarly, Tbx2 expression in heart and retina is positively modulated by BMP (Behesti H et al., 2006). Accordingly, binding sites for Smad, a transcription factor acting downstream of BMP have been identified in both T- box promoters (Ma L et al., 2005; Shirai M et al., 2009; Singh R et al., 2009). Additionally, a putative retinoic acid response element identified in the Tbx2 promoter was shown to be responsible for retinoic acid stimulated Tbx2 gene expression in B16 murine melanoma cells (Boskovik G & Niles RM, 2004); Tbx1 and Tbx5 expression seem to be regulated by retinoic acid as well in heart (Roberts C et al., 2006; Sirbu IO et al., 2008). In melanocytes, the

11 microphthalmia associated transcription factor (MITF), a key regulator of melanocyte differentiation, proliferation and survival binds the Tbx2 promoter to activate gene expression (Carreira S et al., 2000). Evidence suggests than the expression of several T-box transcription factors is auto-regulated, or at least regulated by other members of the T-box family as conserved TBEs have been identified in Tbx2 and other T-box gene promoters (Bruneau BG, 2002; Cai et al., 2005; Chi NC et al., 2008). Moreover, an intact TBE in the tbx2b promoter seems to be essential for its own expression in the zebrafish eye (Chi NC et al., 2008). 1.3.1 Tbx2 in Retinal Development In human, mice, chick, Xenopus, and zebrafish, developmental retinal expression of Tbx2 orthologues is remarkably conserved, suggesting a preservation of function (Ruvinsky I et al., 2000; Sowden JC et al., 2001; Gross JM & Dowling JE, 2005; Hayata T et al., 1999; Gibson-Brown JJ et al., 1998). In all five organisms, Tbx2 exhibits a dorsal-ventral gradient of expression in the retinal neural epithelium with greater mRNA accumulation in the dorsal retina. A second zebrafish orthologue of the mammalian Tbx2, tbx2a (also called tbx2b-like) shares 78% amino acid identity with tbx2b and is also expressed in the retina (Ribeiro I et al., 2007); although no roles have been described for tbx2a in the fish retina. Prior work suggested that tbx2b is essential for neurogenesis in zebrafish (Gross JM & Dowling JE, 2005). MO knock down of tbx2b was associated with a lack of neural differentiation in the dorsal retina, but neurogenesis was unaffected in the ventral retina, consistent with the pattern of expression (Gross JM & Dowling JE, 2005). The targeted disruption of Tbx2 in mouse resulted in in utero death at 10.5-14.5 days post coito most likely from heart malformation (Harrelson Z et al., 2004), preventing studying photoreceptor development, which occurs later. A more detailed analysis of the Tbx2-/- mouse eyes revealed that loss of Tbx2 produced increased apoptosis that accounts for a reduced retinal volume, and a delay in the ventral optic vesicle invagination led to small and misshaped optic cups (Behesti H et al., 2009). Recently, a conditional null allele for Tbx2 was generated in mouse, which will allow studying the role of this gene at different developmental times and in specific tissues (Wakker V et al., 2010). The regulation of Tbx2 expression in the retina is poorly understood. Evidence from mouse suggests that the conserved Tbx2 dorsal-ventral gradient expression pattern during retinal development is dependent on the morphogen BMP4; indeed BMP4 itself is expressed in the dorsal retina overlapping with Tbx2 (Behesti H et al., 2006). In response to increasing BMP4

12 exogenous signaling Tbx2 expression is expanded into the ventral retina; on the contrary, the BMP antagonist Noggin reduced the Tbx2 expression domain in the developing retina (Behesti H et al., 2006). In medaka fish, Tbx2 and Tbx3 are not expressed in the retinal primordium of a mutant in the Rx3 homeobox transcription factor eyeless (el), suggesting that both T-box proteins act downstream of Rx3 (Loosli F et al., 2001). In zebrafish, an intact T-box binding element is required to recapitulate the normal expression pattern of a transgenic line driving a fluorescent reporter by the tbx2b promoter in the retina (Chi NC et al., 2008). This finding suggested that a T-box protein (presumably tbx5) binding is required for tbx2b expression during early patterning of the zebrafish retina (Chi NC et al., 2008).

1.4 Six Genes in Development Six (Sine oculis homeobox) genes have been demonstrated to direct pivotal developmental roles in a variety of tissues as well as in cell cycle regulation. The founder member of the family (reviewed by Kawakami K et al., 2000 and Kumar JP, 2009) was identified in Drosophila as the homeobox transcription factor sine oculis (So) due to essential roles in the compound eye formation (Cheyette BN et al., 1994; Serikaku MA & O’Tousa JE, 1994). Two additional homologues were later identified in Drosophila: Optix and D-Six4. So and Optix are the only homologues expressed in the eye, while D-Six4 functions in several mesoderm derivatives, such as muscles and gonads (Seo HC et al., 1999). Multiple homologues of the Drosophila Six genes have been identified in organisms such as human, mouse, chicken, frog and fish, and invertebrates such as nematodes, planaria, jellyfish, and sponge (Kawakami K et al., 2000; Kumar JP, 2009). Two evolutionarily conserved and adjacent domains characterize the Six family of proteins: the Six domain and the homeodomain. The homeodomain, of about 60 amino acids with unique features is much conserved among all members and acts as the DNA binding motif (Serikaku MA & O’Tousa JE, 1994). The Six domain, of about 115 amino acids, located just upstream of the homeodomain, is mainly devoted to protein-protein interaction (Oliver G et al., 1995). Molecular phylogenetic analysis of the conserved domains has led to the classification of the Six family into three major subfamilies: Six1/2, Six3/6 and Six4/5. Each group contains one of the fly genes and their orthologues (Seo HC et al., 1999).

Six proteins can act both as transcription activators or repressors. In Drosophila, So interacts with the transcriptional co-activator Eyes absent (Eya) to form a transcriptional activator complex (Pignoni F et al., 1997). This interaction seems to be conserved across the animal kingdom (Kumar JP, 2009), but it only true for members of the Six1/2 and Six4/5 subfamilies. No interaction with Eya has been detected for members of the Six3/6 group; indeed Six3 and Six6 seem to bind to the transcriptional repressor Groucho to negatively regulate transcription of target genes (Kobayashi M et al., 2001; Zhu CC et al., 2002; Lopez- Rios J et al., 2003). Six proteins can also repress transcription by complexing with members of the Dach family of co-repressors (Li X et al., 2003). Several genetic diseases in humans have been related to Six genes. Loss-of-function mutations in Six3 cause holoprosencephaly, a condition characterized by the failure of the forebrain to divide and form bilateral cerebral hemispheres; the most severe cases demonstrate cyclopia (Wallis DE et al., 1999). Moreover, it has been determined that Six3 is a direct upstream activator of Sonic hedgehog, whose signaling is prominent in establishing the ventral midline and separation of the eyes (Geng X et al., 2008; Jeong Y et al., 2008). Six6 mutations have been associated with bilateral anophthalmia (lack of eye tissue) and pituitary defects (Gallardo ME et al., 1999; 2004). Six5 has been linked to myotonic dystrophy in mouse and humans, a condition characterized by muscle weakness, some nervous system impairment and cataracts (Klesert TR et al., 2000; Bateman JB et al., 2006). Six1 is over-expressed in mammary cancer cells and it is known to be a cell cycle regulator (Ford HL et al., 2000). 1.4.1 Six Genes in Eye and Retinal Development Several Six family members are expressed in the developing eye. In Drosophila the forced expression of So or Optix induces ectopic eyes (Seimiya M & Gehring WJ, 2000; Weasner B et al., 2007). Loss-of-function mutations in So resulted in absence of eye tissue (Cheyette BN et al., 1994; Serikaku MA & O’Tousa JE, 1994). Both, So and Optix are directly regulated by the Pax6 fly homolog Eyeless (Ey) to establish the eye field (Halder G et al., 1998). Interestingly, in vertebrates only members of the Optix subgroup (Six3 and Six6) seem to have important roles in the developing eye (Oliver G et al., 1995; Seo HC et al., 1998a; Jean D et al., 1999). Bony fish additionally possesses six7, another member of the Six3/6 subfamily with expression almost exclusively in the eye (Seo HC et al., 1998b). The expression of Six4

14 and Six5 has been documented in the mouse retina, but their function in eye development is unknown (Kumar JP, 2009). Six3 is a very well characterized member of the Six genes family, particularly in eye development. In mouse, Six3 is expressed in the anterior neural plate, where it is required for early forebrain specification, the optic vesicles and the lens, and later it is expressed abundantly in the optic cups (Oliver G et al., 1995). Six3 expression at later stages has been observed in all retinal layers: GCL, INL (amacrine and horizontal cells) and ONL in several animal models (Kawakami K et al., 1996; Bovolenta P et al., 1998; 2003; Zhu CC et al., 2002; Manavathi B et al., 2007). Mouse Six3 promotes ectopic lens and retinal tissue formation when is ectopically expressed in medaka (Oliver G et al., 1996; Loosli F et al., 1999). Additionally, Six3 over- expression produce enlargement of the eyes and rostral forebrain in zebrafish, medaka and Xenopus (Loosli F et al., 1999; Kobayashi M et al., 1998, Bernier G et al., 2000). Targeted disruption of Six3 in mouse is lethal and demonstrated absence of eyes and other brain structures anterior to the midbrain (Lagutin OV et al., 2003). Six3 has been described as both transcriptional repressor and activator. The interaction of Six3 and the co-repressor Groucho to form a transcriptional repressor complex has been documented in mouse, medaka fish and zebrafish; this interaction is mediated by the conserved eh1-related (engrailed homeoprotein) motif present in the Six domain (Zhu CC et al., 2002; Lopez-Rios J et al., 2003; Kobayashi M et al., 2001). The eh1-related motif has been previously demonstrated to be critical for homeoprotein repression activity in Drosophila (Smith ST et al., 1996). Six3 seems to auto regulate its own expression as binds specific cis- elements in its own promoter to repress transcription (Zhu CC et al., 2002; Manavathi B et al., 2007; Suh CS et al., 2010). Six3 also binds to and activates the rhodopsin promoter by synergistic interaction with known co-activators, such as Crx and Nrl (Manavathi B et al., 2007). A direct link of Six3 and cell cycle regulation in the eye has been established with the identification of the Six3 and Geminin interaction in medaka fish (Del Bene F et al., 2004). Geminin is a DNA replication-initiation inhibitor that acts as negative regulator of the cell cycle by sequestering Cdt1, and impeding the replication fork to assemble. It was suggested that Six3 competes with Cdt1 to bind to Geminin, interfering with its anti-proliferative function. As a

15 result, it has been proposed that Six3 and Geminin act antagonistically to balance proliferation and differentiation during early eye development (Del Bene F et al., 2004). Six6 is another member of the Optix (Six3/6) subgroup expressed in retina, pituitary gland and hypothalamus in all vertebrate species analyzed (Jean D et al., 1999; Gallardo ME et al., 1999; Conte I et al., 2005; Lopez-Rios J et al., 1999; Li X et al., 2002). In the developing eye, Six6 shares similar expression domains with Six3, such as the optic vesicle and the optic stalk, and then expands to the neural retina but it is only transiently expressed in the lens (Jean D et al., 1999). At later stages Six6 expression is retained in ganglion and amacrine cells (Li X et al., 2002; Conte I et al., 2010). Ectopic Six6 expression is sufficient to induce retinal tissue, but not lens material (Loosli F et al., 1999), and in chick produces trans-differentiation of the pigmented epithelium cells into retinal or neuronal-like cells (Toy J et al., 1998). Over- expression of Xenopus Six6 results in a dramatic increase in eye size (Zuber ME et al., 1999). Targeted disruption of Six6 in mice demonstrated retinal hypoplasia, often with absence of optic chiasm and optic nerve, as well as impaired fertility due to defects in the pituitary gland development (Li X et al., 2002; Larder R et al., 2011). Little is known regarding the transcriptional regulation of Six6 gene or by Six6 in the retina. Data from medaka identified the transcription factor NeuroD as a transcriptional activator for Six6 retinal expression through binding to a conserved E-box in the Six6 promoter (Conte I et al., 2010). Interestingly, Six6 also activates NeuroD expression in the retina and this regulatory loop appears to control rhodopsin expression and amacrine cell specification (Conte I et al., 2010). Six6 acts as a direct repressor of the cdk inhibitor p27/Kip in the murine retina and that role requires interaction of Six6 with the co-repressor Dach1 (Li X et al., 2002). Similar to Six3, Six6 is also able to interact with the transcriptional co-repressor Groucho (Lopez-Rios J et al., 2003). 1.4.2 The Six3/6 Subfamily in Zebrafish Zebrafish possesses five homologues of the Six3/6 subfamily: six3a, six3b, six6a, six6b and six7 (http://zfin.org/). six3a, six3b and six7 display partially overlapping expression domains during early gastrulation and early eye formation (Seo HC et al., 1998a; 1998b; Kobayashi M et al., 1998; Wargelius A et al., 2003); no expression data is available for the zebrafish six6 orthologues. six3a and six3b early expression pattern is very similar in the prospective forebrain, optic primordia and the optic vesicles (Seo HC et al., 1998a; Kobayashi

M et al., 1998; Wargelius A et al., 2003). Although, the later retinal expression is quite different: at 24 hpf six3b expression get confined to the ventral half of the retina, and at 48 hpf mostly to the choroid fissure edges (Seo HC et al., 1998b). In contrast, six3a expression at 32- 48 hpf located to the ganglion cell layer and, as retinal differentiation progresses, also to the inner nuclear layer. At 5 dpf six3a is confined to the CMZ and GCL (Wargelius A et al., 2003). From the two six3 zebrafish orthologues, six3a retains the higher sequence conservation with the mammalian Six3, in addition to share similar retinal expression pattern (Wargelius A et al., 2003). Over-expression of six3b in zebrafish embryos induced enlargement of the rostral forebrain, and a dramatic dorsalization of the embryo was observed (Kobayashi M et al., 1998). Moreover, it has been suggested that six3b acts as a Groucho-dependent transcriptional repressor in the eye and forebrain formation (Kobayashi M et al., 2001). The LIM- homeodomain lhx2 transcription factor has been identified as a downstream effector of six3a and six3b to regulate forebrain cell proliferation and development (Ando H et al., 2005), in agreement with findings in Xenopus (Zuber ME et al., 2003). six7 is a Six3/6-like gene with orthologues identified only in fish. six7 protein demonstrates overall 66-69% sequence identity with other Six3-like proteins, but higher identity in the homeodomain (95%) but less in the Six domain (77%) (Seo HC et al., 1998b). Another distinctive feature is that six7 displays a 41-amino-acid residue truncated N-terminal region compared to other Six3/6 members and a C-terminal portion largely divergent (Seo HC et al., 1998b). six7 expression can be first detected shortly after gastrulation at 6 hpf, at 9 hpf it is expressed in the midbrain primordium, and later shares expression domains with six3 orthologues in the most rostral region of the prospective forebrain (Seo HC et al., 1998a; 1998b). Similar to previous observations on six3a and six3b, six7 expression correlates to the first appearance of the optic vesicles at 11-12 hpf (Seo HC et al., 1998b). At 14 hpf after gastrulation is completed, six7 transcript levels are dramatically reduced, and reportedly no longer detectable by reverse transcribed polymerase chain reaction (RT-PCR) (Seo HC et al., 1998b). Consistent with early roles in patterning anterior neural tube and forebrain six7 antisense MO knock down in the six3bvu87/vu8 null mutant background resulted in strongly reduced eye size or no eye tissue. Although, six7 morphants in a wild-type (WT) background did not demonstrate a noticeable phenotype (Inbal A et al., 2007). This finding suggested

17 important redundant or compensatory roles for six3b and six7 transcription factors in the eye field determination in zebrafish. Contrasting with previous reports, Vihtelic TS et al. (2005) detected the six7 transcript in an adult eye library; also our data demonstrated that six7 is expressed at later times during development and similarly in the adult retina (Alvarez-Delfin K & Fadool JM, unpublished data), suggesting later roles for six7 in eye development and maintenance.

CHAPTER TWO

TBX2B IS REQUIRED FOR ULTRAVIOLET PHOTORECEPTOR CELL SPECIFICATION DURING ZEBRAFISH RETINAL DEVELOPMENT

2.1 Introduction Vertebrates have evolved two major classes of retinal photoreceptors: rods, which mediate dim light vision, and cones, which detect light of greater intensity, have a faster temporal resolution and mediate color vision. Largely from the analysis of mutations in mice and humans, a transcriptional network regulating photoreceptor cell development has been proposed. Photoreceptor progenitors sequentially express the homeobox transcription factors Otx2 and Crx (Freund CL et al., 1997; Furukawa T et al., 1997; Nishida A et al., 2003), and in their absence, photoreceptor precursors are not specified or fail to differentiate. Rod specification requires the additional expression of the Maf-family transcription factor Nrl and its target Nr2e3 (Chen J et al., 2005; Mears AJ et al., 2001). Nrl acts as a molecular switch; in its absence, precursors adopt the short-wavelength (S) opsin cone fate (Mears AJ et al., 2001; Akimoto M et al., 2006), and mis- and over-expression of Nrl transforms most if not all cone precursors into functional rods (McIlvan VA & Knox BE, 2007; Oh EC et al., 2007). NR2E3 expression, which is disrupted in enhanced S-cone syndrome in humans and the rd7 mouse, is required for the repression of cone specific genes in rod precursors (Chen J et al., 2005; Akhmedov NB et al., 2000; Haider NB et al., 2000). However, it remains to be determined if a reciprocal system exists in cone precursors for repressing rod-specific genes. The zebrafish retina, in addition to rods, possesses four cone subtypes, each with a distinct morphology and expressing a unique opsin (Branchek T & Bremiller R, 1984; Branchek T, 1984; Larison KD & Bremiller R, 1990; Raymond PA et al., 1993; Raymond PA et al., 1995; Robinson J et al., 1993; Schmitt EA & Dowling JE, 1996). The spatial and temporal differentiation of the photoreceptors leads to the formation of a highly ordered, precisely defined arrangement (Robinson J et al., 1993; Fadool JM, 2003). The photoreceptor mosaic provides an opportunity to systematically uncover genetic mechanisms regulating vertebrate

19 photoreceptor subtype specification, similar to the studies of Drosophila ommatidial assembly initiated several decades ago. We identified a mutation called lots-of-rods (lorp25bbtl) that results in an increase in the number of rods and a decrease in the number of ultraviolet UV cones in the larval and adult zebrafish retina. To our knowledge, this is the first report of a genetic mutation isolated in the zebrafish that results in a change in photoreceptor subtype. The lorp25bbtl phenotype demonstrates many features opposite to those observed in enhanced s-cone syndrome and mutations of Nr2e3 or Nrl in mice. Genetic analysis revealed that lorp25bbtl is an allele of tbx2b, a T-box transcription factor with essential roles in development (Christoffels VM et al., 2004; Harrelson Z et al., 2004; Snelson CD et al., 2008; Fong SH et al., 2005). Our data suggest that during photoreceptor cell differentiation, tbx2b acts cell autonomously to promote the UV cone fate by repressing the rod fate in zebrafish photoreceptor cell progenitors.

