System-Wide Modulation of HECT E3 Ligases with Selective Ubiquitin Variant Probes

System-wide modulation of HECT E3 ligases with selective ubiquitin variant probes

Wei Zhang1,11, Kuen-Phon Wu2,11, Maria A. Sartori1, Hari B. Kamadurai2, Alban Ordureau3, Chong Jiang4, Peter Y. Mercredi2, Ryan Murchie4, Jicheng Hu5, Avinash Persaud4, Manjeet Mukherjee2, Nan Li6, Anne Doye7, John R. Walker5, Yi Sheng8, Zhenyue Hao9, Yanjun Li5, Kevin R. Brown1, Emmanuel Lemichez7, Junjie Chen6, Yufeng Tong5,10, J. Wade Harper3, Jason Moffat1,12, Daniela Rotin4,12, Brenda A. Schulman2,12 * and Sachdev. S. Sidhu1,12 *

1Donnelly Centre for Cellular and Biomolecular Research, Banting and Best Department of Medical Research, University of Toronto, 160 College Street, Toronto, Ontario M5S3E1, Canada 2Department of Structural Biology and Tumor Cell Biology, Howard Hughes Medical Institute, St. Jude Children's Research Hospital, Memphis, TN 38105, USA 3Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA 4Program in Cell Biology, Hospital for Sick Children, and Department of Biochemistry, University of Toronto, Toronto, Ontario M5G 0A4, Canada 5Structural Genomics Consortium, University of Toronto, Toronto, Ontario M5G1L7, Canada 6Department of Experimental Radiation Oncology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030, USA 7Inserm U1065, Centre Méditerranéen de Médecine Moléculaire, C3M, Université de Nice-Sophia Antipolis, 151 Route St Antoine de Ginestière, BP 2 3194, 06204 Nice Cedex, France. 8Department of Biology, York University, Toronto, Ontario M3J1P3, Canada 9Campbell Family Cancer Research Institute, University Health Network, Toronto, Ontario M5G2C1, Canada 10Department of Pharmacology and Toxicology, University of Toronto, Toronto, Ontario M5G1L7, Canada 11Co-first author 12Co-senior author

*To whom correspondence should be addressed. E-mail: [email protected] (B.A.S.) and [email protected] (S.S.S).

SUMMARY

HECT-family E3 ligases ubiquitinate protein substrates to control virtually every eukaryotic process, and are misregulated in numerous diseases. Nonetheless, understanding of HECT E3s is limited by a paucity of selective and potent modulators.

To overcome this challenge, we systematically developed ubiquitin variants (UbVs) that inhibit or activate HECT E3s. Structural analysis of 6 HECT-Ubv complexes revealed their UbV inhibitors hijacking the E2-binding site, and activators occupying a ubiquitin- binding exosite. Furthermore, UbVs unearthed distinct regulation mechanisms among

NEDD4 subfamily HECTs and proved useful for modulating therapeutically relevant targets of HECT E3s in cells and intestinal organoids, and in a genetic screen that identified a role for NEDD4L in regulating cell migration. Our work demonstrates versatility of UbVs for modulating activity across an E3 family, defines mechanisms and provides a toolkit for probing functions of HECT E3s, and establishes a general strategy for systematic development of modulators targeting families of signaling proteins. (150 words)

HIGHLIGHTS

• High-affinity and selective UbV modulators for 20 HECT E3 ligases

• UbV inhibitors hijack the E2 binding site

• N-lobe exosite bound UbVs activate HECT E3 ligases

• UbVs function in cells and intestinal organoids to reveal new roles of HECT E3

ligases

INTRODUCTION

Ubiquitination mediated by E1-E2-E3 multi-enzyme cascades rivals phosphorylation as a predominant mechanism regulating myriad protein functions (Cohen and Tcherpakov,

2010; Nalepa et al., 2006). Repeated catalytic cycles result in substrates modified on multiple lysines with various polyubiquitin chains, which alter protein functions in an extraordinary variety of ways. Because E3 ligases control substrate specificity and the topology of ubiquitination, they represent attractive targets for therapeutic intervention

(Nalepa et al., 2006; Petroski, 2008). Yet, identifying the diversity of mechanisms regulating E3 ligases, as well as generation of tools for their manipulation, has lagged behind deciphering regulation and developing therapeutics for kinases (Cohen and

Tcherpakov, 2010; Nalepa et al., 2006). Being the first family of E3 ligases discovered

(Huibregtse et al., 1995), HECT (Homologous to E6AP C-Terminus) E3s are directly implicated in cancer, hypertension, neurological disorders and other diseases (Table

S1) (Rotin and Kumar, 2009; Scheffner and Kumar, 2014). Moreover, some pathogenic bacteria have evolved HECT-like E3s as virulence factors to manipulate host cell signaling (Lin et al., 2012; Rohde et al., 2007). Therefore, understanding molecular mechanisms of HECT E3 function could greatly advance therapeutic strategies for many diseases.

However, development of agents to selectively modulate HECT E3s has been hampered by extreme inter-domain rotations accompanying catalysis, a shallow active site, and dynamic regulation of HECT E3 activity (Escobedo et al., 2014; Gallagher et al., 2006; Huang et al., 1999; Kamadurai et al., 2013; Kamadurai et al., 2009; Mari et

al., 2014; Persaud et al., 2014; Ronchi et al., 2013; Verdecia et al., 2003; Wiesner et al.,

2007). In principle, recently reported small molecule and peptide inhibitors obtained by high throughput screening for several HECT E3s provide routes to assess functions and mechanisms of HECT E3s in normal and diseased cells (Cao et al., 2014; Kathman et al., 2015; Mund et al., 2014; Rossi et al., 2014). However, existing molecules generally do not conform to a general strategy that could be used to interrogate HECT E3s across the family, fall short in terms of potency and specificity, and generally have had limited utility in probing unknown HECT mechanisms. Thus, we sought to develop a protein- based toolkit for HECT E3s on a system-wide scale, with the goal to discover and alter unknown functions and to validate therapeutic targets supported by genetic studies.

The defining feature of HECT E3s is a ~40 kDa C-terminal “HECT domain” containing two flexibly-tethered lobes (N- and C-), with 16-92% amino acid identity across the family. In addition to the catalytic domain, HECT E3 primary sequences reveal various

N-terminal domains that presumably enable substrate binding and dynamic regulation by mediating autoinhibition and influencing subcellular localization (Figure 1A). The largest and best-characterized class of HECT E3s comprises the NEDD4-family, which display a common architecture consisting of an N-terminal C2 domain, 2-4 central WW- domains distal and proximal to the catalytic domain, and the C-terminal HECT domain

(Rotin and Kumar, 2009; Scheffner and Kumar, 2014) (Figure 1A).

Notably, studies of E3s in the NEDD4-family revealed that the HECT domain interacts with Ub at multiple sites. For example, in complex with E2~Ub or in the E3~Ub

intermediate, the HECT “C-lobe” binds the Ub to be transferred, and a separate C-lobe interaction with the acceptor Ub is implied from biochemical studies (Kamadurai et al.,

2013; Kamadurai et al., 2009; Kim and Huibregtse, 2009; Maspero et al., 2013) (Figure

S1). In addition to interactions made by the active-site-bound Ub, a weak Ub-binding

“exosite” has been reported in the HECT “N-lobe” of various NEDD4-family E3s (French et al., 2009; Kim et al., 2011; Maspero et al., 2011; Ogunjimi et al., 2010). The diversity of Ub interactions with HECT E3s is reminiscent of deubiquitinases (DUBs), for which we recently devised a strategy to generate specific and potent inhibitors that we proposed would be adaptable to virtually any Ub-interacting protein (Ernst et al., 2013).

Our approach is based on the fact that numerous proteins that interact with Ub recognize a common surface with low affinity. The weak interactions may be required because Ub has to be quickly released after an enzymatic reaction or transient recognition has occurred. We reasoned that it is possible to identify specific mutations in

Ub that produce a Ub variant (UbV) with optimized contacts to a particular Ub- interacting protein. To date, this strategy has been used to create potent and specific inhibitors that block DUB binding sites for substrate Ub molecules (Ernst et al., 2013;

Phillips et al., 2013; Zhang et al., 2013). In an initial screen, we identified a UbV that bound weakly to the HECT domain of NEDD4 and acted as an activator rather than inhibitor of enzymatic function (Ernst et al., 2013). This surprising result led us to hypothesize that the inherent complexities of the HECT catalytic mechanism, involving allosteric changes and multiple Ub-binding sites, may prove advantageous to enabling the development of UbV modulators that could alter enzymatic activities to promote

cellular phenotypes beyond those possible with simple active-site inhibitors (Figure 1B).

In principle, such modulators could shed light on the mechanistic subtleties and biological functions of HECT family members and could aid development of therapeutic strategies based on activation of ligase activity. Thus, we conducted a system-wide, unbiased screen with a diverse UbV library (Figure 1C-D) to explore the full potential for modulating enzyme function across the human HECT family.

RESULTS

Development of potent and selective UbV modulators for 20 HECT E3 ligases

We used a phage-displayed UbV library that varies almost all residues contacting the N- lobe exosite but only a subset of those mediating interactions in the transient catalytic intermediates (Figure S1). Binding selections (Figure 1D) against purified HECT domains for 19 of 28 total human and 1 of 5 total yeast HECT E3s (Table S1) yielded 69

UbVs with a variety of substitutions across the binding surface (Tables S2 and S3).

Assessment of affinities for cognate HECT domains by measuring EC50 values (Figure

S2 and Table S4) confirmed higher affinity interactions for UbVs (in some cases EC50

<10 nM) than for Ub, which in accordance with previous studies showed no detectable binding even at micromolar concentrations. Tight binding was also confirmed by Bio-

Layer interferometry (BLI) (Figures 1E-F and S3). Indeed, many UbVs bound their cognate HECT domains 500-1000-fold tighter than Ub (Table S5). Moreover, ELISAs revealed that the UbVs are highly specific, as most recognize preferentially their cognate HECT domain amongst a panel of 20 HECT domains and other control proteins

(Figures 1G). Even among the 9 most closely related HECT E3s in humans that

comprise the NEDD4-family, for those related by ≤55% identity there was strong specificity, for example an average of 500-fold lower affinity for half the NEDD4L- binding UbVs toward WWP1 (52% identity) and 70-fold lower affinity of WWP1-binding

UbVs toward NEDD4L (Figure 1F). Although there is some cross-reactivity for HECT domains that are ≥80% identical (e.g. WWP2 UbVs to WWP1), four NEDD4L-binding

UbVs displayed ≥14-fold selectivity over NEDD4 (Figure S3 and Table S5). While a subset of UbVs selected with WWP2 showed cross-reactivity to its close homolog

WWP1, those selected with NEDD4 and WWP1 were strikingly specific and did not cross-react with non-cognate E3s sharing > 80% identity (Figure 1G-H).

Whereas previous studies confirmed that DUB catalytic activity is potently inhibited by associated UbVs targeting their substrate-binding sites (Ernst et al., 2013; Phillips et al.,

2013; Zhang et al., 2013), we hypothesized that UbVs targeting different sites on HECT

E3s may modulate ligase activity in a variety of ways that might not involve the active site. To explore how UbVs could influence intrinsic HECT ligase enzyme activity, we monitored E3 autoubiquitination and observed a wide range of effects for 59 UbVs assayed with 19 HECT E3s (Figures S4 and S5). Indeed, many UbVs acted as inhibitors (e.g. WWP1 UbVs in Figure S4C) but others massively increased ubiquitination (e.g. WWP2 UbVs in Figure S4D). Unexpectedly, rather than having a switch-like activating or inhibiting effect, two UbVs that bind NEDD4L (NL.1 and NL.2) primarily altered extent of autoubiquitination in our assays (Figure S4B).

UbV inhibitors hijack the E2 binding site

To gain insights into the basis for specific interactions and the mechanisms whereby

UbVs inhibit, activate or modulate activity, we attempted co-crystallization of numerous

HECT domain-UbV complexes, with or without E2s. We focused on members of the

NEDD4-family because they regulate crucial physiological processes ranging from blood pressure to immunity, their catalytic mechanisms are better characterized than those of other HECT E3s (Scheffner and Kumar, 2014), and their UbVs displayed a perplexing variety of effects despite the perceived common catalytic mechanism across this subfamily (Figure S4). We determined structures of six complexes (Table 1) that span a wide range of affinities with five different HECT domains (NEDD4L-NL.1 – 10 nM, Rsp5-R5.4 – 125 nM, WWP1-P2.3 – 230 nM, WWP1-P1.1 – 325 nM, ITCH-IT.2 -

≈10 µM and NEDD4-N4.4 - ≈90 µM) (Figure S3 and Table S5), and that display inhibitory (P1.1, IT.2), activating (P2.3, N4.4) or modulatory (NL.1, R5.4) effects in autoubiquination assays, including a complex between WWP1 and a tightly binding UbV

(P2.3) selected to bind the closely related WWP2. In all of the structures, UbV binding was mediated by a surface including the classic protein interacting hydrophobic patch

(positions 8, 44, 68 and 70). Furthermore, all these HECT domains displayed one of two distinctive UbV binding modes described in detail below.

Unexpectedly, UbV P1.1 on WWP1 and UbV IT.2 on ITCH inhibit not by binding a known Ub-binding site, but rather, by hijacking the E2-binding site (Huang et al., 1999), which appears to be partially mobile based on the variety of conformations observed in previous structures of WWP1, ITCH, and other HECT domains (Figures 2A, S6, and

S7). Here, UbV hydrophobic patch residues 8, 44, 68 and 70 occupy the classic HECT

E3 binding site for E2 loops 1 and 2 (F63 and P97, respectively, in a HECT-bound

UBCH7) (Huang et al., 1999; Kamadurai et al., 2009) (Figure 2B). The inhibitory interactions are stabilized by numerous additional interactions, including a UbV’s β1/β2 loop inserting into a nearby flexible pocket (Figure S8A-D). Accordingly, these UbVs inhibited HECT E3 activity by counteracting Ub transfer from E2 to E3 (Figured 2C-D and S4C, E).

N-lobe exosite bound UbVs promote E3 catalytic activities

The other four structures showed UbVs binding the N-lobe exosite of NEDD4, NEDD4L,

WWP1 or Rsp5 in a manner resembling the previously described binding of Ub at this site (Kim et al., 2011; Maspero et al., 2011) (Figure 3A). The HECT domain N-lobe-

Ub/UbV complexes superimpose with 0.8-1.5 Å RMSD overall, but also reveal details for how subtle differences can be exploited for specific noncovalent targeting at this site

(Figures S6D and S8E-F). Although previous mutagenesis studies probed roles of Ub binding to the N-lobe exosite, the interpretations have been inconclusive and controversial. Proposed functions have ranged from competition of Ub with the C2 domain to relieve E3 autoinhibition, binding of the acceptor Ub that receives Ub from the

HECT active site, or binding of substrate-linked Ub chains to either stimulate or inhibit further chain elongation (French et al., 2009; Herrador et al., 2013; Kathman et al.,

2015; Kim et al., 2011; Maspero et al., 2011; Ogunjimi et al., 2010). To date, it has not been possible to differentiate positive and negative roles of exosite Ub binding with deleterious mutations. By contrast, adding a UbV to the ubiquitination reaction can

promote positive allosteric effects on the E3 while competing with prospective ubiquitinated substrates.

We therefore tested whether the NEDD4-family N-lobe exosite generally recruits an acceptor Ub and/or relieves allosteric autoinhibition mediated by the C2 domain. For

NEDD4L and WWP1, we used pulse-chase assays that produce free Ub~Ub chains to monitor Ub transfer from the E3 to an acceptor Ub. Because rapid HECT E3 autoubiquitination precludes generation of stable HECT~Ub intermediates, we initiated the reactions with thioester-bonded E2~Ub intermediates for the E2 UBCH7 using a fluorescently-labeled version of Ub. Adding the E2~Ub to an active HECT E3 along with or without excess free Ub and substrate tests the effects of UbVs on E3-mediated Ub transfer from E2 to E3 to substrate or acceptor Ub. The reactions generate a thioester- bonded E3~Ub, isopeptide-linked Ub~Ub or ubiquitinated substrate product readily detected by SDS-PAGE (Figures 3B-F and 4A-C). Surprisingly, experiments performed in the presence of UbVs excluded previously hypothesized roles and instead identified novel functions for Ub binding at this exosite on NEDD4L and WWP1. Saturating the N- lobe exosite with a UbV did not inhibit Ub~Ub synthesis, ruling out the possibility that this site binds the acceptor Ub. Unexpectedly, these UbVs activated E3~Ub, Ub~Ub synthesis and substrate ubiquitination for multiple versions of both E3s, suggesting allosteric activation mechanisms not involving the C2 domain (Figures 3D-F and 4A-C).

Notably, occupation of the N-lobe exosite by a UbV has different effects on different

HECT E3s, because all versions of WWP1 including the isolated HECT domain showed substantially activated Ub~Ub synthesis whereas inclusion of distal WW domains was

required to observe dramatic UbV-mediated activation for NEDD4L (Figures 4D and

S9).

To further probe how UbVs differentially modulate HECT E3 activities, we performed a battery of experiments with various substrates using either WT Ub or methylated Ub that cannot form chains (Figures S9, S10, and S11). Taken together, our data imply that occupation of the N-lobe exosite modulates activity through numerous mechanisms that were not previously reported. For example, for NEDD4L and Rsp5, N-lobe exosite- binding UbVs activated the transthioesterification reaction (Ub transfer from E2 to E3) in a manner that is independent of the C2 domain but depends on the distal WW domains, presumably by relieving their autoinhibition (Figures 3D, F, S9A-B, and S10B) (Riling et al., 2015). Intriguingly, two UbVs modulate NEDD4L activity by decreasing processive and increasing distributive multi-monoUb ligation directly to substrate, with slightly increased Ub chain elongation (Figure S11A-E and H-I). Thus, unlike previous reports on other NEDD4-family members that suggested blocking Ub binding primarily inhibits processive extension of a Ub chain (Kathman et al., 2015; Kim et al., 2011; Maspero et al., 2011; Maspero et al., 2013), our data demonstrate that occupation of the exosite positively and negatively influences many properties of the reaction. Accordingly, ubiquitination can be activated by relieving from autoinhibition and increased substrate turnover, yet individual substrate molecules may have fewer lysines modified at a time.

Depending on reaction conditions, there may be increased flux through the pathway when NEDD4L is saturated with an exosite-binding UbV. Indeed, we used the UB-

AQUA method, an unbiased proteomics approach for quantifying ubiquitin signaling

(Kirkpatrick et al., 2005; Ordureau et al., 2015; Ordureau et al., 2014; Phu et al., 2011), and found that NL.1 increased the total abundance of Ub chains, primarily containing canonical K63-linkages, formed on in vitro autoubiquitinated NEDD4L (Figure 3G-I).

Furthermore, this effect was also observed upon induction of NL.1 expression in

HEK293 cells, which resulted in a ~20% increase in total K63-linked chains (Figure 3J).

