DOCSLIB.ORG

A Protein Associated with Toll-Like Receptor 4 (PRAT4A) Regulates Cell Surface Expression of TLR4

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Protein Associated with Toll-Like Receptor 4 (PRAT4A) Regulates Cell Surface Expression of TLR4 A Protein Associated with Toll-Like Receptor 4 (PRAT4A) Regulates Cell Surface Expression of TLR4 This information is current as Yasutaka Wakabayashi, Makiko Kobayashi, Sachiko of September 25, 2021. Akashi-Takamura, Natsuko Tanimura, Kazunori Konno, Koichiro Takahashi, Takashi Ishii, Taketoshi Mizutani, Hideo Iba, Taku Kouro, Satoshi Takaki, Kiyoshi Takatsu, Yoshiya Oda, Yasushi Ishihama, Shin-ichiroh Saitoh and Kensuke Miyake Downloaded from J Immunol 2006; 177:1772-1779; ; doi: 10.4049/jimmunol.177.3.1772 http://www.jimmunol.org/content/177/3/1772 http://www.jimmunol.org/ References This article cites 30 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/177/3/1772.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology A Protein Associated with Toll-Like Receptor 4 (PRAT4A) Regulates Cell Surface Expression of TLR41 Yasutaka Wakabayashi,*2 Makiko Kobayashi,*2 Sachiko Akashi-Takamura,* Natsuko Tanimura,* Kazunori Konno,* Koichiro Takahashi,* Takashi Ishii,* Taketoshi Mizutani,† Hideo Iba,† Taku Kouro,‡ Satoshi Takaki,‡ Kiyoshi Takatsu,‡ Yoshiya Oda,§ Yasushi Ishihama,§ Shin-ichiroh Saitoh,* and Kensuke Miyake*¶3 TLRs recognize microbial products. Their subcellular distribution is optimized for microbial recognition. Little is known, how- ever, about mechanisms regulating the subcellular distribution of TLRs. LPS is recognized by the receptor complex consisting of TLR4 and MD-2. Although MD-2, a coreceptor for TLR4, enhances cell surface expression of TLR4, an additional mechanism regulating TLR4 distribution has been suggested. We show here that PRAT4A, a novel protein associated with TLR4, regulates Downloaded from cell surface expression of TLR4. PRAT4A is associated with the immature form of TLR4 but not with MD-2 or TLR2. PRAT4A knockdown abolished LPS responsiveness in a cell line expressing TLR4/MD-2, probably due to the lack of cell surface TLR4. PRAT4A knockdown down-regulated cell surface TLR4/MD-2 on dendritic cells. These results demonstrate a novel mechanism regulating TLR4/MD-2 expression on the cell surface. The Journal of Immunology, 2006, 177: 1772–1779. nnate immunity is the first line of defense against microbial LPS, one of the most immunostimulatory glycolipids constitut- http://www.jimmunol.org/ infection (1). The Toll family of receptors plays an essential ing the outer membrane of the Gram-negative bacteria, is recog- I role in innate recognition of microbial products (2). TLRs are nized by the receptor complex consisting of TLR4 and MD-2 (3, type I transmembrane proteins that contain a large, leucine-rich 11–14). MD-2 is an extracellular molecule that is associated with repeat in an extracellular region and a Toll/IL-1 receptor homology the extracellular domain of TLR4 and is indispensable for LPS domain in a cytoplasmic region (3). Cell surface TLRs, including recognition by TLR4 (15–18). TLR4/MD-2 is similar to TLR9 in TLR1, TLR2, TLR4, TLR5, and TLR6, recognize bacterial prod- that LPS can be recognized at the two distinct sites. TLR4/MD-2 ucts, whereas TLR3, TLR7, TLR8, and TLR9 reside in intracel- is expressed on the cell surface, and LPS recognition occurs on the lular organella and recognize microbial nucleic acids. These sub- cell surface in macrophage cells (19–21). In intestinal epithelial cells, cellular distributions of TLRs are optimized for microbial TLR4/MD-2 resides in the Golgi apparatus and recognizes internal- by guest on September 25, 2021 recognition. TLR5, e.g., is expressed exclusively on the basolateral ized LPS (20). Little is known about differences between LPS recog- surface of intestinal epithelia where pathogenic Salmonella, but nition/signaling on the cell surface and that in the Golgi apparatus. not commensal Escherichia coli, translocate TLR5 ligand flagellin Considering roles for TLR9 subcellular distribution in CpG recogni- across epithelia (4). The subcellular distribution of TLR9 is im- tion, it is possible that these LPS responses are distinct from each portant for sensing viral infection and differential recognition of other with regard to specificity or cytokine production. two distinct types of TLR9 ligands (5–8). A/D-type CpG is re- The subcellular distribution of TLR4 is reported to be regulated tained for long periods in the endosomal vesicles of plasmacytoid by two molecules, the endoplasmic reticulum (ER) chaperon gp96 dendritic cells (DCs),4 together with the complex consisting of and