DOCSLIB.ORG

Coordinated Repression of Cell Cycle Genes by KDM5A and E2F4 During Differentiation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Coordinated Repression of Cell Cycle Genes by KDM5A and E2F4 During Differentiation Coordinated repression of cell cycle genes by KDM5A and E2F4 during differentiation Michael L. Beshiria,1, Katherine B. Holmesa,1, William F. Richtera, Samuel Hessa, Abul B. M. M. K. Islama,b, Qin Yanc, Lydia Planted, Larisa Litovchicke, Nicolas Gévryd, Nuria Lopez-Bigasb,f, William G. Kaelin, Jr.e,2, and Elizaveta V. Benevolenskayaa,2 aDepartment of Biochemistry and Molecular Genetics, University of Illinois, Chicago, IL 60607; bResearch Unit on Biomedical Informatics, Department of Experimental and Health Sciences, Universitat Pompeu Fabra, 08003 Barcelona, Spain; cDepartment of Pathology, Yale University School of Medicine, New Haven, CT 06520; dDépartement de biologie, Faculté des sciences, Université de Sherbrooke, Sherbrooke, QC, Canada J1K 2R1; eDepartment of Medical Oncology, Dana–Farber Cancer Institute and Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and fInstitució Catalana de Recerca i Estudis Avançats (ICREA), Passeig Lluis Companys, 08010 Barcelona, Spain Contributed by William G. Kaelin, Jr., September 27, 2012 (sent for review August 10, 2012) Epigenetic regulation underlies the robust changes in gene expres- role in human tumors, most of which carry mutations in the RB sion that occur during development. How precisely epigenetic pathway. During cell cycle progression, pRB and the related pro- enzymes contribute to development and differentiation processes teins p107 and p130 (collectively called “pocket” proteins) are pe- is largely unclear. Here we show that one of the enzymes that riodically and reversibly recruited to E2F target genes, accompanied removes the activating epigenetic mark of trimethylated lysine 4 on by recruitment of histone deacetylase Sin3/HDAC and chromatin- histone H3, lysine (K)-specific demethylase 5A (KDM5A), reinforces remodeling activities (2). In the Go/quiescent state, the repression the effects of the retinoblastoma (RB) family of transcriptional of cell cycle genes is mediated by the DP, RB, E2F, and MuvB (DREAM) complex that contains p130 and E2F4 (3). repressors on differentiation. Global location analysis showed that Here we show that the histone demethylase KDM5A is KDM5A cooccupies a substantial portion of target genes with the recruited to genes experiencing strong repression during the E2F4 transcription factor. During ES cell differentiation, knockout of course of differentiation, and that these genes are also occupied KDM5A resulted in derepression of multiple genomic loci that are by components of the DREAM complex. Using high-resolution targets of KDM5A, denoting a direct regulatory function. In termi- ChIP-seq analysis, we found that KDM5A preferentially binds to nally differentiated cells, common KDM5A and E2F4 gene targets the TSS regions. Using cells where KDM5A expression level was were bound by the pRB-related protein p130, a DREAM complex decreased either by RNA inhibition or by using null and condi- component. KDM5A was recruited to the transcription start site tional (floxed) KDM5A alleles, we show that KDM5A is critical for regions independently of E2F4; however, it cooperated with E2F4 H3K4 demethylation and repression of cell cycle genes. Differ- to promote a state of deepened repression at cell cycle genes during entiation time-course experiments showed a prominent recruit- differentiation. These findings reveal a critical role of H3K4 deme- ment of both KDM5A and E2F4 during later stages to specific thylation by KDM5A in the transcriptional silencing of genes that are genomic loci. Importantly, the recruitment of KDM5A and E2F4 suppressed by RB family members in differentiated cells. was independent of one another. Specifically, E2F4 knockdown did not abolish KDM5 recruitment and H3K4 demethylation, and chromatin | histone demethylase | whole-genome sequencing | KDM5A knockdown did not affect E2F4 recruitment and histone histone methylation acetylation. Nevertheless, KDM5A and E2F4 cooperated at cell cycle genes to enforce transcriptional repression. egulation of gene expression is accomplished by transcription Results Rfactors, histone-modifying enzymes, and chromatin remodeling fi machinery. The combined action of these three has been implicated ChIP-Seq Analysis for KDM5A Identi es Common Targets with E2F4. We previously showed that mouse ES cells lacking KDM5A are in a number of biological processes, including cell cycle control, fi development, reprogramming, differentiation, and aging. Deregu- signi cantly impaired with respect to differentiation (4). To de- lation of chromatin-modifying enzymes has been strongly linked to termine KDM5A targets genome-wide, we performed ChIP-seq the development of cancer. For example, two enzymes that regulate experiments in two different clones of mouse ES cells with a con- ditional (floxed) KDM5A allele (Kdm5af/f) and a clone where the methylation at the histone H3 lysine 4 (H3K4) residue, mixed lin- −/− eage leukemia-1 (MLL1) and lysine (K)-specific