Interestingly, the effect of UbV binding to the N-lobe exosite on WWP1 differs from the effect on NEDD4L (Figures S9 and S11). Although UbV P2.3 slightly inhibits WWP1 reactions where a substrate molecule only encounters the E3 once, it massively increases the amount of substrate modified and the number of Ubs attached in reactions where ubiquitinated products that are released can re-bind WWP1 in numerous reaction cycles (Figure S11F, G, J). Thus, capture of Ub on a substrate is less important for processive monoubiquitination of multiple sites during a single encounter with WWP1 than with NEDD4L. Instead, it is more important for reactions where ubiquitinated substrates come off and on E3s during repeated reaction cycles

(Figure S11B-E vs. F-G).

UbVs modulate HECT E3 functions in cells and intestinal organoids (mini-guts)

Given the utility of the UbVs for probing HECT E3 functions in vitro, and the parallel effects of UbV NL.1 on increasing Ub chain formation in mammalian cells (Figure 3J), we examined effects in cells upon expressing UbVs targeting a select panel of HECT

E3s (HACE1, HUWE1, WWP2, and NEDD4L). In all cases, expression of UbVs increased or attenuated ubiquitination levels in accordance with their in vitro properties

(Inoue et al., 2013; Maddika et al., 2011; Torrino et al., 2011). For instance, inhibitors of

HACE1 or HUWE1 significantly decreased ubiquitination of the HACE1 target Rac1

(Figure S12A) or stabilized the protein levels of HUWE1 and its substrate c-Myc, respectively (Figure S12B). Furthermore, activators of WWP2 increased autoubiquitination and degradation of WWP2 and its substrate PTEN (Figure S12C-D).

We also evaluated the effects of UbVs targeting NEDD4L on regulation of its best- characterized substrate, the Epithelial Na+ Channel, ENaC (SCNN1) (Kamynina et al.,

2001; Kimura et al., 2011). Kidney-derived epithelial MDCK cells stably expressing

αβγENaC (Figure 5A-B) and activator NL.1 or inhibitor NL.3 (Figure S13A) were tested for ENaC cell surface stability and function. Our results show reduced stability and cell- surface expression of ENaC by NL.1, but not NL.3 (Figures 5A-C and S13B), and accordingly, reduced or enhanced ENaC function (amiloride-sensitive Na+ channel activity, Isc) by NL.1 or NL.3, respectively (Figure 5D-E). Taken together, these results show that UbVs activate or inhibit HECT E3s in cells in a manner consistent with their in vitro activities.

The ability to modulate NEDD4L activity is of particular interest, because elevated cell surface expression of ENaC and NCC (Na+-Cl− Co-transporter, another NEDD4L substrate) in the distal nephron causes increased Na+ reabsorption and salt-induced hypertension (Ronzaud et al., 2013). Indeed, mutations in the PY motifs of ENaC, which prevent proper NEDD4L binding to and suppression of this channel, cause Liddle syndrome, a hereditary hypertension (Lifton et al., 2001). Likewise, renal tubular

deficiency of NEDD4L causes salt-induced hypertension by elevated NCC and ENaC abundance and function (Ronzaud et al., 2013). The increased NCC function and hypertension partially resembles Pseudohypoaldosteronism II (PHA II), another genetic hypertension caused by elevated NCC function due to mutations in its regulators, the

WNK kinases (Wilson et al., 2001). Moreover, NEDD4L targets ENaC in lung epithelia, and NEDD4L depletion there causes massive inflammation and airway mucus plugging, resembling lung disease in cystic fibrosis patients (Kimura et al., 2011).

Thus, our identification of UbV activators of NEDD4L function could point to a novel therapeutic avenue for the treatment of hypertension and inflammation. This would require a proof that UbVs can function in mammalian tissues, not just in isolated cells.

To this end, we utilized the recently developed technology to grow three-dimensional intestinal epithelial organoids (mini-guts) from intestinal stem cells (Sato and Clevers,

2013)) and grew mouse distal colon organoids; the distal colon strongly expresses both

ENaC and NEDD4L ((Duc et al., 1994) and Jiang & Rotin, unpublished). Consistent with inhibition of ENaC function observed in MDCK cells, lentiviral transduction of NL.1 caused organoid luminal swelling due to reduced fluid reabsorption into the media, while expression of NL.3 had the opposite effect (Figures 5F and S13C). The effect of UbVs on the organoid luminal volume change is likely mediated by NEDD4L regulating ENaC

(which is expressed in these organoids, Figure S13D), as treatment of NL.3 ubiquitin variant-transduced organoids with the ENaC inhibitor amiloride prevents the reduction in organoid surface area (Figure 5G). In conclusion, these data suggested that activation

of NEDD4L by targeting of the N-lobe exosite could be a means for treatment of hypertension and inflammation.

Lentiviral UbV genetic screen identifies novel functions of HECT E3s

To test whether UbVs can be used in a screen to discover unknown biological functions of HECT E3s in an unbiased and high throughput manner, we used our UbV panel to globally interrogate the family for roles in cell migration, a pathway known to involve ubiquitination and that is central to embryonic development and plays a major role in cancer invasion and metastasis (Deng and Huang, 2014; Simpson et al., 2008). While

SMURF2 and HACE1 have been implicated in cell migration by RNA interference

(Castillo-Lluva et al., 2013; David et al., 2014; Jin et al., 2009), we wondered whether our unprecedented ability to activate (or block) enzyme activity with UbVs could both score these positive controls and also potentially reveal roles for other HECT E3s not known previously as regulators this pathway. To this end, we transduced HCT116 human colon cancer carcinoma cells with a pool of 83 distinct lentiviruses, each containing an inducible defined UbV expression cassette targeting one of 19 HECT E3s or one of 13 other proteins, and analyzed the migratory response in a trans-well migration assay by deep sequencing (Figure 6A-B). Selected modulatory UbVs were further validated individually using two different cell migration assays (Figures 6C-E).

Upon induction of UbV expression by doxycycline and as expected based on RNA interference experiments (Castillo-Lluva et al., 2013; Jin et al., 2009), our screen identified inhibitors of HACE1 (HA.3) and SMURF2 (S2.5) that increased or decreased

cell migration, respectively (Figure 6B). In addition, we found that two activators (P2.3 and NL.1) caused striking decreases in cell migration. UbV P2.3 binds to both WWP1 and WWP2 (Table S5), and its effect is thus likely due to the combined activation of these two enzymes. UbV NL.1 potently and specifically activates NEDD4L, which has not previously been implicated in cell migration. To identify putative NEDD4L substrates, we assayed effects of UbV NL.1 transient expression on protein levels of small GTPases, which are key regulators of cell migration (Torrino et al., 2011; Wang et al., 2003; Wang et al., 2014). Notably, we observed decreased abundance of endogenous RhoB protein following transient or inducible expression of NL.1 (Figures

6F and S14A), suggesting that RhoB could be an ubiquitination substrate of NEDD4L.

Consistent with this, we observed that NEDD4L interacts with RhoB in a pull down experiment (Figure 6G). Moreover, NEDD4L and was able to ubiquitinate RhoB in cells

(Figure 6H) and in vitro (Figure S14B), a process that was enhanced by NL.1. We further confirmed that in HCT116 cells, the depletion of RhoB decreased cell migration to the same level as Rac1 knockdown (Figure 6I). Although the function of RhoB in cell migration is not entirely understood, our observations are consistent with a report showing that depletion of RhoB can significantly reduce migration and invasion of prostate carcinoma cells (Alfano et al., 2012). Based on our observations, RhoB is likely the functional substrate of NEDD4L in regulating cell migration and access to both inhibitors and activators of HECT E3s enhanced our view of how these enzymes work to regulate cell migration (Figure 6J). The results imply that activation of NEDD4L through binding to the N-lobe exosite could be exploited as a novel means for inhibition of metastatic phenotypes.

DISCUSSION

There is great need for platforms that enable exploring functions of entire protein families in a wide array of settings. Indeed, the ability to screen kinases with hundreds of thousands of related potential inhibitory compounds has revolutionized our understanding of phosphoregulation and has revealed phosphorylation cascades to target for therapeutic development (Gross et al., 2015; Zhang et al., 2009). Given that ubiquitination plays equally important roles in signaling pathways essential for human health (Nalepa et al., 2006), it is very likely that similar systems directed at probing E3 ligase functions will yield new therapeutic avenues for many diseases. Furthermore, while traditional screening methods typically focus on developing inhibitors, an emerging concept is that allosteric modulators are likewise useful tools for interrogating pathways and developing therapeutics (Arkin et al., 2014; Hardy and Wells, 2004).

Here we showed that engineered UbVs are broadly useful for probing various functions across an E3 ligase family. Rather than acting as simple substrate mimics that target the active site, the UbVs acted through alternative structural mechanisms, which led to many unanticipated discoveries that collectively demonstrate versatility of the platform and diversity of HECT E3 ligase mechanisms. First, UbVs can target sites not known previously to bind Ub, such as the E2-binding site. Thus, it seems that the plasticity of the Ub fold allows selection of UbVs that target binding sites in general, although the striking similarity of the WWP1 and ITCH complexes with their UbVs also raises the question as to whether Ub may bind here as a natural means of regulation. Second, the

ability to use UbVs to probe functions across an E3 ligase family unveiled strikingly different roles of parallel interactions targeting HECT N-lobe exosites on different reactions performed by a given HECT E3, and among homologous proteins. Third, our system allows simultaneous selection of UbVs modulating various protein activities, showing that the complexity of multi-domain proteins can be exploited to alter rather than inhibit enzymatic functions. Notably, we anticipate that future studies could improve capturing distinctive mechanisms, for example through addition of various types of counter-screens during UbV selection.

Because a screen for UbV binders can yield modulators targeting different sites, which lead to very different effects on enzymatic function, the options for identifying potential pathways for therapeutic intervention are expanded beyond simple inhibition. Insights gained from in vitro analyses can be extended to cellular systems with lentiviral delivery of UbV genes. In particular, as shown by the example of NEDD4L, activation of E3 ligases may be exploited to enhance ubiquitination and degradation of ion channels involved in the regulation of blood pressure and inflammation, and of signaling proteins involved in cell migration and other cell functions that are subverted during cancer progression. Moreover, our results with NEDD4L UbV expression in colonic mini-guts demonstrate for the first time that UbVs can function in mammalian tissues, suggesting a means for modulating HECT E3 ligase activity for therapeutic benefit, and establish utility of the system in models of development and disease. We anticipate that our UbV toolkit will be useful for researchers exploring other pathways regulated by HECT E3s in cells and tissues, and that the UbV selection platform will be generally amenable to

cellular screens for studying the biology of ubiquitination and for the identification of new strategies for therapeutic targeting that go beyond traditional inhibitor development.

EXPERIMENTAL PROCEDURES

Selection of UbVs by phage display

All DNA constructs used to produce proteins for UbV selections and subsequent assays are listed in Table S6. The phage displayed UbV library used in this study was re- amplified from Library 2 as described (Ernst et al., 2013). Protein immobilization and

UbV binding selections were performed according to established protocols (Tonikian et al., 2007). Briefly, purified HECT E3 ligases were coated on 96-well MaxiSorp plates

(Thermo Scientific 12565135) by adding 100 µL of 1 µM proteins and incubating overnight at 4 ºC. Five rounds of selections using the phage-displayed UbV library were performed against immobilized proteins (Figure 1D). After the fifth round, binding UbV- phage clones were identified by clonal phage ELISAs and subjected to DNA sequencing to decode the UbV sequences (Tonikian et al., 2007).

Bio-Layer Interferometry (BLI)

Concentrated analyte and ligand proteins were diluted into BLI reaction buffer (25 mM

HEPES pH 7.0, 150 mM NaCl, 0.1 mg/ml bovine serum albumin, 0.01% Tween20). BLI experiments were performed on an Octet RED96 system (ForteBio) using anti-GST antibody biosensors for GST-tagged ligands (HECT domains) and His-tagged analytes or native WT ubiquitin at 25 ºC. 7-9 dilution points of analytes covering a wide concentration range were applied. Sensorgram raw data was processed and extracted by Octet Analysis 9.0 software. Dissociation constants (KD) were obtained by fitting the response wavelength shifts in the steady-state regions using single-site binding system

(Eq. 1) or nonequivalent two-site binding system (Eq. 2) shown below.

[!] �!" = �!"# (1) !!![!]

! ![!] !!!![!] �!" = �!"# ! (2) [!] !!!!!!!!!!![!] where Req is value of steady-state response shift in each sensorgram curve, [C] is the titrant concentration, Rmax is the maximal response in the steady-state region, KD is the binding constant for single-site binding system and KD1 and KD2 are two binding constants of nonequivalent two-site binding system. In both equations, Rmax and KD values are unknown and Levenberg–Marquardt algorithm was used to perform iterative non-linear least squares curve fitting in Profit 6.2 (QuantumSoft) to obtain the fitted Rmax and KD.

Protein crystallization

Six HECT E3-UbV complexes were crystalized: NEDD4LHECT-UbV NL.1, WWP1HECT-

UbV P2.3-UBCH7, WWP1HECT-UbV P1.1, Rsp5HECT-UbV R5.4, ITCHHECT-UbV IT.2, and

NEDD4HECT-UbV N4.4. Crystallization conditions and data analysis details are in

Supplemental Information.

Pulse-chase ubiquitination assays

The biochemical assays were performed and monitored using either fluorescently labeled ubiquitin (Ub*, * stands for fluorescein probe) or substrates (WBP2* or S-WBP2-

1K*). In all UbV-treated assays, 10-fold molar ratio of UbV/E3 was used to saturate

HECT E3 with UbV during the entire reaction time. All reacted samples were quenched by mixing with SDS sample loading buffer, separated by SDS-PAGE and analyzed based on fluorescent signals of Ub*, WBP2* or S-WBP2-1K*. A Typhoon FLA9500

Phosphoimager (GE Healthcare) was used to scan fluorescent gel images. Assay details are described in Supplemental Information.

Mammalian cell culture

DNA constructs used in the mammalian cell culture experiments are listed in Table S6.

Construction of the described vectors, conditions for transfection and lentivirus transduction, and antibodies for western blotting and immunoprecipitation (IP) are described in Supplemental Information.

ENaC stability and functional assays

To evaluate ENaC cell surface stability, MDCK cells stably expressing αβγENaC (Lu et al., 2007) together with NL.1 or NL.3 were seeded on 6-well plates and treated (or not) with 44.4 µM cycloheximide (CHX) at the indicated times. Cells were biotin-labeled with

0.5 mg/ml EZ-Link Sulfo-NHS-LC-Biotin (15 min, 4 °C), washed with PBS to remove unbound biotin, and lysed. Stability of surface ENaC was determined by quantifying

αENaC, as described in Supplemental Information, together with procedures for Ussing chamber analysis and Immunofluorescent (IF) confocal microscopy.

Trans-well cell migration assay

5x104 HCT116 cells expressing the UbV library or individual UbVs along with control cells were added on the upper chamber of cell-permeable inserts (Falcon #353182) placed into 12-well plates. Cells were maintained in FBS-free medium and treated with doxycycline (500 ng/mL) or vehicle and allowed to migrate for 48 h. 10% FBS-

containing medium was used as the chemoattractant agent in the lower chamber. All experiments were performed in triplicate. For UbV library-expressing cells, migratory and non-migratory cells were harvested from the outer or inner membranes, respectively. Genomic DNA was extracted using the QIAmp Blood Maxi kit according to manufacturer’s instructions (Qiagen) and prepared for Illumina sequencing as described in Supplemental Information. For single UbV-expressing cell lines, cells were stained using the Hemacolor stain kit according to the manufacturer’s instructions (Harleco).

Cells on the inner surface were swabbed out to remove non-migratory cells. Pictures of

5 different fields on the outer membrane were taken using a digital inverted microscope

(EVOSfl-AMG) and migratory cells were counted.

Full details of all experimental procedures are given in Supplemental Information.

AUTHOR CONTRIBUTIONS

Conceptualization, W.Z., K.P.W., B.A.S., S.S.S.; Methodology, W.Z., K.P.W., B.A.S.,

S.S.S.; Software, K.R.B. and J.M.; Investigation, W.Z., K.P.W., M.A.S., H.B.K., A.O.,

C.J., P.Y.M., R.M., J.H., A.P. M.M., N.L., A.D., J.R.W., Y.S., Z.H, Y.L., Y.T.,; Writing –

Original Draft and reviewing, W.Z., K.P.W., B.A.S., S.S.S.; Writing – Editing, E.L., J.M. and D.R.; Funding Acquisition, J.W.H., J.M., D.R., B.A.S., and S.S.S.; Supervision, E.L.,

J.C., Y.T., J.W.H., J.M., D.R., B.A.S., and S.S.S.

ACKNOWLEDGEMENTS

We thank members of the Sidhu and Schulman groups for helpful comments. We thank

Andrew Vorobyov, Eva Chou, Yogesh Hooda, Jun Gu and Aiping Dong for technical assistance. We are indebted to Pankaj Garg, Andreas Ernst, Abiodun Ogunjimi, Clare

Jeon, Satra Nim, Frank Sicheri and Hongrui Wang for reagents and advice. J.W.H. was supported by research grants from the NIH (R37NS083524 and GM095567). A.O. was supported by an Edward R. and Anne G. Lefler Center Postdoctoral Fellowship. J.W.H. is a consultant for Millennium: the Takada Oncology Company and Biogen. D.R. holds a

Canada Research Chair (Tier 1 in Biochemistry and Signal Transduction) and was supported by CIHR (MOP#130422). B.A.S. is an investigator of the Howard Hughes

Medical Institute (HHMI) and was supported by ALSAC, NIH R37GM065930 and

P30CA021765. NECAT and APS were supported by NIH P41 GM103403 and DOE

Contract DE-AC02-06CH11357. W.Z. was supported by a CIHR post-doctoral fellowship. S.S.S. was supported by CIHR operating grants (MOP#111149 and

136956). The Structural Genomics Consortium (SGC) is a registered charity (number

1097737) that receives funds from AbbVie, Bayer Pharma AG, Boehringer Ingelheim,

Canada Foundation for Innovation, Eshelman Institute for Innovation, Genome Canada,

Innovative Medicines Initiative (EU/EFPIA) [ULTRA-DD grant no. 115766], Janssen,

Merck & Co., Novartis Pharma AG, Ontario Ministry of Economic Development and

Innovation, Pfizer, São Paulo Research Foundation-FAPESP, Takeda, and the

Wellcome Trust. No conflicts of interest declared.