MD-2. Randow and Seed (22) described a pre-B cell line downstream signaling molecules (8), whereas the B/K-type CpG is deficient in the gp96 in which TLR4 failed to associate with MD-2, recognized by TLR9 in the lysosome (9, 10). get to the cell surface, and respond to LPS (22). We previously demonstrated that TLR4 alone is little expressed on the cell surface Ϫ/Ϫ *Division of Infectious Genetics, †Division of Host-Parasite Interaction, and ‡Divi- in MD-2 embryonic fibroblasts and that most TLR4s reside in sion of Immunology, Institute of Medical Science, University of Tokyo, Tokyo, Ja- ER or the Golgi apparatus without mature glycosylation, revealing pan; §Laboratory of Seeds Finding Technology, Eisai Co. Ltd., Tsukuba, Japan; and ¶ an important role for MD-2 in cell surface expression of TLR4 Core Research for Engineering, Science, and Technology, Japan Science and Tech- 526 nology Corporation, Tokyo, Japan (16). MD-2 association permits TLR4 glycosylation at Asn or 575 Received for publication February 15, 2006. Accepted for publication May 5, 2006. Asn , which facilitates cell surface expression of TLR4 (23). Despite an important role for MD-2 in cell surface expression of The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance TLR4, several studies claimed that TLR4 alone may be expressed with 18 U.S.C. Section 1734 solely to indicate this fact. on the cell surface without MD-2 in a human kidney cell line (10, 1 This study was supported by Special Coordination Funds of the Ministry of Edu- 24, 25), suggesting that another MD-2-like molecule regulates cation, Culture, Sports, Science and Technology of the Japanese Government, Uehara TLR4 trafficking to the cell surface. In this study we addressed this Memorial Foundation, the Takeda Foundation, and the Naito Foundation. issue and described a novel molecule that is associated with TLR4 2 Y.W. and M.K. contributed equally to this study. and regulates its expression on the cell surface. 3 Address correspondence and reprint requests to Dr. Kensuke Miyake, Division of Infectious Genetics, Institute of Medical Science, University of Tokyo, 4-6-1 Shiro- kanedai, Minatoku, Tokyo 108-8639, Japan. E-mail address: [email protected] Materials and Methods tokyo.ac.jp Reagents, cells, and mice 4 Abbreviations used in this paper: DC, dendritic cell; ER, endoplasmic reticulum; FH, Flag/His6 epitope; HPRT, hypoxanthine phosphoribosyltransferase; siRNA, Anti-Flag Ab and anti-Flag-agarose were purchased from Sigma-Aldrich. small interfering RNA; shRNA, short hairpin RNA. Rat anti-mouse TLR4 mAb (MTS510 and Sa15-21) and rat anti-mouse Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00 The Journal of Immunology 1773 CD14 (Sa2-8) were established in our laboratory and described previously ican Qualex) and goat anti-rat IgG-alkaline phosphatase conjugate (American (19). Pre-made Northern blot for mouse normal tissues was purchased from Qualex). Seegene. HEK293 cells were maintained in DMEM supplemented with 10% FCS and antibiotics. IL-3-dependent Ba/F3 cells were cultured in 10% Small interfering RNA ␮ FCS-RPMI 1640 supplemented with antibiotics, 100 M 2-ME, and re- To investigate the biological function of PRAT4A, we purchased an RNA ϳ combinant murine IL-3 ( 70 U/ml) at 37°C in a humidified atmosphere of interference duplex (Invitrogen Life Technologies). The oligonucleotide 5% CO2. A rat was immunized with the GST-PRAT4A (protein associated sequences of target sequences for human and mouse PRAT4A were ggag with TLR4A) fusion protein and used for hybridoma production. The anti gaagaccugacugaauuccuc (sense strand sequence for human PRAT4A, no.9) PRAT4A mAb (542; rat IgG) can be used for immunoprobing. Ϫ/Ϫ and accugacugaauuccucugcgccaa (sense strand sequence for mouse C57BL/6 mice were purchased from Japan SLC. TLR4 mice were PRAT4A, no.11). Sequence-scrambled negative controls for no.9 and kindly provided by Dr. S. Akira (Osaka University, Osaka, Japan), and Ϫ/Ϫ no.11 were ggaagaaguccgucauuaacggcuc and accgucauuaacuccgcgucgu MD-2 mice were established in our own laboratory (16). These mice caa, respectively. HEK293 transfectants were seeded onto 24- or 6-well were maintained in the animal facility at the Institute of Medical Science, plates in antibiotic-free medium on the day before RNA interference the University of Tokyo, Tokyo, Japan. Bone marrow-derived DCs and transfection. LipofectAMINE 2000 (Invitrogen Life Technologies) was macrophages were prepared as described previously (16). Briefly, bone used as a transfection reagent. Cells were collected 3–4 days after trans- ϫ 6 marrow cells were plated at 1 10 cells/ml in 24-well plates with 10% fection and used for further analyses.
