A Protein Associated with Toll-Like Receptor 4 (PRAT4A) Regulates Cell Surface Expression of TLR4

This information is current as Yasutaka Wakabayashi, Makiko Kobayashi, Sachiko of September 25, 2021. Akashi-Takamura, Natsuko Tanimura, Kazunori Konno, Koichiro Takahashi, Takashi Ishii, Taketoshi Mizutani, Hideo Iba, Taku Kouro, Satoshi Takaki, Kiyoshi Takatsu, Yoshiya Oda, Yasushi Ishihama, Shin-ichiroh Saitoh and Kensuke Miyake Downloaded from J Immunol 2006; 177:1772-1779; ; doi: 10.4049/jimmunol.177.3.1772 http://www.jimmunol.org/content/177/3/1772 http://www.jimmunol.org/ References This article cites 30 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/177/3/1772.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

A Protein Associated with Toll-Like Receptor 4 (PRAT4A) Regulates Cell Surface Expression of TLR41

Yasutaka Wakabayashi,*2 Makiko Kobayashi,*2 Sachiko Akashi-Takamura,* Natsuko Tanimura,* Kazunori Konno,* Koichiro Takahashi,* Takashi Ishii,* Taketoshi Mizutani,† Hideo Iba,† Taku Kouro,‡ Satoshi Takaki,‡ Kiyoshi Takatsu,‡ Yoshiya Oda,§ Yasushi Ishihama,§ Shin-ichiroh Saitoh,* and Kensuke Miyake*¶3

TLRs recognize microbial products. Their subcellular distribution is optimized for microbial recognition. Little is known, however, about mechanisms regulating the subcellular distribution of TLRs. LPS is recognized by the receptor complex consisting of TLR4 and MD-2. Although MD-2, a coreceptor for TLR4, enhances cell surface expression of TLR4, an additional mechanism

regulating TLR4 distribution has been suggested. We show here that PRAT4A, a novel protein associated with TLR4, regulates Downloaded from cell surface expression of TLR4. PRAT4A is associated with the immature form of TLR4 but not with MD-2 or TLR2. PRAT4A knockdown abolished LPS responsiveness in a cell line expressing TLR4/MD-2, probably due to the lack of cell surface TLR4. PRAT4A knockdown down-regulated cell surface TLR4/MD-2 on dendritic cells. These results demonstrate a novel mechanism regulating TLR4/MD-2 expression on the cell surface. The Journal of Immunology, 2006, 177: 1772–1779.

nnate immunity is the first line of defense against microbial LPS, one of the most immunostimulatory glycolipids constitut- http://www.jimmunol.org/ infection (1). The Toll family of receptors plays an essential ing the outer membrane of the Gram-negative bacteria, is recog- I role in innate recognition of microbial products (2). TLRs are nized by the receptor complex consisting of TLR4 and MD-2 (3, type I transmembrane proteins that contain a large, leucine-rich 11–14). MD-2 is an extracellular molecule that is associated with repeat in an extracellular region and a Toll/IL-1 receptor homology the extracellular domain of TLR4 and is indispensable for LPS domain in a cytoplasmic region (3). Cell surface TLRs, including recognition by TLR4 (15–18). TLR4/MD-2 is similar to TLR9 in TLR1, TLR2, TLR4, TLR5, and TLR6, recognize bacterial prod- that LPS can be recognized at the two distinct sites. TLR4/MD-2 ucts, whereas TLR3, TLR7, TLR8, and TLR9 reside in intracel- is expressed on the cell surface, and LPS recognition occurs on the lular organella and recognize microbial nucleic acids. These sub- cell surface in macrophage cells (19–21). In intestinal epithelial cells, cellular distributions of TLRs are optimized for microbial TLR4/MD-2 resides in the Golgi apparatus and recognizes internal- by guest on September 25, 2021 recognition. TLR5, e.g., is expressed exclusively on the basolateral ized LPS (20). Little is known about differences between LPS recog- surface of intestinal epithelia where pathogenic Salmonella, but nition/signaling on the cell surface and that in the Golgi apparatus. not commensal Escherichia coli, translocate TLR5 ligand flagellin Considering roles for TLR9 subcellular distribution in CpG recogni- across epithelia (4). The subcellular distribution of TLR9 is im- tion, it is possible that these LPS responses are distinct from each portant for sensing viral infection and differential recognition of other with regard to specificity or cytokine production. two distinct types of TLR9 ligands (5–8). A/D-type CpG is re- The subcellular distribution of TLR4 is reported to be regulated tained for long periods in the endosomal vesicles of plasmacytoid by two molecules, the endoplasmic reticulum (ER) chaperon gp96 dendritic cells (DCs),4 together with the complex consisting of and MD-2. Randow and Seed (22) described a pre-B cell line downstream signaling molecules (8), whereas the B/K-type CpG is deficient in the gp96 in which TLR4 failed to associate with MD-2, recognized by TLR9 in the lysosome (9, 10). get to the cell surface, and respond to LPS (22). We previously demonstrated that TLR4 alone is little expressed on the cell surface Ϫ/Ϫ *Division of Infectious Genetics, †Division of Host-Parasite Interaction, and ‡Divi- in MD-2 embryonic fibroblasts and that most TLR4s reside in sion of Immunology, Institute of Medical Science, University of Tokyo, Tokyo, Ja- ER or the Golgi apparatus without mature glycosylation, revealing pan; §Laboratory of Seeds Finding Technology, Eisai Co. Ltd., Tsukuba, Japan; and ¶ an important role for MD-2 in cell surface expression of TLR4 Core Research for Engineering, Science, and Technology, Japan Science and Tech- 526 nology Corporation, Tokyo, Japan (16). MD-2 association permits TLR4 glycosylation at Asn or 575 Received for publication February 15, 2006. Accepted for publication May 5, 2006. Asn , which facilitates cell surface expression of TLR4 (23). Despite an important role for MD-2 in cell surface expression of The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance TLR4, several studies claimed that TLR4 alone may be expressed with 18 U.S.C. Section 1734 solely to indicate this fact. on the cell surface without MD-2 in a human kidney cell line (10, 1 This study was supported by Special Coordination Funds of the Ministry of Edu- 24, 25), suggesting that another MD-2-like molecule regulates cation, Culture, Sports, Science and Technology of the Japanese Government, Uehara TLR4 trafficking to the cell surface. In this study we addressed this Memorial Foundation, the Takeda Foundation, and the Naito Foundation. issue and described a novel molecule that is associated with TLR4 2 Y.W. and M.K. contributed equally to this study. and regulates its expression on the cell surface. 3 Address correspondence and reprint requests to Dr. Kensuke Miyake, Division of Infectious Genetics, Institute of Medical Science, University of Tokyo, 4-6-1 Shiro- kanedai, Minatoku, Tokyo 108-8639, Japan. E-mail address: [email protected] Materials and Methods tokyo.ac.jp Reagents, cells, and mice 4 Abbreviations used in this paper: DC, dendritic cell; ER, endoplasmic reticulum; FH, Flag/His6 epitope; HPRT, hypoxanthine phosphoribosyltransferase; siRNA, Anti-Flag Ab and anti-Flag-agarose were purchased from Sigma-Aldrich. small interfering RNA; shRNA, short hairpin RNA. Rat anti-mouse TLR4 mAb (MTS510 and Sa15-21) and rat anti-mouse