demethylase 5A KDM5A allele was deleted (Kdm5a ). As expected, we were un- fi able to detect a significant enrichment of bound DNA in ChIP-seq (KDM5A), have been identi ed in translocations associated with −/− fi fi human leukemia. H3K4 histone methylation states exhibit a highly samples from Kdm5a cells, con rming high speci city of the fi KDM5A antibody. We detected 3,093 regions bound by KDM5A distinct distribution pattern in the genome. Speci cally, H3K4 tri- f/f methylation (H3K4me3) is strongly associated with transcriptional in Kdm5a cells (Datasets S1 and S2). Relating KDM5A-bound activation, with the highest levels observed near transcriptional regions to known mouse genes showed that KDM5A is preferen- start sites (TSS). In vitro studies suggest that the four KDM5 tially bound at TSS regions, especially among the top 5% most- enzymes (KDM5A, KDM5B, KDM5C, and KDM5D) are able to highly expressed genes (Fig. 1A). To determine whether direct remove methylation at lysine 4 of histone H3, and in vivo KDM5A and KDM5B may be recruited to common gene regions (1). This finding leads to multiple questions: (i) Do KDM5 proteins play Author contributions: W.G.K. and E.V.B. designed research; M.L.B., K.B.H., W.F.R., S.H., a role in gene regulation by transcription factors? (ii) Are KDM5 and E.V.B. performed research; M.L.B., K.B.H., Q.Y., L.P., N.G., W.G.K., and E.V.B. contrib- GENETICS enzymes nonredundant H3K4 demethylases? uted new reagents/analytic tools; M.L.B., K.B.H., A.B.M.M.K.I., L.L., N.L.-B., and E.V.B. During differentiation, cells exhibit two novel properties: re- analyzed data; and M.L.B., W.G.K., and E.V.B. wrote the paper. pression of cell cycle genes associated with permanent cell cycle The authors declare no conflict of interest. exit and activation of cell type-specific genes. Histone mod- Data deposition: The data reported in this paper have been deposited in the Gene Ex- ifications are thought to be important epigenetic events intimately pression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE28343). linked to initiation and maintenance of transcriptional changes for 1M.L.B. and K.B.H. contributed equally to this work. both of these processes. Cell cycle exit is associated with repression 2To whom correspondence may be addressed. E-mail: [email protected] or of a large group of genes, many of which are targets of the tran- [email protected]. scription factor complex between the retinoblastoma protein (pRB) This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. and E2F. Derepression of pRB/E2F target genes plays an important 1073/pnas.1216724109/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1216724109 PNAS | November 6, 2012 | vol. 109 | no. 45 | 18499–18504 Downloaded by guest on October 1, 2021 Fig. 1. KDM5A ChIP-seq analysis in mouse ES cells reveals corecruitment of KDM5A and E2F4. (A) Av- erage KDM5A enrichment near TSS and in genic region. Genic regions are presented as a 3-kb-long metagene surrounded by a 1-kb region upstream TSS and 1-kb downstream region from transcription termination site (TTS). Dotted lines show TSS and TTS. Most KDM5A binding occurs at the TSS. High TSS ChIP signal is observed for KDM5A reads in the top 5% expressed genes compared with the bottom 5% expressed genes (expression data from GEO GSE5914). A drop in the signal occurs near the TTS, probably because of nucleosome depletion. (B) − − KDM5A targets in Kdm5a / ES cells are differen- tially expressed. Gene expression microarray data were generated from ES cells that were induced to differentiate by leukemia inhibitory factor (LIF) withdrawal (4). Change in expression for each gene − − was determined in Kdm5a / (KO) versus normal Kdm5af/f (FF) cells (Dataset S3). Box-and-whisker plots show distribution of Log2 fold-change values for genes associated with the classified KDM5A peaks (in relation to the closest gene as distal, promoter, TSS, gene body, or downstream regions). Solid bars of boxes display the 25–75% of ranked genes, with the median indicated as an intersection. The yellow bars depicting the expression changes that occur in differentiated cells in the group with KDM5A bound at the TSS are shifted toward higher values, indicating activation of this group of genes, which is statistically significant as determined by Wilcoxon rank sum test (Dataset S4). (C) KDM5A and E2F4 bind to many common genes. The Venn diagram shows the overlap between KDM5A tar- gets (present study) and E2F4 targets (5). (D) En- richment analysis for common and distinct target genes shows relations to GO terms and KEGG pathways. Corrected (false-discovery rate) P values are delineated in a colored heatmap, where red signifies overrepresentation of targets in a particu- lar term. All large GO and KEGG groups with over- representation are shown. KDM5A targets are changed in expression in cells lacking KDM5A, “overlap” in Fig. 1D). KDM5A also bound multiple genes that we further analyzed previously acquired gene-expression data (4). were not direct targets of E2F4, yet these genes still participated in We found differences in expression of multiple KDM5A-bound functions linked to genes regulated by both factors.