Load more

Recommended publications
  • TLR3-Dependent Activation of TLR2 Endogenous Ligands Via the Myd88 Signaling Pathway Augments the Innate Immune Response
    cells Article TLR3-Dependent Activation of TLR2 Endogenous Ligands via the MyD88 Signaling Pathway Augments the Innate Immune Response 1 2, 1 3 Hellen S. Teixeira , Jiawei Zhao y, Ethan Kazmierski , Denis F. Kinane and Manjunatha R. Benakanakere 2,* 1 Department of Orthodontics, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA 19004, USA; [email protected] (H.S.T.); [email protected] (E.K.) 2 Department of Periodontics, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA 19004, USA; [email protected] 3 Periodontology Department, Bern Dental School, University of Bern, 3012 Bern, Switzerland; [email protected] * Correspondence: [email protected] Present address: Department of Pathology, Wayne State University School of Medicine, y 541 East Canfield Ave., Scott Hall 9215, Detroit, MI 48201, USA. Received: 30 June 2020; Accepted: 12 August 2020; Published: 17 August 2020 Abstract: The role of the adaptor molecule MyD88 is thought to be independent of Toll-like receptor 3 (TLR3) signaling. In this report, we demonstrate a previously unknown role of MyD88 in TLR3 signaling in inducing endogenous ligands of TLR2 to elicit innate immune responses. Of the various TLR ligands examined, the TLR3-specific ligand polyinosinic:polycytidylic acid (poly I:C), significantly induced TNF production and the upregulation of other TLR transcripts, in particular, TLR2. Accordingly, TLR3 stimulation also led to a significant upregulation of endogenous TLR2 ligands mainly, HMGB1 and Hsp60. By contrast, the silencing of TLR3 significantly downregulated MyD88 and TLR2 gene expression and pro-inflammatory IL1β, TNF, and IL8 secretion. The silencing of MyD88 similarly led to the downregulation of TLR2, IL1β, TNF and IL8, thus suggesting MyD88 / to somehow act downstream of TLR3.
    [Show full text]
  • TLR4 and TLR9 Ligands Macrophages Induces Cross
    Lymphotoxin β Receptor Activation on Macrophages Induces Cross-Tolerance to TLR4 and TLR9 Ligands This information is current as Nadin Wimmer, Barbara Huber, Nicola Barabas, Johann of September 27, 2021. Röhrl, Klaus Pfeffer and Thomas Hehlgans J Immunol 2012; 188:3426-3433; Prepublished online 22 February 2012; doi: 10.4049/jimmunol.1103324 http://www.jimmunol.org/content/188/7/3426 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2012/02/23/jimmunol.110332 Material 4.DC1 http://www.jimmunol.org/ References This article cites 42 articles, 13 of which you can access for free at: http://www.jimmunol.org/content/188/7/3426.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Lymphotoxin b Receptor Activation on Macrophages Induces Cross-Tolerance to TLR4 and TLR9 Ligands Nadin Wimmer,* Barbara Huber,* Nicola Barabas,* Johann Ro¨hrl,* Klaus Pfeffer,† and Thomas Hehlgans* Our previous studies indicated that lymphotoxin b receptor (LTbR) activation controls and downregulates inflammatory reac- tions.