CD14 (Sa2-8) were established in our laboratory and described previously ican Qualex) and goat anti-rat IgG-alkaline phosphatase conjugate (American (19). Pre-made Northern blot for mouse normal tissues was purchased from Qualex). Seegene. HEK293 cells were maintained in DMEM supplemented with 10% FCS and antibiotics. IL-3-dependent Ba/F3 cells were cultured in 10% Small interfering RNA ␮ FCS-RPMI 1640 supplemented with antibiotics, 100 M 2-ME, and re- To investigate the biological function of PRAT4A, we purchased an RNA ϳ combinant murine IL-3 ( 70 U/ml) at 37°C in a humidified atmosphere of interference duplex (Invitrogen Life Technologies). The oligonucleotide 5% CO2. A rat was immunized with the GST-PRAT4A (protein associated sequences of target sequences for human and mouse PRAT4A were ggag with TLR4A) fusion protein and used for hybridoma production. The anti gaagaccugacugaauuccuc (sense strand sequence for human PRAT4A, no.9) PRAT4A mAb (542; rat IgG) can be used for immunoprobing. Ϫ/Ϫ and accugacugaauuccucugcgccaa (sense strand sequence for mouse C57BL/6 mice were purchased from Japan SLC. TLR4 mice were PRAT4A, no.11). Sequence-scrambled negative controls for no.9 and kindly provided by Dr. S. Akira (Osaka University, Osaka, Japan), and Ϫ/Ϫ no.11 were ggaagaaguccgucauuaacggcuc and accgucauuaacuccgcgucgu MD-2 mice were established in our own laboratory (16). These mice caa, respectively. HEK293 transfectants were seeded onto 24- or 6-well were maintained in the animal facility at the Institute of Medical Science, plates in antibiotic-free medium on the day before RNA interference the University of Tokyo, Tokyo, Japan. Bone marrow-derived DCs and transfection. LipofectAMINE 2000 (Invitrogen Life Technologies) was macrophages were prepared as described previously (16). Briefly, bone used as a transfection reagent. Cells were collected 3–4 days after trans- ϫ 6 marrow cells were plated at 1 10 cells/ml in 24-well plates with 10% fection and used for further analyses. FCS-RPMI 1640 supplemented with 10 ng/ml recombinant murine GM- To inhibit mouse PRAT4A expression, we produced a retroviral vector CSF (Genzyme/Techne) or 100 ng/ml recombinant murine macrophage expressing shRNA (26). The target sequences was 5Ј-gag ttt gaa gag gtg att CSF (M-CSF) (Genzyme/Techne). On day 7, cells were harvested and used gag-3Ј. for flow cytometry. For retroviral transduction, bone marrow cells during DC induction were transduced on days 1, 3, and 5 with retroviruses and 25 RNA extract and Northern hybridization ␮lofN-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-