REFERENCES

Alfano, D., Ragno, P., Stoppelli, M.P., and Ridley, A.J. (2012). RhoB regulates uPAR signalling. Journal of cell science 125, 2369-2380. Arkin, M.R., Tang, Y., and Wells, J.A. (2014). Small-molecule inhibitors of protein- protein interactions: progressing toward the reality. Chemistry & biology 21, 1102-1114. Cao, Y., Wang, C., Zhang, X., Xing, G., Lu, K., Gu, Y., He, F., and Zhang, L. (2014). Selective small molecule compounds increase BMP-2 responsiveness by inhibiting Smurf1-mediated Smad1/5 degradation. Scientific reports 4, 4965. Castillo-Lluva, S., Tan, C.T., Daugaard, M., Sorensen, P.H., and Malliri, A. (2013). The tumour suppressor HACE1 controls cell migration by regulating Rac1 degradation. Oncogene 32, 1735-1742. Cohen, P., and Tcherpakov, M. (2010). Will the ubiquitin system furnish as many drug targets as protein kinases? Cell 143, 686-693. David, D., Jagadeeshan, S., Hariharan, R., Nair, A.S., and Pillai, R.M. (2014). Smurf2 E3 ubiquitin ligase modulates proliferation and invasiveness of breast cancer cells in a CNKSR2 dependent manner. Cell division 9, 2. Deng, S., and Huang, C. (2014). E3 ubiquitin ligases in regulating stress fiber, lamellipodium, and focal adhesion dynamics. Cell adhesion & migration 8, 49-54. Duc, C., Farman, N., Canessa, C.M., Bonvalet, J.P., and Rossier, B.C. (1994). Cell- specific expression of epithelial sodium channel alpha, beta, and gamma subunits in aldosterone-responsive epithelia from the rat: localization by in situ hybridization and immunocytochemistry. The Journal of cell biology 127, 1907-1921. Ernst, A., Avvakumov, G., Tong, J., Fan, Y., Zhao, Y., Alberts, P., Persaud, A., Walker, J.R., Neculai, A.M., Neculai, D., et al. (2013). A strategy for modulation of enzymes in the ubiquitin system. Science 339, 590-595. Escobedo, A., Gomes, T., Aragon, E., Martin-Malpartida, P., Ruiz, L., and Macias, M.J. (2014). Structural basis of the activation and degradation mechanisms of the E3 ubiquitin ligase Nedd4L. Structure 22, 1446-1457. French, M.E., Kretzmann, B.R., and Hicke, L. (2009). Regulation of the RSP5 ubiquitin ligase by an intrinsic ubiquitin-binding site. The Journal of biological chemistry 284, 12071-12079. Gallagher, E., Gao, M., Liu, Y.C., and Karin, M. (2006). Activation of the E3 ubiquitin ligase Itch through a phosphorylation-induced conformational change. Proceedings of the National Academy of Sciences of the United States of America 103, 1717-1722. Gross, S., Rahal, R., Stransky, N., Lengauer, C., and Hoeflich, K.P. (2015). Targeting cancer with kinase inhibitors. J Clin Invest 125, 1780-1789. Hardy, J.A., and Wells, J.A. (2004). Searching for new allosteric sites in enzymes. Current opinion in structural biology 14, 706-715. Herrador, A., Leon, S., Haguenauer-Tsapis, R., and Vincent, O. (2013). A mechanism for protein monoubiquitination dependent on a trans-acting ubiquitin-binding domain. The Journal of biological chemistry 288, 16206-16211. Huang, L., Kinnucan, E., Wang, G., Beaudenon, S., Howley, P.M., Huibregtse, J.M., and Pavletich, N.P. (1999). Structure of an E6AP-UbcH7 complex: insights into ubiquitination by the E2-E3 enzyme cascade. Science 286, 1321-1326.

Huibregtse, J.M., Scheffner, M., Beaudenon, S., and Howley, P.M. (1995). A family of proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase. Proceedings of the National Academy of Sciences of the United States of America 92, 2563-2567. Inoue, S., Hao, Z., Elia, A.J., Cescon, D., Zhou, L., Silvester, J., Snow, B., Harris, I.S., Sasaki, M., Li, W.Y., et al. (2013). Mule/Huwe1/Arf-BP1 suppresses Ras-driven tumorigenesis by preventing c-Myc/Miz1-mediated down-regulation of p21 and p15. Genes & development 27, 1101-1114. Jin, C., Yang, Y.A., Anver, M.R., Morris, N., Wang, X., and Zhang, Y.E. (2009). Smad ubiquitination regulatory factor 2 promotes metastasis of breast cancer cells by enhancing migration and invasiveness. Cancer research 69, 735-740. Kamadurai, H.B., Qiu, Y., Deng, A., Harrison, J.S., Macdonald, C., Actis, M., Rodrigues, P., Miller, D.J., Souphron, J., Lewis, S.M., et al. (2013). Mechanism of ubiquitin ligation and lysine prioritization by a HECT E3. eLife 2, e00828. Kamadurai, H.B., Souphron, J., Scott, D.C., Duda, D.M., Miller, D.J., Stringer, D., Piper, R.C., and Schulman, B.A. (2009). Insights into ubiquitin transfer cascades from a structure of a UbcH5B approximately ubiquitin-HECT(NEDD4L) complex. Molecular cell 36, 1095-1102. Kamynina, E., Tauxe, C., and Staub, O. (2001). Distinct characteristics of two human Nedd4 proteins with respect to epithelial Na(+) channel regulation. American journal of physiology Renal physiology 281, F469-477. Kathman, S.G., Span, I., Smith, A.T., Xu, Z., Zhan, J., Rosenzweig, A.C., and Statsyuk, A.V. (2015). A Small Molecule That Switches a Ubiquitin Ligase From a Processive to a Distributive Enzymatic Mechanism. J Am Chem Soc. Kim, H.C., and Huibregtse, J.M. (2009). Polyubiquitination by HECT E3s and the determinants of chain type specificity. Molecular and cellular biology 29, 3307-3318. Kim, H.C., Steffen, A.M., Oldham, M.L., Chen, J., and Huibregtse, J.M. (2011). Structure and function of a HECT domain ubiquitin-binding site. EMBO reports 12, 334- 341. Kimura, T., Kawabe, H., Jiang, C., Zhang, W., Xiang, Y.Y., Lu, C., Salter, M.W., Brose, N., Lu, W.Y., and Rotin, D. (2011). Deletion of the ubiquitin ligase Nedd4L in lung epithelia causes cystic fibrosis-like disease. Proceedings of the National Academy of Sciences of the United States of America 108, 3216-3221. Kirkpatrick, D.S., Gerber, S.A., and Gygi, S.P. (2005). The absolute quantification strategy: a general procedure for the quantification of proteins and post-translational modifications. Methods 35, 265-273. Lifton, R.P., Gharavi, A.G., and Geller, D.S. (2001). Molecular mechanisms of human hypertension. Cell 104, 545-556. Lin, D.Y., Diao, J., and Chen, J. (2012). Crystal structures of two bacterial HECT-like E3 ligases in complex with a human E2 reveal atomic details of pathogen-host interactions. Proceedings of the National Academy of Sciences of the United States of America 109, 1925-1930. Lu, C., Pribanic, S., Debonneville, A., Jiang, C., and Rotin, D. (2007). The PY motif of ENaC, mutated in Liddle syndrome, regulates channel internalization, sorting and mobilization from subapical pool. Traffic 8, 1246-1264.

Maddika, S., Kavela, S., Rani, N., Palicharla, V.R., Pokorny, J.L., Sarkaria, J.N., and Chen, J. (2011). WWP2 is an E3 ubiquitin ligase for PTEN. Nature cell biology 13, 728- 733. Mari, S., Ruetalo, N., Maspero, E., Stoffregen, M.C., Pasqualato, S., Polo, S., and Wiesner, S. (2014). Structural and functional framework for the autoinhibition of Nedd4- family ubiquitin ligases. Structure 22, 1639-1649. Maspero, E., Mari, S., Valentini, E., Musacchio, A., Fish, A., Pasqualato, S., and Polo, S. (2011). Structure of the HECT:ubiquitin complex and its role in ubiquitin chain elongation. EMBO reports 12, 342-349. Maspero, E., Valentini, E., Mari, S., Cecatiello, V., Soffientini, P., Pasqualato, S., and Polo, S. (2013). Structure of a ubiquitin-loaded HECT ligase reveals the molecular basis for catalytic priming. Nature structural & molecular biology 20, 696-701. Mund, T., Lewis, M.J., Maslen, S., and Pelham, H.R. (2014). Peptide and small molecule inhibitors of HECT-type ubiquitin ligases. Proceedings of the National Academy of Sciences of the United States of America 111, 16736-16741. Nalepa, G., Rolfe, M., and Harper, J.W. (2006). Drug discovery in the ubiquitin- proteasome system. Nature reviews Drug discovery 5, 596-613. Ogunjimi, A.A., Wiesner, S., Briant, D.J., Varelas, X., Sicheri, F., Forman-Kay, J., and Wrana, J.L. (2010). The ubiquitin binding region of the Smurf HECT domain facilitates polyubiquitylation and binding of ubiquitylated substrates. The Journal of biological chemistry 285, 6308-6315. Ordureau, A., Munch, C., and Harper, J.W. (2015). Quantifying ubiquitin signaling. Molecular cell 58, 660-676. Ordureau, A., Sarraf, S.A., Duda, D.M., Heo, J.M., Jedrychowski, M.P., Sviderskiy, V.O., Olszewski, J.L., Koerber, J.T., Xie, T., Beausoleil, S.A., et al. (2014). Quantitative proteomics reveal a feedforward mechanism for mitochondrial PARKIN translocation and ubiquitin chain synthesis. Molecular cell 56, 360-375. Persaud, A., Alberts, P., Mari, S., Tong, J., Murchie, R., Maspero, E., Safi, F., Moran, M.F., Polo, S., and Rotin, D. (2014). Tyrosine phosphorylation of NEDD4 activates its ubiquitin ligase activity. Science signaling 7, ra95. Petroski, M.D. (2008). The ubiquitin system, disease, and drug discovery. BMC biochemistry 9 Suppl 1, S7. Phillips, A.H., Zhang, Y., Cunningham, C.N., Zhou, L., Forrest, W.F., Liu, P.S., Steffek, M., Lee, J., Tam, C., Helgason, E., et al. (2013). Conformational dynamics control ubiquitin-deubiquitinase interactions and influence in vivo signaling. Proceedings of the National Academy of Sciences of the United States of America 110, 11379-11384. Phu, L., Izrael-Tomasevic, A., Matsumoto, M.L., Bustos, D., Dynek, J.N., Fedorova, A.V., Bakalarski, C.E., Arnott, D., Deshayes, K., Dixit, V.M., et al. (2011). Improved quantitative mass spectrometry methods for characterizing complex ubiquitin signals. Molecular & cellular proteomics : MCP 10, M110 003756. Riling, C., Kamadurai, H., Kumar, S., O'Leary, C.E., Wu, K.P., Manion, E.E., Ying, M., Schulman, B.A., and Oliver, P.M. (2015). Itch WW domains inhibit its E3 ubiquitin ligase activity by blocking E2-E3 transthiolation. The Journal of biological chemistry. Rohde, J.R., Breitkreutz, A., Chenal, A., Sansonetti, P.J., and Parsot, C. (2007). Type III secretion effectors of the IpaH family are E3 ubiquitin ligases. Cell Host Microbe 1, 77- 83.

Ronchi, V.P., Klein, J.M., and Haas, A.L. (2013). E6AP/UBE3A ubiquitin ligase harbors two E2~ubiquitin binding sites. The Journal of biological chemistry 288, 10349-10360. Ronzaud, C., Loffing-Cueni, D., Hausel, P., Debonneville, A., Malsure, S.R., Fowler- Jaeger, N., Boase, N.A., Perrier, R., Maillard, M., Yang, B., et al. (2013). Renal tubular NEDD4-2 deficiency causes NCC-mediated salt-dependent hypertension. J Clin Invest 123, 657-665. Rossi, M., Rotblat, B., Ansell, K., Amelio, I., Caraglia, M., Misso, G., Bernassola, F., Cavasotto, C.N., Knight, R.A., Ciechanover, A., et al. (2014). High throughput screening for inhibitors of the HECT ubiquitin E3 ligase ITCH identifies antidepressant drugs as regulators of autophagy. Cell death & disease 5, e1203. Rotin, D., and Kumar, S. (2009). Physiological functions of the HECT family of ubiquitin ligases. Nature reviews Molecular cell biology 10, 398-409. Sato, T., and Clevers, H. (2013). Growing self-organizing mini-guts from a single intestinal stem cell: mechanism and applications. Science 340, 1190-1194. Scheffner, M., and Kumar, S. (2014). Mammalian HECT ubiquitin-protein ligases: biological and pathophysiological aspects. Biochimica et biophysica acta 1843, 61-74. Simpson, K.J., Selfors, L.M., Bui, J., Reynolds, A., Leake, D., Khvorova, A., and Brugge, J.S. (2008). Identification of genes that regulate epithelial cell migration using an siRNA screening approach. Nature cell biology 10, 1027-1038. Tonikian, R., Zhang, Y., Boone, C., and Sidhu, S.S. (2007). Identifying specificity profiles for peptide recognition modules from phage-displayed peptide libraries. Nature protocols 2, 1368-1386. Torrino, S., Visvikis, O., Doye, A., Boyer, L., Stefani, C., Munro, P., Bertoglio, J., Gacon, G., Mettouchi, A., and Lemichez, E. (2011). The E3 ubiquitin-ligase HACE1 catalyzes the ubiquitylation of active Rac1. Developmental cell 21, 959-965. Verdecia, M.A., Joazeiro, C.A., Wells, N.J., Ferrer, J.L., Bowman, M.E., Hunter, T., and Noel, J.P. (2003). Conformational flexibility underlies ubiquitin ligation mediated by the WWP1 HECT domain E3 ligase. Molecular cell 11, 249-259. Wang, H.R., Zhang, Y., Ozdamar, B., Ogunjimi, A.A., Alexandrova, E., Thomsen, G.H., and Wrana, J.L. (2003). Regulation of cell polarity and protrusion formation by targeting RhoA for degradation. Science 302, 1775-1779. Wang, M., Guo, L., Wu, Q., Zeng, T., Lin, Q., Qiao, Y., Wang, Q., Liu, M., Zhang, X., Ren, L., et al. (2014). ATR/Chk1/Smurf1 pathway determines cell fate after DNA damage by controlling RhoB abundance. Nature communications 5, 4901. Wiesner, S., Ogunjimi, A.A., Wang, H.R., Rotin, D., Sicheri, F., Wrana, J.L., and Forman-Kay, J.D. (2007). Autoinhibition of the HECT-type ubiquitin ligase Smurf2 through its C2 domain. Cell 130, 651-662. Wilson, F.H., Disse-Nicodeme, S., Choate, K.A., Ishikawa, K., Nelson-Williams, C., Desitter, I., Gunel, M., Milford, D.V., Lipkin, G.W., Achard, J.M., et al. (2001). Human hypertension caused by mutations in WNK kinases. Science 293, 1107-1112. Zhang, J., Yang, P.L., and Gray, N.S. (2009). Targeting cancer with small molecule kinase inhibitors. Nature reviews Cancer 9, 28-39. Zhang, W., and Sidhu, S.S. (2014). Development of inhibitors in the ubiquitination cascade. FEBS letters 588, 356-367.

Zhang, Y., Zhou, L., Rouge, L., Phillips, A.H., Lam, C., Liu, P., Sandoval, W., Helgason, E., Murray, J.M., Wertz, I.E., et al. (2013). Conformational stabilization of ubiquitin yields potent and selective inhibitors of USP7. Nature chemical biology 9, 51-58.

All HECT ligase C2 ARLD RLD ANK PHD DOC WW HECT C A or or or or or or N-lobe C-lobe

WW WW NEDD4-family HECT ligase WW WW C C2 distal HECT ( )0-2 N-lobe C-lobe 2+ binding (catalyze Ub transfer) B Potential UbV effects

Ub binds Inhibitory Inhibitory Allosteric Inert Ub C-lobe C Ub C UbV C C C E2 C C C E2 UbV N-lobe UbV Ub UbV UbV binds UbV binds E2-binding site C G47 K48 A46 E Q49 0.30 0.30 F I44 0.20 0.20 R42 Q62 R72 0.10 KD R74 V70 0.10 G76 K63 Ub GST-HECT domain H68 0.00 0.00 F4 E64 0 30 60 90 120 0 200 400 600 800 Ub/UbV NEDD4L WWP1 G75 L73 L71 K6 concentration (µM) L8 Q2 0.15 0.15 Ub 141.2 ± 15.5 µM 274.0 ± 35.2 µM

T9 T14 0.10 0.10 Response (nm) NL.1 9.7 ± 1.9 nM 9.7 ± 4.2 µM G10 T12 K11 0.05 0.05 UbV NL.1 NL.2 30.7 ± 7.0 nM 2.8 ± 0.8 µM 0.00 0.00 04080 120 160 04080 120 time (second) 841.0 ± 94.6 nM D concentration (nM) NL.3 18.8 ± 4.5 µM (16.6 ± 7.6 µM) (IV) 0.6 0.6 817.2 ± 104.0 nM AMPLIFICATION NL.4 15.7 ± 7.0 µM (12.1 ± 6.9 µM) Bacteria host 0.4 0.4 P1.1 13.2 ± 3.9 µM 322.9 ± 60.3 nM Encoded DNA 0.2 0.2 (II) Ub Binding 0.0 0.0 P1.3 14.4 ± 3.5 µM 134.6 ± 23.3 nM (I) Immobilized 0 100 200 300 0 300 600 900 phage proteins concentration (µM) P2.1 1.4 ± 0.3 µM 244.5 ± 40.7 nM Ub variant Response (nm) 0.20 0.20 Phage pool 0.15 0.15 P2.3 5.1 ± 4.8 µM 232.0 ± 49.0 nM Ub variant Washed away 0.10 0.10 0.05 0.05 BINDING SELECTION Non-binding phage UbV P2.3 (III) 0.00 0.00 0 100 200 300 0 600 1200 1800 time (second) concentration (nM) H G

WWP1 WWP2 NEDD4 NEDD4L ITCH SMURF1 SMURF2 HECW1 HECW2 HUWE1HACE1 HERC1HERC2HERC4HERC6UBE3CEDD1 HECTD1KIAA0317

1 2 3 4 1 2 3 4 2 4 5 1 2 3 4 2 3 4 6 1 2 3 4 5 1 2 3 4 5 1 2 3 4 1 2 3 4 1 2 1 2 3 2 3 2 3 1 2 3 4 1 2 3 3 7 1 2 3 4 1 2 3 4 WWP1 WWP2 NEDD4 NEDD4L ITCH SMURF1 SMURF2 HECW1 HECW2 HUWE1 HACE1 HERC1 HERC2 HERC4 HERC6 UBE3A UBE3C EDD1 HECTD1 KIAA0317 GST NA BSA SA WWP1 WWP1 WWP2 WWP2 NEDD4 NEDD4 NEDD4L NEDD4L ITCH ITCH SMURF1 SMURF1 SMURF2 SMURF2 HECW1 HECW1 HECW2 HECW2 HUWE1 HUWE1 HACE1 HACE1 HERC1 HERC1 HECT domains HERC2 HERC2 HERC4 HERC4 HERC6 HERC6 UBE3A UBE3A UBE3C UBE3C EDD1 EDD1 HECTD1 HECTD1 KIAA0317 KIAA0317 GST GST NA NA BSA BSA SA SA controls Binding (ELISA OD nm) 450 0 20 40 60 80 100 0.0 1.0 2.0

Figure 1. A panel of high affinity ubiquitin variants (UbVs) that bind selectively across the HECT E3 family. (A) Schematic diagrams of HECT E3 ligases, with variable N-terminal domains and a conserved C-terminal HECT domain comprised of N- and C-lobes. The variable region of the largest HECT family (NEDD4-family) contains an N-terminal C2 domain and 2-4 WW domains. Domain functions are listed below. (B) Schematic drawing of HECT sub-domains and known binding interactions with E2~Ub or Ub. Different classes of HECT-UbV binding complexes are anticipated from an unbiased screen. (C) Positions subjected to diversification in the phage-displayed library used to select HECT-binding UbVs. Basic, acidic, polar, hydrophobic and Gly residues are colored blue, red, green, gray and yellow, respectively. (D) Phage display selection of UbVs binding to HECT E3 ligases (adapted from (Zhang and Sidhu, 2014)). (I) Each phage particle in the library pool displays a unique UbV and encapsulates the encoding DNA. (II) Binding phages are captured with an immobilized HECT domain protein. (III) Non-binding phages are washed away. (IV) Bound phages are amplified by infection of Escherichia coli. The enriched phage pool is cycled through additional rounds of selection to further enrich for HECT-binding UbVs, and the sequences of individual UbVs are decoded by DNA sequencing. (E). Representative sensorgrams and curve fits from binding measured by bio-layer interferometry (BLI), with soluble Ub/UbVs and immobilized GST-HECT domain fusions (NEDD4L and WWP1, 52% sequence identity). Error bars show SEM from two independent measurements. (F). Dissociation constants for Ub and UbV binding from titrations in (E). NL refers to UbVs selected for binding to NEDD4L, and P1 and P2 refer to UbVs selected for binding to WWP1 or WWP2, respectively. Weak affinities for second sites are in parentheses. (G) The binding specificities of phage-displayed UbVs (x-axis, detailed sequence information in Table S2) are shown across the HECT family (y-axis), as assessed by phage ELISA. Cognate HECT E3s are noted on top of individual graphs. Sub-saturating concentrations of phage were added to immobilized proteins as indicated (20 HECT domains and four control proteins, GST, BSA, and NA (neutravidin), and SA (streptavidin)). Bound phages were detected by the addition of anti-M13-HRP and colorimetric development of TMB peroxidase substrate. The mean value of absorbance at 450 nm is shaded in a purple gradient (white = 0, purple = 2.2 or greater signal). (H). Sequence identity matrix shows conservation amongst the 20 HECT domains, but not negative control proteins shown in (G) (white = 0 and purple = 100% identity).