Load more

Recommended publications
  • Hypoxia and Hormone-Mediated Pathways Converge at the Histone Demethylase KDM4B in Cancer
    International Journal of Molecular Sciences Review Hypoxia and Hormone-Mediated Pathways Converge at the Histone Demethylase KDM4B in Cancer Jun Yang 1,* ID , Adrian L. Harris 2 and Andrew M. Davidoff 1 1 Department of Surgery, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105, USA; [email protected] 2 Molecular Oncology Laboratories, Department of Oncology, Weatherall Institute of Molecular Medicine, University of Oxford, Oxford OX3 9DS, UK; [email protected] * Correspondence: [email protected] Received: 19 December 2017; Accepted: 9 January 2018; Published: 13 January 2018 Abstract: Hormones play an important role in pathophysiology. The hormone receptors, such as estrogen receptor alpha and androgen receptor in breast cancer and prostate cancer, are critical to cancer cell proliferation and tumor growth. In this review we focused on the cross-talk between hormone and hypoxia pathways, particularly in breast cancer. We delineated a novel signaling pathway from estrogen receptor to hypoxia-inducible factor 1, and discussed the role of this pathway in endocrine therapy resistance. Further, we discussed the estrogen and hypoxia pathways converging at histone demethylase KDM4B, an important epigenetic modifier in cancer. Keywords: estrogen receptor alpha; hypoxia-inducible factor 1; KDM4B; endocrine therapy resistance 1. Introduction A solid tumor is a heterogeneous mass that is comprised of not only genetically and epigenetically distinct clones, but also of areas with varying degree of hypoxia that result from rapid cancer cell proliferation that outgrows its blood supply. To survive in hostile hypoxic environments, cancer cells decelerate their proliferation rate, alter metabolism and cellular pH, and induce angiogenesis [1].
    [Show full text]
  • Tumor Mutation Burden and JARID2 Gene Alteration Are Associated with Short Disease-Free Survival in Locally Advanced Triple-Negative Breast Cancer
    1052 Original Article Page 1 of 13 Tumor mutation burden and JARID2 gene alteration are associated with short disease-free survival in locally advanced triple-negative breast cancer Xiangmei Zhang1#^, Jingping Li2#, Qing Yang1, Yanfang Wang3, Xinhui Li1, Yunjiang Liu2, Baoen Shan1 1Research Center, 2Breast Cancer Center, 3Medical Center, Fourth Hospital of Hebei Medical University, Shijiazhuang, China Contributions: (I) Conception and design: Y Liu, B Shan; (II) Administrative support: X Zhang, J Li; (III) Provision of study materials: X Zhang, J Li; (IV) Collection and assembly of data: Y Wang, Q Yang, X Li; (V) Data analysis and interpretation: X Zhang, J Li, Y Liu, B Shan; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors have contributed equally to this work. Correspondence to: Yunjiang Liu. Breast Cancer Center, Fourth Hospital of Hebei Medical University, Shijiazhuang, China. Email: [email protected]; Baoen Shan. Research Center, Fourth Hospital of Hebei Medical University, Shijiazhuang, China. Email: [email protected]. Background: In locally advanced triple-negative breast cancer (TNBC), patients who did not achieve pathologic complete response (non-pCR) after neoadjuvant chemotherapy develop rapid tumor metastasis. Tumor mutation burden (TMB) is a potential biomarker of cancer therapy, though whether it is applicable to TNBC is still unclear. Methods: A total of 14 non-pCR TNBC patients were enrolled, and tissue samples from radical operation were collected. Of these, 7 cases developed disease progression within 12 months after operation [short disease-free survival (short DFS)], while others showed longer DFS over 1 year (long DFS). Next generation sequencing (NGS) analysis targeting 422 cancer-related genes and in vitro studies were performed.