Premade Northern blot for mouse normal tissues was purchased from See- Downloaded from sulfate (DOTAP) transfection reagent (Roche) and centrifuged at 2000 rpm 32 for1hatroom temperature. After centrifugation, cells were cultured in gene. The RNA blot was hybridized with a P-labeled cDNA probe en- 10% FCS-RPMI1640 supplemented with GM-CSF and cultured at 37°C in coding mouse PRAT4A (from aa 1 to aa 166). The probe was labeled using a humidified atmosphere of 5% CO2. On day 7, cells were harvested and a random primed labeling system (Rediprime II; Amersham Biosciences). used for flow cytometry. To detect DCs expressing short hairpin RNA Hybridization was conducted at 65°C for 17 h in a buffer containing 10% (shRNA), we used a retroviral vector encoding GFP. In flow cytometry, the dextran sulfate, 1% SDS, 50 mM Tris-HCl (pH7.5), 1 M NaCl, and dena- tured salmon sperm DNA (100 ␮g/ml). Blots were washed three times in gate was set so that only DCs with GFP expression were analyzed (Fig. 7, ϫ ϫ A and B). To enrich DCs expressing shRNA, we used a retroviral vector 2 SSC/0.1% SDS at 65°C and three times in 0.2 SSC/0.1% SDS for http://www.jimmunol.org/ with the puromycin resistance gene. Bone marrow was isolated from 10 min at 65°C before exposure to imaging plate (Fuji Film). C57BL/B6 mice that had been injected i.p. 4 days earlier with 5 mg of RT-PCR and semiquantitative PCR 5-fluorouracil. After 48 h of culture, cells were transduced with retroviral supernatant on two successive days. After the second transduction, cells Total pure RNA (1 ␮g) from Ba/F3 or HEK293 cells was reverse tran- were washed and cultured in the presence of GM-CSF. During DC induc- scribed into cDNA using ReverTra Ace-␣ (Toyobo) according to the man- tion, puromycin (2␮g/ml) was included to enrich DCs expressing shRNA ufacturer’s instruction. cDNA was diluted at 1/1, 1/4, and 1/16, and each (Fig. 7C). diluted cDNA was used as PCR template. RT-PCR was conducted with initial denaturation at 94°C for 3 min followed by 25 cycles of 94°C for Microsequencing of N-terminal amino acids 30 s, 54°C for 30 s, and 72°C for 1 min. The primer pairs used were as follows: 5Ј-ggctcgagatggattcaatgcctgagcc-3Ј and 5Ј-ggggatcctcagagctcatc ϳ ϫ 9 HEK293/mTLR4-GFP cells were collected up to 5 10 cells. Cell agggg-3Ј for human PRAT4A; 5Ј-tctactcaagccaggatgag-3Ј and 5Ј-ttcct by guest on September 25, 2021 lysate extraction and purification with the anti-GFP Abs were conducted as gccaattgcatcctg-3Ј for human TLR4; and 5Ј-tatggacaggactgaacgtc-3Ј and described in the paragraph title Immunoprecipitation and immunoprobing 5Ј-cctacaacaaacttgtctgg-3Ј for human hypoxanthine phosphoribosyltrans- below in this section. Bound proteins were eluted and fractionated with the ferase (HPRT). elution buffer containing 30 mM glycine/HCl (pH 2.5), 30 mM NaCl, and To determine the efficiency of gene silencing, semiquantitative PCR 0.1% Triton X-100. Each fraction was neutralized immediately with 1 M analyses were conducted using a 7300 fast real-time PCR System (Applied Tris-HCl (pH 8.0), and peak fractions were subjected to freeze drying, Biosystems) with TaqMan gene expression assays (Applied Biosystems) SDS-PAGE, electroblotting, and staining with Coomassie brilliant blue for mouse PRAT4A (Mm00511161). To normalize the amount of cDNAs, R-250 (Bio-Rad). The coprecipitated protein was excised, and its N-ter- each sample was standardized by using internal TaqMan gene expression minal amino acid sequence was determined by APRO Science. assays for mouse ␤-actin (Mm00607939). Expression constructs and transfectants Results Mouse PRAT4A cDNA was cloned into a retroviral vector, pMX-IRES- HEK293 cells expressing mouse TLR4 alone GFP. PRAT4A was tagged with the Flag epitope followed by the His 6 Because HEK293 cells do not express endogenous MD-2, epitope (collectively designated hereafter as the FH epitope) at the C ter- minus (PRAT4A-FH). PRAT4A-FH was expressed in Ba/F3 cells stably HEK293 cells expressing TLR4 responded to LPS/MD-2 but not expressing TLR4/MD-2 and CD14. Retroviral vectors were transfected to LPS alone (25), suggesting that TLR4 was expressed on the cell into the Plat-E cells using the FuGENE 6 transfection reagent (Roche). surface and bound to the LPS/MD-2 complex. We established Retroviruses were transduced into Ba/F3 cells, and stable cells expressing HEK293 cells stably expressing mouse TLR4 fused with GFP. mouse PRAT4A were established by enriching GFP-positive cells with a cell sorter. Human and mouse PRAT4A cDNAs were also cloned into the Established HEK293 cells, in which TLR4 expression was con- expression vector pEFBOS. We also established retroviral expression vec- firmed by GFP expression, were stained with two distinct mAbs to tor (pMX-puromycin) encoding TLR4, MD-2, and TLR2, all of which TLR4, Sa15-21 and MTS510. Cell surface TLR4 was detected by were either tagged with the FH epitope (TLR4FH, MD-2FH, and TLR4FH) Sa15-21, but very weakly with MTS510 (Fig. 1A, middle). When or without epitope tags (see Fig. 3C). these cells were transiently transfected with an expression vector Immunoprecipitation and immunoprobing encoding mouse MD-2, cell surface TLR4 was apparently up-regulated, confirming a role for MD-2 in optimal expression of TLR4 Cells were lysed on ice for 30 min with a lysis buffer containing 150 mM on the cell surface (Fig. 1A, bottom). MTS510 was able to detect NaCl, 50 mM Tris-HCl (pH 7.6), 2 mM EDTA, 10 ␮g/ml aprotinin, 10 ␮g/ml leupeptin, 1 mM PMSF, and 1% Triton X-100. Lysates were sep- cell surface TLR4 only when MD-2 was coexpressed (Fig. 1A, arated from debris by centrifuging at 13,000 rpm at 4°C for 10 min and then bottom row). incubated with Ab-conjugated beads at 4°C for 2 h. Beads were washed three To study a role for MD-2 in cell surface expression of TLR4 on times, and bound proteins were boiled at 99°C for 5 min in the sample buffer. normal immune cells, we examined bone marrow-derived macro- Samples were subjected to SDS-PAGE and Western blotting. Reagents used Ϫ Ϫ phages and DCs prepared from wild-type, TLR4 / , and MD- for immunoprobing were anti-Flag (M2), anti-mouse PRAT4A mAb, anti- Ϫ/Ϫ mouse TLR4 mAb, anti-His mAb, and anti-mouse MD-2 polyclonal Abs. The 2 mice. As published previously (16), MTS510 only bound to 6 Ϫ Ϫ Ϫ Ϫ second Abs were goat anti-mouse IgG-alkaline phosphatase conjugate (Amer- wild-type cells but not to TLR4 / or MD-2 / cells. In contrast, 1774 A MOLECULE ASSOCIATED WITH TOLL-LIKE RECEPTOR 4

least in certain types of cells such as HEK293 cells, bone marrow- derived DC, or macrophages. We have previously demonstrated with Ba/F3 cells that the above two mAbs to TLR4, MTS510 and Sa15-21, reacted with TLR4/MD-2 but poorly with TLR4 alone as judged by immunoprecipitation (19, 27). Sa15-21 was not able to detect cell surface TLR4 alone on Ba/F3 cells by ﬂow cytometry. Because Sa15-21 was found to react with TLR4 on HEK293 cells, MD-2-deﬁcient macrophages, or DCs, Sa15-21 but not MTX510 was able to bind to TLR4 without MD-2. TLR4 without MD-2 expressed in Ba/F3 cells might be distinct in conformation from TLR4 on HEK293 cells, macrophages, or DCs.