2.2 Material and Methods Zebrafish Maintenance. Rearing, breeding, and staging of zebrafish (Danio rerio) were performed according to standard methods (Westerfield M, 1995). The tbx2bp25bbtl mutant was isolated from a screen of ethyl-nitrosourea (ENU) mutagenized zebrafish immunolabeled for developing rods at 5-6 dpf (Morris AC & Fadool JM, 2005). Mutagenesis was performed at the University of Pennsylvania as previously described (Dosch R et al., 2004). The transgenic zebrafish line expressing GFP in rods (Fadool JM, 2003) and the fbyc144 line were previously described (Snelson CD et al., 2008). The insertional mutant for tbx2b ZM_00198827 (Zenomics) was provided by Dr. Joshua Gamse, heterozygous larvae were pair-wise mated and the progeny was fixed at 4 dpf and processed for whole-mount immunolabeling. The hst mutant line was kindly provided by Dr. D. M. Garrity (Garrity DM et al., 2002), heterozygous larvae for hst were pair-wise mated and the progeny was fixed at 4 dpf and processed for whole-mount immunolabeling. To inhibit pigmentation, larvae used in immunolabeling or in situ hybridization experiments were treated with 0.003% 1-phenyl-2-thiourea at 18-22 hpf. Polymerase Chain Reaction (PCR), Cloning and Sequencing. Primers for cloning the open reading frame of tbx2b were provided by Dr. Jeffrey Gross. The sequences of the primers used were: for the 5’ untranslated region (UTR), 5’-UTR, (JG-CS-29) 5’- CTTCGTGGAAACTAGCAGCTACG and, for the 3’-UTR, (JG-CS-31) 5’-

TCATGCCCTGGATAGGTTGG. RNA was isolated with TRIzol (Life Technologies, Carlsbad CA), and cDNA was synthesized using oligo-dT primer. The RT-PCR products from 4-dpf WT and tbx2bp25bbtl embryos were cloned into the TOPO vector (Invitrogen, Carlsbad CA) according to manufacturer’s instructions and sequenced. 1051 pb of the tbx2b proximal promoter (- 802/+249) from WT and lorp25bbtl was PCR-amplified and sequenced; the primers used were, forward (JMF455) 5’-GGTCTTTAGATTCCATCAGC and reverse (JMF459) 5’- GGATCTTCCACTTTAACTCC. Amplification and sequencing of the T-box domain of tbx2b from the fbyc144 line was performed as follows: the progeny of fbyc144 heterozygous parents were fixed at 5 dpf, immunolabeled with rod-specific antibody 4C12, and screened for WT and “lots- of-rods” phenotype. DNA was extracted from 3 individual larva of each condition and subjected to PCR. The primers used were: forward (JMF319) 5’- GACGAGCACTAATGTCTTCC and reverse (JG-CS-37) 5’- AACCTAAGTGGGCTGGAAACCG. The 1603 bp PCR product was sequenced and the resulting data for WT and tbx2bp25bbtl were compared. Immunohistochemistry. Immunolabeling and fluorescence microscopy of whole- mount larvae and frozen sections (10 µm) were performed as described previously (Fadool JM, 2003; Morris AC et al., 2005). BrdU (bromodeoxyuridine) incorporation was performed as described (Morris AC et al., 2008). Sections and enucleated eyes from whole-mounted immunolabeled larvae were imaged with a Zeiss 510 Scanning Laser Confocal (Carl Zeiss, Oberkochen, Germany) microscope equipped with either a 20x (NA 0.75) objective or 40x water-immersion objective (NA 1.2) as described (Fadool JM, 2003). The following primary antibodies and dilutions were used: 4C12, which recognizes an unknown epitope in rods (Fadool JM & Linser P, unpublished data, 1999) (mouse, 1:120); 1D1, which recognizes rod opsin (mouse, 1:50); Zpr1, which recognizes red-green double cones (mouse, 1:20, Oregon monoclonal bank); antibodies against zebrafish blue, UV, green, and red cone opsins (Vihtelic TS et al., 1999) (rabbit, 1:100); anti-BrdU (mouse, 1:500, Sigma); 5e11, which recognizes amacrine cells (mouse,1:10); Zrf-1, which recognizes Müller glia (mouse, 1:10, Oregon monoclonal bank); Zn8, which recognizes ganglion cells (mouse, 1:10); and anti-Nr2e3 (rabbit, 1:100), a generous gift from J. Nathans (Baltimore, Maryland). Alexa fluor-conjugated secondary antibodies (1:200, Molecular Probes-Invitrogen, Carlsbad CA) and donkey anti- rabbit Cy5-conjugated secondary antibodies (Jackson Laboratories, Bar Harbor ME) were used

21 according to manufacturer’s instructions. Cell nuclei were counterstained with DAPI (4, 6- diamidino-2-phenylindole; Sigma-Aldrich, St. Louis MO). Whole-mount in situ Hybridization. Whole-mount in situ hybridization was performed essentially as described (DeCarvalho AC et al., 2004) in embryos at 22 and 28 hpf. Antisense RNA probe was prepared with a digoxigenin RNA-labeling kit (Hoffmann–La Roche Ltd., Basel, Switzerland) by in vitro transcription with T7 RNA polymerase, according to the manufacturer's instructions. tbx2b ORF (open reading frame) was amplified from a 4-dpf- embryo cDNA preparation and cloned into the TOPO vector (Invitrogen, Carlsbad CA). The construction was digested with NcoI to generate a 500 pb probe that correspond to the 5’ end of the gene. The hybridized probe was detected with alkaline phosphatase coupled with anti- digoxigenin antibodies (Hoffmann–La Roche Ltd., Basel, Switzerland) and NBT/X-phosphate substrate (Hoffmann–La Roche Ltd., Basel, Switzerland). Labeled embryos were cleared in a graded series of glycerol and viewed on a Axiovert S100 microscope (Carl Zeiss, Oberkochen, Germany), and images were captured by Zeiss Axiocam digital camera (Carl Zeiss, Oberkochen, Germany) and processed with Axiovision and Photoshop 5.5 softwares. Cell Transplantation. Genetic chimeras were generated as described (Link B et al., 2000). Donors were labeled at the 1- and 2-cell stage by injection with lysine-fixable dextran- conjugated Alexa Fluor 594 (Invitrogen, Carlsbad CA). Transplant was performed at the 1000- cell stage. The chimeras were fixed with paraformaldehyde 4% at 80 hpf and immunolabeled as described above. Imaging of dissected eyes was performed by confocal microscopy as described above. Optokinetic Response Assay (OKR) was performed at 5 dpf in wild-type and lor embryos, essentially as described previously (Brockerhoff SE et al., 1995). Mapping. Linkage analysis was performed at the Zebrafish Mapping Facility at the University of Louisville from DNA isolated from 100 WT siblings and 100 tbx2bp25bbtl embryos using SSLP (simple sequences length polymorphism) markers (Gregg RG et al., 2003). Cell Quantification. Confocal images from whole eyes immunolabeled for UV cones and rods (4C12 antibody) where analyzed with the Scion Image Software (Scion) (Fadool JM, 2003). An area corresponding to 3500 µm2 in the central retina was used to count UV cones and rods in 4- and 5-dpf WT and lor retinas. The following number (n) of 4 or 5 dpf-retinas and cells types were analyzed: WT, n=4 (UV cones) and n=6 (rods); tbx2bp25bbtl, n=6 (UV cones)

22 and n=6 (rods); lor/ fbyc144, n=7 (UV cones and rods). The average number of UV cones or rods and the standard deviation (SD) were reported. Cell Death. Terminal deoxynucleotide transferase-mediated dUTP nick-end labeling (TUNEL) was performed on retinal frozen sections of 5, 10, and 21 dpf embryos and adults of WTs and tbx2bp25bbtl, using the Apoptag in situ Apoptosis Detection kit (Chemicon, Temecula CA) according to the manufacturer’s instructions.

2.3 Results To identify genes essential for vertebrate photoreceptor development, we screened 5-6- dpf zebrafish larvae for ENU-induced mutations leading to alterations in rod patterning (Morris AC & Fadool JM, 2005). Rods first appear in the ventral retina coincident with the expression of the first cone opsin (Fig. 4B) but differentiate in the dorsal and central retina in a sporadic pattern subsequent to the differentiation of the cones (Fig. 4C) (Raymond PA et al., 1995; Schmitt EA & Dowling JE, 1996). In contrast, lorp25bbtl mutants displayed a higher number of rods across the entire retina with few gaps in the central or dorsal regions (Fig. 4E). Between 3 and 5 dpf, rod immunolabeling in mutant larvae spread in a continuous front from the ventral to central and finally to the dorsal retina, reminiscent of the wave-like fashion of cone differentiation (Raymond PA et al., 1993) (Fig. 4F). The increased number of rods was confirmed by labeling with either monoclonal or polyclonal antibodies against rhodopsin, and was mirrored by GFP expression when lorp25bbtl was placed on the XOPS-GFP transgenic background (Fadool JM, 2003). In teleosts, rods are continuously added to the post-embryonic retina from a population of mitotically active cells called the rod progenitors (Johns PR & Fernald RD, 1981); however, BrdU labeling detected no increased mitotic activity in lorp25bbtl mutants (data not shown). lorp25bbtl mutants were also morphologically normal (Fig 4A and D), demonstrated a robust optokinetic response (OKR), and could be routinely reared to fertile adults. The lorp25bbtl mutation was mapped to an interval of chromosome 15, near SSLP markers z22430/z25911 (Fig. 4G) where tbx4 and tbx2b/ fbyc144 were localized (Snelson CD et al., 2008). tbx2b is a transcription factor mainly associated with transcriptional repression during cell cycle control, limb, heart and endoderm development (Christoffels VM et al., 2004; Harrelson Z et al., 2004; Fong SH et al., 2005) and cancer (Jacobs JJ et al., 2000). A single

Figure 4. lorp25bbtl mutants display increased labeling for rods. Ventral views of bright field images (A & D) and immunofluorescent images of rod (4C12 antibody) specific labeling of WT (B & C) and a lorp25bbtl mutant larvae (E & F). At 3 dpf WT larvae display rod labeling first in the ventral retina (B) followed by sporadic labeling of individual cells in the central and dorsal retina at 5 dpf (C). At 3 dpf, lorp25bbtl mutant larvae display increased rod immunolabeling across the ventral and central retina (E) that is evenly distributed at 5 dpf (F). (G) Linkage analysis placed lorp25bbtl between simple SSLP markers Z31583 and Z22430 on the MGH panel. The number of recombinants in 87 mutant larvae is shown (red). The interval containing the lor mutation and the tbx2b locus is shown.

24 mutant allele of tbx2b has been reported in zebrafish. The fbyc144 mutation results from a T-to- A transversion generating a premature stop codon within the T-box sequence and was isolated based upon a pineal gland phenotype (Snelson CD et al., 2008). Complementation testing indicated that lorp25bbtl is an allele of tbx2b. Crosses between carriers of the lorp25bbtl mutation and the fbyc144 mutation revealed that fbyc144 failed to complement lorp25bbtl; approximately 25% of the progeny of the intercross displayed the increased rod phenotype (data not shown). In addition, homozygous fbyc144 mutant larvae, confirmed by sequencing the tbx2b gene, demonstrated the “lots-of-rods” phenotype, whereas phenotypically WT siblings were either homozygous for the WT allele or heterozygous. Moreover, homozygous larvae for the strain ZM_00198827 (Zenomics), which contain an insertion in a tbx2b exon also displayed the “lots- of-rods” phenotype, more rods and a reduced number in UV cones (data not shown). tbx2b expression was examined by in situ hybridization in WT and lorp25bbtl mutant embryos (Fig. 5A-D). tbx2b expression was greater in the dorsal retina and absent in the ventral retina adjacent to the choroid fissure (Fig. 2A-B) (Rubinsky I et al., 2000; Gross JM & Dowling JE, 2005), the region of precocious rod differentiation in embryos and of highest rod density in larvae (Fig. 5B). In lorp25bbtl mutants, the dorsal/ventral gradient of tbx2b retinal expression was still detectable but labeling was much fainter than in the WT embryos (Fig. 5B and D). At 44 and 60 hpf (data not shown), tbx2b expression persisted in the inner retina, in the regions of continued neurogenesis at the retinal margins and cells adjacent to the forming ONL but was diminished in the central retina. In mutant larvae, labeling was greatly reduced across the retina. RT-PCR of RNA extracted from WT and lor mutant embryos confirmed the lower expression of tbx2b at 20 and 28 hpf in the mutant (Fig. 5E). Sequencing of tbx2b cDNA from 4 dpf WT and lorp25bbtl larvae revealed no changes in the tbx2b coding region (data not shown) suggesting that lorp25bbtl represents a mutation in a regulatory sequence. To test if the increased number of rods resulted from a change in fate of one of the four cone subtypes, serial sections of larvae from intercrosses of lorp25bbtl heterozygotes were co- immunolabeled with one of four polyclonal antisera to the cone opsins and a rod specific monoclonal antibody to distinguish mutant from WT larvae (Fig. 6). In the lorp25bbtl retinas, labeling for the UV-opsin was nearly absent (Fig. 6D’). Immunolabeling for the three other cone opsins (Fig. 6) and markers of other retinal cell types did not reveal any other alteration, nor was increased apoptosis or retinal degeneration found.

Figure 5. tbx2b expression is reduced in lor p25bbtl mutant embryos. Sagittal sections of WT (A) and lorp25bbtl mutant (C) embryos at 28 hpf following in situ hybridization for tbx2b show labeling throughout the eye but the lack of expression in the ventral retina near the choroid fissure (CF) and lens (L). Transverse sections of labeled WT (B) and lorp25bbtl embryos (D) at 44 hpf. tbx2b expression is most intense at the dorsal retinal margin and cells adjacent to the developing ONL as well as the inner nuclear layer (INL) (optic nerve; ON). Note the dramatically reduced expression in the lorp25bbtl embryos. (E) Amplification of tbx2b by RT- PCR from RNA extracted from WT and lorp25bbtl embryos at 20 and 28 hpf demonstrates a reduction in the amount of tbx2b mRNA in the mutant.

Figure 6. Reduced expression of UV opsin in lorp25bbtl mutant larvae. Transverse retinal cryo- sections from WT (A-C, A’-C’) and lorp25bbtl (D-E, D’-F’) embryos at 5 dpf immunolabeled for rods (4C12-green) and the blue, UV, and green opsins (red). Nuclei were counterstained with DAPI (blue); dorsal is up. lorp25bbtl displays no labeling for UV cones in this particular section. Red opsin labeling was positive for lorp25bbtl (data not shown).

Confocal images of eyes enucleated from whole mount immunolabeled WT and mutant larvae confirmed the significant changes in the number of rods and UV cones (Fig. 7A,B,D). In WT larvae, the UV cones are regularly spaced across the entire retina with the few rods distributed across the central and dorsal regions (Fig. 7A). In lorp25bbtl mutant larvae, rods were evenly distributed across the entire retina and the number of UV cones was markedly reduced (Fig. 7B). The number and distribution of UV cones varied from mutant to mutant and between the two eyes from a single animal, and no cells were observed that labeled for both UV opsin and markers of rods simultaneously. Cell counts and spatial pattern analysis of rod labeling in lorp25bbtl mutants mirrored those typically observed for the UV cones in WT larvae. Immunolabeling of fbyc144 mutant larvae revealed a similar yet stronger phenotype (Fig. 7C), and trans-heterozygous larvae (lorp25bbtl/fbyc144) revealed an intermediate phenotype (Table I). Expression analysis by RT-PCR of opsins and photoreceptor arrestins in 5 dpf larvae confirmed the increase in expression of rod opsin and rod arrestin and the decrease in expression of the UV opsin in lorp25bbtl mutant larvae relative to controls (Fig. 7E-F). Based upon the genetic data, we propose that lorp25bbtl is a hypomorphic allele of tbx2b and together, fbyc144 and lorp25bbtl form an allelic series. Therefore, we shall refer to the lorp25bbtl allele as tbx2bp25bbtl. Histological analysis of the photoreceptor cell mosaic was performed in WT and tbx2bp25bbtl adults. In transverse sections (Fig. 8A and C), other than showing fewer UV-cones, tbx2bp25bbtl homozygous adults demonstrated no significant difference in laminar organization of the photoreceptors (Fig. 8A-B). Rods appeared equally abundant in WT and lor, most likely due to the persistent mitotic activity of the rod progenitors. Across the entire retina, the morphology of the rods and remaining UV cones was normal (Fig. 8C). There were no intermediate cell types such as the so-called “cods” or “rones” which occur in the Nr2e3 mutant mice (Corbo JC & Cepko CL, 2005). In tangential sections taken near the outer limiting membrane (OLM), the photoreceptor mosaic was distorted in tbx2bp25bbtl adults; the double cone nuclei were not in orderly rows, and the numerous rod inner segments were aggregated together as they passed through the OLM (data not shown). However, more distal sections through the level of the blue cone inner segments and remaining UV cone outer segments revealed that the alternating rows of single and double cones were maintained, and the occasional UV-cone alternated in rows with the blue cones (Fig. 8D). Therefore, the most plausible explanation for the disruption of the mosaic near the OLM is that the physical absence of the UV-cones led to

Figure 7. Increased rod number and fewer UV cones in lorp25bbtl and fbyc144 mutants. (A-C) Confocal images of eyes from 5 dpf WT (A), lorp25bbtl (B), and fbyc144 (C) larvae, immunolabeled for UV opsin (green) and rods (red). Eyes from lorp25bbtl and fbyc144 mutant larvae demonstrate a dramatic deficit in UV cones with fbyc144 displaying a more severe phenotype; in this particular sample, no UV cones were detected. (D) Graph showing the average number of rods (red) and UV cones (green) per unit area quantified from confocal images of lorp25bbtl mutant and WT retinas (average + SD). (E-F) Expression analysis of opsins (E) and arrestins (F) by RT-PCR from RNA extracted from 5 dpf WT and lorp25bbtl larvae. The RT-PCR product for UV opsin was reduced and products for rod opsin and rod arrestin were increased in lorp25bbtl (red boxes).

Table 1. Number of UV cones and rods in WT and lorp25bbtl mutant retinas. Genotype UV conesa Rodsa +/+; lorp25bbtl /+ 120.5 ± 25.6 17.8 ±7.3 lorp25bbtl 16.6 ± 11.2 99 ± 10.2 lorp25bbtl/ fbyc144 7.3 ± 2.8 109.3 ± 12.4 fbyc144 0 n.db a Reported as the average number of cells/3500 m2 ± SD b n.d., not determined

Figure 8. Maintenance of the photoreceptor mosaic in tbx2bp25bbtl mutant adults. Transverse (A and C) and tangential (B and D) histological sections through the ONL from WT and tbx2bp25bbtl adult animals (rods are GFP-positive, green), immunolabeled for UV opsin (red), and counterstained with DAPI (blue). (A and C) Tiering of the rod and cone photoreceptor cells is maintained although the UV cones (asterisks in A & C) in the tbx2bp25bbtl retinas are diminished in number and appear to have a greater width than in WT retinas. The approximate plane of the sections in B and D are indicated (arrows in A and C). (B) Immunolabeling of tangential sections for the UV opsin reveals the photoreceptor cell mosaic composed of rows of UV cones and blue cones (arrowheads). (D) In tbx2bp25bbtl the regular arrangement of the rows of blue cones (gaps in labeling; arrowheads) and occasional UV cones are maintained although the width of the cones is greater and there is some distortion of the row mosaic.

