DOCSLIB.ORG

CLC Sequence Viewer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
CLC Sequence Viewer CLC Sequence Viewer USER MANUAL Manual for CLC Sequence Viewer 8.0.0 Windows, macOS and Linux June 1, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark Contents I Introduction7 1 Introduction to CLC Sequence Viewer 8 1.1 Contact information.................................9 1.2 Download and installation..............................9 1.3 System requirements................................ 11 1.4 When the program is installed: Getting started................... 12 1.5 Plugins........................................ 13 1.6 Network configuration................................ 16 1.7 Latest improvements................................ 16 II Core Functionalities 18 2 User interface 19 2.1 Navigation Area................................... 20 2.2 View Area....................................... 27 2.3 Zoom and selection in View Area.......................... 35 2.4 Toolbox and Status Bar............................... 37 2.5 Workspace...................................... 40 2.6 List of shortcuts................................... 41 3 User preferences and settings 44 3.1 General preferences................................. 44 3.2 View preferences................................... 46 3.3 Advanced preferences................................ 49 3.4 Export/import of preferences............................ 49 3 CONTENTS 4 3.5 View settings for the Side Panel.......................... 50 4 Printing 52 4.1 Selecting which part of the view to print...................... 53 4.2 Page setup...................................... 54 4.3 Print preview..................................... 56 5 Import/export of data and graphics 57 5.1 Standard import................................... 57 5.2 Data export...................................... 59 5.3 Export graphics to files............................... 68 5.4 Export graph data points to a file.......................... 72 5.5 Copy/paste view output............................... 73 6 Data download 75 6.1 Search for Sequences at NCBI........................... 75 III Bioinformatics 78 7 Viewing and editing sequences 79 7.1 View sequence.................................... 79 7.2 Circular DNA..................................... 85 7.3 Working with annotations.............................. 87 7.4 Element information................................. 93 7.5 View as text..................................... 94 7.6 Sequence Lists................................... 95 8 Viewing structures 98 8.1 Importing molecule structure files.......................... 99 8.2 Viewing molecular structures in 3D......................... 99 8.3 Customizing the visualization............................ 100 8.4 Tools for linking sequence and structure...................... 109 9 General sequence analyses 111 9.1 Extract sequences.................................. 111 CONTENTS 5 9.2 Shuffle sequence.................................. 113 9.3 Sequence statistics................................. 114 9.4 Join sequences................................... 118 10 Nucleotide analyses 120 10.1 Convert DNA to RNA................................. 120 10.2 Convert RNA to DNA................................. 121 10.3 Reverse complements of sequences........................ 121 10.4 Reverse sequence.................................. 122 10.5 Translation of DNA or RNA to protein........................ 123 10.6 Find open reading frames.............................. 124 11 Restriction site analyses 127 11.1 Dynamic restriction sites.............................. 127 11.2 Restriction Site Analysis............................... 131 11.3 Restriction enzyme lists............................... 133 12 Sequence alignment 135 12.1 Create an alignment................................. 135 12.2 View alignments................................... 140 12.3 Edit alignments................................... 142 13 Phylogenetic trees 146 13.1 Create tree...................................... 147 13.2 Tree Settings..................................... 151 IV Appendix 159 A More features 160 B Graph preferences 161 C Formats for import and export 163 C.1 List of bioinformatic data formats.......................... 163 C.2 List of graphics data formats............................ 165 CONTENTS 6 D Restriction enzymes database configuration 167 E IUPAC codes for amino acids 168 F IUPAC codes for nucleotides 169 Bibliography 170 V Index 172 Part I Introduction 7 Chapter 1 Introduction to CLC Sequence Viewer Contents 1.1 Contact information................................9 1.2 Download and installation............................9 1.2.1 Program download..............................9 1.2.2 Installation on Microsoft Windows.....................9 1.2.3 Installation on macOS............................ 10 1.2.4 Installation on Linux with an installer.................... 11 1.3 System requirements............................... 11 1.3.1 CLC Sequence Viewer vs. Workbenches.................. 12 1.4 When the program is installed: Getting started................. 12 1.4.1 Quick start.................................. 12 1.5 Plugins....................................... 13 1.5.1 Install.................................... 13 1.5.2 Uninstall................................... 14 1.5.3 Updating plugins............................... 15 1.6 Network configuration.............................. 16 1.7 Latest improvements............................... 