Molecular cloning of a molecule interacting with TLR4 We hypothesized that cell surface expression of TLR4 is regulated not only by MD-2 but also by another unknown molecule. With an aim to identifying such a molecule, we sought for a molecule coprecipitated with TLR4-GFP in HEK293 cells. An ϳ40 kDa signal was consistently coprecipitated with TLR4/MD-2, and we there- Downloaded from fore determined its N-terminal amino acid sequence. The determined amino acid sequence (EENDWVRLPS) was completely matched with aa 38–47 of a gene containing CAG trinucleotide repeats (28). A similar 40-kDa molecule was also found to be coprecipitated with TLR4 in Ba/F3 cells, and its N-terminal amino

acid sequence was determined. The N-terminal amino acid se- http://www.jimmunol.org/ quence was precisely the same portion of the mouse homologue (Fig. 2A) that was previously described as a retinoic acid-induced by guest on September 25, 2021

FIGURE 1. TLR4 alone is expressed on the cell surface. A, HEK293 cells were stained with two biotinylated mAbs to TLR4, MTS510, or Sa15- 21, followed by streptavidin-PE. The stained cells were HEK293 cells (top row), HEK293 cells stably expressing mouse TLR4 (middle row), and HEK293 cells stably expressing mouse TLR4 and transiently expressing mouse MD-2 (bottom row). Open histograms depict staining with the second reagent alone. B and C, Bone marrow-derived DCs (B) and macrophages (C) were prepared from wild-type, TLR4Ϫ/Ϫ, and MD-2Ϫ/Ϫ mice as indicated. Cells were stained with biotinylated mAbs to CD14 or TLR4 (MTS510 and Sa15-21), followed by streptavidin-PE. Open histograms depict staining with the second reagent alone. FIGURE 2. The amino acid sequences of PRAT4A and its tissue distribution. A, The amino acid sequences of mouse and human PRAT4A were aligned. The signal sequence and the experimentally determined N- Sa15-21 was able to detect TLR4 on DCs or macrophages from terminal sequence were boxed and underlined by a dashed line, respec- Ϫ/Ϫ MD-2 mice (Fig. 1, B and C). Although a role for MD-2 in tively. Cysteine residues and an N-glycosylation site were marked by augmenting cell surface expression of TLR4 was confirmed, MD-2 closed circles and an asterisk, respectively. B, Northern hybridization was was found to be dispensable for cell surface expression of TLR4 at conducted with a cDNA probe encoding mouse PRAT4A. The Journal of Immunology 1775 gene (29). We hereafter describe this molecule as PRAT4A, a protein associated with TLR4A. Data base analyses identified a molecule similar to PRAT4A. We named it PRAT4B, which was described elsewhere (30). The experimentally determined N-terminal amino acid sequence of PRAT4A clearly identified the first 37 amino acids as a signal sequence (Fig. 2A, boxed area). The mature peptide has a canonical N-glycosylation site and six cysteine residues. PRAT4A is highly conserved among a variety of species, including cow, chick, pig, catfish, sea squirt, nematode, zebra fish, and fruit fly (29). We examined tissue distribution of mRNA for mouse PRAT4A. Abundant expression of PRAT4A mRNA was detected in all of the organs tested, including lymphoid organs such as spleen and thymus (Fig. 2B).

PRAT4A is associated with the hypoglycosylated form of TLR4 We ﬁrst conﬁrmed the physical association between TLR4 and

PRAT4A. HEK293 cells expressing mouse TLR4-GFP or TLR4- Downloaded from GFP/MD-2 were transiently transfected with human PRAT4A tagged with the Flag epitope followed by the His6 epitope (PRAT4A-FH). TLR4-GFP and PRAT4A-FH were precipitated, and coprecipitated RPAT4-FH or TLR4-GFP was immunoprobed by the anti-Flag mAb or anti-GFP Ab, respectively (Fig. 3A).

Mouse TLR4-GFP was coprecipitated with PRAT4A-FH (Fig. 3A, http://www.jimmunol.org/ upper panel, lanes 4 and 6), and human PRAT4A-FH was coprecipitated with mouse TLR4-GFP (lower panel, lanes 4 and 6). The amount of PRAT4A coprecipitated with TLR4-GFP appeared to decrease when MD-2 was coexpressed (Fig. 3A, upper, lanes 4 and 6). To conﬁrm the physical association between TLR4 and PRAT4A with another cell line and to study the interaction between PRAT4A and other TLRs, Ba/F3 transfectants expressing TLR4-FH, TLR4-FH/MD-2, MD-2-FH, or TLR2-FH were used by guest on September 25, 2021 for immunoprecipitation studies. Coprecipitation of endogenously expressed PRAT4A was detected by a mAb to PRAT4A. PRAT4A was coprecipitated with TLR4-FH and TLR4-FH/MD-2, but not with MD-2-FH, TLR2-FH, or RP105/MD-1 (Fig. 3B, and data not shown), demonstrating speciﬁc association between TLR4 and FIGURE 3. PRAT4A is associated with the immature form of TLR4. A, PRAT4A. In contrast to the results with HEK293 cells, PRAT4A HEK293 cells (lanes 1 and 2), those expressing murine TLR4-GFP coprecipitated with TLR4 increased with MD-2 coexpression (Fig. (mTLR4-GFP; lane 3 and 4), or those expressing murine TLR4-GFP/MD-2 3B, lanes 2 and 3). The association of human PRAT4A with mouse (mTLR4-GFP mMD2; lanes 5 and 6) were transfected with an expression TLR4 might be weaker than that of mouse PRAT4A and may be vector encoding human PRAT4A (hPRAT4A) with the FH epitope tag affected by MD-2 association. Next, epitope-tagged PRAT4A (hPRAT4A-FH) (lanes 2, 4, and 6). PRAT4A-FH (top two panels) and (PRAT4A-FH) was expressed in Ba/F3 cells expressing TLR4, TLR4-GFP (bottom two panels) were precipitated and immunoprobed (IP) MD-2, and CD14. PRAT4A-FH was precipitated by the anti-Flag with an anti-Flag (for PRAT4A-FH) or anti-GFP (for TLR4-GFP) Ab as indicated. B, TLR4-FH/MD-2, TLR4FH, MD-2FH, or TLR2F were pre- mAb, and coprecipitated TLR4 and MD-2 were immunoprobed cipitated with anti-Flag mAb-coupled beads and probed with anti-His6 Abs (Fig. 3C). Interestingly, the smaller species of TLR4 and MD-2 followed by goat-anti-rat alkaline phosphatase (top panel). Coprecipitated were coprecipitated with PRAT4A-FH (Fig. 3C, lane 3). Consid- endogenous PRAT4A was probed with a mAb to PRAT4A, followed by ering that PRAT4A-FH was not associated with MD-2 alone (Fig. goat anti-rat alkaline phosphatase (bottom panel). C, TLR4/MD-2 (lane 1) 3B), PRAT4A-FH was likely to be associated with the hypogly- and PRAT4A-FH (lane 3) were precipitated from Ba/F3 cells expressing cosylated form of TLR4 that was expressed either alone or as a TLR4, MD-2, CD14, and PRAT4A-FH. As a control, Ba/F3 cells express- complex with the hypoglycosylated form of MD-2. As published ing TLR4, MD-2, and CD14, but not PRAT4A-FH, were used in lane 2 as a control for precipitation with anti-Flag Abs. Precipitates were probed previously (19), coexpressed MD-2 facilitated TLR4 glycosylation with the anti-TLR4 Ab (top panel), the anti-Flag mAb for PRAT4A-FH as revealed by the larger form in SDS-PAGE (Fig. 3B, lane 2 (middle panel), or anti-MD-2 Ab (bottom panel). WB, Western blotting. compared with lane 3). The glycosylated mature form was preferentially precipitated by the MTS510 mAb (compare Fig. 3B, lane 2 with C, lane 1). Coprecipitation of PRAT4A-FH was hardly PRAT4A knockdown negatively regulates cell surface expression detected when the MTS510 mAb was used for immunoprecipita- of TLR4 tion of TLR4/MD-2 (Fig. 3C, middle, lane 1). The MTS510 mAb To address a role for PRAT4A in cell surface expression of TLR4, would bind to the mature TLR4/MD-2 complex from which we used siRNA for inhibiting the expression of endogenous PRAT4A has been already dissociated, or the mAb might disrupt PRAT4A. The effect of siRNA was validated by detecting the the association between PRAT4A and TLR4/MD-2. transiently expressed human PRAT4A protein (Fig. 4A) or mRNA 1776 A MOLECULE ASSOCIATED WITH TOLL-LIKE RECEPTOR 4