31 a distortion of the orderly packing of the remaining photoreceptors. Numerous soluble factors have been implicated in the differentiation of rods and cones (Ng L et al., 2001; Levine EM et al., 2000), yet as a transcription factor, we would predict that tbx2b functions cell-autonomously in photoreceptor cell specification. To test this hypothesis, we generated genetic chimeras between WT and tbx2bp25bbtl mutant embryos (Link BA et al., 2000). Cells from WT blastula stage embryos (donors) injected with rhodamine-dextran were transplanted into age-matched tbx2bp25bbtl hosts carrying the XOPS-GFP transgene (Fadool JM, 2003). The resulting chimeras displayed retinas with a mixture of donor WT cells amongst regions of mutant cells with GFP-positive rods. Immunolabeling for UV opsin and rhodopsin demonstrated that the donor-derived WT cells (red) often colabeled for UV opsin, but few colabeled for rod opsin (Fig. 9A). In contrast, among the neighboring mutant cells, UV opsin expression was absent and GFP-positive rods were abundant (Fig. 9A). In 4 mutant retinas, cell counts showed of the 113 WT donor cells located in the ONL, 44 cells (39%) colabeled for UV opsin and only 9 (8%) for rod opsin. In reciprocal transplants, out of 148 tbx2bp25bbtl mutant donor cells, 5 cells (3.4%) colabeled for UV opsin and 65 cells (44%) colabeled for rod opsin (Fig. 9B), consistent with a cell-autonomous role in regulating photoreceptor cell fate. Nr2e3, an early marker and key regulator of rod differentiation in most vertebrates, is transiently expressed in all presumptive photoreceptors in the zebrafish, then, prior to the onset of opsin expression, becomes restricted to cells of the rod lineage (Chen J et al., 2005; Morris AC et al., 2008). As such, we would anticipate that in tbx2bp25bbtl mutant larvae, Nr2e3 expression would persist in the population of progenitors trans-fated to become rods. Immunofluorescent images of WT retinas showed that at 2 dpf, prior to genesis of the ONL, cells in the central retina and near the future ONL expressed Nr2e3 (Fig. 10A). By 3 dpf, almost all of the Nr2e3 labeling was restricted to the ONL, and as the first rods started developing in the ventral retina, colocalization of nuclear labeling for Nr2e3 and rod labeling was detected (Fig. 10B). As previously reported (Chen J et al., 2005), by 4 dpf the expression of Nr2e3 was down-regulated in the presumptive cones, and became restricted to cells sporadically distributed across the ONL that colabeled for rod opsin (Fig. 10C). Near the retinal margin, individual cells expressing Nr2e3 and not colabeled for the rod marker can be observed. In tbx2bp25bbtl mutants, Nr2e3 expression persisted in many cells across the ONL most of which colabeled for rod markers (Fig. 10D). These data suggest that the reduction or absence of tbx2b

Figure 9. tbx2bp25bbtl acts cell-autonomously. Genetic chimeras were generated by blastula transplantation and allowed to develop to 80 hpf. Donor cells were labeled by rhodamine- dextran (red); tbx2bp25bbtl deficient rods expressed the XOPS-GFP transgene. Chimeras were whole mount immunolabeled for UV opsin (A and B, blue) and for rods (A, green). (A and B) Stacks of confocal images taken tangential to the photoreceptor cell layer and in the orthogonal plane (insets). (A) WT donor cells (red) located in the ONL of tbx2bp25bbtl hosts frequently colabel for the UV opsin (inset). (B) tbx2bp25bbtl mutant donor cells (red) in the ONL of WT hosts frequently differentiate as GFP-positive rods and rarely label for the UV opsin (inset shows dextran/GFP labeled rods neighboring UV opsin-positive/dextran negative cone outer segments).

Figure 10. Persistent Nr2e3 expression in lor p25bbtl. (A-D) Transverse cryo-sections from 2 (A), 3 (B) and 4 dpf (C and D) WT and tbx2bp25bbtl embryos immunolabeled for rods (4C12, green) and Nr2e3 (red), and counterstained with DAPI (blue); dorsal is up. (A) At 2 dpf labeling for Nr2e3 is observed in the inner and outer retina prior to differentiation of photoreceptors. (B) At 3 dpf, Nr2e3 labeling is restricted to developing photoreceptors in the ONL. In the ventral retina Nr2e3 nuclear labeling co-localizes with immunolabeling for rods (inset). (C-D) At 4 dpf, expression of Nr2e3 persists in differentiating rods in WT and tbx2bp25bbtl retinas.

expression leads to the persistent expression of Nr2e3 in a subset of cells and their subsequent differentiation as rods. tbx5, another member of the T-box family, is also expressed in the developing zebrafish eye, in a more restricted domain of the dorsal retina that overlaps tbx2b expression (Ruvinsky I et al., 2000). Chi NC et al. (2008), while studying heart development in zebrafish, demonstrated that the tbx2b enhancer could drive the expression of a fluorescent reporter that almost recapitulates the tbx2b endogenous expression in a wild-type embryo. Moreover, when a T-box response element (presumably for tbx5 binding) inside the tbx2b enhancer was mutated, no fluorescent expression was detected in the eyes, but heart expression was unaffected. These data suggested that tbx5 could be regulating tbx2b expression in the larval zebrafish eye, and we then reasoned that a tbx5 mutant could display the “lots of rods” phenotype. To address this, we studied the zebrafish mutant heartstring (hst), which is caused by a premature stop codon at amino acid 316 of tbx5 (Garrity DM et al., 2002) and produces severe heart defects, absence of pectoral fins, and death by 6-7 dpf. hst mutants and wild-type sibling embryos were fixed at 4.5 dpf, and immunolabeled for rods and UV cones. We found that tbx5-/- mutants did not show the “lots of rods” phenotype: in this mutant, rods and UV cones showed a WT distribution. The explanation may be that Chi NC et al. (2008) used a small portion of the tbx2b promoter, but other upstream cis- elements could be regulating the retinal expression of tbx2b. Alternatively, a T-box transcription factor other than tbx5 might be cooperatively regulating tbx2b expression in the retina.

2.4 Discussion Taking advantage of the precisely defined photoreceptor mosaic in zebrafish, the data show that lorp25bbtl mutants exhibit an increase in the number of rods and a dramatic decrease in the number of UV cones due to a change in cell fate. We present genetic evidence that tbx2b is a novel regulator of photoreceptor cell fate in zebrafish and is essential for the proper specification of the UV cone. Most striking is that the function of tbx2b during photoreceptor development is opposite to that of Nrl (Mears AJ et al., 2001). First, our data significantly add to the most widely held model of neuronal specification during retinal development. The current model proposes that multipotent retinal progenitor cells pass through a series of competence states, such that at a specific time, cells can adopt only one

35 or a few particular cell fates in response to extrinsic signals or internal cues (Cepko CL et al., 1996). Consistent with this model, early- and late-born photoreceptor cell progenitors express the transcription factors Otx, Crx and NeuroD (Freud CL et al., 1997; Furukawa T et al., 1997; Nishida A et al., 2003; Morrow EM et al., 1999). Yet, in early-born photoreceptor cell precursors, thyroid hormone receptor beta regulates the expression of middle wavelength- sensitive opsin versus S-opsin (Ng L et al., 2001), and in later-born precursors, Nrl acts as a molecular switch to drive expression of rod genes and repress the S-cone fate (Mears AJ et al., 2001; Akimoto M et al., 2006). Thus, the S-cone was positioned as the default photoreceptor. Our data are the first to identify a pathway essential for specification of the UV cone fate, the likely homologue of the S-cone in mammals. Previous studies have described Tbx2 as a transcriptional repressor (Christoffels VM et al., 2004; Harrelson Z et al., 2004; Jacobs JJ et al., 2000). Based upon these observations, we propose a mechanism by which photoreceptor cell diversity is maintained by the expression of discrete genes which act to suppress alternative cell fates within precursors that share a common molecular signature. What can be concluded about this strikingly conserved relationship between SWS1-cone precursors and rod progenitors in teleosts and mammals? As noted, the phenotype observed by mutation of tbx2b in zebrafish is directly opposite to the phenotype elicited by loss of Nrl function in mammals, suggesting a conserved ontology. The evidence suggests that tbx2 orthologues may also play a role in photoreceptor identity in mammals. Consistent with the genetic data, the dorsal-ventral pattern of expression of Tbx2 in the retina is remarkably conserved across vertebrates, suggesting a conservation of function (Rubinsky I et al., 2000; Gross JM & Dowling JE, 2005; Gibson-Brown JJ et al., 1998; Hayata T et al., 1999; Sowden JC et al., 2001). Additionally, a search for genetic modifiers of the rd7 mouse uncovered several loci that suppress the retinal degeneration and restore the normal photoreceptor number (Haider NB et al., 2008). One of these mapped to chromosome 11, in close proximity to the Tbx2 locus. Moreover, as part of an in silico study of human promoter sequences, TBX2 was identified as a potential target for the photoreceptor-specific transcription factors NRL, NR2E3 and CRX (Qian J et al., 2005). Unfortunately, targeted mutagenesis of Tbx2 in mice causes severe cardiac defects (Harrelson Z et al., 2004), and mutant embryos die between embryonic day 10.5 and 14.5, preventing an analysis of photoreceptor cell fate.

The dorsal-ventral gradient of tbx2b expression and its conspicuous absence from the ventral retina, an area of precocious rod genesis in zebrafish, suggests that the function of tbx2b is to repress the rod cell fate. Consistent with this hypothesis, the reduction or absence of tbx2b expression in genetic mutants underlies the precocious differentiation of rods across the entire retina. The expression data suggest that the timing of tbx2b action precedes photoreceptor differentiation. tbx2b mRNA is expressed in the neuroepithelium and at the retinal margin prior to formation of the ONL yet is down-regulated in photoreceptors. Similarly, we report that nr2e3 expression in observed in cells of the central retina prior to formation of the ONL, at the retinal margin, and is expressed by mitotic photoreceptor progenitors (Morris AC et al., 2008). In addition, others have shown that Crx and NeuroD are also expressed in a comparable pattern (Morrow EM et al., 1999; Nelson SM et al., 2008). Thus in a rapidly developing vertebrate such as the zebrafish, photoreceptor specification may occur prior to or coincident with cell cycle exit and laminar positioning. Interestingly, prior work suggested that tbx2b is essential for neuronal differentiation in the dorsal retina (Gross JM & Dowling JE, 2005), but we did not find evidence for a similar defect in homozygous tbx2bp25bbtl or fbyc144 mutant larvae. However, a second zebrafish orthologue of mammalian tbx2, tbx2a (also called tbx2b-like), shares 78% identity with tbx2b and shows a similar pattern of expression (Ribeiro I et al., 2007). The previously reported MO experiments likely revealed a role for tbx2 orthologues during the earlier stages of neurogenesis. Also from studies of zebrafish heart development, tbx5 has been proposed as an upstream regulator for tbx2b expression in the retina (Chi NC et al., 2008). We could not find evidence of such a regulation in photoreceptor development as tbx5a -/- (heartstrings) larvae did not displayed the “lots-of-rods” phenotype, demonstrating a normal distribution of rods and UV cones. Recently a second orthologue for tbx5 was identified in zebrafish, tbx5b (Albalat R et al., 2010), presumably a result of the teleost ancestral genome duplication. The expression data demonstrated overlapping expression of the two paralogues tbx5a and tbx5b during eye and heart development, which could explain some functional compensation of the tbx5a-/- by tbx5b. In summary, our unique finding for tbx2b in zebrafish is one of only a small collection of studies in vertebrates, to show a specific role for a transcription factor in photoreceptor-cell subtype specification. The phenotype also suggests a highly conserved relationship between rod progenitors and the UV-cone precursors in teleost and mammals. It is anticipated that as

37 genetic screens for alterations in the teleost retinal mosaic continue, additional genes that regulate vertebrate photoreceptor subtype specification will be isolated and allow us to test specific hypotheses of the mechanisms of cell fate determination in the nervous system.

CHAPTER THREE

TRANSCRIPTIONAL REGULATION OF PHOTORECEPTOR GENES

3.1 Introduction Photoreceptors are responsible for phototransduction, the first step in a cascade that allows constructing visual images. The vertebrate retina contains two types of photoreceptors; rods which mediate dim light vision and cones that mediate color vision. Cones are further subdivided based on wave-length sensitivity and opsin expression. (Dowling JE, 1987). The specification of the diverse photoreceptor subtypes during development requires precisely regulated gene expression. Many individual components of the photoreceptor gene regulatory network has been identified, largely from mutations that cause rod and cone degeneration, or developmental changes in cell fate in diverse organisms (reviewed by Hennig AK et al., 2008 and Swaroop A et al., 2010). Transcription factors of the photoreceptor gene regulatory network directly bind to and regulate photoreceptor specific gene expression (reviewed by Hennig AK et al., 2008 and Swaroop A et al., 2010). Expression of the phototransduction genes is tightly regulated at the level of transcription (Treisman JE et al., 1988; Hennig AK et al., 2008); of those, rhodopsin transcriptional regulation has been the most extensively studied. The binding and synergistic activation of the rhodopsin promoter by the transcription factors Crx and Nrl have been well documented in several animal models (Furukawa T et al., 1997; Swaroop A et al., 1992; Rehemtulla A et al., 1996; Chen S et al., 1997; Cheng H et al., 2004; Whitaker SL & Knox BE, 2004; Peng GH et al., 2005; Liu Y et al., 2001). Corresponding DNA cis-elements have been identified in the proximal rhodopsin promoter, such as NRL Response Element (NRE; binding element for NRL), Ret4 and Bat1 (two binding elements for Crx) (Chen S et al., 1997; Rehemtulla A et al., 1996; Kumar R et al., 1996). Robust connection between transcriptional regulation and photoreceptor subtype specification has been demonstrated in the Nrl knock out mouse that resulted in the transformation of rod precursors into S cones (Mears AJ et al., 2001; Akimoto M et al., 2006). Additionally, mutations in Nr2e3, a downstream target of Nrl, also led

39 to a similar phenotype in humans (Enhanced S-cone syndrome) and in the rd7 mouse (retinal degeneration 7) (Haider NB et al., 2000; Akhmedov NB et al., 2000). Largely driven by these findings, the mammalian S opsin (SWS1 opsin) promoter has been a focus of recent investigation. Similar to the rhodopsin promoter, studies have demonstrated that Crx acts as a transcriptional activator of the SWS1 opsin in a concentration-dependent manner (Peng GH et al., 2005; Srinivas M et al., 2006). Additionally, synergistic activation of the SWS1 opsin by Crx and the retinoic-related orphan receptor (Ror) has been described (Liu H et al., 2008; Srinivas M et al., 2006). On the other hand, when present, the orphan receptor Nr2e3 represses Crx-mediated SWS1 transcription (Peng GH et al., 2005). Based on the available genetic and molecular data, a proposed model for mammalian photoreceptor cell fate determination has placed the S cone as the default phenotype unless additional regulatory signals direct the photoreceptor precursor to acquire another identity (Swaroop A et al., 2010). Zebrafish possesses a UV opsin that most likely constitutes the homologue of the S opsin present in mammals (Shi Y & Yokoyama S, 2003). The 4.8 kb fragment of the zebrafish SWS1 opsin promoter directs expression of a GFP reporter specifically to the zebrafish UV cones, and this activity required both distal and proximal sequences (Luo W et al., 2004). In a similar study expression of GFP driven by the 5.5-kb upstream region of the SWS1 opsin proceeded in the same spatio-temporal pattern as the endogenous gene in transgenic zebrafish (Takechi M et al., 2003). Experimental evidence supports conservation of photoreceptor gene cis- and trans- regulatory elements among human, bovine, mouse, amphibian, and fish. Consequently, reporter assays for photoreceptor genes often use interchangeably transcriptional regulators and cis- elements from different organisms (McIlvain VA & Knox BE, 2007; Whitaker SL & Knox BE, 2004; Fadool JM, 2003; Batni S et al., 1996; Gouras P et al., 1994; Zhang T et al., 2003). For example, the Xenopus rhodopsin promoter has been previously used to generate transgenic zebrafish (Fadool JM, 2003), with reporter gene expression nearly identical to the endogenous rhodopsin gene. Additionally, alignment of Xenopus, zebrafish and Fugu pufferfish proximal rhodopsin promoters revealed conserved regulatory motifs and similar to other vertebrates (Zhang T et al., 2003). Moreover, the Fugu rhodopsin promoter specifically directed reporter expression to rods in transgenic tadpoles and in transgenic mice, although much weaker (Zhang T et al., 2003). Similarly, the two human phototransduction genes phosphodiesterase and

40 inter-photoreceptor retinoid binding protein proximal promoters drove rod and photoreceptor specific expression, respectively, in Xenopus (Lerner LE et al., 2002; Boatright JH et al., 2001). These data validate the idea that basic mechanisms of photoreceptor cell specific expression are conserved in fish and amphibians, and to a great extent also in mammals. lorp25bbtl zebrafish mutant displays an increased number of rods at the expense of UV cones, due to a cell fate change. We have demonstrated that the transcription factor tbx2b is the gene affected in lorp25bbtl (Alvarez-Delfin K et al., 2009). Tbx2 orthologues commonly act as transcriptional repressors through TBE binding in target promoters (Christoffels VM et al., 2004; Habets PE et al., 2001); although a weak activation domain has been described in the mouse Tbx2 (Paxton C et al., 2002). I hypothesized that tbx2b promote the UV cone fate by directly repressing rod-specific genes, such as rhodopsin in UV cone precursors or by activating the SWS1 opsin promoter. The direct role for tbx2b in regulating photoreceptor gene expression was tested in promoter reporter assays in HEK293T cells. I demonstrate that tbx2b acts a potent repressor of the rhodopsin promoter, most likely independently of its DNA binding properties, while modest regulatory effects were detected for the SWS1 opsin promoter.