    [Show full text]
  • TLR4 Signaling and Macrophage Inflammatory Responses Are Dampened by GIV/Girdin
    TLR4 signaling and macrophage inflammatory responses are dampened by GIV/Girdin Lee Swansona, Gajanan D. Katkara, Julian Tama, Rama F. Pranadinataa, Yogitha Chareddya, Jane Coatesa, Mahitha Shree Anandachara, Vanessa Castilloa, Joshua Olsonb, Victor Nizetb,c, Irina Kufarevac, Soumita Dasd, and Pradipta Ghosha,e,1 aDepartment of Cellular and Molecular Medicine, University of California San Diego, La Jolla, CA 92093; bDepartment of Pediatrics, University of California San Diego, La Jolla, CA 92093; cSkaggs School of Pharmacy and Pharmaceutical Sciences, University of California San Diego, La Jolla, CA 92093; dDepartment of Pathology, University of California San Diego, La Jolla, CA 92093; and eDepartment of Medicine, University of California San Diego, La Jolla, CA 92093 Edited by Shizuo Akira, Osaka University, Osaka, Japan, and approved September 18, 2020 (received for review June 10, 2020) Sensing of pathogens by Toll-like receptor 4 (TLR4) induces an inflam- and integrins (reviewed in refs. 5, 6), here we studied if and how matory response; controlled responses confer immunity but uncon- GIV may impact the LPS/TLR4 signaling in the most relevant trolled responses cause harm. Here we define how a multimodular cell line, i.e., macrophages. We dissect the relevance of those scaffold, GIV (a.k.a. Girdin), titrates such inflammatory response in findings in murine disease models and its broader relevance macrophages. Upon challenge with either live microbes or microbe- among other TLRs. derived lipopolysaccharides (a ligand for TLR4), macrophages with GIV mount a more tolerant (hypo-reactive) transcriptional response and Results and Discussion suppress proinflammatory cytokines and signaling pathways GIV Is Preferentially Expressed in the Myeloid Cells of Our Immune (i.e., NFkB and CREB) downstream of TLR4 compared to their System.
    [Show full text]
  • Fcγriib Attenuates TLR4‑Mediated NF‑Κb Signaling in B Cells
    MOLECULAR MEDICINE REPORTS 16: 5693-5698, 2017 FcγRIIb attenuates TLR4‑mediated NF‑κB signaling in B cells LI QIAN1-3, WENYAN CHEN1, SHAOQING WANG1, YANG LIU1, XIAOQIN JIA1, YI FU1, WEIJUAN GONG1 and FANG TIAN1 1Department of Immunology, School of Medicine, Yangzhou University, Yangzhou, Jiangsu 225001; 2Jiangsu Key Laboratory of Zoonosis, Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, Jiangsu 225009; 3Jiangsu Key Laboratory of Integrated Traditional Chinese and Western Medicine for Prevention and Treatment of Senile Diseases, Yangzhou, Jiangsu 225001, P.R. China Received September 26, 2016; Accepted June 28, 2017 DOI: 10.3892/mmr.2017.7269 Abstract. Toll-like receptors (TLRs) serve a vital role in (TLRs) are triggered to induce pro‑inflammatory cytokines activating the innate immune system by sensing conserved production, thus serving important roles in the initiation of microbial products. Fc γ receptor IIb (FcγRIIb), the inhibitory innate immunity (1). The TLR intracellular signaling pathway Fc receptor, exerts its immune regulatory functions by binding has been studied intensively. Binding of TLR4 agonist, to the immunoglobulin G Fc domain. Although the individual LPS, to TLR4 activates myeloid differentiation protein 88 roles of TLRs and FcγRIIb have been studied intensively, the (MyD88)-dependent signaling, leading to the activation cross-talk between FcγRIIb and TLR4 on B cells remains of mitogen-activated protein kinase (MAPK) and nuclear unknown. The present study demonstrated that FcγRIIb ligation factor (NF)-κΒ pathways, and contributing to the release of by the immune complex (IC) attenuated the TLR4-triggered pro‑inflammatory cytokines (2,3). Increased production of nuclear factor (NF)-κΒ activation, and decreased the release pro‑inflammatory cytokines causes damage to the host and of interleukin (IL)-6 from B cells, via enhancing LYN induces pathological inflammation.