encoding endogenously expressed PRAT4A by RT-PCR (Fig. 4B), both of which were apparently down-regulated by two distinct siRNA, siRNA1 and siRNA2, but not by sequence-scrambled control RNA, ctrl1 and ctrl2 (Fig. 4, A and B). The PRAT4A siRNA did not down-regulate mRNA expression encoding human TLR4- FH, indicating specific silencing by the siRNA (Fig. 4B). HEK293 cells stably expressing human TLR4 were transiently transfected with the human PRAT4A siRNA. Cell surface TLR4 was detected by flow cytometry with an anti-human TLR4 mAb, HTA125 (Fig. 4C). The PRAT4A siRNA down-regulated cell surface human TLR4 without influencing the expression of mRNA encoding hTLR4-FH (Fig. 4B). Cell surface CD44 was not influenced by the siRNA, and the sequence-scrambled control siRNA had no effect on cell surface hTLR4-FH. PRAT4A knockdown negatively regulates cell surface expression of TLR4/MD-2 and LPS responsiveness We next asked whether PRAT4A regulates cell surface expression

of TLR4/MD-2. We established two Ba/F3 cell lines, PRAT4A8 Downloaded from and PRAT4A11, stably expressing TLR4/MD-2 and the mouse PRAT4A shRNA. The effect of the PRAT4A shRNA was con- ﬁrmed by semiquantitative PCR (Fig. 5A). The PRAT4A mRNA was reduced to 15% (PRAT4A8) or 13% (PRAT4A11) by the shRNA when compared with the Ba/F3 transfectant without trans-

duction or with the Ba/F3 transfectant expressing an empty vector http://www.jimmunol.org/ (Fig. 5A). PRAT4A mRNA reduction by ϳ85% appeared to be sufficient for down-regulating cell surface TLR4/MD-2 on Ba/F3 cells to the undetectable level by flow cytometry (Fig. 5B). Such a drastic down-regulation was not observed in cell surface TLR2 or CD43 (Fig. 5B, and data not shown). We asked whether the lack of cell surface TLR4/MD-2 influenced LPS responses. Because the Ba/F3 transfectants had been transfected with a luciferase reporter construct driven by NF-␬B activity, transfectants were stimulated with lipid A, LPS, another TLR4/MD-2 ligand (Taxol), or TNF-␣. by guest on September 25, 2021 Luciferase activity in the cell lysate was determined (Fig. 5C). Whereas Ba/F3 transfectants without any treatment or with an empty control vector both responded to the TLR4 ligands, those with the PRAT4A shRNA did not respond to lipid A or LPS from E. coli even at a concentration as high as 10 ␮g/ml (Fig. 5C). Similar results were obtained with another TLR4/MD-2 ligand (Taxol) (data not shown). PRAT4A knockdown had no effect on NF-␬B activation induced by TNF-␣ (data not shown). PRAT4A knockdown led to the lack of mature TLR4/MD-2 on the cell surface To ask how the PRAT4A shRNA led to the lack of cell surface TLR4/MD-2 and hyporesponsiveness to LPS, the expression of TLR4 and MD-2 was studied. RT-PCR revealed that the amount of FIGURE 4. Cell surface murine TLR4 is down-regulated by the knockdown of human PRAT4A (hPRAT4A). A, HEK293 cells were transiently mRNA encoding TLR4 or MD-2 was not down-regulated by the transfected with the expression vector encoding human PRAT4A-FH PRAT4A shRNA (Fig. 6A). Because TLR4 and MD-2 had been (hPRAT4A-FH; lanes 2–6) and 2 nM siRNA (PRAT4A siRNA1 and siRNA2 tagged with the FH epitope, these molecules were precipitated with are in lanes 4 and 6, respectively, and control siRNAs for siRNA1 and siRNA2 the anti-Flag mAb and immunoprobed with the anti-His6 mAb, are in lanes 3 and 5, respectively) 3 days before analyses. HEK293 cells were respectively. The amount of TLR4 protein was decreased in one of subjected to SDS-PAGE, Western blotting, and immunoprobing with the anti- the transfectants, PRAT4A11, but not in the other transfectant, top panel Flag mAb for PRAT4A-FH ( ) or with an anti-actin mAb as loading PRAT4A8, when compared with Ba/F3 cells without transduction controls (bottom panel). B, HEK293 cells stably expressing human TLR4-FH were transfected with the 20 nM PRAT4A siRNA (siRNA1 and siRNA2) or or with a control vector (Fig. 6B, lanes 4 and 5). The MD-2 protein 20 nM sequence-scrambled control RNA (control 1 and control 2) as indicated. was comparably expressed in all the lines. Despite the expression RT-PCR was conducted with template cDNAs without dilution or with 4-fold of TLR4, PRAT4A was not coprecipitated with TLR4 in the trans- or 16-fold dilution. cDNAs encoding human PRAT4A (top panel), human fectants expressing PRAT4A shRNA, demonstrating its silencing TLR4 (middle panel), or human HPRT (hHPRT; bottom panel) were ampli- effect (Fig. 6B, middle). The MTS510 mAb was specific for the fied, electrophoresed on an agarose gel, and visualized. C, HEK293 cells stably TLR4/MD-2 complex and the preferentially precipitated mature expressing human TLR4 were transfected with the PRAT4A siRNA or control siRNA at the indicated concentration (2 or 10 nM). HEK293 cells were stained form of TLR4 (compare TLR4 in Fig. 6B, lane 2, between the 4 days later with an anti-human TLR4 mAb HTA125 or anti-human CD44 as upper and lower panels). Despite the expression of TLR4 and indicated. MD-2, TLR4 was much less precipitated by the MTS510 mAb in The Journal of Immunology 1777 Downloaded from