16 Welcome to CLC Sequence Viewer 8.0.0 --- a software package supporting your daily bioinformatics work. We strongly encourage you to read this user manual in order to get the best possible basis for working with the software package. This software is for research purposes only. 8 CHAPTER 1. INTRODUCTION TO CLC SEQUENCE VIEWER 9 1.1 Contact information The CLC Sequence Viewer is developed by: QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark http://www.qiagenbioinformatics.com Email: [email protected] The QIAGEN Aarhus team is continuously improving the CLC Sequence Viewer with our users' interests in mind. We welcome all requests and feedback from users, as well as suggestions for new features or more general improvements to the program. Users of the freely available CLC Sequence Viewer can make use of any of our online doc- umentation sources, including the manuals (http://www.qiagenbioinformatics.com/ support/manuals/), tutorials (http://www.qiagenbioinformatics.com/support/tutorials/) and other entries in our FAQ area (http://helpdesk.clcbio.com/index.php?pg=kb). 1.2 Download and installation The CLC Sequence Viewer is developed for Windows, macOS and Linux. The software for either platform can be downloaded from http://www.qiagenbioinformatics.com/product- downloads/. 1.2.1 Program download Before you download the program you are asked to fill in the Download dialog. In the dialog you must choose: • Which operating system you use • Whether you would like to receive information about future releases When the download of the installer (an application which facilitates the installation of the program) is complete, follow the platform specific instructions below to complete the installation procedure. 1.2.2 Installation on Microsoft Windows When you have downloaded an installer, locate the downloaded installer and double-click the icon. The default location for downloaded files is your desktop. Installing the program is done in the following steps: • On the welcome screen, click Next. CHAPTER 1. INTRODUCTION TO CLC SEQUENCE VIEWER 10 • Read and accept the License agreement and click Next. • Choose where you would like to install the application and click Next. • Choose a name for the Start Menu folder used to launch CLC Sequence Viewer and click Next. • Choose if CLC Sequence Viewer should be used to open CLC files and click Next. • Choose where you would like to create shortcuts for launching CLC Sequence Viewer and click Next. • Choose if you would like to associate .clc files to CLC Sequence Viewer. If you check this option, double-clicking a file with a "clc" extension will open the CLC Sequence Viewer. • Wait for the installation process to complete, choose whether you would like to launch CLC Sequence Viewer right away, and click Finish. When the installation is complete the program can be launched from the Start Menu or from one of the shortcuts you chose to create. 1.2.3 Installation on macOS Starting the installation process is done in the following way: When you have downloaded an installer, locate the downloaded installer and double-click the icon. The default location for downloaded files is your desktop. Launch the installer by double-clicking on the "CLC Sequence Viewer" icon. Installing the program is done in the following steps: • On the welcome screen, click Next. • Read and accept the License agreement and click Next. • Choose where you would like to install the application and click Next. • Choose if CLC Sequence Viewer should be used to open CLC files and click Next. • Choose whether you would like to create desktop icon for launching CLC Sequence Viewer and click Next. • Choose if you would like to associate .clc files to CLC Sequence Viewer. If you check this option, double-clicking a file with a "clc" extension will open the CLC Sequence Viewer. • Wait for the installation process to complete, choose whether you would like to launch CLC Sequence Viewer right away, and click Finish. When the installation is complete the program can be launched from your Applications folder, or from the desktop shortcut you chose
Load more

Recommended publications
  • Current Status and Future Perspectives of Bioinformatics in Tanzania
    CURRENT STATUS AND FUTURE PERSPECTIVES OF BIOINFORMATICS IN TANZANIA Sylvester L. Lyantagaye Department of Molecular Biology and Biotechnology, College of Natural and Applied Sciences, University of Dar es Salaam, P.O. Box 35179, Dar es Salaam, Tanzania E-mail: [email protected], [email protected] ABSTRACT The main bottleneck in advancing genomics in present times is the lack of expertise in using bioinformatics tools and approaches for data mining in raw DNA sequences generated by modern high throughput technologies such as next generation sequencing. Although bioinformatics has been making major progress and contributing to the development in the rest of the world, it has still not yet fully integrated the tertiary education and research sector in Tanzania. This review aims to introduce a summary of recent achievements, trends and success stories of application of bioinformatics in biotechnology. The applications of bioinformatics in the fields such as molecular biology, biotechnology, medicine and agriculture, the global trend of bioinformatics, accessibility bioinformatics products in Tanzania, bioinformatics training initiatives in Tanzania, the future prospects of bioinformatics use in biotechnology globally and Tanzania in particular are reviewed. The paper is of interest and importance to rouse public awareness of the new opportunities that could be brought about by bioinformatics to address many research problems relevant to Tanzania and sub-Sahara Africa. Keywords: Bioinformatics, Biotechnology, Genomics, Tanzania. INTRODUCTION analysis, and management of biological Bioinformatics is conceptualising biology in information through computational terms of molecules (in the sense of physical techniques. It uses mathematics, biology, chemistry) and applying "informatics and computer science to understand the techniques" (derived from disciplines such biological importance of an extensive as applied mathematics, computer science variety of omics data (Reportlinker 2013).