3.2 Material and methods Plasmids. 2.3 kb containing tbx2b ORF was PCR-amplified and cloned into pCR2.1- TOPO, and the KpnI-XhoI fragment was subcloned into of the pCDNA3.1+ expression vector. tbx2b-RERE was generated by site-directed mutagenesis (Stratagene) in which the conserved arginines 121 and 122 in the T-box from tbx2b-pCDNA3.1+ were substituted for glutamic acid; the base changes were confirmed by sequencing. Human Crx (h-CRX) and Xenopus laevis Nrl (xl-Nrl) cloned in pCS2+ vector, and the Xenopus rhodopsin promoter constructs were provided by Dr. Barry Knox (Mani SS et al., 2001; Whitaker SL & Knox BE, 2004; McIlvain VA & Knox BE, 2007). Rhod503, Rhod1300 and Rhod5500 consisted in the following rhodopsin promoter fragments: -503/+41; -1300/+41; -5500/+41, respectively cloned in the pGL3 basic vector (Promega, Madison WI). To generate the SWS1-Luc vector, a 4.8 kb BamHI fragment of the zebrafish SWS1 promoter was subcloned from the SWS1-eEGFP1 vector (Takechi M et al., 2003) into the BglII site of the pGL3 basic (Promega, Madison WI). six7 cloned in the pCS2+ vector was provided by Dr. L. Solnica-Krezel (Inbal A et al., 2007). To generate the vector CMV-Luc, a MluI-HindIII fragment containing the CMV promoter was subcloned from

41 pCDNA3.1+ into the pGL3 basic vector (Promega, Madison WI). The pRL-TK vector (Promega, Madison WI) expressing Renilla luciferase was used as internal transfection control. Cell culture. Human embryonic kidney cells (HEK293T) were cultured in HyClone DMEM/High glucose medium (Gibco-Invitrogen, Life Technologies, Carlsbad CA), supplemented with 10% fetal bovine serum, 2 mM L-glutamine and antibiotics and kept at 37°C and 6% CO2 (Liang Q et al., 2011). Cells were transfected using OptiMEM reduced serum medium (Gibco-Invitrogen, Life Technologies, Carlsbad CA). Luciferase Reporter Assay. Luciferase assays were performed as previously described (Zhu FX et al., 2002). Briefly, subconfluent HEK293T cells grown in 24-well plates were transfected with DNA vectors using Lipofectamine 2000 according to manufacturer protocol (Invitrogen, Carlsbad CA). The amounts of plasmids used were: 100 ng of each promoter construct, increasing amounts of tbx2b or tbx2b-RERE (0-100 ng), 100 ng of each of the activators xl-Nrl and/or h-CRX, and 10 ng of the Renilla luciferase pRL-TK vector as internal control. The correspondent empty plasmid was added to samples to equalize the total amount of DNA in each transfection reaction. Luciferase activity was detected 24 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega, Madison WI) according to manufacturer protocol. Relative luciferase activity is the ratio between the Firefly luciferase and the Renilla luciferase values. Results were presented as fold change relative to the samples without activation.

3.3 Results In zebrafish, a hypomorphic allele of tbx2b that reduces expression in lorp25bbtl mutant produced an increase in the number of rods and a reduction in the number of UV cones (Alvarez-Delfin K et al., 2009). To test the physiological relevance of tbx2b on the rod fate specification, I measured the ability of tbx2b to regulate a luciferase reporter driven by the rhodopsin promoter in HEK293T cells. tbx2b repression activity was evaluated on the Rhod5500 (-5500/+41) Xenopus rhodopsin promoter activated with the transcription factors Crx and Nrl. As previously shown, Nrl or Crx moderately activated the rhodopsin promoter (13- fold and 9-fold, respectively), whereas the combination synergistically activated rhodopsin with a 200-fold increase in the reporter gene expression (Fig. 11). When a tbx2b expression vector was transfected in combination with Crx and Nrl, rhodopsin promoter activity was strongly

42 repressed in a dose-dependent fashion (Fig. 11). No repression was observed with the CMV promoter (data not shown). Activation of two 5’ deletion versions of the rhodopsin promoter, Rhod503 (-503/+41) and Rhod1300 (-1300/+41) by Crx and Nrl were tested, and found to be equivalent, but less potent than the 5.5 Kb promoter fragment. However, tbx2b equally repressed Rhod503 and Rhod1300, in a dose-dependent mode (Fig. 12). The T-box is the highly conserved DNA binding domain in T-box proteins (Papaioannou VE, 2001). Conserved arginines in the T-box domain have been demonstrated to be essential for Tbx2 DNA binding properties (Habets PE et al., 2001; Christoffels VM et al., 2004). Substitution of arginine (R) 122 and 123 for glutamic acid (E) in human Tbx2 resulted in a Tbx2-RERE mutant unable to bind a TBE probe in electrophoresis mobility shifting assays (EMSA) or to repress the heart-specific promoter ANF (atrial natriuretic factor) in Cos-7 cells (Habets PE et al., 2001). Similarly, the Tbx2-RERE mutant was not able to repress previously described Tbx2 targets, such as connexin 40 and connexin 43 promoters (Christoffels VM et al., 2004) in Cos-7 and HEK cells. Zebrafish tbx2b contains two homologous arginines in positions 121 and 122 in the T-box domain. A zebrafish tbx2b-RERE mutant was similarly generated, and then tested in the rhodopsin promoter reporter assay. Interestingly, tbx2b-mediated repression of rhodopsin was demonstrated to be independent of its DNA binding properties, as the tbx2b-RERE mutant displayed similar levels of repression as the WT tbx2b (data not shown). The data suggest that repression is maybe due to direct interaction between Crx and or Nrl and tbx2b. An additional possibility to explain the cell fate change in the lorp25bbtl mutant is that tbx2b promotes the UV cone fate by activation of UV cone specific genes, such as the SWS1 opsin. Previous study has demonstrated that the 5.5 kb upstream region of the SWS1 opsin gene is sufficient to regulate expression of the endogenous gene in transgenic zebrafish (Takechi M et al., 2003). From the vector used to generate that transgenic line, a 4.8 kb fragment (lacking 700 bp from the 5’ region), was subcloned into the pGL3 basic vector. First, I tested if mammalian Crx was able to activate the zebrafish SWS1 opsin, as it has not been reported. I found that Crx modestly activates SWS1 promoter (Fig. 13). When tbx2b was paired with Crx a mild two-fold repression of the SWS1 activity was observed by all three tbx2b doses used (Fig. 13), opposite to the proposed activation hypothesis. In agreement with previous studies in

Figure 11. tbx2b represses rhodopsin promoter activity. HEK293T cells were transiently transfected with 100 ng of a luciferase reporter vector carrying -5500/+41 bp of the Xenopus rhodopsin promoter (Rho5500), and 0, 10, 50 or 100 ng of the expression vector for zebrafish tbx2b. No activators, 100 ng of each activator xl-Nrl or h-CRX, or the combination of both activators were used. The results are presented as fold change (average + SD, n=3) relative to the samples without activator.

tbx2b 0ng tbx2b 10ng tbx2b 100ng Figure 12. tbx2b represses several versions of the rhodopsin promoter. HEK293T cells were transiently transfected with 100 ng of a luciferase reporter vector carrying one of the three versions of the Xenopus rhodopsin promoter: Rhod503, Rhod1300 or Rhod5500, and 0, 10, 50 or 100 ng of the expression vector for zebrafish tbx2b. No inducer or 100 ng of both activators xl-Nrl and h-CRX were used. The results are presented as fold change (average + SD, n=3) relative to the samples without activator.

4.5

3.5

3 No activator 2.5 h-Crx 2

1.5 Fold change 1

0.5

0 tbx2b 0ng tbx2b 10ng tbx2b 50ng tbx2b 100ng

Figure 13. tbx2b demonstrated modest repression on the SWS1 promoter activity. HEK293T cells were transiently transfected with 100 ng of a luciferase reporter vector carrying 4.8 kb of the zebrafish SWS1 promoter and 0, 10, 50 or 100 ng of the expression vector for zebrafish tbx2b. No activator or 100 ng of h-CRX was used. The results are presented as fold change (average of n=2 with similar results) relative to the samples without activator.

46 mammals (Ng L et al., 2001; Yanagi Y et al., 2002), we observed that the nuclear receptor h- Nr2e3 inhibited Crx-mediated activation of the SWS1 gene (data not shown).

3.4 Discussion Based on our previous characterization of lorp25bbtl mutant line we proposed that tbx2b promoted the UV cone fate by repressing rod-specific genes in cone precursors during development (Alvarez-Delfin K et al., 2009). Our data confirmed that tbx2b acts as a robust repressor of Crx and Nrl activation of the rhodopsin promoter using an in vitro luciferase reporter assay. The repression was specific as the CMV promoter did not evoke such effect. As tbx2b and Nrl mutants in zebrafish and mouse, respectively have demonstrated opposite photoreceptor phenotypes, it is not surprising that their molecular function is also reciprocal. Nrl is a potent activator of rhodopsin and other rod-specific genes, and acts synergistically with Crx and Nr2e3 (Chen S et al., 1997; Mitton KP et al., 2000). Additionally, Nr2e3, a downstream target of Nrl, directly represses cone-specific genes (Chen J et al., 2005; Peng GH et al., 2005). Thus my data suggest that one potential role of tbx2b in photoreceptor determination is to repress rod-specific gene expression. Interestingly, tbx2b caused repression on the SWS1 promoter. One possibility is that another co-factor is required to partner with tbx2b and activate SWS1 or that the SWS1 promoter region used could be missing cis- elements that are tbx2b responsive. Our results do not fully contradict the proposed model of S cones being the default fate among photoreceptors during development (Swaroop A et al., 2010), but suggest that additional factors may be involved. TBE is the cis- element recognized by T-box proteins in target promoters. Notably, in our experimental conditions, tbx2b transcriptional repression of rhodopsin has demonstrated to be independent of its DNA binding capacity. tbx2b-RERE, a mutant form with substitutions in critical residues that impair the DNA binding domain in mammalian Tbx2 (Habets PE et al., 2001; Christoffels VM et al., 2004) was able to repress rhodopsin as efficiently as the WT protein. Additionally, inspection of the Xenopus rhodopsin promoter sequence did not detect putative T-box binding elements (data not shown). To our knowledge no DNA-binding independent transcriptional regulation has been described before for Tbx2 or other T-box factor. Based on our results, we propose that tbx2b interferes with the Crx and Nrl transcriptional activation of rhodopsin most likely by protein-protein interaction; although, the DNA binding

47 properties of the zebrafish tbx2b-RERE we generated should be further tested in a previously identified tbx2b target promoter. Interaction between T-box and homeobox protein has been previously described in heart, where Tbx2 and Tbx5 independently associate with the homeobox Nkx2.5 to form a transcriptional repressor and activator complex, respectively (Habets PE et al., 2001). Although in that case, in addition of the protein-protein interaction, DNA cis- elements are bound by Tbx2 and Tbx5 in the target genes. In the retina, interaction between tbx2b and Crx could provide a mechanism to block rhodopsin transcription. Our results demonstrated that Crx and Nrl activate the Rhod5500 promoter more strongly than the shorter versions, Rhod1300 and Rhod503 (Fig. 12). This finding slightly differs with results by Mani SS et al., (2001) where luciferase activity driven by those same promoters were measured in transfected whole Xenopus embryos. In that study, transfected embryos with Rhod5500 resulted in 35% lower luciferase activity compared with Rhod503 and Rhod1300 promoters. This discrepancy is most likely due to the use of whole embryos versus our in vitro experimental conditions. Although equivalent to our results, the two shorter promoters Rhod503 and Rhod1300 demonstrated comparable luciferase activity (Mani SS et al., 2001). In the developing zebrafish retina, tbx2b is expressed in the neural epithelium in a conserved dorsal-ventral gradient, but after the embryonic photoreceptor genesis is completed, tbx2b expression is confined to the CMZ (Rubinsky I et al., 2000; Gross JM & Dowling JE, 2005; Alvarez-Delfin K et al., 2009), where all new retinal cells, except for the rods, are continually added to the growing retina. Consequently, tbx2b could be expressed in the nascent cone precursors in the CMZ to repress the rod-specific genetic program. Previously, the member of the Sp/Krüppel-like Factor family of zinc-finger containing transcription factors, KLF15 was identified as a rhodopsin and interphotoreceptor retinoid-binding protein repressor (Otteson DC et al., 2004; 2005). Since KLF15 was not expressed in the murine photoreceptors, it was proposed that it could be repressing photoreceptor-specific gene expression in retinal non-photoreceptor cells (Otteson DC et al., 2004; 2005). Therefore, tbx2b would be the first rhodopsin repressor recognized to act in photoreceptor cells. Further studies are needed to confirm the role of tbx2b in photoreceptor fate specification. First, the specific retinal cells expressing tbx2b need to be identified; a double in situ hybridization with tbx2b and neuroD (an early cone precursor marker at the CMZ

(Ochocinska MJ & Hitchcock PF, 2007)) will address the hypothesis that tbx2b is expressed in cone precursors to repress rod-specific genes. Second, to investigate the tbx2b repressive mechanism of rhodopsin, luciferase reporter assay could be performed with a tbx2b mutant form lacking the repression domain. Additionally, in vitro and in vivo interaction assays between tbx2b, Crx and Nrl could be evaluated, as well as ChIP. Third, to evaluate the tbx2b capacity to repress transcription of other rod-specific genes, such as arrestin and phosphodiesterase. Finally, it will be interesting to test if mammalian Tbx2 orthologues share this novel function that I have proposed for tbx2b in zebrafish.

CHAPTER FOUR

THE TRANSCRIPTION FACTOR SIX7 REGULATES ROD NUMBER DURING ZEBRAFISH RETINAL DEVELOPMENT

4.1 Introduction Photoreceptor cells are responsible for light detection and image formation in the retina. Rods mediate dim light vision and cones respond to bright light and mediate color vision. Development and maintenance of the rods and cones are subjects of intensive study, as numerous inherited diseases of the photoreceptors cause vision impairment or blindness in humans, such as Leber congenital amaurosis, retinitis pigmentosa and macular degeneration (http://www.sph.uth.tmc.edu/Retnet/). Numerous secreted factors and transcriptional regulators that control photoreceptor cell fate determination and differentiation have been identified (reviewed by Reh TA & Cagan RL, 1994; Hennig AK et al., 2008; Swaroop A et al., 2010) through studies of mutations causing visual deficiencies in human and mice, or by homology to genes identified in Drosophila. The Six (sine oculis homeobox) family of transcription factors, initially discovered in Drosophila, have demonstrated pivotal developmental roles in a wide range of species (reviewed by Kawakami K et al., 2000 and Kumar JP, 2009). Drosophila possesses three Six genes, two of them, sine oculis and optix are required for proper development of the compound eye; D-six4 the third member, functions in muscle and gonad development. Based on molecular phylogenetics, three major Six subfamilies have been identified: Six1/2 (sine oculis), Six3/6 (optix) and Six4/5 (D-six4), each one containing one of the fly genes and their vertebrate orthologues. Six3 and Six6 are two highly related members of the Six3/6 subfamily with prominent functions in early forebrain and eye development in vertebrates. Over-expression of either protein produces enlarged eyes and forebrain or ectopic retinal tissue in several model organisms (Oliver G et al., 1995; 1996; Loosli F et al., 1999; Kobayashi M et al., 1998; Bernier G et al., 2000; Zuber ME et al., 1999; Toy J et al., 1998; Lopez-Rios J et al., 2003). Six3 null alleles significantly affect proper forebrain and eye specification in humans, mice and zebrafish (Carl M et al., 2002; Inbal A et al., 2007), whereas the Six6-null mice display pituitary defects

50 and retina hypoplasia often with impairment of the optic chiasma and optic nerve (Li X et al., 2002). Mutations in human SIX3 cause holoprosencephaly (Geng X et al., 2008; Wallis DE et al., 1999), the most common forebrain malformation affecting brain midline formation, and mutations in SIX6 has been linked to bilateral anophthalmia (Gallardo ME et al., 1999; 2004). Both genes act as transcriptional repressors through interaction with members of the Groucho family of co-repressors (Lopez-Rios J et al., 2003; Kobayashi M et al., 2001; Zhu CC et al., 2002), but functions as activator have also been described (Liu W et al., 2006; Jeong Y et al., 2008). Due to essential functions in early forebrain patterning and eye development, few genetic studies have addressed later functions of the Six3/6 genes. Zhu CC et al. (2002) documented for the first time Six3 expression in the photoreceptor layer of the adult mouse retina. Subsequently, Six3’s role in retinal differentiation was evaluated by in vivo lineage analysis using a replication incompetent retrovirus in newborn rat retinas. Six3 over-expression affected photoreceptor differentiation, as well as the ratio of retinal cell types within each clone (Zhu CC et al., 2002). Over-expression of a mutated version of Six3 carrying a substitution in a conserved phenylalanine at position 88 for glutamic acid (F88E) that abrogates Six3 interaction with the co-repressor Groucho, increased the proportion of clones forming only rods and decreased the proportion of other cell types (Zhu CC et al., 2002). Subsequently, evidence corroborated Six3 expression in the adult mouse ONL, and in vitro, Six3 activated transcription of the rhodopsin promoter, alone and cooperatively with the well known activators Nrl and Crx (Manavathi B et al., 2007). Moreover, ChIP demonstrated Six3 recruitment to three consensus motifs in the proximal rhodopsin promoter, and mutations on those motifs abrogated the reporter activation by Six3 (Manavathi B et al., 2007). The authors proposed that in physiological conditions the repressor MTA1 (metastasis associated protein 1) negatively regulates the ability of Six3 to activate rhodopsin expression, presumably by repressing Six3 transcription (Manavathi B et al., 2007; Kumar R et al., 2010). In medaka fish, Six6, another Six3/6 subfamily member, was demonstrated to have NeuroD-dependent expression in the retina, but also a mutual and complex regulation loop that appears to control rhodopsin expression and amacrine cell specification (Conte I et al., 2010). Altogether, the available data suggest that a delicate balance of members of the Six3/6 protein family is able to influence photoreceptor development and cell fate in the vertebrate retina.

Zebrafish possesses an extended Six3/6 subfamily due to an ancestral genome duplication, with two orthologues for Six3 (a and b) and two more for Six6 (a and b) (Postlethwait J et al., 2004; http://zfin.org/). Interestingly and probably due to a separate duplication event, teleost possesses another Six3/6 orthologue, six7. six7 demonstrates 66-69% overall amino acid identity with other Six3/6 paralogues, reaching 95% of identity in the homeodomain, 77% for the Six domain, and a very divergent C-terminal portion of the protein (Seo HC et al., 1998b). six7 expression has been documented in the developing zebrafish forebrain and optic vesicles (Seo HC et al., 1998b), but the transcript expression was dramatically reduced at 14 hpf and was no longer detectable by 24 hpf, the latest stage tested (Seo HC et al., 1998b). Accordingly, an early function establishing the eye field in the fish has been demonstrated for six7 in conjunction with six3b, as the double six3bvu8/7vu87/six7 morphant lacked ocular tissue (Inbal A et al., 2007). Interestingly, in silico analysis of the six7 proximal promoter revealed binding sites for homeobox proteins, presumably Otx2, an important transcription factor in photoreceptor development (Drivenes O et al., 2000). Overall, little is known about the six7 mechanism of action in early eye determination and even less regarding later functions. The ljrp23ahub mutant was uncovered in a genetic screen for changes in rod patterning from chemically mutagenized zebrafish (Morris AC & Fadool JM, 2005; Alvarez-Delfin K et al., 2009). ljrp23ahub demonstrated a dramatic increase in the number of rods in the larval retina, and a small, but significant increase in apoptotic cell number in the inner retina, with no other evident morphologic changes. Linkage mapping identified the transcription factor six7 as the main candidate gene affected in ljrp23ahub. Antisense MO against six7 injected into WT embryos similarly resulted in an increased number of rods in the larval retina. Our results demonstrated the genetic evidence that a Six protein functions in vertebrate photoreceptor specification, by regulating the rod number in the zebrafish retina. Given the subfunctionalization of the duplicated genes in zebrafish this study raises the question of whether Six3 or Six6 share a similar role in non-teleost vertebrates where six7 orthologues do not exist.