FIGURE 6. PRAT4A knockdown leads to the lack of mature TLR4/ MD-2. A, Expression of mRNAs encoding TLR4, MD-2, and HPRT was http://www.jimmunol.org/ determined by RT-PCR in TLR4/MD-2-expressing Ba/F3 transfectants without any treatment (no treat), with transduction with an empty vector (control), or with the PRAT4A shRNA (PRAT4A no.8 and PRAT4A no.11). RTPCR was conducted with template cDNAs without dilution or with 4-fold or 16-fold dilution for each sample. cDNAs encoding murine TLR4 (mTLR4; top panel), murine MD-2 (mMD-2; middle panel), or murine HPRT (mHPRT; bottom panel) were ampliﬁed, electrophoresed on an agarose gel, and visualized. B, TLR4 and MD-2 with the FH epitope

(TLR4-FH and MD-2-FH) were precipitated (IP) with anti-Flag mAb (top by guest on September 25, 2021 and middle panels) or the anti-TLR4 mAb MTS510 (bottom panel) from TLR4/MD-2-expressing Ba/F3 transfectants as indicated. Precipitated TLR4-FH and MD-2-FH were probed with the anti-His mAb (top panel). Coprecipitated endogenous PRAT4A was probed with the anti-PRAT4A mAb (middle panel). TLR4-FH precipitated with MTS510 was probed with the anti-His mAb (bottom panel). WB, Western blotting.

PRAT4A knockdown negatively regulates cell surface TLR4 and TLR4/MD-2 on DCs To confirm that the role for PRAT4A on TLR4 was not restricted to in vitro cell lines such as Ba/F3 or HEK293 cells, bone marrow- FIGURE 5. Down-regulation of cell surface TLR4/MD-2 by the derived DCs were transduced with retrovirus encoding the PRAT4A knockdown. A, Expression of PRAT4A mRNA was determined by semiquantitative PCR in TLR4/MD-2-expressing Ba/F3 transfectants PRAT4A shRNA or an empty control vector. Cell surface expres- without any treatment (no treat), with transduction with an empty vector sion of TLR4 alone, TLR4/MD-2, or TLR2 was determined by (control), or with the PRAT4A shRNA (PRAT4A8 and PRAT4A11). The flow cytometry analyses. TLR4 alone was detected on MD-2-de- amount of PRAT4A mRNA was normalized by the amount of ␤-actin ficient DCs without any treatment or with an empty control vector mRNA and is represented as the mean average from triplicate samples. B, but not on those with the PRAT4A shRNA (Fig. 7A). Similarly, Cell surface TLR4/MD-2 and TLR2 on Ba/F3 transfectants were stained cell surface TLR4/MD-2 on wild-type DCs was drastically down- with biotinylated mAbs to TLR4 (MTS510) or TLR2, followed by strepta- regulated with the PRAT4A shRNA (Fig. 7B). The control vector vidin-PE. Open histograms depict staining with the second reagent alone. had no effect on cell surface expression of TLR4/MD-2. To make The cell lines studied are indicated in the figure. C, Ba/F3 cells expressing sure that the TLR4 protein is expressed in PRAT4A-silenced DCs, TLR4/MD-2 and the NF-␬B luciferase reporter construct were stimulated DCs expressing the PRAST4A shRNA were enriched and subject with lipid A or LPS from E. coli as indicated. Luciferase activity was determined and represented as fold increase from the activity without stim- to immunoprecipitation with the anti-TLR4 mAb Sa15-21 and to ulation. The results were shown as the mean from triplicates. immunoprobing with anti-TLR4 Ab (Fig. 7C). We were able to detect the TLR4 protein in DCs expressing the RPAT4A shRNA, but the amount of TLR4 protein in PRAT4A-silenced DCs was the transfectants with RPAT4A shRNA (Fig. 6B, lower panel), much less than the amount in control cells, DCs without any treat- indicating the lack of mature TLR4. These results demonstrate an ment, or DCs expressing an empty vector. When compared with important role for PRAT4A in TLR4 maturation. TLR4/MD-2, cell surface TLR2 was much less influenced by the 1778 A MOLECULE ASSOCIATED WITH TOLL-LIKE RECEPTOR 4

gene silencing of the PRAT4A mRNA down-regulated cell surface TLR4 alone on human HEK293 cells and mouse MD-2-deficient DCs (Figs. 4 and 7). Third, PRAT4A knockdown decreased cell surface TLR4/MD-2 on Ba/F3 transfectants and wild-type DCs. Fourth, mature TLR4/MD-2 precipitated by the MTS510 mAb was reduced by the PRAT4A knockdown (Fig. 6). PRAT4A binds hypoglycosylated TLR4 with or without MD-2 (Fig. 3C), but not with mature TLR4/MD-2. PRAT4A knockdown decreased the amount of mature TLR4 precipitated with the MTS510 mAb, but not that of immature TLR4 (Fig. 6B). These results suggest a role for PRAT4A in TLR4 maturation/glycosylation. Although the MTS510 mAb was unable to precipitate TLR4/ MD-2 in Ba/F3 transfectants with RPAT4A shRNA (Fig. 6B), it is possible that hypoglycosylated TLR4 is still associated with hypoglycosylated MD-2 even in the lack of PRAT4A. A role for PRAT4A in the assembly of the TLR4/MD-2 complex remains to be clarified. An ER chaperon, gp96, was shown to have a similar role. Ran- dow and Seed (22) described a pre-B cell line, deficient in gp96, in Downloaded from which TLR4 failed to associate with MD-2, get to the cell surface, and respond to LPS. Altered localization of gp96 from ER to the membrane led to the redistribution of TLR4 (20). gp96 regulates the subcellular distribution of not only TLR4 but also TLR2, TLR1, and some integrins (22). Although PRAT4A is not associated with TLR2, it remains to be determined whether PRAT4A is http://www.jimmunol.org/ associated with other TLRs, including TLR1 or TLR6. A majority of TLR4 was detected inside the cells in the Golgi apparatus (16) as a hypoglycosylated immature form as judged by SDS-PAGE analyses (Fig. 3B, lane 3). Overexpression of MD-2 increased the mature form of TLR4 on the cell surface, but most TLR4 still remained immature in the Golgi apparatus (Fig. 3B, lane 2) (16). There must be machinery regulating the subcellular