    [Show full text]
  • KDM5B Promotes Drug Resistance by Regulating Melanoma-Propagating Cell Subpopulations Xiaoni Liu1,2, Shang-Min Zhang1, Meaghan K
    Published OnlineFirst December 6, 2018; DOI: 10.1158/1535-7163.MCT-18-0395 Cancer Biology and Translational Studies Molecular Cancer Therapeutics KDM5B Promotes Drug Resistance by Regulating Melanoma-Propagating Cell Subpopulations Xiaoni Liu1,2, Shang-Min Zhang1, Meaghan K. McGeary1,2, Irina Krykbaeva1,2, Ling Lai3, Daniel J. Jansen4, Stephen C. Kales4, Anton Simeonov4, Matthew D. Hall4, Daniel P. Kelly3, Marcus W. Bosenberg1,2,5, and Qin Yan1 Abstract Tumor heterogeneity is a major challenge for cancer elevated KDM5B expression, melanoma cells shift toward a À treatment, especially due to the presence of various sub- more drug-tolerant, CD34 state upon exposure to BRAF populations with stem cell or progenitor cell properties. inhibitor or combined BRAF inhibitor and MEK inhibitor þ À þ In mouse melanomas, both CD34 p75 (CD34 )and treatment. KDM5B loss or inhibition shifts melanoma cells À À À þ CD34 p75 (CD34 ) tumor subpopulations were charac- to the more BRAF inhibitor–sensitive CD34 state. These terized as melanoma-propagating cells (MPC) that exhibit results support that KDM5B is a critical epigenetic regulator some of those key features. However, these two subpopula- that governs the transition of key MPC subpopulations tions differ from each other in tumorigenic potential, with distinct drug sensitivity. This study also emphasizes ability to recapitulate heterogeneity, and chemoresistance. the importance of continuing to advance our understand- þ À In this study, we demonstrate that CD34 and CD34 ing of intratumor heterogeneity and ultimately develop V600E subpopulations carrying the BRAF mutation confer novel therapeutics by altering the heterogeneous character- differential sensitivity to targeted BRAF inhibition.
    [Show full text]
  • Imidazopyridines As Potent KDM5 Demethylase Inhibitors Promoting Reprogramming Efficiency of Human Ipscs
    Article Imidazopyridines as Potent KDM5 Demethylase Inhibitors Promoting Reprogramming Efficiency of Human iPSCs Yasamin Dabiri, Rodrigo A. Gama- Brambila, Katerina Taskova, ..., Jichang Wang, Miguel A. Andrade-Navarro, Xinlai Cheng [email protected] HIGHLIGHTS O4I3 supports the maintenance and generation of human iPSCs O4I3 is a potent H3K4 demethylase KDM5 inhibitor in vitro and in cells KDM5A, but not KDM5B, serves as an epigenetic barrier of reprogramming Chemical or genetic inhibition of KDM5A tends to promote the reprogramming efficiency Dabiri et al., iScience 12,168– 181 February 22, 2019 ª 2019 The Author(s). https://doi.org/10.1016/ j.isci.2019.01.012 Article Imidazopyridines as Potent KDM5 Demethylase Inhibitors Promoting Reprogramming Efficiency of Human iPSCs Yasamin Dabiri,1 Rodrigo A. Gama-Brambila,1 Katerina Taskova,2,3 Kristina Herold,4 Stefanie Reuter,4 James Adjaye,5 Jochen Utikal,6 Ralf Mrowka,4 Jichang Wang,7 Miguel A. Andrade-Navarro,2,3 and Xinlai Cheng1,8,* SUMMARY Pioneering human induced pluripotent stem cell (iPSC)-based pre-clinical studies have raised safety concerns and pinpointed the need for safer and more efficient approaches to generate and maintain patient-specific iPSCs. One approach is searching for compounds that influence pluripotent stem cell reprogramming using functional screens of known drugs. Our high-throughput screening of drug-like hits showed that imidazopyridines—analogs of zolpidem, a sedative-hypnotic drug—are able to improve reprogramming efficiency and facilitate reprogramming of resistant human primary fibro- blasts. The lead compound (O4I3) showed a remarkable OCT4 induction, which at least in part is 1Institute of Pharmacy and due to the inhibition of H3K4 demethylase (KDM5, also known as JARID1).