4.2 Material and Methods Zebrafish Maintenance. Rearing, breeding, and staging of zebrafish (Danio rerio) were performed according to standard methods (Westerfield M, 1995). The ljrp23ahub mutant was isolated from a screen of ENU-mutagenized zebrafish immunolabeled for developing rods at 5- 6 dpf (Morris AC & Fadool JM, 2005). Mutagenesis was performed at the University of Pennsylvania as previously described (Dosch R et al., 2004). The transgenic zebrafish line XOPS-GFP (Fadool JM, 2003) and the lorp25bbtl line were previously described (Alvarez-Delfin K et al., 2009). The six3bvu87 mutant line was kindly provided by Dr. Solnica-Krezel (Inbal A et al., 2007). Homozygous fish for six3bvu87 or lorp25bbtl were pair-wise mated with homozygous ljrp23ahub and the progeny was raised to adulthood to be in-crossed, and the resulting embryos were fixed at 4 dpf and processed for whole-mount immunolabeling. To inhibit pigmentation, larvae used in immunolabeling or in situ hybridization experiments were treated with 0.003% 1- phenyl-2-thiourea at 18-22 hpf. Cloning and Sequencing. A 1,655 pb fragment including the six7 ORF and 5’ and 3’ UTR was amplified with the primers JMF474-JMF477 from WT and ljrp23ahub 48 hpf-embryo cDNA. PCR products were cloned into the PCR2.1-TOPO vector and sequenced. Embryo Injections. MO antisense oligonucleotide targeting the six7 5’UTR with the sequence 5’ CCAACGGCATTCCAGTGTGAGTAAC 3’ (Inbal A et al., 2007) was injected into WT, lorp25bbtl or ljrp23ahub embryos. six7 MO stock was prepared at 1.25 ng/nL and the indicated amounts of MO were injected. pCS2+six7 vector was kindly provided by Dr. Solnica- Krezel (Inbal A et al., 2007). Synthetic capped six7 mRNA was prepared using the mMESAGE mMACHINE Kit according to manufacturer (Ambion, Life Technologies, Carlsbad CA) from the pCS2+six7 vector linearized with NotI. six7 mRNA stock was prepared at 25 pg/uL and the indicated amounts were injected into WT or ljrp23ahub embryos. six7 MO or mRNA were injected into 1-2 cell stage embryos. RT-PCR. RNA was isolated with TRIzol (Life Technologies, Carlsbad CA), and cDNA was synthesized using oligo-dT primer. Actin was amplified in all samples as positive control and to ensure similar amount of cDNA template per sample. six7 was amplified from RNA extracted from 26- and 48-hpf WT and ljrp23ahub embryos; primers JMF476 and JMF477 were used to generate the six7 734 bp product. Cone opsins were PCR-amplified from 4-dpf cDNA obtained from RNA of WT uninjected control and MO six7 injected embryos (1.78 ng of

MO six7). Green, red, UV and blue opsins were amplified using the primers: JMF327-JMF328, JMF329-JMF330, JMF331-JMF332, and JMF333-JMF334, respectively. Whole-mount in situ Hybridization. Whole-mount in situ hybridization was performed essentially as described (DeCarvalho AC et al., 2004) in WT embryos at 10, 16, 24, 36, 48, and 72 hpf. To generate the six7 probe, a 444 bp fragment was amplified with the primers JMF472-JMF473 from WT 10 hpf-embryo cDNA and cloned into the vector PCR2.1- TOPO (Invitrogen, Carlsbad CA); the construct was linearized with KpnI. Antisense RNA probe was prepared with a digoxigenin RNA-labeling kit (Hoffmann–La Roche Ltd., Basel, Switzerland) by in vitro transcription with T7 RNA polymerase, according to the manufacturer's instructions. The hybridized probe was detected with alkaline phosphatase-coupled anti- digoxigenin antibodies (Hoffmann–La Roche Ltd., Basel, Switzerland) and NBT/X-phosphate substrate (Hoffmann-La Roche Ltd., Basel, Switzerland). Labeled embryos were cleared in a graded series of glycerol and viewed on a Zeiss Axiovert S100 microscope (Carl Zeiss, Oberkochen, Germany), and images were captured by Zeiss Axiocam digital camera (Carl Zeiss, Oberkochen, Germany) and processed with Axiovision and Photoshop 5.5 softwares. Cell Quantification. Confocal images from whole eyes immunolabeled for UV cones and rods (4C12 antibody) where analyzed with the Scion Image Software (Scion) (Fadool JM, 2003). An area corresponding to 3500 µm2 in the central retina (dorsal to the optic nerve) was used to quantify UV cones, rods and double red-green cones (Zpr1-positive) in 4-dpf retinas. The following strains and number (n) of 4 dpf retinas were analyzed: WT (n=5); ljrp23ahub homozygous (n=5); ljrp23ahub heterozygous (n=6); double mutant lorp25bbtl/ljrp23ahub (n=5); MOsix7 (n=6/each MO dose). Quantification of rods in MO six7-injected lorp25bbtl (n=5 per MO dose), ljrp23ahub (n=7 per MO dose) and control uninjected (n=5) retinas at 4 dpf was performed similarly. The average number of UV cones, rods or Zpr1-positive cells per unit area and the SD were reported. Mapping. Linkage analysis was performed at the Zebrafish Mapping Facility at the University of Louisville from DNA isolated from 100 WT siblings and 100 ljrp23ahub embryos using SSLP markers (Gregg RG et al., 2003). The mutagenesis strategy incorporated a mapping panel to facilitate linkage analysis of the mutated loci. Fine resolution mapping was performed with 374 ljrp23ahub mutant embryos.

Immunohistochemistry. Immunolabeling and fluorescence microscopy of whole- mount larvae and frozen sections (10 µm) were performed as described previously (Fadool JM, 2003). BrdU incorporation was performed as described (Morris AC et al., 2008), briefly 3-, 4- and 5-dpf embryos were incubated for 5 hours in fish water with 0.5% BrdU and subsequently fixed in paraformaldehyde 4%. Sections and enucleated eyes from whole-mounted immunolabeled larvae were imaged with a Zeiss 510 Scanning Laser Confocal microscope (Carl Zeiss, Oberkochen, Germany) equipped with either a 20x (NA 0.75) objective or 40x water-immersion objective (NA 1.2) as described (Morris AC et al., 2008). The following primary antibodies and dilutions were used: 4C12, which recognizes an unknown epitope in rods (J.M.Fadool and Linser P, unpublished data, 1999) (mouse, 1:120); Zpr1, which recognizes red-green double cones (mouse, 1:20, Oregon monoclonal bank); antibody against zebrafish blue and UV cone opsin (Vihtelic TS et al., 1999 ) (rabbit, 1:400); anti-BrdU (mouse, 1:500, Sigma); 5e11, which recognizes amacrine cells (mouse, 1:10); CAZ, which recognizes Müller glia (rabbit, 1:100); Zn8, which recognizes ganglion cells (mouse, 1:10); PKC, which recognizes bipolar cells (rabbit, 1:100, Santa Cruz Biotechnology); Alexa fluor-conjugated secondary antibodies (1:200, Molecular Probes-Invitrogen, Carlsbad CA) were used according to manufacturer’s instructions. Cell nuclei were counterstained with DAPI (Sigma-Aldrich, St. Louis MO) or SYTO 61 (Invitrogen, Carlsbad CA). For plastic sections WT control and MO six7-injected embryos were fixed at 4 dpf with 1% OsO4 and 1% glutaraldehyde. Blocks were sectioned (1 µm) and stained with methylene blue. Nuclei from a fixed area that spanned all retinal layers, dorsal to the optic nerve were quantified in control (n=6) and MO six7-injected (n=5) sections. The average nuclei number (n) in the ganglion cell layer, inner nuclear layer and outer nuclear layer and the SD were reported. Cell Death. TUNEL labeling was performed on retinal cryo-sections of 3-dpf embryos using ApoTag in situ Apoptosis Detection kit (Chemicon, Temecula CA) according to the manufacturer’s instructions. The following number (n) of 3 dpf-retinas were analyzed: WT, n=7; ljrp23ahub, n= 9; MOsix7, n=6. The average number of TUNEL-positive cells in the GCL, INL and ONL per retinal section and the SD were reported.

4.3 Results ljr mutants were isolated as part of the genetic screen conducted to identify essential genes for photoreceptor development (Morris AC & Fadool JM, 2005; Alvarez-Delfin K et al., 2009). Several independent recessive mutations were identified leading to an increase in the number of rod photoreceptors across the larval retinas. The lots-of-rods locus was detected initially in the 25BBTL family, where the tbx2bp25bbtl allele was identified as causing the cell fate change that led to an increase in the number of rods at the expense of UV cones (Alvarez- Delfin K., et al., 2009). Subsequently, a similar increase in rod number was detected in other families during the screen, such as 23AHUB (Fig. 14). Interestingly, fish heterozygous for the 23AHUB allele genetically complemented the tbx2bp25bbtl and double homozygous larvae for lorp25bbtl/ljrp23ahub displayed an additive number of rods (Fig. 14C), suggesting an independent locus regulating rod number in 23AHUB, which I termed lots-of-rods-junior (ljrp23ahub). To further verify the finding of a newly mutated locus and to identify the gene involved, linkage analysis was performed. The ljrp23ahub mutation mapped to an 8 cM-interval on chromosome 7 (Fig. 15), whereas the tbx2b locus is located on chromosome 15 (Alvarez-Delfin K et al., 2009). These genetic features corroborated that ljrp23ahub constituted an independent locus that similar to lorp25bbtl, displayed an increase in the number of rods in the developing zebrafish retina. Rods appeared precociously in ljrp23ahub as 3-dpf mutant larvae demonstrated great rod abundance across the entire retina in contrast to WT that displayed a scattered rod pattern at that stage (Fig. 16). Interestingly, ljrp23ahub seems to exhibit semi-dominance as heterozygous larva demonstrated intermediate rod number between WT and homozygous ljrp23ahub. WT larvae displayed 18.9±6.4 rods per 3500 m2; heterozygous ljrp23ahub displayed 34.4±10.8; and homozygous ljrp23ahub displayed 76.8±13.8. To test if the increased number of rods in ljrp23ahub resulted from a change in the fate of any of the cone subtypes as observed in lorp25bbtl, the presence of the different cones was assayed in WT and ljrp23ahub mutants. Whole mount immunolabeling of 4 dpf-larvae with an antibody recognizing UV opsin was performed and the UV cones were quantified in enucleated eyes of 4-dpf WT and ljrp23ahub homozygous larvae. The UV cone number appeared similar in ljrp23ahub and WT embryos, in contrast with being drastically reduced in lorp25bbtl (Fig. 14). Whole mount immunolabeling of 4-dpf larvae using Zpr1, a monoclonal antibody that label green and red double cones, was performed. Imaging in the confocal microscopy of enucleated

Figure 14. The ljrp23ahub mutant demonstrates an increase in rod number. (A-C) Confocal images of eyes from 4-dpf WT (A) and ljrp23ahub (B). The retina from ljrp23ahub displays more rods than the WT, while there is no difference in the UV cone number. (C) Graph showing the average number of rods (red) and UV cones (green) per unit area quantified from confocal images of immunolabeled ljrp23ahub, lorp25bbtl, double mutant lorp25bbtl/ljrp23ahub and WT retinas. The difference in rod and UV cone number among lorp25bbtl and ljrp23ahub, as well as the additive number of rods in the double mutant lorp25bbtl/ljrp23ahub suggest independent genetic pathways in both mutants. Error bars represent SD.

Figure 15. Linkage analysis placed ljrp23ahub in an interval on chromosome 7. The number of recombinants in 163 mutant larvae is shown in red. The bracket includes the interval containing the ljrp23ahub mutation between markers zC168D1 and zC42C5.

Figure 16. Rods appear precociously in ljrp23ahub. (A-B) Transverse cryo-sections from 3-, 4- and 5-dpf WT (A) and ljrp23ahub (B) embryos immunolabeled for rods (4C12, red) and counterstained with DAPI (blue) (dorsal is up). At 3 dpf ljrp23ahub retinas display increased rod immunolabeling across the whole retina, if compared to WT at similar stage, where rods are mainly abundant in the ventral retina. Overall, in all three stages ljrp23ahub demonstrates more rods compared to WT.

59 eyes and quantification of Zpr1-positive cells revealed no change in the number of green-red doubled cones in ljrp23ahub when compared to WT (Fig. 17). The overall maintenance of the insipient larval photoreceptor mosaic in the mutant was evidenced, with no change in the alternating arrangement of red (brighter red) and green cones (dimmer red) in ljrp23ahub mutant larvae, when compared to WT. The position of blue cones nuclei (green) and UV cones (black) appeared unaffected in ljrp23ahub. In situ hybridization was performed for the blue opsin at 4 dpf in WT and ljrp23ahub larvae. No difference in the expression level and pattern of the blue opsin was detected in ljrp23ahub compared to WT (data no shown). Additionally, the identity of other retinal cells was also assayed by immunolabeling 4-dpf retinal cryo-sections with specific antibodies. No evident alterations were revealed in amacrine, bipolar, ganglion or Müller cells in ljrp23ahub compared to WT in 4-dpf immunolabeled cryo-sections (Fig. 18). In teleosts, post-embryonic rods are generated from a population of mitotically active cells called rod progenitors; consequently, a deregulation of this pathway could explain the increase in rod number in ljrp23ahub. To address this hypothesis, BrdU incorporation was assayed at 3, 4 and 5 dpf in WT and ljrp23ahub embryos. Immunolabeled retinal cryo-sections with anti- BrdU antibody revealed no changes in the patterning or number of BrdU-positive cells among mutants and WT at 3, 4 or 5 dpf (Fig. 19 shows 5-dpf retinas). Anti phospho-histone 3 (PH3), a marker for M-phase revealed a trend of increased number of PH3-positive cells in the ljrp23ahub retinas when compared to WT at 48 hpf, that was not statistically different from controls (Fig. 20). The genetic and phenotypic data indicated that ljrp23ahub constitutes a novel locus regulating rod number. Fine resolution mapping was performed to narrow the ljrp23ahub interval on chromosome 7. ljrp23ahub mutant and WT sibling larvae from ljrp23ahub heterozygous crosses were sorted based upon rod immunolabeling and sent to the Zebrafish Mapping Facility (University of Louisville, KY). Fine mapping reduced the critical interval down to 0.3 Mb and the number of candidate genes to 6 (data not shown). The identified candidates genes were: nitrilase 1, prefoldin, subunit 2, N-acetyllactosaminide beta-1,3-N- acetylglucosaminyltransferase, sine oculis homologous homeobox 7 (six7), actin-related protein, ras-related protein expressed in neurons (RIN1). From those, genes demonstrating no eye expression data (http://zfin.org/) or functions that were not obviously related to the

WT (n=6) ljrp23ahub (n=6) Zpr1+ cells 237 ± 5 230 ± 8

Figure 17. Larval photoreceptor mosaic is conserved in ljrp23ahub retinas. (A-B) Whole mount immunolabeling with the monoclonal antibody Zpr1 for green and red cones (red) and nuclear counterstaining with SYTO 61 (green). No change in the alternating arrangement of red (brighter red) and green cones (dimmer red) was evident in ljrp23ahub mutant 4-dpf larvae (B), when compared to WT (A). The position of blue cones nuclei (green) and UV cones (black) appeared unaffected in ljrp23ahub. (C) Similar number of Zpr1-positive cells per area unit was detected in WT and ljrp23ahub retinas.

Figure 18. ljrp23ahub and WT embryos demonstrate similar pattern of retinal cell markers. (A-B) Transverse cryo-sections from 4-dpf WT (A) and ljrp23ahub (B) embryos immunolabeled with 4C12 (rods), 5e11 (amacrine cells), PKC (bipolar cells), CAZ (Müller glial cells), and Zn8 (ganglion cells) showed no detectable difference between mutants and WT. Nuclei were counterstained with DAPI. Rod labeling (4C12) contrasted WT and mutants.

Figure 19. BrdU incorporation is similar in WT and ljrp23ahub mutants. (A-B) Transverse cryo- sections from 5-dpf WT (A) and ljrp23ahub (B) embryos previously treated with BrdU, immunolabeled for anti-BrdU, and counterstained with DAPI. At this stage, retinal cell proliferation (BrdU-positive cells) is only evident in the CMZ in WT and mutant.

WT (n=5) Inner Outer Total

Average 5 8.4 13.4 SD 2.73 2.50 4.03

ljr (n=5) Inner Outer Total Average 7.2 9.8 17 SD 1.30 3.89 4.69

Figure 20. ljrp23ahub and WT retinas demonstrate similar mitotic cell index at 48 hpf. (A-B) Transverse cryo-sections from 48-hpf WT (A) and ljrp23ahub (B) embryos immunolabeled for phospho-histone 3 (PH3) and counterstained with DAPI. (C) Quantification of the number of PH3-positive cells in the inner and outer retina (t-test, p<0.05).