    [Show full text]
  • Treebase: an R Package for Discovery, Access and Manipulation of Online Phylogenies
    Methods in Ecology and Evolution 2012, 3, 1060–1066 doi: 10.1111/j.2041-210X.2012.00247.x APPLICATION Treebase: an R package for discovery, access and manipulation of online phylogenies Carl Boettiger1* and Duncan Temple Lang2 1Center for Population Biology, University of California, Davis, CA,95616,USA; and 2Department of Statistics, University of California, Davis, CA,95616,USA Summary 1. The TreeBASE portal is an important and rapidly growing repository of phylogenetic data. The R statistical environment has also become a primary tool for applied phylogenetic analyses across a range of questions, from comparative evolution to community ecology to conservation planning. 2. We have developed treebase, an open-source software package (freely available from http://cran.r-project. org/web/packages/treebase) for the R programming environment, providing simplified, programmatic and inter- active access to phylogenetic data in the TreeBASE repository. 3. We illustrate how this package creates a bridge between the TreeBASE repository and the rapidly growing collection of R packages for phylogenetics that can reduce barriers to discovery and integration across phyloge- netic research. 4. We show how the treebase package can be used to facilitate replication of previous studies and testing of methods and hypotheses across a large sample of phylogenies, which may help make such important reproduc- ibility practices more common. Key-words: application programming interface, database, programmatic, R, software, TreeBASE, workflow include, but are not limited to, ancestral state reconstruction Introduction (Paradis 2004; Butler & King 2004), diversification analysis Applications that use phylogenetic information as part of their (Paradis 2004; Rabosky 2006; Harmon et al.
    [Show full text]
  • NASP: an Accurate, Rapid Method for the Identification of Snps in WGS Datasets That Supports Flexible Input and Output Formats Jason Sahl
    Himmelfarb Health Sciences Library, The George Washington University Health Sciences Research Commons Environmental and Occupational Health Faculty Environmental and Occupational Health Publications 8-2016 NASP: an accurate, rapid method for the identification of SNPs in WGS datasets that supports flexible input and output formats Jason Sahl Darrin Lemmer Jason Travis James Schupp John Gillece See next page for additional authors Follow this and additional works at: http://hsrc.himmelfarb.gwu.edu/sphhs_enviro_facpubs Part of the Bioinformatics Commons, Integrative Biology Commons, Research Methods in Life Sciences Commons, and the Systems Biology Commons APA Citation Sahl, J., Lemmer, D., Travis, J., Schupp, J., Gillece, J., Aziz, M., & +several additional authors (2016). NASP: an accurate, rapid method for the identification of SNPs in WGS datasets that supports flexible input and output formats. Microbial Genomics, 2 (8). http://dx.doi.org/10.1099/mgen.0.000074 This Journal Article is brought to you for free and open access by the Environmental and Occupational Health at Health Sciences Research Commons. It has been accepted for inclusion in Environmental and Occupational Health Faculty Publications by an authorized administrator of Health Sciences Research Commons. For more information, please contact [email protected]. Authors Jason Sahl, Darrin Lemmer, Jason Travis, James Schupp, John Gillece, Maliha Aziz, and +several additional authors This journal article is available at Health Sciences Research Commons: http://hsrc.himmelfarb.gwu.edu/sphhs_enviro_facpubs/212 Methods Paper NASP: an accurate, rapid method for the identification of SNPs in WGS datasets that supports flexible input and output formats Jason W. Sahl,1,2† Darrin Lemmer,1† Jason Travis,1 James M.