31 Table 1. Structure data collection and refinement statistics WWP1HECT –Ubv P2.3 - Protein complexes ITCHHECT -Ubv IT.2 NEDD4HECT-Ubv N4.4 Rsp5HECT-Ubv R5.4 NEDD4LHECT-Ubv NL.1 WWP1HECT –Ubv P2.3 WWP1HECT – Ubv P1.1 UBCH7

Data collection Beam line APS 19-ID APS 19-ID NECAT-24-ID-C SERCAT-22-ID NECAT-24-ID-E NECAT-24-ID-E NECAT-24-ID-C Wavelength (Å) 0.97899 0.97918 0.9792 0.9792 0.9791 0.9792 0.9791 crystals Native Native Native Native SetMet Native Native

Unit cell parameters

Space group P 3 2 1 P 32 P 1 21 1 P 4 21 2 P 21 21 21 P 63 2 2 C 1 2 1 a, b, c (Å) 121.115, 121.115, 85.547 139.867, 139.867, 59.386 72.486, 92.352, 82.161 151.306, 151.306, 85.922 114.005, 118.897, 158.663 119.4, 119.4, 159.9 207.9, 44.91, 60.2 α, β, γ (°) 90, 90,120 90, 90,120 90, 101.6, 90 90, 90, 90 90, 90, 90 90, 90, 120 90, 96.07, 90 Resolution (Å) 49.43-3.03 50.00-3.00 80.48-2.31 45.976-2.431 95.15-2.84 103.45-3.67 103.5 - 2.05 Measured reflections 1,286,517 725,669 151,799 556,930 342,597 72,711 130,097 Unique reflections 14277 (1343) 26023(2663) 45787 (4593) 38009 (3757) 51506 (5066) 7846 (765) 34,692 (3461) Completeness (%) 99.5 (96.97) 99.99 (100.00) 98.17 (98.58) 99.79 (99.89) 99.86 (99.74) 99.64 (99.61) 98.7 (99.3) Rmerge 0.094 (0.908) 0.071 (0.979) 0.134 (0.9418) 0.135 (0.89) 0.1414 (1.359) 0.2676 (1.724) 0.0615 (0.544) Overall I/σI 61.41 (4.4) 34.75 (2.06) 7.72 (1.41) 17.36 (1.56) 15.7 (1.4) 10.2 (1.59) 15.7 (2.5) Multiplicity 18.1 (18.5) 7.6 (7.8) 3.3 (3.4) 12.1 (2.94) 6.7 (6.7) 9.3 (9.4) 3.8 (3.8) Wilson B-factor 96.69 97.47 38.88 51.26 75.54 111.93 37.42

Refinement Resolution (Å) 49.43-3.03 (3.143-3.034) 50.00-3.00 (3.107-3.0) 80.48-2.31 (2.393-2.31) 35.66-2.431(2.4919-2.431) 95.15-2.84 (2.942-2.84) 86.85-3.67 (3.801-3.67) 103.5 - 2.05 (2.12-2.05)

Rwork/Rfree 0.2537/0.2969 0.2272/0.2766 0.1942/0.2499 0.2114/0.2268 0.2184/0.2374 0.2287/0.2738 0.2169/0.2651 Rmsd bond lengths (Å) 0.008 0.007 0.012 0.011 0.011 0.0115 0.009 Rmsd bond angles (°) 0.83 1.116 1.354 1.207 1.612 1.47 1.259 Number of protein atoms 3868 7157 7464 3749 13524 3718 3722 Number of water atoms 3 4 285 131 5 0 70 B factor-average 104.6 100.8 45.5 53 86.7 102.6 51 B factor-Protein 104.6 100.8 45.6 53.2 86.7 102.6 51 B factor-Water 69.1 74.2 42.7 47.7 55.6 N/A 44.7

Ramachandran statistics (Molprobity) Preferred (%) 97.02 96.9 97.87 97.08 94.85 92.13 95.24 Allowed (%) 2.96 3.1 2.13 2.92 4.96 7.87 4.76 Disallowed (%) 0 0 0 0 0.19 0 0 Clashscore 0.14 1.41 4.27 3.77 15.18 17.31 8.25 Statistics for the highest-resolution shell are shown in parentheses. Figure 2

A UbV UbV E2 UBCH7

loop 2

loop 1

Classic HECT binding loops: C-lobe loop 1 loop 2

N-lobe HECTWWP1 HECTITCH HECTWWP1 B I42 W709 WWP1 W690 L70 ITCH WWP1 P97 UBCH7 I44 F70 L44 W709

Y756 Y737 Y756 Y68 Y68

F63 F703 L8 F684 L8 F703

C Inhibitor UbV

E2(Cys)~Ub + HECT E3(Cys) E2(Cys) + HECT E3(Cys)~Ub

D E3 HECT domain WWP1 ITCH NEDD4L UbV

HECT~Ub*

UBCH7~Ub*

Figure 2. UbV inhibitors block the E2-binding site. (A) Crystal structures of UbV P1.1 and IT.2 in complex with the HECT domains of WWP1 or ITCH, shown beside a complex of the WWP1 HECT domain and the E2, UBCH7. Structures are shown aligned by the highlighted E2-binding subdomain. Details of interactions are in Figure S8. (B) UbV hydrophobic patch residues hijack the canonical binding site for F63 and P97 from the E2 UBCH7 (Huang et al., 1999). (C) Schematic view of HECT E3 reaction involving E2, whose binding would be blocked by UbVs. (D). Phosphorimager data from pulse-chase assay showing transfer of fluorescent Ub to indicated E3 HECT domain, showing effects of selected inhibitory UbVs.

Figure 3. UbV activators bind to the N-lobe exosite. (A) Close-up view of crystal structures of indicated HECT-Ub and HECT-UbV complexes, with HECT domains in magenta, Ub in olive and UbVs in yellow. Details of interactions are in Figure S8. (B) Scheme of pulse-chase reactions. A thioester-bonded E2~Ub intermediate was enzymatically generated using E1, E2 UBCH7 and fluorescently-labeled Ub. After quenching formation of the E2~Ub intermediate, various versions of HECT E3s were added either alone, or with the substrate WBP2 or free Ub. Reactions were monitored by following the fluorescent Ub, first in E2~Ub, then in E3~Ub, and where tested ultimately in substrate~Ub or Ub~Ub products. (C) Schematic diagrams of NEDD4L and WWP1 deletion mutants used in assays to define domains (C2, all WW domains, proximal WW domain, and/or catalytic HECT domain) required for UbV modulation of ubiquitination activities. (D) Pulse-chase reactions testing effects of UbVs (Top: UbV NL.1, Bottom: UbV NL.2) on NEDD4L-mediated Ub transfer from E2 to E3. Requirements of various E3 domains for UbV modulations were examined with four deletion constructs for each E3. For NEDD4L, the distal WW domains, present in NEDD4LFL and NEDD4LWW(all)-HECT but not NEDD4LWW(proximal)-HECT, are required for UbV stimulation of catalysis. (E) Pulse-chase reactions testing effects of UbVs on free Ub chain formation by NEDD4L, from phosphorimager data monitoring effects of UbVs on fluorescent Ub transfer from an E2 (UBCH7), to the indicated WT or deletion mutant version of NEDD4L, to free Ub. (F) Pulse-chase reactions testing effects of UbVs on NEDD4L-mediated Ub transfer from E2 to E3 to substrate. These reactions require the WW domains for substrate recruitment. For NEDD4L, the distal WW domains, present in NEDD4LFL and NEDD4LWW(all)-HECT but not NEDD4LWW(proximal)-HECT are required for UbV stimulation of catalysis. (G) Sequence alignment of Ub and UbV NL.1.The white letters on a black background indicate identical sequences and the black letters on a grey background indicate similar sequences. Due to sequence identity with UbV NL.1, K27 and K29 linkage of Ub could not be absolutely quantified. (H-J) UB-AQUA proteomics of total Ub (H) and individual Ub chain linkage types (I) for in vitro NEDD4L reaction mixtures (45 min) and the effect of UbV NL.1. Error bars represent experimental triplicate measurements (± SEM). (J) UB-AQUA proteomics of individual Ub chain linkage types measured from whole cell lysate HEK293 cells expressing UbV NL.1 for the time indicated. Error bars represent biological triplicate measurements (± SEM). *: Amount quantified can be from Ub and/or UbV NL.1.

Figure 4. UbVs binding to the N-lobe exosite differentially modulate related HECT E3 ligases. (A-C) Same reactions as Figure 3D-F, except for WWP1. UbV P2.3 can activate all versions of WWP1 from E2 to E3 then to substrate of Ub~Ub synthesis. (D) Models for different steps in Ub chain formation affected by UbVs binding to various NEDD4-family HECT E3s. For NEDD4L and Rsp5, UbV stimulation requires distal WW domains, potentially by releasing their autoinhibition. For WWP1, UbV stimulation only requires the HECT domain, which may be conformationally stabilized by UbV binding.

34 Figure 5

MDCK+ENaC A B MDCK+ENaC MDCK UbV: - NL.1 NL.3 UbV: - NL.1 NL.3 ChQ(M): 0 50 100 0 50 100 0 50 100 ChQ(M): 0 0 100 0 100 0 100 WB: ENaC WB: 95- 130- HA cleaved Myc 100- ENaC ENaC actin actin 43 - actin 43 - actin C D E Resting Amiloride-sensitive DAPI ENaC DIC Merge amiloride 3.0 NL.3 2.0 100 ) MDCK 2 1.0 1.5 50 Control Amp/cm Normalized Isc

Isc( 0 0 MDCK NL.1 0 Control NL.1 NL.3 Control NL.1 NL.3 +ENaC 0 2 4 6 8 Time (min)

F G 40000 MDCK 80000 * a e r +ENaC a e A r 35000 e +NL.1 A 60000

c ) e a s f c l ) r a e s f u l x r

i 30000 e S u

40000 p x i ( S d i

p ( o d

MDCK i n o a

n 25000

+ENaC 20000 g a r g O +NL.3 r O 0 20000 Control NL.1 NL.3 Organoid Line: Control NL.3 NL.3 Organoid Line Amiloride (10µM): - - + Organoid Line and Treatment

Figure 5. UbVs modulate NEDD4L functions in cells and intestinal organoids (mini-guts). (A-B) Western blot analysis of protein levels of HA-tagged αENaC and Myc-tagged βENaC (in MDCK cells stably expressing α3xHA, βmyc,T7 and γFlag-ENaC) with NEDD4L UbV NL.1 or NL.3 (or no UbV) in cells treated (or not) with the indicated concentrations of the lysosomal inhibitor chloroquine (ChQ). Actin blots are shown as loading control. Reduced levels of cleaved αENaC (the active form of αENaC) (B) and βENaC (C) were observed with the expression of NL.1 but not NL.3. (C) Immunofluorescence analysis of cell surface ENaC in MDCK cells (stably expressing tagged α, β, and γENaC, αβγENaC) co-expressing either UbV NL.1 or NL.3. Non- permeablized cells were stained for αENaC with antibodies directed to its ectodomain. Cells were then permeabilized and stained for DAPI (nucleus). (D) ENaC function (Isc) analyzed in Ussing chambers in the above MDCK cells stably expressing tagged αβγENaC alone or together with NL.1 or NL.3. The traces from one representative experiment (arrow: apical addition of the ENaC inhibitor amiloride, 10 µM) are shown. (E) Summary of 3 separate experiments (mean ± SEM) of resting Isc or amiloride- sensitive Isc as described in (D). (F-G) Quantification of surface area (in pixels) of control intestinal (distal colon) organoids (GFP-transduced) or organoids expression ubiquitin variant (NL.1 or NL.3), 7 days after seeding. Histogram bars represent mean ± SEM. N = 30-40 organoids per condition. Pixel count to surface area ratio is 1 pixel to 0.78 µm². In (F), Statistical analysis demonstrated a significant difference in surface area between the control and NL.1-expressing organoids (t-test, p < 0.05). In (G), NL.3- variant organoids were incubated with or without amiloride (10 µM) for 30 min followed by analysis of surface area by microscopy.

35 Figure 6

1.5 A 1. Lentiviral-based 2. UbV library 3. Migration assay B C Trans-well migration assay (HCT116) UbV library -containing cells 125

100

1 75

25 0.5 Migration Ratio (Mig/Non-Mig+Dox)/(Mig/Non-Mig-Dox) 0 NL.1 S2.5 P2.3 Ub WT HA.3 0 Migrated cells (%) Normalized to No Dox control UbV: P2.3 S2.5 NL.1 No Dox Control 6. High-throughput 5. Genomic DNA 4. Collect migrated and sequencing extraction and Ubv non migrated cells Ubvs (1-83) PCR amplification MG132 Transient expression Myc-NEDD4L + + + + + + D F Vector NL.1 G H Flag-RhoB + + + + - - Wound-healing assay HA-Ub - - + + + + MW (kDa) Myc-NEDD4L + + + V5-NL.1 - + - + - + 17 Flag-Ubv 11 Flag-RhoB - + + Endogeneous protein levels V5-NL.1 + + - No UbV 25 WB: RhoB IP: Myc Rac1 20 WB: Flag IP: HA 25 WB: Myc RhoA 20 WB: Flag 25 Input 20 RhoB WB: V5 NL.1 25 RhoC WB: Actin WB: Myc 20 WB: RhoB Input 25 Time (hr) 1 30 Cdc42 WB: V5 20 WB: HA Wound-healing migration assay 48 Actin E (MDA-MB-231) 35 WB: Actin 50 Total cell lysate No UbV S2.4 120 WWP1 40 S2.5 I and/or NL.1 J WWP2 P2.3 80 NEDD4L 30 HACE1 ? SMURF2 RhoB 20 40 Rac1 Nucleus CNKSR2

10 Migrated cell counts Direction of migration 0 1 2 1 2 0 0 5 10 15 20 25 Control Rac1- Rac1- RhoB- RhoB- Adhesion sites Wound density (%) Wound Time (hr) shRNAs

Figure 6. UbVs reveal new functions of HECT E3s in cell migration. (A) Schematic representation of the HECT UbV lentiviral library screens for the identification of UbVs affecting cell migration (see Experimental Procedures for details). (B) Ranking by migration ratio of 83 UbVs from two independent pooled UbV (Dox-inducible expression) lentivirus screens examining cell migration in HCT116 cells using a trans- well assay. UbVs discussed in the text are circled. (C) Quantitation of migrated HCT116 cells (%) stably expressing control Ub and indicated UbVs using the trans-well assay. The data were presented as the mean ± SEM (N = 3) normalized to non-Dox treatment control. (D-E) Wound healing assay (measured by Incucyte, Essen Bioscience) was performed to examine the effect of indicated UbVs on cell migration efficiency. Representative photos of scratch wound closure with and without expression of NL.1 are shown in (D). (E) Quantitation of relative wound density closure after scratch in MDA-MB-231 cells stably expressing indicated UbVs (no UbV as control). The data are presented as the mean ± SEM (N = 3). (F) Expression of NL.1 destabilizes RhoB. Western blot analysis of whole-cell extracts from HCT116 cells with transient expression of vector or Flag-tagged NL.1. From top to bottom panels, the blot was probed with antibodies detecting the following proteins: Flag, Rac1, RhoA, RhoB, RhoC, Cdc42, and Actin as a loading control. (G-H) NEDD4L pulled down and ubiquitinated RhoB in cells (G), and NL.1 stimulated the activity of NEDD4L (H). HCT116 cells were transfected with constructs encoding HA-Ub, Myc-NEDD4L, Flag-RhoB, and UbV NL.1. Whole cell lysates were subjected to immunoprecipitation (IP) with anti-Myc antibody (G) or anti- Flag antibody (H) and followed by western blotting using the indicated antibodies. Cell lysates were also immunoblotted with the indicated antibodies to monitor expression levels. (I) RhoB is required for cell migration of HCT116 cells. Quantitation of migrated HCT116 cells expressing control shRNA or two different shRNAs targeting Rac1 or RhoB. Scatter blots of mean migrate cell counts from 3 independent experiments were shown. (J) Schematic illustration of the roles of HECT E3 ligases in regulation of cell migration. UbV inhibitors confirmed that SMURF2 promotes and HACE1 inhibits cell migration, presumably through ubiquitination of CNKSR2 or Rac1, respectively. In addition, UbV activators revealed that NEDD4L inhibits cell migration by ubiquitination of RhoB and activation of WWP1 and/or WWP2 also leads to decreased cell migration.

Supplemental Information

System-wide modulation of HECT E3 ligases with selective ubiquitin variant probes

Wei Zhang1, Kuen-Phon Wu1, Maria A. Sartori, Hari B. Kamadurai, Alban Ordureau, Chong Jiang, Peter Y. Mercredi, Ryan Murchie, Jicheng Hu, Avinash Persaud, Manjeet Mukherjee, Nan Li, Anne Doye, John R. Walker, Yi Sheng, Zhenyue Hao, Yanjun Li, Kevin R. Brown, Emmanuel Lemichez, Junjie Chen, Yufeng Tong, J. Wade Harper, Jason Moffat2, Daniela Rotin2, Brenda A. Schulman2* and Sachdev. S. Sidhu2*

1 Co-first author 2 Co-senior author

*To whom correspondence should be addressed. E-mail: [email protected] (B.A.S.) and [email protected] (S.S.S).