64 phenotype displayed by ljrp23ahub were ruled out. six7 was selected as the main candidate for further analysis based upon previously described roles for members of the Six family of transcription factors in eye development (reviewed by Kumar JP et al., 2009). Expression data has shown six7 in the prospective forebrain and optic vesicles; although the transcript was highly reduced by 14 hpf and not detectable by 24 hpf (Seo HC et al.,1998b). No data were available regarding six7 expression in later larval stages; however the transcript had been documented in the adult fish eye (Vihtelic TS et al., 2005; Alvarez-Delfin K and Fadool JM, unpublished). To test the possibility of six7 being affected in the ljrp23ahub mutant, antisense MO against the six7 5’UTR (Inbal A et al., 2007) were injected into WT embryos at 1-2 cell stage. Control and injected embryos were fixed at 4 dpf and whole-mount immunolabeled for rods. Similar to ljrp23ahub mutant, six7 morphants demonstrated an increase in the number of rods (Fig. 21) in a dose-dependent fashion, with no effect in the UV cone number. Notably, six7 morphant reached a higher rod number than the ljrp23ahub genetic mutant (compare Fig. 14C and Fig. 21). six7 morphants did not demonstrate any other evident morphological defect (data not shown). Expression of the four cone opsins was examined by RT-PCR from RNA extracted from 4-dpf uninjected control and six7 morphants. No apparent difference in the amount of amplified cone opsin transcripts was detected between uninjected controls and six7 morphants (Fig. 22). Other retinal cells such as bipolar, amacrine, ganglion and Müller, evaluated by immunohistochemistry in cryo-sections demonstrated to be present in the morphants at 4 dpf with no apparent difference when compared to uninjected controls (data not shown). Moreover, counting nuclei from plastic sections from 4-dpf MOsix7 and control larva revealed an overall increase in nuclei number in the ONL in the morphants, consistent with the observed increase in rod number, and no significant change in the nuclei number in the INL or the GCL, ruling out the possibility of an increase in other neuronal types (data not shown). Apoptosis has been previously shown to be a minor developmental event in the zebrafish retina, although a mild peak has been described at 3 dpf (Biehlmaier O et al., 2001). Accordingly, apoptotic cell death was evaluated by TUNEL labeling in ljrp23ahub, MOsix7 and WT retinas at 3 dpf. Interestingly, ljrp23ahub mutants demonstrated an increase in TUNEL- positive cell number in the INL and GCL when compared to WT (Fig. 23A-B). Similarly, an

Figure 21. six7 morphants phenocopy the increase in the rod number observed in ljrp23ahub. (A- B) Transverse cryo-sections from 4-dpf uninjected control WT (A) and six7 MO-injected (B) embryos immunolabeled for rods (4C12, green). six7 morphants display an increase in the number of rods compared to uninjected controls. (C) Graph showing the average number of rods (green) per unit area quantified from confocal images of rod-immunolabeled WT uninjected control and six7 MO-injected embryos with two different MO doses. The increase in rod number appears to be MO dose-dependent. Error bars represent SD.

cycle 21 green red UV blue C MO C MO C MO C MO

cycle 25 green red UV blue C MO C MO C MO C MO

Figure 22. Control and MOsix7 embryos demonstrate similar expression of the cone opsins. Amplification of green, red, UV and blue opsins by RT-PCR from RNA extracted from 4-dpf controls (C) and six7 MO-injected embryos. Amplicon aliquots were run in agarose gel electrophoresis at cycle 21 and cycle 25 of the PCR program.

67 increase in TUNEL-positive retinal cells was revealed in the six7 MO-injected embryos compared to uninjected controls at 3 dpf in the inner retina, as well as the GCL (Fig. 24). Although the increase in apoptosis in MOsix7 retinas demonstrated to be more modest compared to ljrp23ahub mutants at a similar stage. (compare Fig. 23 and 24). Previous work had demonstrated that knocking down six7 expression in a six3bvu87 null mutant background strongly reduced or lacked eye tissue in the zebrafish larva (Inbal A et al., 2007). Subsequently, we reasoned that if ljrp23ahub was an allele of six7, a double mutant six3bvu87/vu8/ljrp23ahub would demonstrate the eyeless phenotype. To evaluate this hypothesis, homozygous ljrp23ahub and six3bvu87 fish were mated, the double heterozygous progeny were raised to adulthood and siblings mated. 1/16 of the progeny of double heterozygous parents for ljrp23ahub and six3bvu87 were expected to be homozygous for both traits. Interestingly, no eye morphological phenotype was detected in any larvae in several clutches and, only one quarter of larvae in a clutch displayed the “lots-of-rods” phenotype by rod immunolabeling. This negative result still did not rule out six7 as the candidate as the ljrp23ahub subtle rod phenotype could be due to a six7 hypomorphic allele affecting rod development and not early eye field patterning. Accordingly, six7 sequencing in ljrp23ahub from homozygous larvae did not reveal any nucleotide change in the open reading frame, compared to WT sequence, suggesting a defect in six7 regulatory sequence leading to the “lots-of-rods” phenotype in ljrp23ahub. To confirm six7 function during early development, synthetic six7 mRNA was injected in WT and ljrp23ahub zebrafish embryos at 1-2 cell stage. Injected embryos demonstrated a dramatic enlargement of the eyes and anterior head structures at the expense of posterior tissues, such as tail and trunk (Fig. 25A-B), as previously described (Inbal A et al., 2007). Interestingly, when the six7 RNA-injected embryos and controls were whole-mounted immunolabeled for rods, a WT pattern of rod distribution was evident in the WT embryos, and the “lots-of-rods” phenotype was maintained in the injected ljrp23ahub. Some six7 over-expressing embryos displayed dorsalized eyes and often in the ventral retina the choroid fissure failed to close. Several embryos demonstrated ectopic retinal tissue and even rod labeling extended into the optic stalk and brain (Fig. 25C-D). Interestingly, in many six7-injected embryos ectopic rod labeling was evident in the dorsal brain, potentially representing an expansion of the pineal gland (data not shown).

Figure 23. ljrp23ahub mutant demonstrates an increase in apoptotic cell number. (A-B) Transverse cryo-sections from 3-dpf WT (A) and ljrp23ahub (B) embryos labeled for TUNEL (red) and immunolabeled for rods (4C12, green); nuclei counterstained with SYTO 61. (C) Quantification of the average of TUNEL-positive cells in the GCL and the INL in WT and ljrp23ahub retinas (t-test, p<0.05). Error bars represent SD.

Figure 24. six7 morphants demonstrate an increase in apoptotic cell number. Retinal cryo- sections of 3-dpf WT uninjected control and six7 morphants embryos were labeled for TUNEL. Average of TUNEL-positive cells in the ONL, INL and the GCL per section are shown. Error bars represent SD.

Figure 25. six7 over-expression promotes anterior-dorsal structures leading to retinal and brain overgrowth. WT (B) and ljrp23ahub (C-D) embryos were injected with synthetic six7 mRNA at 1- 2 cell stage and raised to 1 or 4 dpf. (A-B) At 1 dpf, six7-injected embryos demonstrated enlargement of anterior structures, such as yolk, brain, otic vesicles and eyes at the expense of posterior tissue, such as tail and trunk (B) when compared to control uninjected (A); note the shorter length embryo in (B). (C-D) Bright field (C) and the correspondent fluorescent image of a rod-immunolabeled ljrp23ahub homozygous embryo (D) over-expressing six7 at 4 dpf; ectopic retinal tissue that occupies the optic stalk and brain regions is evident. The patterning and distribution of rods in the retina was not affected, as six7-injected ljrp23ahub embryos still displayed the “lots-of-rods” phenotype (D).

six7 expression was examined in WT and ljrp23ahub embryos. In situ hybridization at 10, 16, 24, 36, 48 and 72 hpf showed no differences in six7 expression pattern in mutants compared to WT. In WT or mutant embryos six7 mRNA was abundantly detected at 10 hpf in the anterior region of the embryo corresponding to the eye field as previously described (Seo HC et al., 1998b), and down-regulated by 24 hpf. Interestingly, at 36 hpf the gene is expressed in the retinal epithelium and at 48 hpf it is becoming concentrated in the nascent ONL, where photoreceptors are differentiating in the ventral retina (Fig. 26); the expression in the ONL persisted at 72 hpf. Previous studies had claimed that six7 expression was down-regulated after 24 hpf (Seo HC et al., 1998b), our data had confirmed that finding but also revealed that six7 is expressed again at detectable levels at 36, 48 and 72 hpf. Moreover, we found evidence of six7 adult expression: in an adult eye cDNA library the six7 transcript was identified (Vihtelic TS et al., 2005). Additionally, our unpublished microarray data also detected the six7 transcript in adult retinas. The six7 expression data are consistent with a potential role during photoreceptor development. As tbx2bp25bbtl, ljrp23ahub, and MOsix7 all affect the rod number during zebrafish retinal development; we evaluated the relationship between them. lorp25bbtl homozygous and WT embryos were injected with MO six7. If these two transcription factors regulate independently the rod number, an additive number of rods would be expected in the double lorp25bbtl/six7 morphant. Interestingly, no effect in the number of rods was detected with either of the two MO six7 doses used (Fig. 27). In this aspect MOsix7 differs from ljrp23ahub as the double mutant ljrp23ahub/lorp25bbtl did display additive number of rods (compare Fig. 27 to Fig. 14C). Interestingly, MO six7 injected into ljrp23ahub homozygous embryos resulted in a slight increase in rod number (Fig. 28). However, RT-PCR from RNA extracted from ljrp23ahub mutants and WT revealed an unanticipated up-regulation of the six7 transcript level at 26 and 48 hpf (Fig. 29). These apparently incongruent results, and the lack of a molecular change in the six7 coding sequence opened the possibility that ljrp23ahub is a gain-of-function allele originated from a six7 cis- element mutation.

ONL V

Figure 26. six7 is expressed in the outer nuclear layer (ONL). In situ hybridization for six7 in WT embryos at 48-50 hpf shows expression in the retinal neural epithelium in the dorsal (D) retina, while in the ventral (V) retina six7 expression is confined to the recently differentiated ONL, where the photoreceptors reside.

Figure 27. six7 MO injection in lorp25bbtl does not affect rod number. lorp25bbtl embryos were injected with two different doses of MO six7 at 1-2 cell stage, fixed at 4 dpf, and processed for whole-mount rod immunolabeling. Rod quantification in a fixed area of the central retina did not demonstrate change in rod number in lorp25bbtl MOsix7-injected when compared to uninjected lorp25bbtl control embryos. Error bars represent SD.

Figure 28. six7 MO injected ljrp23ahub mutant embryos demonstrated a slight increase in rod number. ljrp23ahub embryos were injected with two different doses of MO six7 at 1-2 cell stage, fixed at 4 dpf and processed for whole-mount rod immunolabeling. Rod quantification in a fixed area of the central retina showed a moderate increase in rod number in ljrp23ahub MOsix7- injected when compared to uninjected ljrp23ahub control embryos. Error bars represent SD.

Figure 29. six7 is over-expressed in the ljrp23ahub mutant. Amplification of a six7 fragment by RT-PCR from RNA extracted from WT and ljrp23ahub embryos at 26 and 48 hpf demonstrated an increase in amount of six7 transcript in the mutant at both time points. Note that as previously described (Seo HC et al., 1998b), at 26 hpf six7 expression is not detectable in WT embryos. Actin was amplified as a positive control.

Table 2. Summary of the rod phenotype observed for different genetic backgrounds.

Genotype Rod phenotypea Reference

lorp25bbtl Lots-of-rods (LOR) Fig. 7, Table 1

ljrp23ahub LOR Fig. 14C

lorp25bbtl/ ljrp23ahub double mutant Additive number of rods Fig. 14C

WT embryos injected with Six7 MO LOR Fig. 21

lorp25bbtl injected with MO six7 LOR, no change in rod number Fig. 27

ljrp23ahub injected with MO six7 LOR, slight increase in rod number Fig. 28

six3bvu87 injected with MO six7 No eyes Inbal A et al., 2007

six3bvu87 WT Not shown

six3bvu87/ljrp23ahub LOR Page 68 aThe rod phenotype was determined by quantification of the rod number from an area of the central retina of immunolabeled retinas of 4 dpf larvae.

4.4 Discussion The data unequivocally show that ljrp23ahub mutant larvae exhibit an increase in the number of rods. Fine resolution mapping pointed to the transcription factor six7 as a robust candidate locus affected in the ljrp23ahub mutant. Moreover, antisense MO knock down of six7 in WT embryos led to a dosage-dependent increase in the rod number, phenocopying ljrp23ahub. Our analysis was not able to identify any other cell type affected in ljrp23ahub, nor effects upon the cell cycle, although cell death was elevated in the inner retinas of ljrp23ahub at 3 dpf compared to WT. Linkage analysis, as well as the presence of WT number of UV cones in the mutant indicated that ljrp23ahub constitutes a novel and independent locus from the previously identified lorp25bbtl (Alvarez-Delfin K et al., 2009). Even though both ljrp23ahub mutants and six7 morphants displayed an increase in the number of rods and apoptotic cells in the inner retina, clear genetic discrepancies are evident. First, ljrp23ahub exhibits partial dominance over the WT allele as heterozygous larvae showed an intermediate rod number between the WT and the homozygous ljrp23ahub. Second, no nucleotide changes in the six7 ORF in ljrp23ahub compared to WT was identified, and unexpectedly, RT- PCR from WT and ljrp23ahub RNA revealed that the six7 transcript is up-regulated in the mutant. Third, double mutant ljrp23ahub/lorp25bbtl demonstrated an additive number of rods, suggesting independent pathways that regulate rod number; whereas in the lorp25bbtl/MOsix7 larvae, the number of rods did not change. Additionally, six3bvu87/MOsix7 displayed severe forebrain defects (Inbal A et al., 2007) not observed in the double mutant six3bvu87/ljrp23ahub. Six3 is expressed across all the retinal layers in mammals, but in zebrafish six3a and six3b are restricted to the inner retina and absent from the photoreceptor layer, where only six7 is expressed. I propose the following model based upon interaction between six7 and six3 co- orthologues, which also accounts for the observed differences between ljrp23ahub and MOsix7 larvae (Fig. 30). The up-regulation of six7 in ljrp23ahub leads to an increase in the rod number by an undetermined mechanism (Fig 30A), similar to studies in rat showing than retinal cells over- expressing Six3 demonstrate an increase in rod fate specification (Zhu CC et al., 2002). Additionally, I propose that six7 restricts six3 (a or b) expression in zebrafish, and the knock down of six7 by antisense MO injection releases the repression on six3 and leads to an increase in rod fate specification (Fig. 30B).

A B

Figure 30. Proposed model. (A) Over-expression of six7 in the ljrp23ahub mutant led to an increase in the rod number by an undetermined mechanism. I propose that in zebrafish, as part of the subfunctionalization of the six duplicated genes, six7 represses six3 (a or b) expression, which may directly activate rhodopsin. (B) The knock down of six7 by antisense MO injection releases the repression on six3 and leads to an increase in rod fate specification.

Over-expression of Six3 orthologues, the closest homologue to six7, had demonstrated retinal hyperplasia and ectopic retinal tissue in medaka fish, zebrafish and Xenopus (Lossli F et al., 1999; Kobayashi M et al., 1998; Zuber ME et al., 1999), suggesting important developmental functions in those tissues. Six3 promotes eye determination by repressing forebrain specification. Consistently, SIX3 mutations led to forebrain and ocular defects in holoprosencephaly. In zebrafish, it was also shown that six3b over-expression led to optic stalk enlargement and brain disorganization (Kobayashi M et al., 1998). I demonstrated that over- expression of six7 in WT or ljrp23ahub mutants resulted in anterior-dorsalization of the embryo, at the expense of tail and trunk structures. It was also evident extension of the retina into the optic stalk as it was previously described for six3b (Kobayashi M et al., 1998). Interestingly, six7 over-expression in the early embryo had no effect in the rod pattern or number in any of the two genetic backgrounds tested. These data would suggest sequential, but different roles of six7 in early versus late stages of development. Our hypothesis of a distinct late function for six7 is in agreement of the role uncovered for Six3 in the rat retina by Zhu CC et al. (2002). Briefly, first it was demonstrated that the interaction of Six3 with the Groucho co-repressor requires a conserved Phe (F) residue in an eh- 1 motif located in the Six domain. To evaluate the in vivo significance of that interaction, retroviral infection of newborn rat retinas to over-express Six3 or Six3F88E, a mutated form unable to interact with Groucho was performed. It was found that nearly all (97%) of the infected clones over-expressing Six3F88E contained only rods at the expense of clones containing bipolar and Müller cells; compared to 79% of the control virus infected. Interestingly, the WT

Six3 over-expression led to abundant clones with altered rod morphology (not Six3F88E), but only at the expense of clones containing bipolar cells. Although, not clearly stated in that publication is the fact that the overall total number of rod-containing clones, including the ones with normal morphology, and altered morphology, but correctly positioned in the ONL, was also augmented (90%) in the Six3 over-expressing clones. Therefore, Six3 or Six3F88E over- expression led to an increase in rod specification. In the light of the reassessment of Zhu CC et al. (2002) findings I propose that our results of six7 gain-of-function in the ljrp23ahub mutant and six7 MO knock down are equivalent to the ones obtained with Six3 and Six3F88E, assuming that the mutant form acts as dominant negative. Together those results strongly support a role for

Six3 and six7 in the regulation of photoreceptor differentiation in rodents and zebrafish retina, respectively. The identification of the mechanism involved will require further investigation. A direct link between regulation of rhodopsin expression and Six genes has been exclusively provided in mice by Manavathi B et al. (2007). It was demonstrated in vitro and in vivo that Six3 bind ATTA-core cis-elements in the proximal rhodopsin promoter to activate transcription, although the metastasis associated protein 1 (MTA1) interfere with this activation in physiological conditions (Manavathi B et al., 2007; Kumar R et al., 2010). Moreover, cooperation of Six3 with Crx and Nrl to activate rhodopsin was also shown in reporter assays in vitro. We found no evidence for six7 direct regulation of the Xenopus rhodopsin promoter in HEK293T cells using reporter assays as described in Chapter 3, even in the presence of Groucho (data not shown). We propose that six7 may be biasing early retinal progenitors to become rods, possibly at the expense of a small fraction of other retinal cells types that we have not been able to identify. six7 only share orthologues with other teleost fish, but phylogenetic analysis has placed six7 in the Six3/6 subfamily (Seo HC., et al 1998b). Subsequently, it would be reasonable to extrapolate Six3 and Six6 known functions to address six7 developmental roles. Accordingly, six7 expression pattern is comparable to Six3 and Six6 vertebrate orthologues in early eye and forebrain development (Seo HC., et al 1998a; b; Kawakami K et al., 1996; Bovolenta P et al., 1998; Oliver G et al., 1995; Jean D et al., 1999; Toy J. et al., 1998; Loosli F et al., 1998). Moreover, zebrafish six7 exerts complementary functions in the establishment of eye field with six3b (Inbal A et al., 2007); also, in later developmental stages vertebrate Six3 orthologues in mouse and chicken, and six7 in zebrafish, are all expressed in the photoreceptor layer (Kawakami K et al., 1996; Bovolenta P et al., 1998; Wargelius A et al., 2003; Zhu CC et al., 2002; Manavathi B et al., 2007; this dissertation). Similarly, over-expression of six3b and six7 in zebrafish led to similar phenotype of enlargement of anterior structures, such as the retina and the optic stalk (Kobayashi M et al., 1998; Inbal A et al., 2007; this dissertation). Evidence suggests that six7 is functionally closer to Six3 than to Six6 orthologues. Nevertheless and despite some clear similarities with Six3 orthologues, six7 displays a remarkably divergent C- terminal domain, which may be indicative of unique protein-protein interaction, and consequently unique functions for the fish orthologue.

Our study places six7, together with Pax6, Rx1, Six3 and Six6 in the group of transcriptional regulators that, in addition of having critical roles in early eye field determination, have demonstrated late functions in retinal or lens development. Future studies are needed to uncover the six7 mechanism to regulate rod photoreceptor number in the zebrafish retina. For example, the specific photoreceptor cells that express six7 could be identified by double in situ hybridization with the different opsins. Additionally, the relevance of the Groucho co-repressor interaction with six7 should be evaluated, as the eh-1 interaction motif is conserved in zebrafish six7 (Seo HC et al., 1998b). Regulated six7 over-expression driven by an inducible promoter may provide insights on the exact time window that regulation of rod development occurs. Moreover, it could also provide a six7 photoreceptor-specific over- expression phenotype more efficiently than the mRNA injections, as the earlier six7 functions could be circumvented. Finally, we have not gathered strong enough evidence that six7 is the gene affected in ljrp23ahub mutant, consequently six7 promoter sequencing and analysis in ljrp23ahub may provide confirmation.