distribution of TLR4 between Golgi/ER and the cell surface. The by guest on September 25, 2021 Golgi apparatus is reported to be another site allowing TLR4/ MD-2 to recognize LPS. TLR4 in intestinal epithelial cells resides in the Golgi apparatus, and internalized LPS is recognized in the FIGURE 7. Cell surface TLR4/MD-2 is down-regulated by the knock- Golgi apparatus (20). The molecular mechanisms by which TLR4/ down of murine PRAT4A DCs from MD-2Ϫ/Ϫ (A) or wild-type mice (B) MD-2 stays in Golgi/ER or traffics back from the cell surface are were transduced with a retroviral vector encoding the PRAT4A shRNA currently unknown. PRAT4A is likely to be a component of the (bottom) or with an empty control vector (middle). Because a retroviral machinery facilitating TLR4/MD-2 trafficking to the cell surface. vector encodes GFP, transduced cells can be detected as GFP-positive Further study might reveal a difference in cytokine production be- cells. Cell surface expression of TLR4/MD-2 (left column), TLR4 (center tween TLR4/MD-2 on the cell surface and in the Golgi apparatus. column), or TLR2 (right column) on GFP-positive, transduced DCs was shown by staining with biotinylated MTS510, Sa15-21, or anti-TLR2 mAb, PRAT4A knockdown led to the profound defect in LPS respon- respectively, followed by streptavidin-PE. DCs without transduction (no siveness that is probably due to the impaired maturation of TLR4, treat; top row) were also stained as a control. KO, knockout. C, DCs were leading to the lack of mature TLR4/MD-2 on the cell surface (Fig. subjected to immunoprecipitation with the anti-TLR4 mAb Sa15-21 and 5). PRAT4A was required for cell surface expression of TLR4/ immunoprobed with the anti-TLR4 Ab (top panel). A part of cell lysate MD-2, not only in Ba/F3 cells but also in normal DCs (Fig. 7), was used for immunoprobing with an anti-actin Ab to show that the ap- suggesting a role for PRAT4A in DC response to LPS. We are proximately equal amount of cell lysate was used (bottom panel). The cells currently studying a role for PRAT4A in LPS responses by DCs or used were DCs without any treatment (no treat; lane 1), DCs expressing an macrophages by using shRNA. Up-regulation or down-regulation empty vector (lane 2), or DCs expressing the PRAT4A shRNA (lane 3). of PRAT4A may influence LPS responses. PRAT4A was previously shown to be induced by all-trans retinoic acid (29). It is PRAT4A shRNA (Fig. 7B). However, we cannot exclude a pos- important to study induction and reduction of PRAT4A mRNA sibility that PRAT4A knockdown had a small but significant effect upon a variety of stimulations. on cell surface expression of TLR2. This issue is currently being In conclusion, the present study identified a novel molecule that studied further. is associated with TLR4 and regulates cell surface expression of TLR4. This molecule might reveal a novel mechanism regulating Discussion the subcellular distribution of TLR4. The present study identified RPAT4A as a novel molecule that is associated with TLR4 and regulates its cell surface expression. This conclusion was based on the following results. First, physical Acknowledgments association between TLR4 and PRAT4A was shown in human and We thank Dr. Shizuo Akira (Osaka University, Osaka, Japan) for providing mouse cell lines, HEK293 cells, and Ba/F3 cells (Fig. 3). Second, us with TLR4-deficient mice. The Journal of Immunology 1779

Disclosures surface expression of RP105/CD180 and B-cell responsiveness to lipopolysaccharide. Blood 99: 1699–1705. The authors have no financial conflict of interest. 17. Schromm, A. B., E. Lien, P. Henneke, J. C. Chow, A. Yoshimura, H. Heine, E. Latz, B. G. Monks, D. A. Schwartz, K. Miyake, and D. T. Golenbock. 2001. References Molecular genetic analysis of an endotoxin nonresponder mutant cell line: a point 1. Janeway, C. A., Jr., and R. Medzhitov. 2002. Innate immune recognition. Annu. mutation in a conserved region of MD-2 abolishes endotoxin-induced signaling. Rev. Immunol. 20: 197–216. J. Exp. Med. 194: 79–88. 2. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu. Rev. Im- 18. Miyake, K., H. Ogata, Y. Nagai, S. Akashi, and M. Kimoto. 2000. Innate rec- munol. 21: 335–376. ognition of lipopolysaccharide by Toll-like receptor 4/MD-2 and RP105/MD-1. 3. Medzhitov, R., P. Preston-Hurlburt, and C. A. Janeway, Jr. 1997. A human ho- J. Endotoxin Res. 6: 389–391. mologue of the Drosophila Toll protein signals activation of adaptive immunity. 19. Akashi, S., S.-i. Saitoh, Y. Wakabayashi, T. Kikuchi, N. Takamura, Y. Nagai, Nature 388: 394–397. Y. Kusumoto, K. Fukase, S. Kusumoto, Y. Adachi, et al. 2003. Lipopolysaccha- 4. Gewirtz, A. T., T. A. Navas, S. Lyons, P. J. Godowski, and J. L. Madara. 2001. ride interaction with cell surface Toll-like receptor 4-MD-2: higher affinity than Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce that with MD-2 or CD14. J. Exp. Med. 198: 1035–1042. epithelial proinflammatory gene expression. J. Immunol. 167: 1882–1885. 20. Hornef, M. W., B. H. Normark, A. Vandewalle, and S. Normark. 2003. Intra- 5. Barton, G. M., J. C. Kagan, and R. Medzhitov. 2006. Intracellular localization of cellular recognition of lipopolysaccharide by toll-like receptor 4 in intestinal ep- Toll-like receptor 9 prevents recognition of self DNA but facilitates access to ithelial cells. J. Exp. Med. 198: 1225–1235. viral DNA. Nat. Immunol. 7: 49–56. 21. Latz, E., A. Visintin, E. Lien, K. A. Fitzgerald, B. G. Monks, E. A. Kurt-Jones, 6. Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell, D. T. Golenbock, and T. Espevik. 2002. Lipopolysaccharide rapidly traffics to Z. K. Ballas, S. Endres, A. M. Krieg, and G. Hartmann. 2001. Identification of and from the Golgi apparatus with the Toll-like receptor 4-MD-2-CD14 complex CpG oligonucleotide sequences with high induction of IFN-␣/␤ in plasmacytoid in a process that is distinct from the initiation of signal transduction. J. Biol. dendritic cells. Eur. J. Immunol. 31: 2154–2163. Chem. 277: 47834–47843. 7. Verthelyi, D., K. J. Ishii, M. Gursel, F. Takeshita, and D. M. Klinman. 2001. 22. Randow, F., and B. Seed. 2001. Endoplasmic reticulum chaperone gp96 is re- Human peripheral blood cells differentially recognize and respond to two distinct quired for innate immunity but not cell viability. Nat. Cell Biol. 3: 891–896. 23. Ohnishi, T., M. Muroi, and K. Tanamoto. 2003. MD-2 is necessary for the Toll-