37 Supplemental Information Inventory:

Supplemental Experimental Procedures, related to Experimental Procedures Supplemental References Figure S1, related to Figure 1 Figure S2, related to Figure 1 Figure S3, related to Figure 1 Figure S4, related to Figure 2, Figure 3, and Figure 4 Figure S5, related to Figure 2 and Figure 3 Figure S6, related to Figure 2 and Figure 3 Figure S7, related to Figure 2

Supplemental Items: 1. Figure S8, related to Figure 2 and Figure 3 2. Figure S9, related to Figure 3 and Figure 4 3. Figure S10, related to Figure 3 4. Figure S11, related to Figure 3 and Figure 4 5. Figure S12, related to Figure 5 6. Figure S13, related to Figure 5 7. Figure S14, related to Figure 6 8. Table S1, related to Figure 1 9. Table S2, related to Figure 1 10. Table S3, related to Figure 1 11. Table S4, related to Figure 1 12. Table S5, related to Figure 1 13. Table S6, related to Experimental Procedures

38 Supplemental Experimental Procedures Ubiquitin variant (UbV) selection Protein expression and purification All DNA constructs used to produce proteins for UbV selections and subsequent assays were listed in Table S6. The following proteins were subjected to UbV selections: HECT domains of human ITCH, NEDD4, NEDD4L, SMURF1, SMURF2, WWP2, HECW1, HECW2, HERC1, HERC2, HERC4, HERC6, HACE1, HUWE1, UBE3A, UBE3C, EDD1, KIAA0317, HECTD1 (His- and Avi-tagged for in vivo biotinylation (Kay et al., 2009), pET28 vector, domain boundary shown in Table S6), full length human WWP1 and yeast Rsp5 (GST tagged). PCR amplified DNA fragments encoding the indicated UbVs with a N-terminal Flag epitope tag were cloned into Gateway Entry vector pDONR221 (Thermo Scientific) according to the manufacturer’s instructions and then transferred into Gateway Destination expression vector pET53 (His-tagged, Thermo Scientific). The above-mentioned plasmids were used to transform Escherichia coli BL21 (DE3) for protein expression. Protein expression was induced by addition of IPTG (isopropyl β-D- 1-thiogalactopyranoside, Bioshop) at mid-log phase to a final concentration of 1 mM. After incubation overnight at 16 °C with shaking, cell pellets were collected by centrifugation (12,200 x g, 10 min) and lysed, and proteins were purified using Ni-NTA Agarose (Qiagen 30250) at 4 °C following the manufacturer’s instructions. The purity of eluted fractions was determined by polyacrylamide gel electrophoresis. Protein concentrations were determined by measuring the absorption at 280 nm (Nanodrop 1000, Thermo Scientific). Eluted proteins were dialyzed into 50 mM HEPES buffer pH 7.5, 250 mM NaCl, 5% glycerol, 1 mM DTT and stored at 4 ºC or frozen at -80 ºC for further applications. Protein constructs used in biochemical assays, Octet bio-layer interferometry and crystallization are listed in Table S6. All constructs were made using standard molecular cloning methods or QuickChange mutagenesis. All proteins were expressed in BL21 (DE3) Codon Plus (RIL) Escherichia coli and purified using GST-affinity or nickel-affinity chromatography depending on the expression tags. Protein tags including GST, MBP, and SUMO2 were released by TEV or SENP2 protease. After proteolysis treatment, subsequent purifications including dialysis, ionic exchange and size exclusion chromatography were applied to obtain pure fractions of target proteins. Proteins were in final buffer containing 25 mM Tris pH 7.6, 200 mM NaCl and 3 mM DTT. Tag-free ubiquitin were purified by acidic precipitation followed by ionic exchange and size exclusion in 25 mM HEPES pH 7.0, 200 mM NaCl and 3 mM DTT. Pure proteins were concentrated, aliquoted, flash-frozen by liquid nitrogen and stored at -80 ˚C. To crosslink fluorescent probe on His-1CysUb, WBP2 or S-WBP2-1K, proteins were first treated with 10 mM DTT for 30 minutes, then desalted in 25 mM HEPES pH7.0 and150 mM NaCl by Zeba spin columns or PD-10 columns. 10-fold molar excess maleimide-linked fluorescein (AnaSpec) dissolved in DMSO was mixed with His- 1CysUb or WBP2 at 4 ˚C for 1 hour. Unused fluorescein cross-linker was quenched by 50 mM DTT. Reductive lysine methylation on ubiquitin was carried out by mixing proteins with DMAB (dimethylamine borane complex) and formaldehyde at 4 ˚C overnight. Excess DMAB and formaldehyde were quenched by 50 mM Tris pH 8.0. Both

39 fluorescein-labeled proteins and methylated proteins were purified by thorough desalting procedures and size exclusion to remove unused chemicals and precipitated proteins. ELISA assays to evaluate binding and specificity Proteins in study were immobilized on 384-well MaxiSorp plates (Thermo Scientific 12665347) by adding 30 µL of 1 µM proteins for overnight incubation at 4 ºC. Phage and protein ELISA against immobilized proteins was performed as described (Ernst et al., 2013). Binding of phage was detected using anti-M13-HRP antibody (GE Healthcare 27942101) and binding of Flag-tagged UbVs was detected using anti-Flag-HRP antibody (Sigma-Aldrich A8592). To measure the half maximal binding concentration (EC50) of UbVs binding to HECT E3 ligases, the concentration of UbVs or wild type Ub was varied from 0 to 4 µM (24 points, 1:2 dilution), while the concentration of target proteins immobilized on the plate remained at 1 µM. EC50 values were calculated using the GraphPad Prism software with the built-in equation formula (non-linear regression curve). Protein crystallization and data collection NEDD4LHECT-UbV NL.1 NEDD4LHECT-NL.1 complex was prepared by 2-step GST and Ni-NTA affinity co-pulled down followed by TEV proteolysis, dialysis, ionic exchange and size exclusion. Proteins were concentrated to 22-26 mg/ml in 25 mM HEPES pH 7.0, 150 mM NaCl and 5 mM DTT. Crystals grew at 4 ˚C in 1:1 volumetric ratio of protein and reservoir buffer (0.1 M sodium cacodylate pH 6.0, 0.18 M NaCl, 5-6% polyethylene glycol (PEG) 8000, 0.7% 1- butanol) by the hanging-drop vapor diffusion method and were improved by streak seeding. Crystals were cryoprotected in reservoir solution supplemented with 35% glycerol. WWP1HECT-UbV P2.3-UBCH7 GST-TEV-WWP1HECT ∆5 (C-terminal 5 residues removed), GST-TEV-P2.3 UbV and SUMO-GG-UBCH7-His6 were purified separately by affinity (GST for WWP1 and P2.3 or Ni-NTA for UBCH7), protease digestion (TEV for WWP1 and P2.3 or SENP2 protease for UBCH7), ionic exchange and size exclusion. WWP1HECT-P2.3-UBCH7 complex was created by directly mixing WWP1HECT ∆5, P2.3 and UBCH7 at 1:1.5:1.5 molar ratio, respectively and was concentrated to 8-10 mg/ml for crystallization. Crystals grew by hanging-drop vapor diffusion method at 23 ˚C and quality was improved by streak-seeding in 0.1 M sodium citrate pH 5.2, 10% isopropanol, 8% PEG 3350. Cryoprotectant supplemented with 8% xylitol, 8% glycerol and 8% ethylene glycol in reservoir solution was used. WWP1HECT-UbV P1.1 GST-TEV-P1.1 UbV was purified by GST-affinity, TEV protease digestion and size exclusion. 10 mg/ml complex of WWP1HECT-P1.1 was made by mixing 1:2 molar ratio of WWP1HECT ∆5 and P1.1, respectively. Crystals of WWP1HECT-P1.1 were grew at both 4 ˚C and 23 ˚C by hanging-drop vapor diffusion method and quality was improved by streak-seeding in 0.17 M ammonium sulfate, 25% glycerol and 25% PEG 3350 at 23 ˚C. Reservoir solution was used as cryoprotectant for crystals.

40 Rsp5HECT-UbV R5.4 Expressed GST-TEV-Rsp5HECT and His-R5.4 UbV are co-pulled down by GST and Ni- NTA affinity sequentially. GST tag was removed by TEV protease digestion. The complex was purified by sized exclusion (buffer: 25 mM HEPES, 150 mM NaCl and 2 mM DTT) and concentrated to 12.5 mg/ml. Crystal of Rsp5HECT-R5.4 complex grew at 23 ˚C in 1:1 volumetric ratio of protein and reservoir buffer (0.1 M Bis-Tris, pH 5.5, 0.2- 0.25 M ammonium acetate, 14% PEG 3350) by the hanging-drop vapor diffusion method. Crystals were cryoprotected in reservoir solution supplemented with 8% xylitol, 8% glycerol and 8% ethylene glycol. ITCHHECT-UbV IT.2 His-TEV-ITCHHECT and His-IT.2 were expressed in BL21 (DE3) strain and separately pulled down from cobalt-affinity column. TEV-cleaved ITCHHECT and His-IT.2 were further purified by ionic Q column. 1:2 molar ratio of ITCHHECT and IT.2 were mixed to reach 17 mg/ml for crystallization screening. Crystals were grown in 1.6 M ammonium sulfate, 0.2 M sodium acetate, 0.1 M HEPES pH 7.5, 5% ethylene glycol in hanging drop setup at 20 ˚C. Solution containing well solution and 20% glycerol was used as cryoprotectant for crystals. NEDD4HECT-UbV N4.4 NEDD4HECT and His-N4.4 were expressed and purified with the purification protocols for ITCHHECT-IT.2 complex. NEDD4HECT-N4.4 complex was prepared by mixing 2-fold His- N4.4 to NEDD4HECT. The final concentration is 15 mg/ml. The protein sample was mixed with Trypsin at a 1:1000 (W/W) Trypsin:protein ratio before setting up crystallization. Crystals were grown in 20% PEG 8000, 10% glycerol, 0.1 M HEPES pH 7.0 in hanging drop setup at 20 ˚C. 20% glycerol with reservoir solution is used as cryoprotectant for crystals. Diffraction data were processed with HKL2000 (Otwinowski and Minor, 1997) for NEDD4LHECT -NL.1, HKL3000 (Otwinowski and Minor, 1997) for ITCHHECT-IT.2, and NEDD4HECT-N4.4 and RAPD (https://rapd.nec.aps.anl.gov/rapd) for Rsp5HECT-R5.4, WWP1HECT-P2.3-UBCH7 and WWP1HECT-P1.1. All structures except of ITCHHECT-IT.2 were determined by molecular replacement using Phaser (McCoy et al., 2007) with NEDD4L (PDB: 2ONI), WWP1 (PDB: 1ND7) , NEDD4 (PDB: 2XBB) or UBCH7 (PDB: 4Q5E) as search models. For ITCHHECT-IT.2, phasing was solved by molecular replacement using the CCP4 suite programs BALBES and MOLREP with previous ITCHHECT structure (PDB: 3TUG) as the search model. In the crystal structure, two UbV IT.2 were crystallized with one ITCHHECT. The UbV IT.2 bound to N-lobe exosite is proposed formed by crystal packing. Model constructions and rebuildings were performed in Coot (Emsley et al., 2010) and refined by Phenix (Adams et al., 2010) or REFMAC5 (Murshudov et al., 1997) in CCP4 suite (Winn et al., 2011). MolProbity (Chen et al., 2010) was used to evaluate qualities of all crystal structures. Diffraction data and refinement statistics are provided in Table 1. Molecular interactions in the HECT-UbV structures were analyzed by NACCESS (Hubbard, 1993), PDB ePISA (Krissinel and Henrick, 2007) and MacPyMol (Schrödinger). Biochemical assays

41 Assays detected by fluorescence signals To monitor Ub* transferred from E2 to E3 (E2-to-E3), di-ubiquitin chain synthesis (Ub~Ub*) or substrate (WBP2, Sna3 and Sna4) ubiquitination, pulse-chase assay was applied with 2 steps. Firstly, 20 µM E2 (UBCH5B or UBCH7) was mixed with 500 nM E1 in reaction solution (25 mM HEPES pH 7.5, 200 mM NaCl, 10 mM MgCl2, 2 mM ATP and 0.04 mg/ml bovine serum albumin) at room temperature for 30 minutes to generate charged E2 (E2~Ub*). Then E1 activity was quenched by 25 mM HEPES pH 7.0, 100 mM NaCl and 50 mM EDTA. Second, E2-to-E3, Ub~Ub* or substrate~Ub reactions ran on ice were initiated by loading E2~Ub* to solution containing varied E3, E3 and free ubiquitin or substrate, respectively. 100 mM DTT in SDS sample loading buffer was used to check the formation of thioester bonded E3~Ub* intermediate in pulse-chase reactions. Details of each biochemical assay shown in this study are described here. For E2-to-E3 pulse chase assays with inhibitor UbVs in figure 2D, 1 µM UBCH7~Ub*, 3 µM E3 and/or 50 µM UbVs were mixed on ice for 1 minutes to see Ub transferred from E2 to E3. To monitor the E3 concentration-dependent E2-to-E3 Ub transfer in figure S10B and S10C, 1.6 µM UBCH5B~Ub* and 0.5~30 µM E3 were mixed on ice with or without UbV to monitor Ub transfer efficiency. To test the Ub transfer efficiency by varied truncated E3 in figure S11B-D, 2 µM E3 and 2 µM UBCH7~Ub* were mixed with or without excess UbVs on ice. 6 Rsp5 UbVs (2.7 µM) were tested for E2-to-E3 assays with 2.7 µM Rsp5FL and 0.4 µM UBCH5B~Ub*. Ub~Ub* synthesis assays in figure 3C- E were done by 1.2 µM of UBCH7~Ub*, 2 µM of E3 (saturated with and without UbV NLl1, NL.2 or P2.3) and 100 µM of free Ub on ice. WBP2 ubiquitination (WBP2~Ub) shown in figure S11E-G were performed on ice by mixing 1.2 µM UBCH7~Ub*, 2 µM E3 (with and without UbV) and 2.9 µM WBP2. Rapid-quench flow kinetic studies were carried out at 25 ˚C using the KinTek RQF-3 instrument as described previously (Kamadurai et al., 2013). 2 µM of UBCH5B~Ub was mixed with solution composed of 4 µM E3 (Rsp5FL or Rsp5WW(proximal)-HECT), 2 µM UbV R5.4 and 30 µM Biotin-Sna3. The competition assays were carried out at room temperature by mixing two subset mixtures. The first subset has fluorescently labeled WBP2* or S-WBP2-1K*, E3 and free ubiquitin (or methylated ubiquitin) while the second subset contains E1 and charged UBCH7~Ub mixed with buffer or 30-fold WBP2 (30-fold to WBP2* or S-WBP2-1K*) for the multiple turnover and competition reactions, respectively. Both subsets were prepared in 25 mM HEPES pH 7.5, 200 mM NaCl, 2 mM ATP, 10 mM MgCl2 and 0.04 mg/ml bovine serum albumin. The reactions were initiated by mixing the two subsets and quenched by SDS sample loading buffer at indicated reaction time points. To observe the chain elongation on S-WBP2-1K*, a prime reaction was performed to generate 30~40% portion of monoubiquinted or diubiquitinated S-WBP2-1K*. The reaction was then mixed with 30-fold WBP2 or buffer for single or multiple encounter reactions. The prime reaction ran in the same described buffer with 400 nM E3, 3 µM UBCH7~Ub, 80 nM E1 and 400 nM S-WBP2-1K*. Ubiquitination assays with immunoblotting Biochemical reactions to study HECT E3 ligases autoubiquitination activity were performed in a volume of 25 µl in a buffer of 50 mM Tris pH8.0, containing E1/UBE1 (50

42 nM, Boston Biochem E304), E2 as indicated (1 µM, kindly provided by Pankaj Garg), ubiquitin (20 µM, Boston Biochem U100H), HECT E3s as indicated (1 µM), and UbVs (10 µM). After incubation at room temperature for 60 min, reactions were stopped by the addition of 10 mM EDTA and SDS-PAGE sample buffer and resolved using 4-20% gradient gel (Bio-Rad 4561096). Mono- and poly-ubiquitinated HECT E3s were evaluated by western blotting. To assess the E3 activity of HACE1 on Rac1 GTPase in vivo, CHO cells (5 x 106) were transfected with 5 µg of HA-Rac1Q61L, 5 µg His6- ubiquitin, 2 µg myc-HACE1 and 1 or 5µg of Flag-UbV expression plasmids described in this study. Measurement of Rac1 ubiquitination was performed as described previously (Doye et al., 2012). Briefly, 24h after transfection CHO cells were lysed in 1 ml of BU buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 10 mM imidazole, 0.1% (v/v) Triton X- 100, 8 M urea). Samples were homogenized, centrifuged 10 min at 10,000 g at room temperature. An aliquot of 50 µl was collected (Total protein input). In parallel, 0.1 ml of cobalt beads (Talon, Clontech) 50% slurry in BU buffer were added to each 0.9 ml assay supernatants and incubated at room temperature 1 hour on a rotating shaker. Beads were washed three times in BU and resuspended in one volume Laemmli blue buffer 2x followed by western blotting. The RhoB ubiquitination assay was performed as described (Wang et al., 2014). For in vivo assay, the whole cell lysates were subjected to anti-HA immunoprecipitation and followed by anti-Flag western blotting to detect ubiquitinated Flag-RhoB. For in vitro assay, GST-RhoB were purified using glutathione sepharose beads and added into a volume of 25 µl in a buffer of 50 mM Tris pH8.0, containing E1/UBE1 (50 nM), E2/UBE2L3 (1 µM), ubiquitin (20 µM), HECT E3s as indicated (1 µM), and with and without NEDD4L UbV NL.1 (10 µM). MG-132 was used at 10 µM (Boston Biochem, I-130). DNA constructs for mammalian cell experiments All DNA constructs used in the mammalian cell culture experiments were listed in Table S6. UbV was transferred to mammalian expression vectors either by Gateway methods or PCR sub-cloning. The WWP2 construct was obtained from the Human ORFeome collection (version 5.1), and ubiquitin construct was a gift from R. Baer (Columbia University, New York. USA). The WWP2 and UbV constructs were sub-cloned into pDONR vector and then into Myc-tagged or Flag-tagged destination vectors using Gateway Technology (Invitrogen). The constructs pLVE-NL.1 and pLVE-NL.3 were cloned as follows: BamH1 site with N-termainal V5 tag containing the start code and SpeI site at the C-terminus with stop code were added to the UbV-WZ-12 (NL.1) and UbV-WZ-14 (NL.3) by PCR. After sequence verification, they were cloned into the lentiviral expression vector, pLVE (homemade by Rotin lab with IRES-EGFP, dual Zeocin resistance for bacterial and cell cultures). The expressions of the constructs were verified with western blot by transfecting the plasmids into 293T cells and blotted by V5 antibody. pXJ-HA-Rac1Q61L, pKH3-HACE1 and pRBG4-His6-ubiquitin (pCW7) were reported before (Torrino et al., 2011). Hace1 cDNA from pKH3-HACE1 was subcloned BamHI-EcoRI in pRK5-myc-HACE1. The Lentiviral Destination (pLD) Vector pLD-puro-TnZsGreen was constructed by replacing the versatile affinity (VA) tag from the pLD-puro-TnVA (Mak et al., 2010) with the green fluorescent protein ZsGreen using NheI/AgeI restriction sites. For shRNA-mediated gene silencing, sequences of the control and shRNAs targeting Rac1 and RhoB are available upon request. The vector pDEST-5'3x-Flag-pcDNA5-FRT/TO was a gift from Dr. Anne-Claude Gingras and pLenti