    [Show full text]
  • Introduction to Bioinformatics (Elective) – SBB1609
    SCHOOL OF BIO AND CHEMICAL ENGINEERING DEPARTMENT OF BIOTECHNOLOGY Unit 1 – Introduction to Bioinformatics (Elective) – SBB1609 1 I HISTORY OF BIOINFORMATICS Bioinformatics is an interdisciplinary field that develops methods and software tools for understanding biologicaldata. As an interdisciplinary field of science, bioinformatics combines computer science, statistics, mathematics, and engineering to analyze and interpret biological data. Bioinformatics has been used for in silico analyses of biological queries using mathematical and statistical techniques. Bioinformatics derives knowledge from computer analysis of biological data. These can consist of the information stored in the genetic code, but also experimental results from various sources, patient statistics, and scientific literature. Research in bioinformatics includes method development for storage, retrieval, and analysis of the data. Bioinformatics is a rapidly developing branch of biology and is highly interdisciplinary, using techniques and concepts from informatics, statistics, mathematics, chemistry, biochemistry, physics, and linguistics. It has many practical applications in different areas of biology and medicine. Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological, medical, behavioral or health data, including those to acquire, store, organize, archive, analyze, or visualize such data. Computational Biology: The development and application of data-analytical and theoretical methods, mathematical modeling and computational simulation techniques to the study of biological, behavioral, and social systems. "Classical" bioinformatics: "The mathematical, statistical and computing methods that aim to solve biological problems using DNA and amino acid sequences and related information.” The National Center for Biotechnology Information (NCBI 2001) defines bioinformatics as: "Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline.
    [Show full text]
  • Can Hybridization Be Detected Between African Wolf and Sympatric Canids?
    Can hybridization be detected between African wolf and sympatric canids? Sunniva Helene Bahlk Master of Science Thesis 2015 Center for Ecological and Evolutionary Synthesis Department of Bioscience Faculty of Mathematics and Natural Science University of Oslo, Norway © Sunniva Helene Bahlk 2015 Can hybridization be detected between African wolf and sympatric canids? Sunniva Helene Bahlk http://www.duo.uio.no/ Print: Reprosentralen, University of Oslo II Table of contents Acknowledgments ...................................................................................................................... 1 Abstract ...................................................................................................................................... 3 Introduction ................................................................................................................................ 5 The species in the genus Canis are closely related and widely distributed ........................... 5 Next-generation sequencing and bioinformatics .................................................................. 6 The concepts of hybridization and introgression ................................................................... 8 The aim of my study ............................................................................................................... 9 Materials and Methods ............................................................................................................ 11 Origin of the samples and laboratory protocols .................................................................
    [Show full text]
  • White Paper on CLC Read Mapper
    White Paper White paper on CLC read mapper October 10, 2012 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com [email protected] White paper: White paper on CLC read mapper 2 Contents 1 Abstract 3 2 Introduction 3 3 Performance Benchmark of CLC Genomics Workbench/Server 5 4 Computational Resource Requirements of CLC Assembly Cell 9 5 Accuracy Benchmark of CLC Assembly Cell 12 6 Algorithmic Details 18 7 Conclusions 19 8 Materials & Methods 19 8.1 Performance Benchmark of CLC Genomics Workbench/Server ........... 19 8.2 Computational Resource Requirements of CLC Assembly Cell ............ 20 8.3 Accuracy Benchmark of CLC Assembly Cell ...................... 20 8.4 Read Mappers ..................................... 22 8.5 Data Sets ....................................... 22 8.6 Benchmarking Hardware ............................... 23 8.7 bash related ...................................... 23 References 25 White paper: White paper on CLC read mapper 3 1 Abstract After decades of biological research relying on Sanger sequencing, massively parallel high throughput sequencing (HTS) techniques have created a broad range of new and exciting research applications by increasing the output sequencing data dramatically. Although allowing for hitherto unseen DNA and RNA sequencing and binding study designs, HTS technologies have created remarkable bioinformatic challenges. In typical resequencing studies read mappers are used to align sequence reads to reference genomes. Read mapping, while not too time consuming in the Sanger-century, quickly evolved into one of the most insistent bottlenecks. Nowadays, researchers can resort to a broad range of read mapping solutions and it becomes increasingly challenging to choose software that optimally meets given requirements.