    [Show full text]
  • Generation and Characterization of a Gene Trap and Conditional Lin9
    The Role of LIN9 in Mouse Development Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Nina Reichert aus Marburg an der Lahn Würzburg, 2008 Eingereicht am: ............................................................................................ Mitglieder der Promotionskommission: Vorsitzender: 1. Gutachter: Prof. Dr. Stefan Gaubatz 2. Gutachter: Prof. Dr. Thomas Brand Tag des Promotionskolloquiums: ............................................................................................ Doktorurkunde ausgehändigt am: ............................................................................................ Für meine Familie & Oliver Content I 1 INTRODUCTION ........................................................................................................................1 1.1 Cell Cycle & its Regulators ...................................................................................................1 1.1.1 Mammalian Cell Cycle .............................................................................................................. 1 1.1.2 Cyclins & CDKs ........................................................................................................................ 2 1.1.3 pRB/E2F Pathway .................................................................................................................... 4 1.2 pRB/E2F Complexes in Model Organisms ...........................................................................5
    [Show full text]
  • Increased HOXA5 Expression Provides a Selective Advantage for Gain of Whole Chromosome 7 in IDH Wild-Type Glioblastoma
    Downloaded from genesdev.cshlp.org on May 11, 2018 - Published by Cold Spring Harbor Laboratory Press Increased HOXA5 expression provides a selective advantage for gain of whole chromosome 7 in IDH wild-type glioblastoma Patrick J. Cimino,1,2,17 Youngmi Kim,1,17 Hua-Jun Wu,3,4,5 Jes Alexander,1 Hans-Georg Wirsching,1,6 Frank Szulzewsky,1 Ken Pitter,7 Tatsuya Ozawa,1,8 Jiguang Wang,9,10,16 Julio Vazquez,11 Sonali Arora,1 Raul Rabadan,9,10 Ross Levine,12 Franziska Michor,3,4,5,13,14,15 and Eric C. Holland1 1Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109, USA; 2Department of Pathology, Division of Neuropathology, University of Washington, Seattle, Washington 98104, USA; 3Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02215, USA; 4Department of Biostatistics, Harvard T.H. Chan School of Public Health, Boston, Massachusetts 02115, USA; 5Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, Massachusetts 02138, USA; 6Department of Neurology, University Hospital Zurich, Zurich 8091, Switzerland; 7Department of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, New York 10065, USA; 8Division of Brain Tumor Translational Research, National Cancer Center Research Institute, Tokyo 104-0045, Japan; 9Department of Biomedical Informatics, Columbia University, New York, New York 10027, USA; 10Department of Systems Biology, Columbia University, New York,
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung
    Published OnlineFirst December 12, 2014; DOI: 10.1158/1535-7163.MCT-14-0492 Cancer Biology and Signal Transduction Molecular Cancer Therapeutics Long Noncoding RNA ANRIL Promotes Non–Small Cell Lung Cancer Cell Proliferation and Inhibits Apoptosis by Silencing KLF2 and P21 Expression Feng-qi Nie1, Ming Sun2, Jin-song Yang3, Min Xie2, Tong-peng Xu1, Rui Xia2, Yan-wen Liu2, Xiang-hua Liu2, Er-bao Zhang2, Kai-hua Lu1, and Yong-qian Shu1 Abstract Recent evidence highlights long noncoding RNAs (lncRNA) was increased in NSCLC tissues, and its expression level was as crucial regulators of cancer biology that contribute to essen- significantly correlated with tumor–node–metastasis stages and tial cancer cell functions such as cell proliferation, apoptosis, tumor size. Moreover, patients with high levels of ANRIL and metastasis. In non–small cell lung cancer (NSCLC), several expression had a relatively poor prognosis. In addition, taking lncRNAs' expressions are misregulated and have been nomi- advantage of loss-of-function experiments in NSCLC cells, we nated as critical actors in NSCLC tumorigenesis. LncRNA ANRIL found that knockdown of ANRIL expression could impair cell was first found to be required for the PRC2 recruitment to and proliferation and induce cell apoptosis both in vitro and vivo. silencing of p15INK4B, the expression of which is induced by the Furthermore, we uncover that ANRIL could not repress p15 ATM–E2F1 signaling pathway. Our previous study showed that expression in PC9 cells, but through silencing of KLF2 and P21 ANRIL was significantly upregulated in gastric cancer, and it transcription. Thus, we conclusively demonstrate that lncRNA could promote cell proliferation and inhibit cell apoptosis by ANRIL plays a key role in NSCLC development by associating silencing of miR99a and miR449a transcription.