43 CMV rtTA3 Blast (w756-1) was a gift from Dr. Eric Campeau (Addgene plasmid #26429). The Flag-RhoB and GST-RhoB expression vector was kindly provided Dr. Hong-Rui Wang. Cell culture and transfection Cells were cultured in DMEM (HEK293T and MDA-MB-231 cells) or McCoy’s 5A (HCT116 cells) medium, supplemented with 10% fetal bovine serum (FBS), 100 U/ml of penicillin and 100 µg/ml of streptomycin. Chinese hamster ovary (CHO) epithelial cells were obtained from ATCC (CCL-61). Cells are grown in "DSG” medium, composed of DMEM/HAM-F12 (Life Technologies) supplemented with 10% (v/v) fetal bovine serum (EU Approved Origin, Invitrogen) and 50 µg/mL Gentamicin. The ENaC line, 409, established from MDCK (Madin Darby Canine Kidney) Cell, Type I, stably expressing 3 ENaC subunits, α, β and γ, was cultured in DMEM plus 10% FBS, 1x antibiotics and antimycotics, 600 µg/ml G418, 50 µg/ml hygromycin B and 2 µg/ml puromycin at various confluences for western blot, ELISA and Ussing chamber assays. All cell lines were maintained at 37°C incubator with 5% CO2. Lipofectamine 2000 (Life technologies) was used for transient transfection according to the manufacturer’s instructions. For tet/dox inducible UbV expression cell lines (e.g. NL.1 and HU.1), Flag-UbVs were inserted into Flp-In T-REx HCT116 cells using the Flp-in T-REx system according to the manufacturer’s instructions (Life Technologies). Cells were selected with hygromycin (20 µg/ml) for 2 weeks. Lentivirus transduction V5 N-terminally tagged UbVs (NL.1 and NL.3) were cloned in the lentiviral vector pLVE/Zeo and packaged into viruses. The viruses were transduced into MDCK cell line stably expressing tagged αβγENaC (α3xHA; βmyc,T7; γFlag-ENaC) (Lu et al., 2007) and selected with 100 µg/ml Zeocin (Life Technologies) to obtain individual clones. Survival clones were then expanded and tested for expression of V5-tagged UbVs. Clones with good expression of either NL.1 (clone 3) or NL.3 (clone 1) were used in subsequent assays. For UbV library-expressing cells, lentiviral ZsGreen-UbV clones were pooled at equimolar amounts and used for lentiviral packaging in HEK293T cells. HCT116 cells were transduced with the lentiviral pool at a low multiplicity of infection (M.O.I) <0.3. Transduced cells were selected with puromycin (1 µg/ml) for 7 days. For single UbV- expressing cell lines, lentiviral ZsGreen-UbV clones were individually used to infect HCT116 and MDA-MB-231 cells followed by puromycin selection (1 µg/ml) for 7 days. Antibodies for western blotting and immunoprecipitation (IP) Western blotting and IP assays were performed according to standard protocols, as previously described (Ernst et al., 2013). Anti-Ub monoclonal antibody (clone FK2, Millipore 04-263, 1:3000) was used for auto-ubiquitination assays. For NEDD4L cellular assays, the following antibodies were used: anti-α ENaC (1:500) (Santa Cruz, sc- 21012), anti-HA (Clone 16B12, Biolegend, #901515, 1:10000); anti-Flag (Clone OTI4C5, OriGene, TA50011-1, 1:10000); anti-Myc (Clone 4A6, EMD Millipore, 05-724, 1: 2000); anti-V5 (AbD Serotec, MCA1360, 1:1000); and anti-β-actin (Sigma, A2228, 1:10,000). For WWP2 cellular assays, the following antibodies were used: anti-α-tubulin (Sigma-Aldrich, T6199, 1:5000), anti-HA (Sigma-Aldrich, H9658, 1:5000), and anti-Flag (Sigma-Aldrich, F1804, 1:10000); anti-myc (Santa Cruz, sc-40, 1:5000); anti-PTEN

44 (Santa Cruz, sc-7974, 1:1000). For HACE1 cellular assays, the following antibodies were used: anti-HA (Covance, clone 16B12, 901501, 1:5000); anti-Myc (Santa Cruz, sc- 40, 1:5000); and anti-Flag (Sigma-Aldrich, F1804, 1:5000). For HUWE1 cellular assays, the following antibodies were used: anti-HUWE1 (Bethyl, A300-486A, 1:2000); anti- cMyc (Cell Signaling, 5605, 1:1000); anti-Flag (Sigma-Aldrich, F1804, 1:10000); anti- actin (Sigma, A2228, 1:10,000). For cell migration assays, the following antibodies were used: Rho-GTPase Ab Sampler Kit (Cell Signaling, 9968S); anti-actin (Bethyl, A300- 485A, 1:5000); anti RhoB (Santa Cruz, sc-180, 1:1000); anti-V5 (Invitrogen, 1:5000); anti-myc (Santa Cruz, sc-40, 1:5000); anti-HA (Santa Cruz, sc-7392, 1:5000). Poly-Ub capture from cell extracts HEK293 Flp-In T-REx (HFT) cells were grown in DMEM with 10% fetal bovine serum, 15 µg/ml Blasticidin and 100 µg/ml Zeocin. To generate HFT cells conditionally expressing UbV NL.1, the gene was cloned into pcDNA5-FRT/TO-FLAG-FRT- Hygromycin based vector and the plasmid transfected into HFT cells followed by selection with Hygromycin (100 µg/ml). To induce low UbV NL.1 expression, cells were treated with 0.5 µg/ml doxycycline (DOX) for the time indicated. At the indicated times, cells were washed twice with ice cold PBS and lysed in lysis buffer (50 mM Tris/HCl pH 7.5, 1 mM EDTA, 1 mM EGTA, 50 mM NaF, 5 mM sodium pyrophosphate, 10 mM sodium 2-glycerol 1-phosphate, 1mM sodium orthovanadate, 1% (v/v) NP-40, 1 µg/ml aprotinin and leupeptin, 1 mM benzamidine, 1mM AEBSF, 10 µM PYR-619 and 100 mM chloroacatemide), to produce whole-cell extracts. Whole cell extract derived ubiquitylated proteins were purified using Halo-4×UBAUBQLN1 as described (Ordureau et al., 2014). Briefly, whole-cell extracts (2 mg) that were lysed in lysis buffer containing 100 mM chloroacetamide were incubated at 4 °C for 6h with 40 µL of Halo-4×UBAUBQLN1 beads (pack volume). Following four washes with lysis buffer containing 0.5 M NaCl and four washes in 10 mM Tris (pH 8.0), proteins were released from Halo-4× UBAUBQLN1 beads using 6 M guanidine HCL. Samples were subjected to reduction (10 mM TCEP) and alkylation (20 mM chloroacetamide) followed by TCA precipitation. Samples were digested overnight at 37 °C with Lys-C and trypsin [in 100 mM tetraethylammonium bromide, 0.1% Rapigest (Waters Corporation), 10% (vol/vol) acetonitrile (ACN)]. Digests were acidified with an equal volume of 5% (vol/vol) formic acid (FA) to a pH of ~2 for 30 min, dried down, resuspended in 5% (vol/vol) FA, and subjected to AQUA/PRM analysis as described below. UB-AQUA/PRM Proteomics UB-AQUA/PRM was performed largely as described previously but with several modifications (Ordureau et al., 2015; Phu et al., 2011). A collection of heavy-labeled reference peptides each containing a single 13C/15N- labeled amino acid was produced at Cell Signaling Technologies and quantified by amino acid analysis. The 16 UB-AQUA reference peptides used for quantitation were previously listed in (Ordureau et al., 2014). UB-AQUA peptides from working stocks (in 5% FA) were diluted into the digested sample (in 5% FA) to be analyzed to an optimal final concentration predetermined for individual peptides. Samples mixed to AQUA peptides were oxidized with 0.1% hydrogen peroxide for 30 min, subjected to C18 StageTip desalting, and resuspended in 5% FA. Experiments were performed with three independent experimental samples and analyzed sequentially by mass spectrometry. Our MS data

45 were collected using a Q Exactive mass spectrometer (Thermo Fisher Scientific) as described in (Ordureau et al., 2015) and peptides were separated using a 60 min gradient of 3%–25% acetonitrile in 0.125% FA with a flow rate of ~300 nl.min-1. Raw files were searched and precursor and fragment ions quantified using Skyline version 3.1 (MacLean et al., 2010). Data generated from Skyline was exported into a Microsoft Excel spread sheet and GraphPad Prism for further analysis as previously described (Ordureau et al., 2014). Total Ub amount was determined as the average of the total Ub calculated for each individual locus (Phu et al., 2011). Samples were normalized to total amount of Ub (1,000 fmol). ENaC stability assays Stability of surface ENaC was determined by quantifying αENaC as follows. Briefly, 20 µg cell lysate was transferred to a 96-well ELISA plate (previously coated with anti-HA antibody (1:1000) and blocked with 0.5% BSA), incubated (4oC, 2 hr), plates washed (x3) with PBST (Phosphate Buffer Saline plus Tween 20) Strepavidin-HRP (1:1000) added (30 min, 4°C) and washed (x5) with PBST. TMB substrate (eBioscience) was used for color development. Plates were read at 450nm. All experiments were performed in duplicate and repeated 4 times. Data points were normalized to the αβγENaC-MDCK control (not expressing Ubvs and not treated with CHX), which was set to 100%. To assess ENaC protein stability assays, ENaC- plus Ubvs - expressing MDCK cell were seeded on 6 well plates in duplicates. 100 µM of chloroquine was added to one of duplicate wells overnight. Cells were lysed, quantified by the Bradford assay and analyzed by western blotting. Ussing chamber analysis The above ENaC- plus UbVs - expressing MDCK cell lines were grown on Millicell Cell Culture Inserts (Millpore) with 10 µM amiloride (added apically) for 6 days and induced with 1 µM dexamethasone and 2 mM sodium butyrate overnight to induced EnaC expression. After amiloride wash out, the closed circuit currents (Isc) were recorded in Ussing chambers (Physiological Instruments) and apical amiloride added at the end of the recording. The assays were repeated 3 times. Immunofluorescent (IF) confocal microscopy MDCK cells stably expressing αβγENaC and the NEDD4L UbVs were cultured on coverslips in 6-well plates. Wells were washed twice with cold 1 ml PBS and incubated for 5 min with Alexa-Fluor-647-conjugated ConcanavalinA (1:1000) on ice to visualize the plasma membrane. The cells were fixed with cold 95% methanol for 20 min on ice before blocking with 1:100 NGS in 5% Skim Milk (1 hr). Slides were stained overnight at 4°C with rabbit polyclonal anti-αENaC antibody (1:500, Santa Cruz, sc-21012) that recognizes the extracellular domain. After three PBS washes, cells were permeabilized with 0.1% Triton X100 for 10 mins and incubated with goat anti-rabbit Alexa 555 Fluor- conjugated secondary antibody and briefly stained with DAPI. Cover slips were mounted with Dako Cytomation. Images were acquired using a Quorum WAveFX-X1 spinning disc confocal system at 60x magnification with an Olympus S-Apo 60x/1.35 oil objective (Quorum Technologies Inc., Guelph, Canada).

46 Mouse colonic organoids from a C57BL/6 background were generated as described (Sato and Clevers, 2013). For viral infection, these organoids were isolated from the Matrigel matrix through pipetting, dissociated through incubation with Accutase, and then transduced with lentiviral particles containing either control or ubiquitin variant (NL.1 or NL.3) constructs for 8 h at 37°C. Transduced fragments were re-embedded in fresh Matrigel and allowed to recover with complete media. Positive transduction was confirmed by expression of a bi-cistronic GFP reporter. Supplementation of the growth media with zeocin (200µg/mL) provided selection. Images were generated on a Leica DMI6000B epifluorescent microscope. Surface area measurements were calculated in ImageJ. For the amiloride rescue experiments, NL.3-variant organoids were incubated with or without amiloride (10 µM) for 30 min followed by analysis of surface area by microscopy. Wild-type GFP-transduced organoids were included as controls. Histogram bars represent mean ± SEM. N = 30-40 organoids per condition. RT-PCR mRNA levels of the α, β, and γ subunits of ENaC are similar in both distal colonic organoids and tissue. mRNA was isolated from both distal colonic and ileal intestinal organoids and from distal colonic epithelial cell scrapings using TRIZol elution and spin- column purification. mRNA expression was evaluated by real-time PCR and normalized to GAPDH. Relative levels were calculated using ENaC subunit expression in distal colonic epithelial tissue as the baseline. Histogram bars represent mean ± SEM. RT-PCR Primers: α-ENaC FWD - CTAATGATGCTGGACCACACC REV - AAAGCGTCTGCTCCGTGATGC β-ENaC FWD - GCCAGTGAAGAAGTACCTGC REV - CCTGGGTGGCACTGGTGAA γ-ENaC FWD - AAGAATCTGCCGGTTCGAGGC REV – TACCACTCCTGGATGGCATTG GAPDH FWD - CGTCTTCACCACCATGGAGA REV - CGGCCATCACGCCACAGTTT

Wound healing assay UbV-expressing cell lines were seeded at 1x104 cells/well in a 96-well Essen ImageLock plate (Essen Bioscience). After 16 hours cells were treated with doxycycline (500ng/mL) or vehicle and allowed to grow to confluence. A 96-pin WoundMaker (Essen Bioscience) was used to simultaneously create precise and reproducible wounds in all wells of the 96-well plate by gently removing the cells from the confluent monolayer. After washing, the plate was placed inside the IncuCyte (Essen Bioscience) incubator. The IncuCyte software was set to scan the plate every hour for 36 hours using the “Scratch Wound” option as the “Experiment Type”. The data were analyzed by the “Relative Wound Density” program.

47 Illumina sequencing and data analysis Genomic DNA from migrated and non-migrated cells was precipitated using ethanol and sodium chloride, and resuspended in Buffer EB (10 mM Tris-HCl, pH 7.5). UbV sequences were amplified via PCR using primers harboring Illumina TruSeq adapters with i5 and i7 barcodes (primer sequences available upon request). PCR products were gel purified according to the manufacturer’s instructions (Invitrogen). Purified PCR products were combined in equimolar amounts, and sequenced on an Illumina MiSeq sequencer. To analyze the sequencing data, paired-end reads (2x262bp) were processed using a bespoke Python pipeline as follows. First, reads were demultiplexed, allowing a single mismatch in each of the 8-base forward and reverse barcodes. Next, the UbV-encoding sequence was extracted from the reads using the barcode, Gateway AttB1, and Flag sequences as landmarks to guard against frameshift mutations in the reads. Forward and reverse UbV sequences were aligned using the BioPython pairwise2.align.localms algorithm (options: match = 1, mismatch = -10, gap_open_penalty = -20, gap_extend_penalty = -20, one_alignment_only), and sequences with an alignment score of at least 30 were retained. Unaligned reads or reads with gapped alignments were retained in a separate file for later inspection. Stand-alone BLAST (v. 2.2.18) was then used to match each spliced sequence to a FASTA file of UbV sequences (BLAST options: -p blastn –e 1e-100 –a 6 –m 7). The resulting XML file was parsed with a BioPython parser, and UbV sequences were counted and assembled into a matrix of m UbV sequences x n conditions.

48 Supplemental References

Adams, P.D., Afonine, P.V., Bunkoczi, G., Chen, V.B., Davis, I.W., Echols, N., Headd, J.J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010). PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66, 213-221.

Chen, V.B., Arendall, W.B., 3rd, Headd, J.J., Keedy, D.A., Immormino, R.M., Kapral, G.J., Murray, L.W., Richardson, J.S., and Richardson, D.C. (2010). MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr D Biol Crystallogr 66, 12-21.

Doye, A., Mettouchi, A., and Lemichez, E. (2012). Assessing ubiquitylation of Rho GTPases in mammalian cells. Methods Mol Biol 827, 77-86.

Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66, 486-501.

Ernst, A., Avvakumov, G., Tong, J., Fan, Y., Zhao, Y., Alberts, P., Persaud, A., Walker, J.R., Neculai, A.M., Neculai, D., et al. (2013). A strategy for modulation of enzymes in the ubiquitin system. Science 339, 590-595.

Hubbard, S.J.T., J.M. (1993). 'NACCESS', Computer Program, Department of Biochemistry and Molecular Biology, University College London.

Kamadurai, H.B., Qiu, Y., Deng, A., Harrison, J.S., Macdonald, C., Actis, M., Rodrigues, P., Miller, D.J., Souphron, J., Lewis, S.M., et al. (2013). Mechanism of ubiquitin ligation and lysine prioritization by a HECT E3. eLife 2, e00828.

Kamadurai, H.B., Souphron, J., Scott, D.C., Duda, D.M., Miller, D.J., Stringer, D., Piper, R.C., and Schulman, B.A. (2009). Insights into ubiquitin transfer cascades from a structure of a UbcH5B approximately ubiquitin-HECT(NEDD4L) complex. Molecular cell 36, 1095-1102.

Kay, B.K., Thai, S., and Volgina, V.V. (2009). High-throughput biotinylation of proteins. Methods Mol Biol 498, 185-196.

Kim, H.C., Steffen, A.M., Oldham, M.L., Chen, J., and Huibregtse, J.M. (2011). Structure and function of a HECT domain ubiquitin-binding site. EMBO reports 12, 334- 341.

Krissinel, E., and Henrick, K. (2007). Inference of macromolecular assemblies from crystalline state. Journal of molecular biology 372, 774-797.

Lu, C., Pribanic, S., Debonneville, A., Jiang, C., and Rotin, D. (2007). The PY motif of ENaC, mutated in Liddle syndrome, regulates channel internalization, sorting and mobilization from subapical pool. Traffic 8, 1246-1264.

49 MacLean, B., Tomazela, D.M., Shulman, N., Chambers, M., Finney, G.L., Frewen, B., Kern, R., Tabb, D.L., Liebler, D.C., and MacCoss, M.J. (2010). Skyline: an open source document editor for creating and analyzing targeted proteomics experiments. Bioinformatics 26, 966-968.

Mak, A.B., Ni, Z., Hewel, J.A., Chen, G.I., Zhong, G., Karamboulas, K., Blakely, K., Smiley, S., Marcon, E., Roudeva, D., et al. (2010). A lentiviral functional proteomics approach identifies chromatin remodeling complexes important for the induction of pluripotency. Molecular & cellular proteomics : MCP 9, 811-823.

Maspero, E., Mari, S., Valentini, E., Musacchio, A., Fish, A., Pasqualato, S., and Polo, S. (2011). Structure of the HECT:ubiquitin complex and its role in ubiquitin chain elongation. EMBO reports 12, 342-349.