    [Show full text]
  • TLR Signaling Pathways
    Seminars in Immunology 16 (2004) 3–9 TLR signaling pathways Kiyoshi Takeda, Shizuo Akira∗ Department of Host Defense, Research Institute for Microbial Diseases, Osaka University, and ERATO, Japan Science and Technology Corporation, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan Abstract Toll-like receptors (TLRs) have been established to play an essential role in the activation of innate immunity by recognizing spe- cific patterns of microbial components. TLR signaling pathways arise from intracytoplasmic TIR domains, which are conserved among all TLRs. Recent accumulating evidence has demonstrated that TIR domain-containing adaptors, such as MyD88, TIRAP, and TRIF, modulate TLR signaling pathways. MyD88 is essential for the induction of inflammatory cytokines triggered by all TLRs. TIRAP is specifically involved in the MyD88-dependent pathway via TLR2 and TLR4, whereas TRIF is implicated in the TLR3- and TLR4-mediated MyD88-independent pathway. Thus, TIR domain-containing adaptors provide specificity of TLR signaling. © 2003 Elsevier Ltd. All rights reserved. Keywords: TLR; Innate immunity; Signal transduction; TIR domain 1. Introduction 2. Toll-like receptors Toll receptor was originally identified in Drosophila as an A mammalian homologue of Drosophila Toll receptor essential receptor for the establishment of the dorso-ventral (now termed TLR4) was shown to induce the expression pattern in developing embryos [1]. In 1996, Hoffmann and of genes involved in inflammatory responses [3]. In addi- colleagues demonstrated that Toll-mutant flies were highly tion, a mutation in the Tlr4 gene was identified in mouse susceptible to fungal infection [2]. This study made us strains that were hyporesponsive to lipopolysaccharide [4]. aware that the immune system, particularly the innate im- Since then, Toll receptors in mammals have been a major mune system, has a skilful means of detecting invasion by focus in the immunology field.
    [Show full text]
  • TLR4 Signalling
    RESEA r CH HIGHLIGHTS INNATE IMMUNITY TLR4 signalling Toll-like receptor 4 (TLR4) is unique plasma membrane. Now, a study from sufficient to allow TRAM to localize among TLRs in its ability to activate Ruslan Medzhitov’s laboratory shows specifically to endosomes. These 20 two distinct signalling pathways that the two signalling pathways amino acids constitute a bipartite — one pathway is activated by the are induced sequentially and that localization domain — consisting of adaptors TIRAP (Toll/interleukin-1- the TRAM–TRIF pathway is only a myristoylation motif (the first 7 receptor (TIR)-domain-containing operational from early endosomes amino acids) and a polybasic domain adaptor protein) and MyD88, following endocytosis of TLR4. — that is commonly found in other which leads to the induction of The authors found it puzzling proteins that shuttle between the pro‑inflammatory cytokines, and that TLR4 is the only known TLR plasma membrane and endosomes. the second pathway is activated by capable of inducing the production Mutational analysis showed that the the adaptors TRIF (TIR-domain- of type I interferons from the plasma myristoylation motif is necessary containing adaptor protein inducing membrane so they decided to take for endosomal localization but interferon‑β) and TRAM (TRIF- a closer look at TLR4 signalling. both parts of the bipartite motif related adaptor molecule), which First, they assessed the subcellular are required for plasma-membrane leads to the induction of type I inter- localization of tagged TLR4 and found targeting. A TRAM transgene of ferons. Until now, it had been believed that it localized to both the plasma which the protein product resided that these two signalling pathways membrane and endosomal vesicles.
    [Show full text]
  • Platelet Toll-Like Receptor 4-Related Innate Immunity Potentially Participates in Transfusion Reactions Independent of ABO Compatibility: an Ex Vivo Study
    Platelet Toll-like Receptor 4-related Innate Immunity Potentially Participates in Transfusion Reactions Independent of ABO Compatibility: An ex Vivo Study Chien-Sung Tsai Tri-Service General Hospital Mei-Hua Hu Linkou Chang Gung Memorial Hospital Yung-Chi Hsu Tri-Service General Hospital Go-Shine Huang ( [email protected] ) Tri-Service General Hospital Research Article Keywords: Toll-like receptor 4, innate immunity, platelet, blood mixing, transfusion reaction Posted Date: August 4th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-762879/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/18 Abstract Purpose: The role of platelet TLR4 in transfusion reactions remains unclear. This study analyzed platelet TLR4, certain DAMPs, and the effect of ABO compatibility on TLR4 expression after a simulated transfusion ex vivo. Methods: Donor red blood cells were harvested from a blood bank. Recipient blood from patients undergoing cardiac surgery was processed to generate a washed platelet suspension. Donor blood was added to the washed platelets at 1%, 5%, or 10% (v/v). Blood mixing experiments were performed using four groups: 0.9% saline control group (n = 31); M, matched blood type mixing (n = 20); S, uncross- matched ABO type-specic mixing (n = 20); and I, ABO incompatible blood mixing (n = 20). Platelet TLR4 expression was determined after blood mixing. Levels of TLR4-binding DAMPs (HMGB1, S100A8, S100A9, and SAA) and that of LPS-binding protein and endpoint proteins (TNF-α, IL-1β, and IL-6) in the TLR4 signaling pathway were evaluated. Results: The 1%, 5%, and 10% blood mixtures signicantly increased TLR4 expression in three groups (M, S, and I; all P < 0.001) in a concentration-dependent manner.