CPG motifs. J. Immunol. 166: 2372–2377. Downloaded from 8. Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya, and like receptor 4 protein to undergo glycosylation essential for its translocation to T. Taniguchi. 2005. Spatiotemporal regulation of MyD88-IRF-7 signalling for the cell surface. Clin. Diagn. Lab. Immunol. 10: 405–410. robust type-I interferon induction. Nature 434: 1035–1040. 24. Jia, H. P., J. N. Kline, A. Penisten, M. A. Apicella, T. L. Gioannini, J. Weiss, and 9. Latz, E., A. Schoenemeyer, A. Visintin, K. A. Fitzgerald, B. G. Monks, P. B. McCray, Jr. 2004. Endotoxin responsiveness of human airway epithelia is C. F. Knetter, E. Lien, N. J. Nilsen, T. Espevik, and D. T. Golenbock. 2004. limited by low expression of MD-2. Am. J. Physiol. 287: L428–L437. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat. 25. Gioannini, T. L., A. Teghanemt, D. Zhang, N. P. Coussens, W. Dockstader, Immunol. 5: 190–198. S. Ramaswamy, and J. P. Weiss. 2004. Isolation of an endotoxin-MD-2 complex 10. Kennedy, M. N., G. E. Mullen, C. A. Leifer, C. Lee, A. Mazzoni, K. N. Dileepan, that produces Toll-like receptor 4-dependent cell activation at picomolar concen- and D. M. Segal. 2004. A complex of soluble MD-2 and lipopolysaccharide trations. Proc. Natl. Acad. Sci. USA 101: 4186–4191. http://www.jimmunol.org/ serves as an activating ligand for Toll-like receptor 4. J. Biol. Chem. 279: 26. Yamamichi, N., M. Yamamichi-Nishina, T. Mizutani, H. Watanabe, 34698–34704. S. Minoguchi, N. Kobayashi, S. Kimura, T. Ito, N. Yahagi, M. Ichinose, et al. 11. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. V. Huffel, X. Du, D. Birdwell, 2005. The Brm gene suppressed at the post-transcriptional level in various human E. Alejos, M. Silva, C. Galanos, et al. 1998. Defective LPS signaling in C3H/HeJ cell lines is inducible by transient HDAC inhibitor treatment, which exhibits and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282: 2085–2088. antioncogenic potential. Oncogene 24: 5471–5481. 12. Qureshi, S. T., L. Lariviere, G. Leveque, S. Clermont, K. J. Moore, P. Gros, and 27. Akashi, S., R. Shimazu, H. Ogata, Y. Nagai, K. Takeda, M. Kimoto, and D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 K. Miyake. 2000. Cutting edge: cell surface expression and lipopolysaccharide (Tlr4). J. Exp. Med. 189: 615–625. signaling via the Toll-like receptor 4-MD-2 complex on mouse peritoneal mac- 13. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, rophages. J. Immunol. 164: 3471–3475. and S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deﬁcient mice are 28. Margolis, R. L., M. R. Abraham, S. B. Gatchell, S. H. Li, A. S. Kidwai, hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene prod- T. S. Breschel, O. C. Stine, C. Callahan, M. G. McInnis, and C. A. Ross. 1997. uct. J. Immunol. 162: 3749–3752. cDNAs with long CAG trinucleotide repeats from human brain. Hum. Genet. by guest on September 25, 2021 14. Chow, J. C., D. W. Young, D. T. Golenbock, W. J. Christ, and F. Gusovsky. 100: 114–122. 1999. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduc- 29. Glozak, M. A., Y. Li, R. Reuille, K. H. Kim, M. N. Vo, and M. B. Rogers. 2003. tion. J. Biol. Chem. 274: 10689–10692. Trapping and characterization of novel retinoid response elements. Mol. Endo- 15. Shimazu, R., S. Akashi, H. Ogata, Y. Nagai, K. Fukudome, K. Miyake, and crinol. 17: 27–41. M. Kimoto. 1999. MD-2, a molecule that confers lipopolysaccharide responsive- 30. Konno, K., Y. Wakabayashi, S. Akashi-Takamura, T. Ishii, M. Kobayashi, ness on Toll-like receptor 4. J. Exp. Med. 189: 1777–1782. K. Takahashi, Y. Kusumoto, S. Saitoh, Y. Yoshizawa, and K. Miyake. 2006. A 16. Nagai, Y., R. Shimazu, H. Ogata, S. Akashi, K. Sudo, H. Yamasaki, S. Hayashi, molecule that is associated with Toll-like receptor 4 and regulates its cell surface Y. Iwakura, M. Kimoto, and K. Miyake. 2002. Requirement for MD-1 in cell expression. Biochem. Biophys. Res. Commun. 339: 1076–1082.