McCoy, A.J., Grosse-Kunstleve, R.W., Adams, P.D., Winn, M.D., Storoni, L.C., and Read, R.J. (2007). Phaser crystallographic software. J Appl Crystallogr 40, 658-674.

Murshudov, G.N., Vagin, A.A., and Dodson, E.J. (1997). Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr D Biol Crystallogr 53, 240-255.

Ordureau, A., Heo, J.M., Duda, D.M., Paulo, J.A., Olszewski, J.L., Yanishevski, D., Rinehart, J., Schulman, B.A., and Harper, J.W. (2015). Defining roles of PARKIN and ubiquitin phosphorylation by PINK1 in mitochondrial quality control using a ubiquitin replacement strategy. Proceedings of the National Academy of Sciences of the United States of America 112, 6637-6642.

Ordureau, A., Sarraf, S.A., Duda, D.M., Heo, J.M., Jedrychowski, M.P., Sviderskiy, V.O., Olszewski, J.L., Koerber, J.T., Xie, T., Beausoleil, S.A., et al. (2014). Quantitative proteomics reveal a feedforward mechanism for mitochondrial PARKIN translocation and ubiquitin chain synthesis. Molecular cell 56, 360-375.

Otwinowski, Z., and Minor, W. (1997). Processing of X-ray diffraction data collected in oscillation mode. Method Enzymol 276, 307-326.

Phu, L., Izrael-Tomasevic, A., Matsumoto, M.L., Bustos, D., Dynek, J.N., Fedorova, A.V., Bakalarski, C.E., Arnott, D., Deshayes, K., Dixit, V.M., et al. (2011). Improved quantitative mass spectrometry methods for characterizing complex ubiquitin signals. Molecular & cellular proteomics : MCP 10, M110 003756.

Sato, T., and Clevers, H. (2013). Growing self-organizing mini-guts from a single intestinal stem cell: mechanism and applications. Science 340, 1190-1194.

Sheng, Y., Hong, J.H., Doherty, R., Srikumar, T., Shloush, J., Avvakumov, G.V., Walker, J.R., Xue, S., Neculai, D., Wan, J.W., et al. (2012). A human ubiquitin conjugating enzyme (E2)-HECT E3 ligase structure-function screen. Molecular & cellular proteomics : MCP 11, 329-341.

50 Torrino, S., Visvikis, O., Doye, A., Boyer, L., Stefani, C., Munro, P., Bertoglio, J., Gacon, G., Mettouchi, A., and Lemichez, E. (2011). The E3 ubiquitin-ligase HACE1 catalyzes the ubiquitylation of active Rac1. Developmental cell 21, 959-965.

Wang, M., Guo, L., Wu, Q., Zeng, T., Lin, Q., Qiao, Y., Wang, Q., Liu, M., Zhang, X., Ren, L., et al. (2014). ATR/Chk1/Smurf1 pathway determines cell fate after DNA damage by controlling RhoB abundance. Nature communications 5, 4901.

Winn, M.D., Ballard, C.C., Cowtan, K.D., Dodson, E.J., Emsley, P., Evans, P.R., Keegan, R.M., Krissinel, E.B., Leslie, A.G., McCoy, A., et al. (2011). Overview of the CCP4 suite and current developments. Acta Crystallogr D Biol Crystallogr 67, 235-242.

51 Figure S1

A NEDD4LHECT-UBCH5B~Ub (3JW0)

B Rsp5 WW(proxmial)-HECT~Ub (4LCD)

C NEDD4HECT-Ub (2XBB) Figure S1. Location of varied Ub sequences in the phage display library relative to known HECT E3 binding sites. Related to Figure 1. (A) Structure representing an E2~Ub-HECT intermediate, showing that residues mediating ≈70% of interactions are varied in the library (Kamadurai et al., 2009). (B) Structure representing a HECT E3~Ub-substrate intermediate, showing that residues mediating ≈70% of interactions are varied in the library (Kamadurai et al., 2013). (C) Structure showing Ub bound to exosite, showing that residues mediating ≈95% of interactions are varied in the library (Kim et al., 2011; Maspero et al., 2011).

52 Figure S2

NEDD4 NEDD4L HERC1 HERC2 2.5 4 4 4

) NL.1 H1.2 H2.2

m N4.2

n 2.0 NL.2 H1.3 H2.3

0 N4.4 3 3 3 5 NL.3

( 1.5 N4.5 y NL.4

i s 2 wt Ub 2 2

e 1.0

a 1 1 1

t 0.5

O 0.0 0 0 0 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 Log (UbV, nM) Log (UbV, nM) Log (UbV, nM) Log (UbV, nM)

SMURF1 SMURF2 HERC4 HERC6 4 4 4

) S1.1 S2.1 H4.1 m 3 H6.1 n S1.2 S2.2 H4.2 wt Ub 0 3 3 3 5 S1.3

4 S2.3 H4.3

(

y S1.4

i S2.4 H4.4 2

s 2 2 2 n S1.5 S2.5

D wt Ub wt Ub

a 1

c 1 1 1

O 0 0 0 0 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 Log (UbV, nM) Log (UbV, nM) Log (UbV, nM) Log (UbV, nM)

WWP1 WWP2 HACE1 HUWE1 4 4 4 4 ) P1.1 P2.1 HA.1 HU.1

n P1.2 P2.2 HU.2 0 3 3 3 HA.2 3

4 P1.3 P2.3 wt Ub ( HA.3

t i P1.4 P2.4 s 2 2 2 2

e wt Ub

c 1 1 1 1

O 0 0 0 0 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 Log (UbV, nM) Log (UbV, nM) Log (UbV, nM) Log (UbV, nM)

HECW1 HECW2 UBE3C EDD1 4 4 4 4 W1.1 W2.1 ) 3C.2 ED.7 m W1.2 W2.2

3C.3 3 3 3 3 ED.3

5 W1.3 W2.3 wt Ub wt Ub

( W1.4 W2.4

t i 2 2 2 2 s wt Ub wt Ub

a 1 1 1 1

O 0 0 0 0 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 Log (UbV, nM) Log (UbV, nM) Log (UbV, nM) Log (UbV, nM)

ITCH Rsp 5 HECTD1 KIAA0317 3 4 4 4 R5.1 IT.2 D1.1 KI.1

)

m R5.2 D1.2 KI.2 n IT.3 3 3 3

0 R5.3 D1.3

5 2 IT.4 KI.3

( R5.4 IT.6 D1.4 KI.4

t i 2 R5.5 2 2

e 1 R5.6

l 1 wt Ub 1 1

O 0 0 0 0 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 -4 -2 0 2 4 Log (UbV, nM) Log (UbV, nM) Log (UbV, nM) Log (UbV, nM) Figure S2. Binding curves of UbVs to the cognate HECT E3 ligases. Related to Figure 1. The half maximal binding concentrations (EC50) of UbVs to indicated HECT E3s were determined by established methods (Ernst et al., 2013) and are listed in Table S4. HECT E3s (1 µM) were immobilized in microtiter plates. Serial dilutions of Flag- tagged UbV or Ub (0-4 µM) were added and incubated for 20 min at room temperature. Wells were washed and bound UbV/Ub was detected by anti-Flag-HRP conjugate antibody and colorimetric development of TMB peroxidase substrate. The absorbance at 450 nm (y-axis) was plotted against Log (UbV/Ub concentration, nM) (x-axis). Data were presented as the mean ± SD (N = 3).

53 Figure S3

A GST-NEDD4LHECT B GST-NEDD4HECT C GST-WWP1HECT D GST-WWP2HECT

0.16 0.6 0.6 0.2 0.2 0.15 0.3 0.3

0.10 0.4 0.4 0.08 0.2 0.2 0.1 0.1 0.05 N4.2 N4.2 0.1 0.1 0.2 0.2 0.0 P1.1 P1.1 0.0 0.00 0.00 0306090 120 0306090 050 100 150 200 04812 0.0 0.0 0.0 0 100 200 300 0 600 1200 1800 0.0 04812 concentration (µM) 060 120 180 240 concentration (µM) concentration (nM) concentration (µM) 0.20 0.20 0.2 0.2 0.2 0.2 0.4 0.4 0.15 0.15

0.10 0.1 0.1 0.2 0.2 0.10 0.1 0.1 N4.4 N4.4 0.05 0.05 0.0 P1.3 0.0 0.0 0.0 0.00 0306090 120 03060 0306090 120 050 100 150 200 250 0.00 P1.3 0.0 0.0 0 100 200 300 0 600 1200 1800 0369 concentration (µM) concentration (µM) 060 120 180 240 concentration (µM) 0.2 0.2 0.20 0.20 concentration (nM) 0.3 0.3 0.15 0.15 0.2 0.2 0.2 0.2 0.1 0.1 0.10 0.10 0.1 0.1 0.1 0.1 0.05 N4.5 N4.5 0.05 P2.1 0.0 0.0 0.0 P2.1 0.0 0.00 0.00 0306090 120 03060 90 050 100 150 200 04812 0.0 0.0 concentration (µM) 0 100 200 300 0 600 1200 1800 04080 120 0 100 200 300 400 concentration (µM) concentration (nM) 0.12 0.12 concentration (nM) 0.15 0.15 0.20 0.20 0.2 0.2 0.08 0.08 0.15 0.15 0.10 0.10 0.10 0.10 0.04 0.04 0.05 0.05 0.1 0.1 NL.1 NL.1 0.05 0.05 0.00 0.00 0.00 0.00 0.00 0.00 P2.3 P2.3 04080 120 160 04080 120 0 100 200 300 0 600 1200 1800 0.0 0.0 050 100 150 200 0246 04080 120 0 100 200 300 400 concentration (nM) concentration (µM) concentration (nM) 0.20 0.20 0.15 0.15 0.6 0.6 concentration (nM) 0.08 0.08 0.15 0.15 0.10 0.10 0.4 0.4 0.10 0.10 0.04 0.04 0.05 0.05 0.05 0.2 0.2 0.05 NL.2 NL.2 0.00 0.00 0.00 NL.1 ubiquitin 0.00 0.00 0.00 0.0 0.0 04080 120 160 050 100 150 200 050 100 150 200 0246 050 100 150 02040 concentration (µM) 04080 120 0 100 200 300 concentration (nM) concentration (µM) 0.3 0.2 0.2 time (second) concentration (µM) 0.3 0.15 0.15

0.2 0.2 0.10 0.10 0.1 0.1 0.1 0.1 0.05 0.05 NL.3 NL.2 NL.3 0.00 0.0 0.0 0.0 0.00 04080 120 160 0.0 050 100 150 01530 response (nm) 04812 04812 050 100 150 200 concentration (µM) 0.3 concentration (µM) concentration (µM) 0.3 0.20 0.20 0.2 0.2 0.15 0.15 0.2 0.2 0.10 0.10 0.1 0.1 0.1 0.1 NL.4 0.05 0.05 0.0 NL.4 NL.3 0.0 0.0 0.0 0.00 0.00 04080 120 160 0246 050 100 150 200 0246810 050 100 150 0153045 concentration (µM) concentration (µM) concentration (µM) 0.6 0.6 0.30 0.30 0.30 0.3

0.4 0.4 0.20 0.20 0.20 0.2 0.10 0.2 0.2 0.10 0.10 0.1 NL.4 P1.1 0.00 ubiquitin 0.0 0.00 0.00 0.0 04080 120 160 0 200 400 600 0.0 050 100 150 0153045 050 100 150 0153045 0.12 concentration (µM) time (second) concentration (µM) 0.12 0.6 0.6 concentration (µM)

0.08 0.08 0.4 0.4

0.04 0.04 P1.3 0.2 0.2 0.00 0.00 ubiquitin 050 100 150 02040 0.0 0.0 0 100 200 300 0 300 600 900 0.3 0.3 concentration (µM) time (second) concentration (µM)

0.2 0.2

0.1 0.1 P2.1

0.0 0.0 050 100 150 02040 concentration (µM) 0.4 0.4

0.3 0.3

0.2 0.2

0.1 0.1 P2.3

0.0 0.0 050 100 150 02040 0.30 concentration (µM) 0.30

0.20 0.20

0.10 0.10

0.00 ubiquitin 0 30 60 90 120 0.00 0 200 400 600 800 time (second) concentration (µM) Figure S3 --continued

GST-SMURF2HECT GST-Rsp5HECT E GST-ITCHHECT F G

0.20 0.20 0.20 0.20 0.15 0.15 0.15 0.10 0.10 0.10 0.10 0.10 0.10 0.05 0.05 0.05 S1.3 0.00 R5.1 0.00 IT.2 0.00 0.00 0.00 0.00 060 120 180 240 0510 050 100 150 04080 120 concentration (µM) 0306090 120 0 200 400 600 800 Concentration (µM) 0.3 0.3 concentration (nM) 0.20 0.20 0.20 0.20 0.2 0.2

0.10 0.10 0.10 0.10 0.1 0.1 IT.3 S1.4 R5.2 0.00 0.0 0.00 0.0 0.00 0.00 050 100 150 050 100 150 060 120 180 240 012 050 100 150 200 0 200 400 600 800 Concentration (µM) concentration (µM) concentration (nM) 0.15 0.15 0.20 0.20 0.15 0.15

0.10 0.10 0.10 0.10 0.10 0.10 response (nm) 0.05 0.05 0.05 0.05 S1.5 IT.4 0.00 R5.3 0.00 0.00 0.00 060 120 180 240 0120.00 0.00 04080 120 0510 15 20 050 100 150 200 0 150 300 450 600 concentration (µM) Concentration (µM) concentration (nM) 0.3 0.3 0.10 0.10 0.20 0.20 0.2 0.2 0.05 0.10 0.10 0.05 0.1 0.1 0.00 ubiquitin S2.4 R5.4 0.0 0.0 0.00 0.00 0 30 60 90 120 0.00 060 120 180 240 0 800 1600 2400 0 200 400 600 800 050 100 150 200 0 300 600 900 1200 time (second) concentration (nM) concentration (nM) concentration (µM) 0.3 0.3 0.24 0.24

0.2 0.2 0.16 0.16

0.1 0.1 0.08 0.08 S2.5 R5.5 0.0 0.0 0.00 0.00 060 120 180 240 0 800 1600 2400 050 100 150 200 0 400 800 1200 1600 concentration (nM) concentration (nM) 0.25 0.20 0.24 0.24 0.20 0.15 0.16 0.10 0.16 0.10 0.08 0.05 ubiquitin 0.08 R5.6 0.00 0.00 0.00 0 100 200 0 200 400 600 800 050 100 150 200 0 200 400 600 800 time (second) concentration (µM) concentration (nM) 0.40 0.40

0.30 0.30

0.20 0.20 0.10 0.10 0.00 ubiquitin 0 30 60 90 120 0 200 400 600 800 time (second) concentration (µM)

H I GST-HACE1HECT GST-HUWE1HECT

0.12 0.12 0.2 0.2

0.06 0.06 0.1 0.1 HU.1 0.00 HA.1 0.00 0.0 0.0 04080 120 0.0 1.0 2.0 3.0 0 100 200 0 500 1000 1500 2000 concentration (µM) concentration (nM) 0.2 0.2

0.12 0.12

0.1 0.1 0.06 0.06

HA.3 0.00 HU.2 0.0 0.0 0.00 0 100 200 0 500 1000 1500 2000 04080 120 060 120 180 240 concentration (nM) 0.15 concentration (µM) 0.15 0.3 0.3 0.10 0.2 0.2 0.10 0.05 0.1 0.1 0.05 ubiquitin 0.00 0.0 0.0 ubiquitin 0 30 60 90 120 0.00 060 120 180 240 0 200 400 600 800 0 200 400 600 800 time (second) concentration (µM) time (second) concentration (µM) Figure S3. Raw data for UbV or E2 binding to GST-HECT domains measured by Bio-Layer Interferometry (BLI). Related to Figure 1. (A-I) Sensorgrams and curve fits for titrations of Ub or His-tagged UbV as analytes binding to GST-HECT domain ligands. The data shown in Figure 1E-F are repeated here for convenient comparison with other data. Error = SEM, N = 3.

54 Figure S4 A B C D NEDD4FL ± UbV NEDD4LFL ± UbV WWP1FL ± UbV WWP2FL ± UbV

- - - - P2.1 P2.3 N4.2 N4.4 N4.5 NL.1 NL.2 NL.3 NL.4 P1.1 P1.2 P1.3 P1.4 170 NEDD4LFL WWP1FL WWP2FL FL 130 MW (kDa) NEDD4 -Ub(n) -Ub(n) 245 -Ub(n) -Ub(n) 100 180 245 245 135 72 180 180 100 135 135 55 75 100 100 40 63 75 75 48 35 63 63 35 48 48 25 35 35 25 E2: UBE2L3 E2: UBE2L3 E2: UBE2L3 E2: UBE2L3

HECT E ITCHFL ± UbV F SMURF1WW(all)-HECT ± UbV G SMURF2 ± UbV - IT.2 IT.3 IT.4 IT.6 - - S2.1 S2.2 S2.3 S2.4 S2.5 S1.1 S1.2 S1.3 S1.4 S1.5

170 ITCHFL 130 -Ub(n) 245 SMURF1 245 -Ub(n) 180 100 180 SMURF2 72 135 135 -Ub(n) 100 55 100 40 75 75 35 63 63 25 48 48 15 35 35 E2: UBE2L3 25 25 E2: UBE2L3 E2: UBE2L3 H I

HECW1 ± UbV HECW2 ± UbV

- - W1.2 W1.3 W1.4 W2.1 W2.2 W2.3 W2.4

180 180 135 135 HECW1 HECW2 100 100 -Ub(n) -Ub(n) 75 75 63 63 48 48 35 35 E2: UBE2L3 E2: UBE2J2 Figure S4. Auto-ubiquitination assays for NEDD4 family of HECT E3 ligases. Related to Figures 2, 3 and 4. (A) NEDD4 full-length (NEDD4FL) protein (pre-mixed for 15 min with wt Ub or UbV as indicated) was incubated for 1 hour at room temperature with E1 (UBE1), E2 (UBE2L3), ATP, and Ub. Western blots were probed with an anti- Ub antibody (clone FK2) to detect mono- and poly-ubiquitinated NEDD4FL. UbVs are not incorporated into chains because their C termini do not contain a di-glycine motif that is required for recognition by the E1 enzyme. (B-I) Analysis of in vitro reactions to detect auto-ubiquitination of other members of the NEDD4 family under conditions described in (A). The following HECT E3s were analyzed: (B) NEDD4FL ,(C) WWP1FL, (D) WWP2FL (E) ITCHFL, (F) SMURF1WW(all)-HECT, (G) SMURF2 HECT domain, , (H) HECW1 HECT domain (UBE2J2 was used as E2), and (I) HECW2 HECT domain. E2s were selected according to published work (Sheng et al., 2012).