APPENDIX A

ACUC PROTOCOL APPROVAL

REFERENCES

Akhmedov NB, et al (2000) A deletion in a photoreceptor-specific nuclear receptor mRNA causes retinal degeneration in the rd7 mouse. Proc Natl Acad Sci U S A 97: 5551-5556.

Akimoto M, et al (2006) Targeting of GFP to newborn rods by nrl promoter and temporal expression profiling of flow-sorted photoreceptors. Proc Natl Acad Sci U S A 103: 3890-3895.

Albalat R, Baquero M & Minguillon C (2010) Identification and characterisation of the developmental expression pattern of tbx5b, a novel tbx5 gene in zebrafish. Gene Expr Patterns 10: 24-30.

Alvarez-Delfin K, et al (2009) Tbx2b is required for ultraviolet photoreceptor cell specification during zebrafish retinal development. Proc Natl Acad Sci U S A 106: 2023-2028.

Ando H, et al (2005) Lhx2 mediates the activity of Six3 in zebrafish forebrain growth. Dev Biol 287: 456-468.

Applebury ML, et al (2000) The murine cone photoreceptor: A single cone type expresses both S and M opsins with retinal spatial patterning. Neuron 27: 513-523.

Bateman JB, et al (2006) A new locus for autosomal dominant cataract on chromosome 19: Linkage analyses and screening of candidate genes. Invest Ophthalmol Vis Sci 47: 3441-3449.

Batni S, Scalzetti L, Moody SA & Knox BE (1996) Characterization of the xenopus rhodopsin gene. J Biol Chem 271: 3179-3186.

Behesti H, Holt JK & Sowden JC (2006) The level of BMP4 signaling is critical for the regulation of distinct T-box gene expression domains and growth along the dorso-ventral axis of the optic cup. BMC Dev Biol 6: 62.

Behesti H, Papaioannou VE & Sowden JC (2009) Loss of Tbx2 delays optic vesicle invagination leading to small optic cups. Dev Biol 333: 360-372.

Bernier G, et al (2000) Expanded retina territory by midbrain transformation upon overexpression of Six6 (Optx2) in xenopus embryos. Mech Dev 93: 59-69.

Biehlmaier O, Neuhauss SC & Kohler K (2001) Onset and time course of apoptosis in the developing zebrafish retina. Cell Tissue Res 306: 199-207.

Boatright JH, et al (2001) Evidence of a tissue-restricting DNA regulatory element in the mouse IRBP promoter. FEBS Lett 504: 27-30.

Boogerd CJ, Moorman AF & Barnett P (2009) Protein interactions at the heart of cardiac chamber formation. Ann Anat 191: 505-517.

Boskovic G & Niles RM (2004) T-box binding protein type two (TBX2) is an immediate early gene target in retinoic-acid-treated B16 murine melanoma cells. Exp Cell Res 295: 281-289.

Bovolenta P, Mallamaci A, Puelles L & Boncinelli E (1998) Expression pattern of cSix3, a member of the Six/sine oculis family of transcription factors. Mech Dev 70: 201-203.

Branchek T (1984) The development of photoreceptors in the zebrafish, brachydanio rerio. II. function. J Comp Neurol 224: 116-122.

Branchek T & Bremiller R (1984) The development of photoreceptors in the zebrafish, brachydanio rerio. I. structure. J Comp Neurol 224: 107-115.

Brockerhoff SE, et al (1995) A behavioral screen for isolating zebrafish mutants with visual system defects. Proc Natl Acad Sci U S A 92: 10545-10549.

Bruneau BG (2002) Transcriptional regulation of vertebrate cardiac morphogenesis. Circ Res 90: 509- 519.

Cai CL, et al (2005) T-box genes coordinate regional rates of proliferation and regional specification during cardiogenesis. Development 132: 2475-2487.

Carl M, Loosli F & Wittbrodt J (2002) Six3 inactivation reveals its essential role for the formation and patterning of the vertebrate eye. Development 129: 4057-4063.

Carreira S, Dexter TJ, Yavuzer U, Easty DJ & Goding CR (1998) Brachyury-related transcription factor Tbx2 and repression of the melanocyte-specific TRP-1 promoter. Mol Cell Biol 18: 5099-5108.

Carreira S, Liu B & Goding CR (2000) The gene encoding the T-box factor Tbx2 is a target for the microphthalmia-associated transcription factor in melanocytes. J Biol Chem 275: 21920-21927.

Cepko CL, Austin CP, Yang X, Alexiades M & Ezzeddine D (1996) Cell fate determination in the vertebrate retina. Proc Natl Acad Sci U S A 93: 589-595.

Chen J, Rattner A & Nathans J (2005) The rod photoreceptor-specific nuclear receptor Nr2e3 represses transcription of multiple cone-specific genes. J Neurosci 25: 118-129.

Chen S, et al (1997) Crx, a novel otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes. Neuron 19: 1017-1030.

Cheng H, et al (2004) Photoreceptor-specific nuclear receptor NR2E3 functions as a transcriptional activator in rod photoreceptors. Hum Mol Genet 13: 1563-1575.

Cheyette BN, et al (1994) The drosophila sine oculis locus encodes a homeodomain-containing protein required for the development of the entire visual system. Neuron 12: 977-996.

Chi NC, et al (2008) Foxn4 directly regulates tbx2b expression and atrioventricular canal formation. Genes Dev 22: 734-739.

Christoffels VM, et al (2004) T-box transcription factor Tbx2 represses differentiation and formation of the cardiac chambers. Dev Dyn 229: 763-770.

Conte I, et al (2010) Proper differentiation of photoreceptors and amacrine cells depends on a regulatory loop between NeuroD and Six6. Development 137: 2307-2317.

Conte I, Morcillo J & Bovolenta P (2005) Comparative analysis of six 3 and six 6 distribution in the developing and adult mouse brain. Dev Dyn 234: 718-725.

Coolen M, et al (2005) Phylogenomic analysis and expression patterns of large maf genes in xenopus tropicalis provide new insights into the functional evolution of the gene family in osteichthyans. Dev Genes Evol 215: 327-339.

Corbo JC & Cepko CL (2005) A hybrid photoreceptor expressing both rod and cone genes in a mouse model of enhanced S-cone syndrome. PLoS Genet 1: e11.

DeCarvalho AC, Cappendijk SL & Fadool JM (2004) Developmental expression of the POU domain transcription factor brn-3b (Pou4f2) in the lateral line and visual system of zebrafish. Dev Dyn 229: 869-876.

Del Bene F, Tessmar-Raible K & Wittbrodt J (2004) Direct interaction of geminin and Six3 in eye development. Nature 427: 745-749.

Dosch R, et al (2004) Maternal control of vertebrate development before the midblastula transition: Mutants from the zebrafish I. Dev Cell 6: 771-780.

Dowling JE & Boycott BB (1966) Organization of the primate retina: Electron microscopy. Proc R Soc Lond B Biol Sci 166: 80-111.

Drivenes O, Seo HC & Fjose A (2000) Characterisation of the promoter region of the zebrafish six7 gene. Biochim Biophys Acta 1491: 240-247.

Fadool JM (2003) Development of a rod photoreceptor mosaic revealed in transgenic zebrafish. Dev Biol 258: 277-290.

Fadool JM & Dowling JE (2008) Zebrafish: A model system for the study of eye genetics. Prog Retin Eye Res 27: 89-110.

Fernald RD (1990) Teleost vision: Seeing while growing. J Exp Zool Suppl 5: 167-180.

Fong SH, Emelyanov A, Teh C & Korzh V (2005) Wnt signalling mediated by Tbx2b regulates cell migration during formation of the neural plate. Development 132: 3587-3596.

Ford HL, et al (2000) Cell cycle-regulated phosphorylation of the human SIX1 homeodomain protein. J Biol Chem 275: 22245-22254.

Freund CL, et al (1997) Cone-rod dystrophy due to mutations in a novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the photoreceptor. Cell 91: 543-553.

Fujieda H, Bremner R, Mears AJ & Sasaki H (2009) Retinoic acid receptor-related orphan receptor alpha regulates a subset of cone genes during mouse retinal development. J Neurochem 108: 91-101.

Furukawa T, Morrow EM & Cepko CL (1997) Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell 91: 531-541.

Furukawa T, Morrow EM, Li T, Davis FC & Cepko CL (1999) Retinopathy and attenuated circadian entrainment in crx-deficient mice. Nat Genet 23: 466-470.

Gallardo ME, et al (1999) Genomic cloning and characterization of the human homeobox gene SIX6 reveals a cluster of SIX genes in chromosome 14 and associates SIX6 hemizygosity with bilateral anophthalmia and pituitary anomalies. Genomics 61: 82-91.

Gallardo ME, et al (2004) Analysis of the developmental SIX6 homeobox gene in patients with anophthalmia/microphthalmia. Am J Med Genet A 129A: 92-94.

Garrity DM, Childs S & Fishman MC (2002) The heartstrings mutation in zebrafish causes heart/fin Tbx5 deficiency syndrome. Development 129: 4635-4645.

Geng X, et al (2008) Haploinsufficiency of Six3 fails to activate sonic hedgehog expression in the ventral forebrain and causes holoprosencephaly. Dev Cell 15: 236-247.

Gibson-Brown JJ, I Agulnik S, Silver LM & Papaioannou VE (1998) Expression of T-box genes Tbx2- Tbx5 during chick organogenesis. Mech Dev 74: 165-169.

Goldsmith P & Harris WA (2003) The zebrafish as a tool for understanding the biology of visual disorders. Semin Cell Dev Biol 14: 11-18.

Gouras P, Kjeldbye H & Zack DJ (1994) Reporter gene expression in cones in transgenic mice carrying bovine rhodopsin promoter/lacZ transgenes. Vis Neurosci 11: 1227-1231.

Gregg RG, Willer GB, Fadool JM, Dowling JE & Link BA (2003) Positional cloning of the young mutation identifies an essential role for the brahma chromatin remodeling complex in mediating retinal cell differentiation. Proc Natl Acad Sci U S A 100: 6535-6540.

Greulich F, Rudat C & Kispert A (2011) Mechanisms of T-box gene function in the developing heart. Cardiovasc Res

Gross JM & Dowling JE (2005) Tbx2b is essential for neuronal differentiation along the dorsal/ventral axis of the zebrafish retina. Proc Natl Acad Sci U S A 102: 4371-4376.

Habets PE, et al (2002) Cooperative action of Tbx2 and Nkx2.5 inhibits ANF expression in the atrioventricular canal: Implications for cardiac chamber formation. Genes Dev 16: 1234-1246.

Haider NB, et al (2000) Mutation of a nuclear receptor gene, NR2E3, causes enhanced S cone syndrome, a disorder of retinal cell fate. Nat Genet 24: 127-131.

Haider NB, et al (2008) Mapping of genetic modifiers of Nr2e3 rd7/rd7 that suppress retinal degeneration and restore blue cone cells to normal quantity. Mamm Genome 19: 145-154.

Halder G, et al (1998) Eyeless initiates the expression of both sine oculis and eyes absent during drosophila compound eye development. Development 125: 2181-2191.

Harrelson Z, et al (2004) Tbx2 is essential for patterning the atrioventricular canal and for morphogenesis of the outflow tract during heart development. Development 131: 5041-5052.

Hayata T, Kuroda H, Eisaki A & Asashima M (1999) Expression of xenopus T-box transcription factor, tbx2 in xenopus embryo. Dev Genes Evol 209: 625-628.

Heasman J (2002) Morpholino oligos: Making sense of antisense?. Dev Biol 243: 209-214.

Hennig AK, Peng GH & Chen S (2008) Regulation of photoreceptor gene expression by crx-associated transcription factor network. Brain Res 1192: 114-133.

Herrmann BG, Labeit S, Poustka A, King TR & Lehrach H (1990) Cloning of the T gene required in mesoderm formation in the mouse. Nature 343: 617-622.

Inbal A, Kim SH, Shin J & Solnica-Krezel L (2007) Six3 represses nodal activity to establish early brain asymmetry in zebrafish. Neuron 55: 407-415.

Isaac A, et al (1998) Tbx genes and limb identity in chick embryo development. Development 125: 1867-1875.

Jacobs JJ, et al (2000) Senescence bypass screen identifies TBX2, which represses Cdkn2a (p19(ARF)) and is amplified in a subset of human breast cancers. Nat Genet 26: 291-299.

Jean D, Bernier G & Gruss P (1999) Six6 (Optx2) is a novel murine Six3-related homeobox gene that demarcates the presumptive pituitary/hypothalamic axis and the ventral optic stalk. Mech Dev 84: 31-40.

Jeong Y, et al (2008) Regulation of a remote shh forebrain enhancer by the Six3 homeoprotein. Nat Genet 40: 1348-1353.

Jia L, et al (2009) Retinoid-related orphan nuclear receptor RORbeta is an early-acting factor in rod photoreceptor development. Proc Natl Acad Sci U S A 106: 17534-17539.

Johns PR & Fernald RD (1981) Genesis of rods in teleost fish retina. Nature 293: 141-142.

Kawakami K, Ohto H, Takizawa T & Saito T (1996) Identification and expression of six family genes in mouse retina. FEBS Lett 393: 259-263.

Kawakami K, Sato S, Ozaki H & Ikeda K (2000) Six family genes--structure and function as transcription factors and their roles in development. Bioessays 22: 616-626.

Klesert TR, et al (2000) Mice deficient in Six5 develop cataracts: Implications for myotonic dystrophy. Nat Genet 25: 105-109.

Kobayashi M, Nishikawa K, Suzuki T & Yamamoto M (2001) The homeobox protein Six3 interacts with the groucho corepressor and acts as a transcriptional repressor in eye and forebrain formation. Dev Biol 232: 315-326.

Kobayashi M, Toyama R, Takeda H, Dawid IB & Kawakami K (1998) Overexpression of the forebrain- specific homeobox gene six3 induces rostral forebrain enlargement in zebrafish. Development 125: 2973-2982.

Kumar JP (2009) The sine oculis homeobox (SIX) family of transcription factors as regulators of development and disease. Cell Mol Life Sci 66: 565-583.

Kumar R, Balasenthil S, Manavathi B, Rayala SK & Pakala SB (2010) Metastasis-associated protein 1 and its short form variant stimulates Wnt1 transcription through promoting its derepression from Six3 corepressor. Cancer Res 70: 6649-6658.

Kumar R, et al (1996) The bZIP transcription factor nrl stimulates rhodopsin promoter activity in primary retinal cell cultures. J Biol Chem 271: 29612-29618.

Lagutin O, et al (2001) Six3 promotes the formation of ectopic optic vesicle-like structures in mouse embryos. Dev Dyn 221: 342-349.

Lagutin OV, et al (2003) Six3 repression of wnt signaling in the anterior neuroectoderm is essential for vertebrate forebrain development. Genes Dev 17: 368-379.

Larder R, Clark DD, Miller NL & Mellon PL (2011) Hypothalamic dysregulation and infertility in mice lacking the homeodomain protein Six6. J Neurosci 31: 426-438.

Larison KD & Bremiller R (1990) Early onset of phenotype and cell patterning in the embryonic zebrafish retina. Development 109: 567-576.

Lerner LE, Gribanova YE, Whitaker L, Knox BE & Farber DB (2002) The rod cGMP-phosphodiesterase beta-subunit promoter is a specific target for Sp4 and is not activated by other sp proteins or CRX. J Biol Chem 277: 25877-25883.

Levine EM, Fuhrmann S & Reh TA (2000) Soluble factors and the development of rod photoreceptors. Cell Mol Life Sci 57: 224-234.

Li X, et al (2003) Eya protein phosphatase activity regulates Six1-dach-eya transcriptional effects in mammalian organogenesis. Nature 426: 247-254.

Li X, Perissi V, Liu F, Rose DW & Rosenfeld MG (2002) Tissue-specific regulation of retinal and pituitary precursor cell proliferation. Science 297: 1180-1183.

Liang Q, Deng H, Sun CW, Townes TM & Zhu F (2011) Negative regulation of IRF7 activation by activating transcription factor 4 suggests a cross-regulation between the IFN responses and the cellular integrated stress responses. J Immunol 186: 1001-1010.

Link BA, Fadool JM, Malicki J & Dowling JE (2000) The zebrafish young mutation acts non-cell- autonomously to uncouple differentiation from specification for all retinal cells. Development 127: 2177-2188.

Liu H, et al (2008) NeuroD1 regulates expression of thyroid hormone receptor 2 and cone opsins in the developing mouse retina. J Neurosci 28: 749-756.

Liu W, Lagutin OV, Mende M, Streit A & Oliver G (2006) Six3 activation of Pax6 expression is essential for mammalian lens induction and specification. EMBO J 25: 5383-5395.

Liu Y, Shen Y, Rest JS, Raymond PA & Zack DJ (2001) Isolation and characterization of a zebrafish homologue of the cone rod homeobox gene. Invest Ophthalmol Vis Sci 42: 481-487.

Loosli F, Koster RW, Carl M, Krone A & Wittbrodt J (1998) Six3, a medaka homologue of the drosophila homeobox gene sine oculis is expressed in the anterior embryonic shield and the developing eye. Mech Dev 74: 159-164.

Loosli F, et al (2001) Medaka eyeless is the key factor linking retinal determination and eye growth. Development 128: 4035-4044.

Loosli F, Winkler S & Wittbrodt J (1999) Six3 overexpression initiates the formation of ectopic retina. Genes Dev 13: 649-654.

Lopez-Rios J, Gallardo ME, Rodriguez de Cordoba S & Bovolenta P (1999) Six9 (Optx2), a new member of the six gene family of transcription factors, is expressed at early stages of vertebrate ocular and pituitary development. Mech Dev 83: 155-159.

Lopez-Rios J, Tessmar K, Loosli F, Wittbrodt J & Bovolenta P (2003) Six3 and Six6 activity is modulated by members of the groucho family. Development 130: 185-195.

Luo W, et al (2004) Proximal and distal sequences control UV cone pigment gene expression in transgenic zebrafish. J Biol Chem 279: 19286-19293.

Ma L, Lu MF, Schwartz RJ & Martin JF (2005) Bmp2 is essential for cardiac cushion epithelial- mesenchymal transition and myocardial patterning. Development 132: 5601-5611.

Manavathi B, et al (2007) Repression of Six3 by a corepressor regulates rhodopsin expression. Proc Natl Acad Sci U S A 104: 13128-13133.

Mandel EM, et al (2010) The BMP pathway acts to directly regulate Tbx20 in the developing heart. Development 137: 1919-1929.