    [Show full text]
  • TLR4 Signaling Pathway Modulators As Potential Therapeutics in Inflammation and Sepsis
    vaccines Review TLR4 Signaling Pathway Modulators as Potential Therapeutics in Inflammation and Sepsis Nikolay N. Kuzmich 1,2,*, Konstantin V. Sivak 1, Vladimir N. Chubarev 3, Yury B. Porozov 2,4, Tatiana N. Savateeva-Lyubimova 1 and Francesco Peri 5,* ID 1 Department of Drug Safety, Research Institute of Influenza, WHO National Influenza Centre of Russia, 15/17 Professor Popov St, Saint-Petersburg 197376, Russia; [email protected] (K.V.S.); [email protected] (T.N.S.-L.) 2 Laboratory of Bioinformatics, Institute of Pharmacy and Translational medicine, I.M. Sechenov First Moscow State Medical University, 8-2 Trubetskaya St., Moscow 119991, Russia; [email protected] 3 Department of Pharmacology, Institute of Pharmacy and Translational medicine, I.M. Sechenov First Moscow State Medical University, 8-2 Trubetskaya St., Moscow 119991, Russia; [email protected] 4 Laboratory of Bioinformatics, ITMO University, 49 Kronverkskiy Pr., Saint Petersburg 197101, Russia 5 Department of Biotechnology and Biosciences, University of Milano-Bicocca, Piazza della Scienza 2, Milano 20126, Italy * Correspondence: [email protected] (N.N.K.); Tel.: +7-921-3491-750 (N.N.K.); [email protected] (F.P.); Tel.: +39-026-448-3453 (F.P.); Fax: +7-812-499-15-15 (N.N.K.) Academic Editor: Paola Massari Received: 5 September 2017; Accepted: 1 October 2017; Published: 4 October 2017 Abstract: Toll-Like Receptor 4 (TLR4) signal pathway plays an important role in initiating the innate immune response and its activation by bacterial endotoxin is responsible for chronic and acute inflammatory disorders that are becoming more and more frequent in developed countries.
    [Show full text]
  • Distinct Roles of TLR4 and CD14 in LPS-Induced Inflammatory
    0031-3998/09/6602-0179 Vol. 66, No. 2, 2009 PEDIATRIC RESEARCH Printed in U.S.A. Copyright © 2009 International Pediatric Research Foundation, Inc. Distinct Roles of TLR4 and CD14 in LPS-Induced Inflammatory Responses of Neonates EVA LEVY, GEORGINA XANTHOU, EFTICHIA PETRAKOU, VASSILIKI ZACHARIOUDAKI, CHRISTOS TSATSANIS, SPYROS FOTOPOULOS, AND MARIETTA XANTHOU Neonatal Immunology Laboratory [E.L., E.P., S.F., M.X.], B’Neonatal Intensive Care Unit (NICU), “Aghia Sophia” Children’s Hospital, Athens 115 27, Greece; Cellular Immunology Laboratory [G.X.], Biomedical Research Foundation of the Academy of Athens, Athens 115 27, Greece; Department of Clinical Chemistry [V.Z., C.T.], University of Crete, Crete 71003, Greece ABSTRACT: During infections, pathogens bind to toll-like receptor but lacks an intracellular component and is, thus, incapable of (TLR)4 and CD14 receptors and induce cytokine release, leading to signaling. MD2 is a molecule necessary for LPS recognition inflammation. Here, we investigated TLR4 and CD14 expression on by TLR4, which also cannot mediate signaling. TLR4, upon peripheral blood leukocytes (PBLs) and their roles in lipopolysac- LPS binding, leads to intracellular activation of mitogen- charide (LPS)-induced cytokine and chemokine release. Full-term activated protein kinase and nuclear factor-␬B that mediate and preterm neonates and adults were studied. PBLs were pretreated with anti-TLR4– and anti-CD14–blocking antibodies and stimulated the transcription of proinflammatory cytokine and chemokine with LPS. Cytokine and chemokine levels were measured in super- genes (4). TLR4 signaling also activates DCs that subse- natants. TLR4, CD14 expression, and LPS-induced CXCL8 release quently present pathogenic peptides to T lymphocytes and, were higher in neonates, possibly contributing to aberrant inflamma- thus, stimulate T-cell–mediated immunity (5).