    [Show full text]
  • A Comprehensive SARS-Cov-2 Genomic Analysis Identifies Potential Targets for Drug Repurposing
    PLOS ONE RESEARCH ARTICLE A comprehensive SARS-CoV-2 genomic analysis identifies potential targets for drug repurposing 1☯ 1☯ 2,3 Nithishwer Mouroug Anand , Devang Haresh Liya , Arpit Kumar PradhanID *, Nitish Tayal4, Abhinav Bansal5, Sainitin Donakonda6, Ashwin Kumar Jainarayanan7,8* 1 Department of Physical Sciences, Indian Institute of Science Education and Research, Mohali, India, 2 Graduate School of Systemic Neuroscience, Ludwig Maximilian University of Munich, Munich, Germany, 3 Klinikum rechts der Isar, Technische UniversitaÈt MuÈnchen, MuÈnchen, Germany, 4 Department of Biological Sciences, Indian Institute of Science Education and Research, Mohali, India, 5 Department of Chemical a1111111111 Sciences, Indian Institute of Science Education and Research, Mohali, India, 6 Institute of Molecular a1111111111 Immunology and Experimental Oncology, Klinikum rechts der Isar, Technische UniversitaÈt MuÈnchen, a1111111111 MuÈnchen, Germany, 7 The Kennedy Institute of Rheumatology, University of Oxford, Oxford, United a1111111111 Kingdom, 8 Interdisciplinary Bioscience DTP, University of Oxford, Oxford, United Kingdom a1111111111 ☯ These authors contributed equally to this work. * [email protected] (AKP); [email protected] (AKJ) OPEN ACCESS Abstract Citation: Anand NM, Liya DH, Pradhan AK, Tayal N, The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) which is a novel Bansal A, Donakonda S, et al. (2021) A comprehensive SARS-CoV-2 genomic analysis human coronavirus strain (HCoV) was initially reported in December 2019 in Wuhan City, identifies potential targets for drug repurposing. China. This acute infection caused pneumonia-like symptoms and other respiratory tract ill- PLoS ONE 16(3): e0248553. https://doi.org/ ness. Its higher transmission and infection rate has successfully enabled it to have a global 10.1371/journal.pone.0248553 spread over a matter of small time.
    [Show full text]
  • Computational Biology and Bioinformatics
    DEPARTMENT OF COMPUTATIONAL BIOLOGY AND BIOINFORMATICS UNIVERSITY OF KERALA MSc. PROGRAMME IN COMPUTATIONAL BIOLOGY SYLLABUS Under Credit and Semester System w. e. f. 2017 Admissions DEPARTMENT OF COMPUTATIONAL BIOLOGY AND BIOINFORMATICS UNIVERSITY OF KERALA MSc. PROGRAMME IN COMPUTATIONAL BIOLOGY SYLLABUS PROGRAMME OBJECTIVES Aims to equip students with basic computational and mathematical skill To impart basic life science knowledge To acquire advanced computational and modelling skills required to address problems of life sciences for computational perspectives MSc. Syllabus of the Programme Number of Semester Course Code Name of the course Credits Core Courses BIN-C-411 Introduction to Life Sciences & Bioinformatics 4 BIN-C-412 Applied Mathematics 4 BIN-C-413 Web programming and Databases 4 I BIN-C-414 Bioinformatics Lab I 3 Internal Electives BIN-E-415 (i) Python Programming (E) 2 BIN-E-415 (ii) Seminar I (E) 2 BIN-E-415 (iii) Programming in R (E) 2 BIN-E-415 (iv) Communication skill in English (Elective skill course) 2 Core Courses BIN-C-421 Creativity, Research & Knowledge Management 4 BIN-C-422 Fundamentals of Molecular Biology 4 BIN-C-423 Computational Genomics 4 BIN-C-424 Bioinformatics Lab II 3 II Internal Electives BIN-E-425 (i) Perl and BioPerl (E) 4 BIN-E-425 (ii) Case Study (E) 2 BIN-E-425 (iii) Android App Development for Bioinformatics(E) 2 BIN-E-425 (iv) Negotiated Studies(E) 2 BIN-E-425 (v) Communication skill in English (Elective skill course) 2 Core Courses BIN-C-431 Proteomics and CADD 4 BIN-C-432 Phylogenetics
    [Show full text]
  • An Efficient Pipeline for Assaying Whole-Genome Plastid Variation for Population Genetics and Phylogeography