Mani SS, et al (2001) Xenopus rhodopsin promoter. identification of immediate upstream sequences necessary for high level, rod-specific transcription. J Biol Chem 276: 36557-36565.

Manning L, et al (2006) Regional morphogenesis in the hypothalamus: A BMP-Tbx2 pathway coordinates fate and proliferation through shh downregulation. Dev Cell 11: 873-885.

Martinez-de Luna RI, Moose HE, Kelly LE, Nekkalapudi S & El-Hodiri HM (2010) Regulation of retinal homeobox gene transcription by cooperative activity among cis-elements. Gene 467: 13- 24.

Masland RH (2001) The fundamental plan of the retina. Nat Neurosci 4: 877-886.

Mathers PH, Grinberg A, Mahon KA & Jamrich M (1997) The rx homeobox gene is essential for vertebrate eye development. Nature 387: 603-607.

McIlvain VA & Knox BE (2007) Nr2e3 and nrl can reprogram retinal precursors to the rod fate in xenopus retina. Dev Dyn 236: 1970-1979.

Mears AJ, et al (2001) Nrl is required for rod photoreceptor development. Nat Genet 29: 447-452.

Mitton KP, et al (2000) The leucine zipper of NRL interacts with the CRX homeodomain. A possible mechanism of transcriptional synergy in rhodopsin regulation. J Biol Chem 275: 29794-29799.

Morris AC & Fadool JM (2005) Studying rod photoreceptor development in zebrafish. Physiol Behav 86: 306-313.

Morris AC, Scholz TL, Brockerhoff SE & Fadool JM (2008) Genetic dissection reveals two separate pathways for rod and cone regeneration in the teleost retina. Dev Neurobiol 68: 605-619.

Morris AC, Schroeter EH, Bilotta J, Wong RO & Fadool JM (2005) Cone survival despite rod degeneration in XOPS-mCFP transgenic zebrafish. Invest Ophthalmol Vis Sci 46: 4762-4771.

Morrow EM, Furukawa T, Lee JE & Cepko CL (1999) NeuroD regulates multiple functions in the developing neural retina in rodent. Development 126: 23-36.

Naiche LA, Harrelson Z, Kelly RG & Papaioannou VE (2005) T-box genes in vertebrate development. Annu Rev Genet 39: 219-239.

Nelson SM, Frey RA, Wardwell SL & Stenkamp DL (2008) The developmental sequence of gene expression within the rod photoreceptor lineage in embryonic zebrafish. Dev Dyn 237: 2903- 2917.

Ng L, et al (2001) A thyroid hormone receptor that is required for the development of green cone photoreceptors. Nat Genet 27: 94-98.

Nishida A, et al (2003) Otx2 homeobox gene controls retinal photoreceptor cell fate and pineal gland development. Nat Neurosci 6: 1255-1263.

Ochocinska MJ & Hitchcock PF (2007) Dynamic expression of the basic helix-loop-helix transcription factor neuroD in the rod and cone photoreceptor lineages in the retina of the embryonic and larval zebrafish. J Comp Neurol 501: 1-12.

Oh EC, et al (2008) Rod differentiation factor NRL activates the expression of nuclear receptor NR2E3 to suppress the development of cone photoreceptors. Brain Res 1236: 16-29.

Oh EC, et al (2007) Transformation of cone precursors to functional rod photoreceptors by bZIP transcription factor NRL. Proc Natl Acad Sci U S A 104: 1679-1684.

Oliver G, Loosli F, Koster R, Wittbrodt J & Gruss P (1996) Ectopic lens induction in fish in response to the murine homeobox gene Six3. Mech Dev 60: 233-239.

Oliver G, et al (1995) Six3, a murine homologue of the sine oculis gene, demarcates the most anterior border of the developing neural plate and is expressed during eye development. Development 121: 4045-4055.

Onishi A, et al (2009) Pias3-dependent SUMOylation directs rod photoreceptor development. Neuron 61: 234-246.

Otteson DC & Hitchcock PF (2003) Stem cells in the teleost retina: Persistent neurogenesis and injury- induced regeneration. Vision Res 43: 927-936.

Otteson DC, Lai H, Liu Y & Zack DJ (2005) Zinc-finger domains of the transcriptional repressor KLF15 bind multiple sites in rhodopsin and IRBP promoters including the CRS-1 and G-rich repressor elements. BMC Mol Biol 6: 15.

Otteson DC, et al (2004) Kruppel-like factor 15, a zinc-finger transcriptional regulator, represses the rhodopsin and interphotoreceptor retinoid-binding protein promoters. Invest Ophthalmol Vis Sci 45: 2522-2530.

Packham EA & Brook JD (2003) T-box genes in human disorders. Hum Mol Genet 12 Spec No 1: R37- 44.

Pan Y, et al (2010) Regulation of photoreceptor gene expression by the retinal homeobox (rx) gene product. Dev Biol 339: 494-506.

Pan Y, Nekkalapudi S, Kelly LE & El-Hodiri HM (2006) The rx-like homeobox gene (rx-L) is necessary for normal photoreceptor development. Invest Ophthalmol Vis Sci 47: 4245-4253.

Papaioannou VE (2001) T-box genes in development: From hydra to humans. Int Rev Cytol 207: 1-70.

Paxton C, Zhao H, Chin Y, Langner K & Reecy J (2002) Murine Tbx2 contains domains that activate and repress gene transcription. Gene 283: 117-124.

Peng GH, Ahmad O, Ahmad F, Liu J & Chen S (2005) The photoreceptor-specific nuclear receptor Nr2e3 interacts with crx and exerts opposing effects on the transcription of rod versus cone genes. Hum Mol Genet 14: 747-764.

Peng GH & Chen S (2005) Chromatin immunoprecipitation identifies photoreceptor transcription factor targets in mouse models of retinal degeneration: New findings and challenges. Vis Neurosci 22: 575-586.

Peterson RE, Fadool JM, McClintock J & Linser PJ (2001) Muller cell differentiation in the zebrafish neural retina: Evidence of distinct early and late stages in cell maturation. J Comp Neurol 429: 530-540.

Pignoni F, et al (1997) The eye-specification proteins so and eya form a complex and regulate multiple steps in drosophila eye development. Cell 91: 881-891.

Plageman TF,Jr & Yutzey KE (2005) T-box genes and heart development: Putting the "T" in heart. Dev Dyn 232: 11-20.

Plaza S, Dozier C, Turque N & Saule S (1995) Quail pax-6 (pax-QNR) mRNAs are expressed from two promoters used differentially during retina development and neuronal differentiation. Mol Cell Biol 15: 3344-3353.

Postlethwait J, Amores A, Cresko W, Singer A & Yan YL (2004) Subfunction partitioning, the teleost radiation and the annotation of the human genome. Trends Genet 20: 481-490.

Qian J, et al (2005) Identification of regulatory targets of tissue-specific transcription factors: Application to retina-specific gene regulation. Nucleic Acids Res 33: 3479-3491.

Raymond PA, Barthel LK & Curran GA (1995) Developmental patterning of rod and cone photoreceptors in embryonic zebrafish. J Comp Neurol 359: 537-550.

Raymond PA, Barthel LK, Rounsifer ME, Sullivan SA & Knight JK (1993) Expression of rod and cone visual pigments in goldfish and zebrafish: A rhodopsin-like gene is expressed in cones. Neuron 10: 1161-1174.

Reh TA & Cagan RL (1994) Intrinsic and extrinsic signals in the developing vertebrate and fly eyes: Viewing vertebrate and invertebrate eyes in the same light. Perspect Dev Neurobiol 2: 183-190.

Rehemtulla A, et al (1996) The basic motif-leucine zipper transcription factor nrl can positively regulate rhodopsin gene expression. Proc Natl Acad Sci U S A 93: 191-195.

Ribeiro I, et al (2007) Tbx2 and Tbx3 regulate the dynamics of cell proliferation during heart remodeling. PLoS ONE 2: e398.

Roberts C, Ivins S, Cook AC, Baldini A & Scambler PJ (2006) Cyp26 genes a1, b1 and c1 are down- regulated in Tbx1 null mice and inhibition of Cyp26 enzyme function produces a phenocopy of DiGeorge syndrome in the chick. Hum Mol Genet 15: 3394-3410.

Roberts MR, Hendrickson A, McGuire CR & Reh TA (2005) Retinoid X receptor (gamma) is necessary to establish the S-opsin gradient in cone photoreceptors of the developing mouse retina. Invest Ophthalmol Vis Sci 46: 2897-2904.

Robinson J, Schmitt EA, Harosi FI, Reece RJ & Dowling JE (1993) Zebrafish ultraviolet visual pigment: Absorption spectrum, sequence, and localization. Proc Natl Acad Sci U S A 90: 6009-6012.

Ruvinsky I, Oates AC, Silver LM & Ho RK (2000) The evolution of paired appendages in vertebrates: T-box genes in the zebrafish. Dev Genes Evol 210: 82-91.

Schmitt EA & Dowling JE (1999) Early retinal development in the zebrafish, danio rerio: Light and electron microscopic analyses. J Comp Neurol 404: 515-536.

Schmitt EA & Dowling JE (1996) Comparison of topographical patterns of ganglion and photoreceptor cell differentiation in the retina of the zebrafish, danio rerio. J Comp Neurol 371: 222-234.

Schmitt EA & Dowling JE (1994) Early eye morphogenesis in the zebrafish, brachydanio rerio. J Comp Neurol 344: 532-542.

Seimiya M & Gehring WJ (2000) The drosophila homeobox gene optix is capable of inducing ectopic eyes by an eyeless-independent mechanism. Development 127: 1879-1886.

Seo HC, Curtiss J, Mlodzik M & Fjose A (1999) Six class homeobox genes in drosophila belong to three distinct families and are involved in head development. Mech Dev 83: 127-139.

Seo HC, Drivenes O, Ellingsen S & Fjose A (1998) Transient expression of a novel Six3-related zebrafish gene during gastrulation and eye formation. Gene 216: 39-46.

Seo HC, Drivenes, Ellingsen S & Fjose A (1998) Expression of two zebrafish homologues of the murine Six3 gene demarcates the initial eye primordia. Mech Dev 73: 45-57.

Serikaku MA & O'Tousa JE (1994) Sine oculis is a homeobox gene required for drosophila visual system development. Genetics 138: 1137-1150.

Shen YC & Raymond PA (2004) Zebrafish cone-rod (crx) homeobox gene promotes retinogenesis. Dev Biol 269: 237-251.

Shi Y & Yokoyama S (2003) Molecular analysis of the evolutionary significance of ultraviolet vision in vertebrates. Proc Natl Acad Sci U S A 100: 8308-8313.

Shirai M, Imanaka-Yoshida K, Schneider MD, Schwartz RJ & Morisaki T (2009) T-box 2, a mediator of bmp-smad signaling, induced hyaluronan synthase 2 and Tgfbeta2 expression and endocardial cushion formation. Proc Natl Acad Sci U S A 106: 18604-18609.

Singh R, et al (2009) Tbx20 interacts with smads to confine tbx2 expression to the atrioventricular canal. Circ Res 105: 442-452.

Sirbu IO, Zhao X & Duester G (2008) Retinoic acid controls heart anteroposterior patterning by down- regulating Isl1 through the Fgf8 pathway. Dev Dyn 237: 1627-1635.

Smith ST & Jaynes JB (1996) A conserved region of engrailed, shared among all en-, gsc-, Nk1-, Nk2- and msh-class homeoproteins, mediates active transcriptional repression in vivo. Development 122: 3141-3150.

Snelson CD, Santhakumar K, Halpern ME & Gamse JT (2008) Tbx2b is required for the development of the parapineal organ. Development 135: 1693-1702.

Sowden JC, Holt JK, Meins M, Smith HK & Bhattacharya SS (2001) Expression of drosophila omb- related T-box genes in the developing human and mouse neural retina. Invest Ophthalmol Vis Sci 42: 3095-3102.

Srinivas M, Ng L, Liu H, Jia L & Forrest D (2006) Activation of the blue opsin gene in cone photoreceptor development by retinoid-related orphan receptor beta. Mol Endocrinol 20: 1728- 1741.

Streisinger G, Walker C, Dower N, Knauber D & Singer F (1981) Production of clones of homozygous diploid zebra fish (brachydanio rerio). Nature 291: 293-296.

Suh CS, et al (2010) Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins. FEBS J 277: 1761-1775.

Swaroop A, Kim D & Forrest D (2010) Transcriptional regulation of photoreceptor development and homeostasis in the mammalian retina. Nat Rev Neurosci 11: 563-576.

Swaroop A, et al (1992) A conserved retina-specific gene encodes a basic motif/leucine zipper domain. Proc Natl Acad Sci U S A 89: 266-270.

Takechi M, Hamaoka T & Kawamura S (2003) Fluorescence visualization of ultraviolet-sensitive cone photoreceptor development in living zebrafish. FEBS Lett 553: 90-94.

Toy J, Yang JM, Leppert GS & Sundin OH (1998) The optx2 homeobox gene is expressed in early precursors of the eye and activates retina-specific genes. Proc Natl Acad Sci U S A 95: 10643- 10648.

Treisman JE, Morabito MA & Barnstable CJ (1988) Opsin expression in the rat retina is developmentally regulated by transcriptional activation. Mol Cell Biol 8: 1570-1579.

Trimarchi JM, Stadler MB & Cepko CL (2008) Individual retinal progenitor cells display extensive heterogeneity of gene expression. PLoS One 3: e1588.

Vihtelic TS, Doro CJ & Hyde DR (1999) Cloning and characterization of six zebrafish photoreceptor opsin cDNAs and immunolocalization of their corresponding proteins. Vis Neurosci 16: 571- 585.

Vihtelic TS, et al (2005) Expressed sequence tag analysis of zebrafish eye tissues for NEIBank. Mol Vis 11: 1083-1100.

Wakker V, et al (2010) Generation of mice with a conditional null allele for Tbx2. Genesis 48: 195-199.

Wallis DE, et al (1999) Mutations in the homeodomain of the human SIX3 gene cause holoprosencephaly. Nat Genet 22: 196-198.

Wargelius A, Seo HC, Austbo L & Fjose A (2003) Retinal expression of zebrafish six3.1 and its regulation by Pax6. Biochem Biophys Res Commun 309: 475-481.

Weasner B, Salzer C & Kumar JP (2007) Sine oculis, a member of the SIX family of transcription factors, directs eye formation. Dev Biol 303: 756-771.

Westerfield M (1995) The zebrafish book, (University of Oregon Press, Eugene)

Whitaker SL & Knox BE (2004) Conserved transcriptional activators of the xenopus rhodopsin gene. J Biol Chem 279: 49010-49018.

Wienholds E, et al (2003) Efficient target-selected mutagenesis in zebrafish. Genome Res 13: 2700- 2707.

Yanagi Y, Takezawa S & Kato S (2002) Distinct functions of photoreceptor cell-specific nuclear receptor, thyroid hormone receptor beta2 and CRX in one photoreceptor development. Invest Ophthalmol Vis Sci 43: 3489-3494.

Yurco P & Cameron DA (2005) Responses of muller glia to retinal injury in adult zebrafish. Vision Res 45: 991-1002.

Zhang T, et al (2003) The regulation of retina specific expression of rhodopsin gene in vertebrates. Gene 313: 189-200.

Zhu CC, et al (2002) Six3-mediated auto repression and eye development requires its interaction with members of the groucho-related family of co-repressors. Development 129: 2835-2849.

Zhu FX, King SM, Smith EJ, Levy DE & Yuan Y (2002) A kaposi's sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc Natl Acad Sci U S A 99: 5573-5578.

Zuber ME, Perron M, Philpott A, Bang A & Harris WA (1999) Giant eyes in xenopus laevis by overexpression of XOptx2. Cell 98: 341-352.

BIOGRAPHICAL SKETCH

Karen Alvarez-Delfín M.Sc., Ph.D.

EDUCATION

Ph.D. in Cell and Molecular Biology, June 2011 Department of Biological Science Florida State University, Florida, USA.

M.Sc. in Biochemical Sciences, July 2004 Institute for Cell Physiology Universidad Nacional Autónoma de México, México City, México.

B.Sc. in Biochemistry, July 1996 Biology Department University of Havana, Havana, Cuba.

PUBLICATIONS

Alvarez-Delfin K, Morris AC, Snelson CD, Gamse JT, Gupta T, Marlow FL, Mullins MC, Burgess HA, Granato M, Fadool JM (2009) tbx2b is required for ultraviolet photoreceptor cell specification during zebrafish retinal development. Proc. Natl. Acad. Sci. U S A 106: 2023-2028. Cano-Domínguez N, Alvarez-Delfin K, Hansberg W, Aguirre J (2008) NADPH oxidases NOX-1 and NOX-2 require the regulatory subunit NOR-1 to control cell differentiation and growth in Neurospora crassa. J. Eukaryot Cell. Aug; 7(8):1352-61. (Master’s thesis) Fernández C, Alvarez K, Muy L, Mar M. (1998) Detection of Mycoplasma hominis and Ureaplasma urealyticum in urogenital samples using molecular biology techniques. Revista Argentina de Microbiología Vol.30 No.2. (Bachelor’s thesis)

HONORS AND AWARDS

Ruth L. Kirschstein National Research Service Award (NRSA) Individual Predoctoral Fellowship from the National Eye Institute, NIH, 2010-2011 (one year funding) Leslie N. Wilson-Delores Auzenne Assistantship, FSU, USA, 2010-2011 (one year funding) Margaret Menzel Award for Outstanding Graduate Student, Department of Biological Science, FSU, USA, 2010 Travel Award 2010 Meeting of the Association for Research in Vision and Ophthalmology (ARVO), USA, 2010 Zebrafish Retina: The Year’s Most Amazing Scientific Images, Popular Science Magazine, USA, 2009 Graduate Student Publication Award, Department of Biological Science, FSU, USA, 2009 National Eye Institute Tuition and Travel Scholarship, Fundamental Issues in Vision Research Course. Marine Biological Laboratory (MBL), Woods Hole, USA, 2006 B. W. Robinson Memorial Endowment for the Neurosciences Award, Tallahassee Memorial Foundation, USA, 2006 Dissertation Research Grant, Florida State University, USA, 2005 Latin-American Caribbean Scholarship. Florida State University, USA, 2005 Tuition and Stipend Scholarship from the Postgraduate Studies Department of the Universidad Nacional Autónoma de México, México, 2002-2004 Latin-American Network of Tuberculosis Fellowship, United Nation University, Universidad Nacional Autónoma de México, Cuba-México, 1999 Gold Medal from the University of Havana for graduating from B.S. with a GPA over 4.8 (maximum is 5.0), Cuba, 1996

TEACHING EXPERIENCE

Teaching Assistant for Molecular Biology Laboratory. Professor: Dr. Laura R. Keller, 2006 Teaching Assistant for Biological Sciences I. Professor: Dr. Ann C. Morris, 2006 Teaching Assistant for Animal Development. Professor: Dr. James M. Fadool, 2006 Teaching Assistant for General Genetics. Professor: Dr. James M. Fadool, 2005