    [Show full text]
  • Recognition of Lipopolysaccharide Pattern by TLR4 Complexes
    OPEN Experimental & Molecular Medicine (2013) 45, e66; doi:10.1038/emm.2013.97 & 2013 KSBMB. All rights reserved 2092-6413/13 www.nature.com/emm REVIEW Recognition of lipopolysaccharide pattern by TLR4 complexes Beom Seok Park1 and Jie-Oh Lee2 Lipopolysaccharide (LPS) is a major component of the outer membrane of Gram-negative bacteria. Minute amounts of LPS released from infecting pathogens can initiate potent innate immune responses that prime the immune system against further infection. However, when the LPS response is not properly controlled it can lead to fatal septic shock syndrome. The common structural pattern of LPS in diverse bacterial species is recognized by a cascade of LPS receptors and accessory proteins, LPS binding protein (LBP), CD14 and the Toll-like receptor4 (TLR4)–MD-2 complex. The structures of these proteins account for how our immune system differentiates LPS molecules from structurally similar host molecules. They also provide insights useful for discovery of anti-sepsis drugs. In this review, we summarize these structures and describe the structural basis of LPS recognition by LPS receptors and accessory proteins. Experimental & Molecular Medicine (2013) 45, e66; doi:10.1038/emm.2013.97; published online 6 December 2013 Keywords: lipopolysaccharide (LPS); Toll-like receptor 4 (TLR4); MD-2; CD14; LBP INTRODUCTION the cell surface by a glycosylphosphatidylinositol anchor. CD14 In the initial phase of infection, the innate immune system splits LPS aggregates into monomeric molecules and presents generates a rapid inflammatory response that blocks the them to the TLR4–MD-2 complex. Aggregation of the TLR4– growth and dissemination of the infectious agent.
    [Show full text]
  • TLR8 Differences Between Human TLR7 and Synthetic TLR Agonists
    Synthetic TLR Agonists Reveal Functional Differences between Human TLR7 and TLR8 Keith B. Gorden, Kevin S. Gorski, Sheila J. Gibson, Ross M. Kedl, William C. Kieper, Xiaohong Qiu, Mark A. Tomai, This information is current as Sefik S. Alkan and John P. Vasilakos of September 29, 2021. J Immunol 2005; 174:1259-1268; ; doi: 10.4049/jimmunol.174.3.1259 http://www.jimmunol.org/content/174/3/1259 Downloaded from References This article cites 36 articles, 14 of which you can access for free at: http://www.jimmunol.org/content/174/3/1259.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Synthetic TLR Agonists Reveal Functional Differences between Human TLR7 and TLR8 Keith B. Gorden, Kevin S. Gorski, Sheila J. Gibson, Ross M. Kedl,1 William C.
    [Show full text]
  • Inflammation Fas Modulating Intestinal TLR-Mediated Through TLR4 And
    Intestinal Expression of Fas and Fas Ligand Is Upregulated by Bacterial Signaling through TLR4 and TLR5, with Activation of Fas Modulating Intestinal TLR-Mediated This information is current as Inflammation of September 24, 2021. Philana Fernandes, Charlotte O'Donnell, Caitriona Lyons, Jonathan Keane, Tim Regan, Stephen O'Brien, Padraic Fallon, Elizabeth Brint and Aileen Houston J Immunol 2014; 193:6103-6113; Prepublished online 5 Downloaded from November 2014; doi: 10.4049/jimmunol.1303083 http://www.jimmunol.org/content/193/12/6103 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2014/11/05/jimmunol.130308 Material 3.DCSupplemental References This article cites 43 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/193/12/6103.full#ref-list-1 by guest on September 24, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD
    [Show full text]