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • RBPJ/CBF1 Interacts with L3MBTL3/MBT1 to Promote Repression of Notch Signaling Via Histone Demethylase KDM1A/LSD1
    Published online: October 13, 2017 Article RBPJ/CBF1 interacts with L3MBTL3/MBT1 to promote repression of Notch signaling via histone demethylase KDM1A/LSD1 Tao Xu1,§, Sung-Soo Park1,§, Benedetto Daniele Giaimo2,§, Daniel Hall3, Francesca Ferrante2, Diana M Ho4, Kazuya Hori4,†, Lucas Anhezini5,‡, Iris Ertl6,¶, Marek Bartkuhn7, Honglai Zhang1, Eléna Milon1, Kimberly Ha1, Kevin P Conlon1, Rork Kuick8, Brandon Govindarajoo9, Yang Zhang9, Yuqing Sun1, Yali Dou1, Venkatesha Basrur1, Kojo SJ Elenitoba-Johnson1, Alexey I Nesvizhskii1,9, Julian Ceron6, Cheng-Yu Lee5, Tilman Borggrefe2, Rhett A Kovall3 & Jean-François Rual1,* Abstract Introduction Notch signaling is an evolutionarily conserved signal transduction The Notch signal transduction pathway is a conserved signaling pathway that is essential for metazoan development. Upon ligand mechanism that is fundamental for morphogenesis in multicellular binding, the Notch intracellular domain (NOTCH ICD) translocates organisms (Bray, 2006; Kopan & Ilagan, 2009; Hori et al, 2013). The into the nucleus and forms a complex with the transcription factor biological action of Notch is highly pleiotropic, and impaired Notch RBPJ (also known as CBF1 or CSL) to activate expression of Notch signaling leads to a broad spectrum of developmental disorders target genes. In the absence of a Notch signal, RBPJ acts as a tran- (Louvi & Artavanis-Tsakonas, 2012) and many types of cancer scriptional repressor. Using a proteomic approach, we identified (Aster et al, 2017). The developmental outcome of Notch signaling L3MBTL3 (also known as MBT1) as a novel RBPJ interactor. L3MBTL3 is strictly dependent on the cell context and can influence cell fate competes with NOTCH ICD for binding to RBPJ. In the absence of in a remarkable number of different ways, for example, differentia- NOTCH ICD, RBPJ recruits L3MBTL3 and the histone demethylase tion, proliferation, and apoptosis (Bray, 2006; Kopan & Ilagan, 2009; KDM1A (also known as LSD1) to the enhancers of Notch target Hori et al, 2013).
    [Show full text]
  • UC Riverside UC Riverside Electronic Theses and Dissertations
    UC Riverside UC Riverside Electronic Theses and Dissertations Title The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 Permalink https://escholarship.org/uc/item/25z876bc Author Wu, Wei Publication Date 2010 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA RIVERSIDE The Role of AMPK and miR-92a in the Shear Stress Regulation of KLF2 A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cellular, Molecular and Developmental Biology by Wei Wu December 2010 Dissertation Committee: Dr. John Shyy, Chairperson Dr. Ameae Walker Dr. Kathryn Defea Copyright by Wei Wu 2010 ii The Dissertation of Wei Wu is approved: ------------------------------------------ ------------------------------------------ ------------------------------------------ Committee Chairperson University of California, Riverside iii Acknowledgements It is a pleasure to thank those who made this dissertation possible. First of all, I would like to thank CMDB program for giving me the opportunity to pursue my Ph.D degree in UCR. A hearty thanks to Dr. Anthony W. Norman, Dr. Helen Henry and the professors who taught and encouraged me in these past years. I owe my deepest gratitude to my major professor, Dr. John Y-J. Shyy, for his guidance and support. I am also grateful to Dr. Ameae M. Walker and Dr. Kathryn Defea for their valuable discussions and constructive suggestions. I am thankful to all of my colleagues and friends for their generous help and precious discussion on my work. My parents and parents-in-law, thanks for your support and unconditional love. Even though we are thousand of miles away, you were always there whenever I needed you.
    [Show full text]