    Portland State University PDXScholar Dissertations and Theses Dissertations and Theses Spring 6-2-2017 An Efficient Pipeline for Assaying Whole-Genome Plastid Variation for Population Genetics and Phylogeography Brendan F. Kohrn Portland State University Follow this and additional works at: https://pdxscholar.library.pdx.edu/open_access_etds Part of the Biology Commons, and the Plant Sciences Commons Let us know how access to this document benefits ou.y Recommended Citation Kohrn, Brendan F., "An Efficient Pipeline for Assaying Whole-Genome Plastid Variation for Population Genetics and Phylogeography" (2017). Dissertations and Theses. Paper 4007. https://doi.org/10.15760/etd.5891 This Thesis is brought to you for free and open access. It has been accepted for inclusion in Dissertations and Theses by an authorized administrator of PDXScholar. Please contact us if we can make this document more accessible: [email protected]. An Efficient Pipeline for Assaying Whole-Genome Plastid Variation for Population Genetics and Phylogeography by Brendan F. Kohrn A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Biology Thesis Committee: Mitch Cruzan, Chair Sarah Eppley Rahul Raghavan Portland State University 2017 © 2017 Brendan F. Kohrn i Abstract Tracking seed dispersal using traditional, direct measurement approaches is difficult and generally underestimates dispersal distances. Variation in chloroplast haplotypes (cpDNA) offers a way to trace past seed dispersal and to make inferences about factors contributing to present patterns of dispersal. Although cpDNA generally has low levels of intraspecific variation, this can be overcome by assaying the whole chloroplast genome. Whole-genome sequencing is more expensive, but resources can be conserved by pooling samples.
    [Show full text]
  • Deep Sampling of Hawaiian Caenorhabditis Elegans Reveals
    RESEARCH ARTICLE Deep sampling of Hawaiian Caenorhabditis elegans reveals high genetic diversity and admixture with global populations Tim A Crombie1, Stefan Zdraljevic1,2, Daniel E Cook1,2, Robyn E Tanny1, Shannon C Brady1,2, Ye Wang1, Kathryn S Evans1,2, Steffen Hahnel1, Daehan Lee1, Briana C Rodriguez1, Gaotian Zhang1, Joost van der Zwagg1, Karin Kiontke3, Erik C Andersen1* 1Department of Molecular Biosciences, Northwestern University, Evanston, United States; 2Interdisciplinary Biological Sciences Program, Northwestern University, Evanston, United States; 3Department of Biology, New York University, New York, United States Abstract Hawaiian isolates of the nematode species Caenorhabditis elegans have long been known to harbor genetic diversity greater than the rest of the worldwide population, but this observation was supported by only a small number of wild strains. To better characterize the niche and genetic diversity of Hawaiian C. elegans and other Caenorhabditis species, we sampled different substrates and niches across the Hawaiian islands. We identified hundreds of new Caenorhabditis strains from known species and a new species, Caenorhabditis oiwi. Hawaiian C. elegans are found in cooler climates at high elevations but are not associated with any specific substrate, as compared to other Caenorhabditis species. Surprisingly, admixture analysis revealed evidence of shared ancestry between some Hawaiian and non-Hawaiian C. elegans strains. We suggest that the deep diversity we observed in Hawaii might represent patterns of ancestral C. elegans *For correspondence: genetic diversity in the species before human influence. [email protected] Competing interests: The authors declare that no Introduction competing interests exist. Over the last 50 years, the nematode Caenorhabditis elegans has been central to many important Funding: See page 21 discoveries in the fields of developmental, cellular, and molecular biology.
    [Show full text]
  • Methodology in Phylogenetics
    Bovine TB Workshop 2015 Methodology in Phylogenetics Joseph Crisp BBSRC funded PhD Student Rowland Kao Ruth Zadoks [email protected] NGS Technologies Next Generation Sequencing Platforms • Cheap and fast alternatives to Sanger sequencing methods • Prone to error production • Provides a huge amount of data that can be used to establish the validity of variation observed Metzer 2010 – Sequencing technologies – the next generation Raw Data FASTQ File @InstrumentName : RunId : FlowCellId : Lane : TileNumber : X-coord : Y-coord PairId : Filtered? : Bit CGCGTTCATGTGCGGCGCCGGCGCTGGTTTCCATCGGTCGATTCGGACGGCAAACATCGACCGCAGGATCCGCCGTACCATGTCCGACA GGCGCCCCTTGGGTAGATTGCCGTCGGCGTAGGCGGCACGCAGGCGGACGGAGAGTGCTTCCGAGTGCCACGGCGCTGAATCGATCCG CGCCGCGCACCTTTGGTCCAGGGCGGCCAGCGCGCACTCCCAGCTGGGTGTTTCGGCCCCATCCGCACTCACCC + 1>1>>AA1@333AA11AE00AEAE///FH0BFFGB/E/?/>FHH/B//>EEGE0>0BGE0>//E/C//1<C?AFC///<FGF1?1?C?-<FF-@??- C./CGG0:0C0;C0-.;C-?A@--.:?-@-@B@<@=-9--9---:;-9///;//-----/;/9----9;99///;-9----@;-9-;9-9-;//;B-9/B/9-;9@--@AE@@-;- ;-BB-9/-//;A9-;B-/--------9------//;-- Cock et al. 2010 – The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants FASTQC Raw Data Andrews 2010 – FastQC: A quality control tool for high throughput sequence data Trimming ATGATAGCATAGGGATTTTACATACATACATACAGATACATAGGATCTACAGCGC ATGATAGCATAGGGATTTTACATACATACATACAGATACATAGGATCTACAGCGC Fabbro et al. 2013 – An extensive evaluation of read trimming effects on Illumina NGS data analysis FASTQC Raw Data Andrews 2010 – FastQC: A quality
    [Show full text]
  • Phylogenetic Analyses of Sites in Different Protein Structural Environments Result in Distinct Placements of the Metazoan Root
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 27 October 2019 doi:10.20944/preprints201910.0302.v1 Peer-reviewed version available at Biology 2020, 9, 64; doi:10.3390/biology9040064 Article Phylogenetic Analyses of Sites in Different Protein Structural Environments Result in Distinct Placements of the Metazoan Root Akanksha Pandey 1 and Edward L. Braun 1,2,* 1 Department of Biology, University of Florida; [email protected] 2 Genetics Institute, University of Florida; [email protected] * Correspondence: [email protected] Abstract: Phylogenomics, the use of large datasets to examine phylogeny, has revolutionized the study of evolutionary relationships. However, genome-scale data have not been able to resolve all relationships in the tree of life; this could reflect, at least in part, the poor-fit of the models used to analyze heterogeneous datasets. Some of the heterogeneity may reflect the different patterns of selection on proteins based on their structures. To test that hypothesis, we developed a pipeline to divide phylogenomic protein datasets into subsets based on secondary structure and relative solvent accessibility. We then tested whether amino acids in different structural environments had distinct signals for the topology of the deepest branches in the metazoan tree. The most striking difference in phylogenetic signal reflected relative solvent accessibility; analyses of exposed sites (on the surface of proteins) yielded a tree that placed ctenophores sister to all other animals whereas sites buried inside proteins yielded a tree with a sponge-ctenophore clade. These differences in phylogenetic signal were not ameliorated when we repeated our analyses using the CAT model, a mixture model that is often used for analyses of protein datasets.
    [Show full text]