55 Figure S5

HERC6 ± UbV A B C HERC4 ± UbV D -

- C6.1

C4.1 C4.2 C4.3 HERC1 ± UbV HERC2 ± UbV MW (kDa) MW (kDa) - 170 - 245 C2.3 C2.2 MW (kDa) C1.2 C1.3 130 170 MW (kDa) 180 HERC4 HERC6 130 100 75 135 -Ub(n) -Ub(n) 100 100 72 HERC1 63 HERC2 72 75 -Ub(n) 48 -Ub(n) 55 55 63 35 40 40 25 48 35 20 35 17 35 25 25 E2: UBE2S E2: UBE2N1 25 20 E2: UBE2L3 E2: UBE2L3

E F G UBE3C ± UbV FL HACE1 ± UbV HUWE1 ± UbV - - - 3C.2 3C.3 HA.1 HA.2 HA.3 HU.1 HU.2 MW (kDa) MW (kDa) MW (kDa) 180 HACE1FL 180 HUWE1 245 UBE3C 135 -Ub(n) -Ub(n) 135 180 -Ub(n) 100 100 135 100 75 75 75 63 63 48 48 63 35 35 48 25 25 35 25 E2: UBE2L3 E2: UBE2D2 E2: UBE2L3

HECTD1 ± UbV H EDD1 ± UbV I J KIAA0317 ± UbV - - KI.1 KI.2 KI.3 KI.4

- D1.1 D1.2 D1.3 D1.4 ED.3 ED.7 MW (kDa) MW (kDa) MW (kDa) 245 180 180 180 HECTD1 135 135 135 -Ub(n) 100 KIAA0317 100 100 75 -Ub(n) 75 75 63 63 63 48 EDD1-Ub 48 48 35 35 35 25 20 25 25 20 20 17 17 17 E2: UBE2D1 11 11 E2: UBE2D2 E2: UBE2D3 Figure S5. Auto-ubiquitination assays for non-NEDD4 HECT E3 ligases. Related to Figures 2 and 3. (A) HERC1 HECT domain (pre-mixed for 15 min with wt Ub or UbV as indicated) was incubated for 1 hour at room temperature with E1 (UBE1), E2 (UBE2S), ATP, and Ub. Western blots were probed with an anti-Ub antibody (clone FK2) to detect mono- and poly-ubiquitinated HERC1 HECT. UbVs are not incorporated into chains because their C termini do not contain a di-glycine motif that is required for recognition by the E1 enzyme. (B-J) Analysis of in vitro reactions to detect autoubiquitination of indicated HECT E3 ligases under conditions as described in (A). (B) HERC2 HECT domain (UBE2N1 was used as E2), (C) HERC4 HECT domain (UBE2L3 was used as E2), (D) HERC6 HECT domain (UBE2L3 was used as E2), (E) HACE1FL (UBE2L3 was used as E2), (F) HUWE1 HECT domain (UBE2D2 was used as E2), (G) UBE3C HECT domain (UBE2L3 was used as E2), (H) EDD1 HECT domain, (UBE2D2 was used as E2), (I) HECTD1 HECT domain, (UBE2D3 was used as E2), and (J) KIAA0317 HECT domain. (UBE2D1 was used as E2). E2s were selected according to published work (Sheng et al., 2012).

56 Figure S6

WWP1HECT (1ND7) NEDD4LHECT (2ONI) E6APHECT (1D5F) B

WWP1HECT-UBCH7-UbV.P2.3 NEDD4LHECT-UBCH5B~Ub E6APHECT-UBCH7 (1C4Z) (3JW0) C

WWP1HECT-UbV.P2.3 NEDD4LHECT-UbV.NL.1 NEDD4HECT-UbV.N4.4

WWP1HECT (1ND7) NEDD4LHECT (2ONI) NEDD4HECT (2XBF) WWP1HECT-UbV.P1.1 NEDD4LHECT-UBCH5B~Ub NEDD4HECT-Ub (3JW0, chains: ABCD) (2XBB, chains:ABCD) WWP1HECT-UBCH7-UbV.P2.3 NEDD4LHECT-UbV.NL.1 NEDD4HECT-UbV.N4.4 (chains: ABCDEF) (chains: ABCD) Figure S6. Conformational variability of HECT domain β-hairpin bridging E2- binding site and N-lobe exosite. Related to Figures 2 and 3. HECT E3, E2 and UbV are colored in magenta, cyan or yellow, respectively. Close-up views of apo-, E2-bound and UbV-bound HECT E3s are presented in panels (A), (B) and (C) respectively for indicated HECT E3s. (D) Superpositions of all available WWP1, NEDD4L and NEDD4 complexes highlight the dynamic nature of this region.

57 Figure S7

A B ITCHHECT-UbV.IT.2-UbV.IT.2 ITCHHECT-UbV.IT.2-UbV.IT.2 Rsp5HECT-UbV.R5.4 Figure S7. Crystal structure of ITCHHECT-UbV IT.2. Related to Figures 2. (A) The ITCHHECT domain binds two IT.2 UbV molecules in the crystal. The IT.2 UbV molecule occupying the E2-binding site presumably functions as the inhibitor of Ub transfer from E2 to to E3, and represents the high-affinity form measured by BLI. The second IT.2 molecule is sandwiched in place by crystal packing. For comparison, the UbV occupying the E2-binding site makes few crystal packing interactions, the buried surface area is greater than 3 times that of the second IT.2, and it makes hydrogen bonds and salt bridges to the E2-binding site that are otherwise lacking in the other interaction. (B) The binding site for the second IT.2 molecule overlaps with but differs from the standard Ub- HECT exosite pose.

58 Figure S8 A B UBCH7 N-lobe Hs.NEDD4 (599-678) E M F N P Y Y G L F E Y S A T D N Y T L Q I N P N S G L C N E D H L S Y F K F I G R V A G M A V Y H G K L L D G F F I R P F Y K M M L H K P I T L H D M E S V D 678 Hs.NEDD4L (654-733) E M F N P Y Y G L F E Y S A T D N Y T L Q I N P N S G L C N E D H L S Y F T F I G R V A G L A V F H G K L L D G F F I R P F Y K M M L G K Q I T L N D M E S V D 733 Hs.SMURF1 (454-532) E M L N P Y Y G L F Q Y S T D N I Y M L Q I N P D S S I N - P D H L S Y F H F V G R I M G L A V F H G H Y I N G G F T V P F Y K Q L L G K P I Q L S D L E S V D 532 Hs.SMURF2 (448-526) E M L N P Y Y G L F Q Y S R D D I Y T L Q I N P D S A V N - P E H L S Y F H F V G R I M G M A V F H G H Y I D G G F T L P F Y K Q L L G K S I T L D D M E L V D 526 Hs.WWP1 (622-700) E V L N P M Y C L F E Y A G K N N Y C L Q I N P A S T I N - P D H L S Y F C F I G R F I A M A L F H G K F I D T G F S L P F Y K R M L S K K L T I K D L E S I D 700 Hs.WWP2 (570-648) E V L N P M Y C L F E Y A G K N N Y C L Q I N P A S S I N - P D H L T Y F R F I G R F I A M A L Y H G K F I D T G F T L P F Y K R M L N K R P T L K D L E S I D 648 Hs.ITCH (603-681) E V L N P M Y C L F E Y A G K - - - C L Q I N P A S Y I N - P D H L K Y F R F I G R F I A M A L F H G K F I D T G F S L P F Y K R I L N K P V G L K D L E S I D 588 Sc.Rsp5 (510-588) E M F N P F Y C L F E Y S A Y D N Y T I Q I N P N S G I N - P E H L N Y F K F I G R V V G L G V F H R R F L D A F F V G A L Y K M M L R K K V V L Q D M E G V D 157 #1 #2 #3 Ub

Hs.NEDD4 (679-756) S E Y Y N S L R W I L E N D P T - - E L D L R F I I D E E L F G Q T H Q H E L K D G G S E I V V T N K N K K E Y I Y L V I Q W R F V N R I Q K Q M A A F K E G F 756 Hs.NEDD4L (734-811) S E Y Y N S L K W I L E N D P T - - E L D L M F C I D E E N F G Q T Y Q V D L K P N G S E I M V T N E N K R E Y I D L V I Q W R F V N R V Q K Q M N A F L E G F 811 Hs.SMURF1 (533-611) P E L H K S L V W I L E N D I T P - V L D H T F C V E H N A F G R I L Q H E L K P N G R N V P V T E E N K K E Y V R L Y V N W R F M R G I E A Q F L A L Q K G F 611 Hs.SMURF2 (527-605) P D L H N S L V W I L E N D I T G - V L D H T F C V E H N A Y G E I I Q H E L K P N G K S I P V N E E N K K E Y V R L Y V N W R F L R G I E A Q F L A L Q K G F 605 #2 Hs.WWP1 (701-780) T E F Y N S L I W I R D N N I E E C G L E M Y F S V D M E I L G K V T S H D L K L G G S N I L V T E E N K D E Y I G L M T E W R F S R G V Q E Q T K A F L D G F 780 #1 Hs.WWP2 (649-728) P E F Y N S I V W I K E N N L E E C G L E L Y F I Q D M E I L G K V T T H E L K E G G E S I R V T E E N K E E Y I M L L T D W R F T R G V E E Q T K A F L D G F 728 A Hs.ITCH (682-761) P E F Y N S L I W V K E N N I E E C D L E M Y F S V D K E I L G E I K S H D L K P N G G N I L V T E E N K E E Y I R M V A E W R L S R G V E E Q T Q A F F E G F 761 Sc.Rsp5 (589-667) A E V Y N S L N W M L E N S I D G - V L D L T F S A D D E R F G E V V T V D L K P D G R N I E V T D G N K K E Y V E L Y T Q W R I V D R V Q E Q F K A F M D G F 667 A #4 B B Ub exosite E2 binding site -helix -strand #4 View-1 View-2 View-3 #3 C B N-lobe - UbV

A y y A 0 A B 20 100 0 B 180 100 x x 800 z 2350 z B

N-lobe - UBCH7 A A A B B WWP1HECT + UBCH7 (+ UbV.P2.3) D WWP1HECT + UbV.P1.1 ITCHHECT + UbV.IT.2 E6APHECT + UBCH7 (1C4Z) A46 I44 Y68 R72 F70 L8 R9 D727 G46 L44 Y68 L70 L8 R9 D708 S706 W709 P97 F63 E60 A2 R5 N745

View-1

R47 D712E702 W709 F703 Y756 E683 W690 D681 L688 F684 Y737 E702 F703 Y756 R767 D727

R9 D727 R72 I42 Y68 I44 E702 A46 S706 R9 D708 L8 Y68 L44 E683 R5 S725 A2 E60 P97 K67 E702

View-2

L8 F70 Y756 C718 I710 W709 D712 R47 Y737 L688 F684 W690 G46 N745 Y756 F63 F703 W709

R9 D727 L8 F703 Y68 I44 E702 A46 S706 D708 L8 F684 D681 Y68 E683 S725 D727 R767 E60 F703 K67 E702

View-3

Y756F70 R72I710I42 C718 W709D712R47 R9 Y737 L70 L688 W690 L44 G46 R5 A2 Y756 F63 P97 W709 Figure S8-continued

E 600 #2

#1 #4

N-lobe Ub N-lobe #3 Ub

F WWP1HECT + UbV.P2.3 (+ UBCH7) NEDD4LHECT + UbV.NL.1 Rsp5HECT + UbV.R5.4 NEDD4HECT + UbV.N4.4 WWP1HECT (1ND7) NEDD4LHECT (2ONI) Rsp5WW3-HECT + Ub (3OLM) NEDD4HECT +Ub (2XBB) regions Y633 P514 Y610 P626 L630 P658 P8 P603 F577 P8 F465 A9 #1 F8 + Y660 P74 F515 Y628 Y659 Y516 W11 #3 Y68 N638 Y604 P74 F70 N628 Y656 M71 Y68 Y544 G71

N670 Y639 G635 R10 R10 #2 W10 Y610 Y633 A9 Y665 Y521 P603 P626 Y68 P658 P8 P8 W11 F8 P514

C682 F8 L731 L681 F70 F762 #4 R49

Y68 E729 Y68 Figure S8. Molecular details of UbV-HECT E3 interactions. Related to Figures 2 and 3. (A) Sequence alignment (Clustal W, Lasergene) for closely-related NEDD4- family members showing the E2-binding region and N-lobe exosite. Secondary structures are indicated above based on NEDD4L (PDB: 2ONI, 3JW0) and Rsp5 (PDB: 3OLM, 4LCD). β-strands in dark red vary among HECT structures. (B) To define which portions of HECT domains are shown in panels D-F, regions of HECT domain interacting with E2s (labeled A and B), and the Ub/UbV-binding N-lobe exosite (numbered 1-4) are highlighted on the crystal structure of WWP1 HECT domain in complex with the E2 UBCH7 and UbV P2.3. (C) Three orientations showing details of HECT domain interactions with inhibitory UbVs or E2s. (D) Close-up views of HECT domain interactions with inhibitory UbVs (WWP1—UbV P1.1 and ITCH—UbV IT.2) or E2s (WWP1— or E6AP—UBCH7), with coloring of the proteins as labeled above panels. Structures were aligned over the interaction region of the HECT domain and represented with MacPyMOL (Schrodinger). (E) Expanded views of Ub (yellow cartoon) bound to the N-lobe exosite on the NEDD4 HECT domain (surface) (PDB: 2XBB) highlighting locations of interacting regions 1-4. (F) Close-up views of HECT domain interactions with modulatory UbVs mimicking Ub bound to the N-lobe exosite. Structures were aligned over the HECT domain N-lobe and depicted with MacPymol, with coloring of the proteins as labeled in the above panels. UbV complexes with HECT domains from WWP1 and NEDD4L are shown superimposed with prior structures of the free HECT domains to highlight striking conformational changes in region 4 upon UbV binding to WWP1. Rsp5 and NEDD4 complexes with UbVs and Ub are shown superimposed to highlight structural changes in the UbVs that may dictate specificity.

59 Figure S9

A GO-1 Activation requires distal WW domain by potentially releasing autoinhibition

GO-2 Activates HECT domain and E2-to-E3 Ub transfer

GO E2(Cys)~Ub + HECT E3(Cys) E2(Cys) + HECT E3(Cys)~Ub Ligation-specific mutants Inhibited by blocking E2-E3 binding (NEDD4L: D639A) (WWP1: D607A) HECT E3(Cys)~Ub (automodification) NEDD4L WW -HECT D639A n B all

GO-1 GO-2 GO-1 GO-2

UbV - + NL.1 + NL.2 + NL.3 + NL.4 NEDD4L 1.6 NEDD4L~Ub* + NL.1 1.2

0.8 + NL.2 0.4 + NL.4 no UbV UBCH5B~Ub* + NL.3 NEDD4L~Ub (pmole/s) 0.0 51015202530 time 26 seconds 8 seconds 8.5 seconds 300 seconds 150 seconds NEDD4L D639A (µM)

NEDD4L WWproximal-HECT D639A

+ NL.2 1.0 UbV - + NL.1 + NL.2 + NL.3 + NL.4 NEDD4L 0.8 NEDD4L~Ub* 0.6 no UbV

0.4 + NL.1

0.2 + NL.4 + NL.3 UBCH5B~Ub* NEDD4L~Ub (pmole/s) 0.0 time 10 seconds 10 seconds 10 seconds 358 seconds 240 seconds 5101520 NEDD4L D639A (µM)

WWP1 WW -HECT D607A C all GO-1 GO-2

UbV - +P2.3 WWP1 0.03 WWP1~Ub* +P2.3

0.02

0.01 UBCH5B~Ub* no UbV WWP1~Ub (pmole/s) 0.00 time 33 seconds 31 seconds 0102030 WWP1 D607A (µM) WWP1 HECT D607A

GO-2 UbV +P2.3 - +P2.3 WWP1 0.8

WWP1~Ub* 0.6

0.4

UBCH5B~Ub* 0.2 no UbV time 10 seconds 10 seconds

WWP1~Ub (pmole/s) 0.0 01020 30 WWP1 D607A (µM) Figure S9. UbVs targeting the HECT domain exosite exert various effects on Ub transfer from E2 to NEDD4L and WWP1 HECT E3s. Related to Figures 3 and 4. (A) Schematic of mechanisms by which UbVs activate (GO) or inhibit (STOP) Ub transfer from an E2 to a HECT E3. To prevent HECT E3 autoubiquitination, E3s were mutated with an Ala substitution at a conserved Asp that is dispensable for Ub transfer from E2 to NEDD4-family HECT E3s but that is required for Ub transfer from NEDD4-family HECT E3s to lysines (Kamadurai et al., 2013). (B) Roles of distal WW domains in UbV modulation of Ub transfer from E2 (UBCH5B) to NEDD4L, assayed by titrating UbVs into reactions with versions of NEDD4L harboring all WW domains (NEDD4LWW(all)-HECT) or only the proximal WW domain (NEDD4LWW(proximal)-HECT D639A) in addition to the catalytic HECT domain. The distal WW domains are required for NL.1 and NL.2 to stimulate catalysis, whereas NL.3 and NL.4 inhibit Ub transfer from E2 to both versions of the E3. Note different reaction times used to highlight activation or inhibition. (C) Same as B, but for the E3 WWP1 and an activating UbV. Notably, for WWP1, even the isolated catalytic HECT domain alone is stimulated by the UbV in these reactions.

Figure S10. UbVs stimulate Rsp5 activities in vitro. Related to Figure 3. (A) Pulse- chase reactions showing six different UbVs stimulate fluorescent Ub transfer from E2 to the full-length Rsp5 E3. (B) Pulse-chase UbV R5.4, which was crystallographically shown to bind the Ub-binding exosite (Fig. 3A) stimulates Ub transfer from E2 to Rsp5 even in the absence of the C2 domain. (C) Pulse-chase reactions showing six different UbVs stimulate fluorescent Ub transfer from E2 to the full-length Rsp5 E3 to two substrates, Sna3 peptide (left) and Sna4 peptide (right). (D) Rapid quench-flow experiments confirm the crystallized UbV R5.4 stimulates the rate of Ub transfer from E2 to Rsp5 (~10-fold) and overall production of modified substrate (Sna3~Ub, ~4-fold).. This stimulation mirrors the effect of removing the autoinhibitory N-terminal domain, as there is little effect of the UbV on the activated catalytic unit freed from autoinhibition (Rsp5WW(proximal)-HECT) (Kamadurai et al., 2013).

Figure S11. UbVs targeting the HECT domain exosite exert different effects on NEDD4L and WWP1 in processive ligation of multiple monoUbs or polyUb chain formation, and in distributive reactions where substates and products can cycle on and off E3. Related to Figures 3 and 4. (A) Reaction flow-charts. Reactions in the presence of excess competitor substrate primarily monitor Ub transfer upon a single substrate encounter with E3, because fluorescent substrate or product released from E3 is generally replaced by an unlabeled counterpart not sensed in the reaction. Reactions performed with methylated Ub examine individual (mono) Ubs transfer to multiple substrate lysines in the absence of polyUb chain formation. The fluorescent substrate WBP2* has multiple lysines as potential Ub acceptors, whereas S-WBP2-1K* contains a single Lys that can serve as a site for Ub chain elongation. To monitor polyUb chain extension of pre-modified targets, a priming reaction first generated some S-WBP2-1K* modified with either a single Ub or a Ub~Ub chains. (B) Effect of UbV NL.1 on multi- mono-Ub transfer by a NEDD4L construct, either in a single substrate encounter with the E3 (left) or in multiple encounters (right) shows that occupation of the N-lobe exosite inhibits processive linkage of multiple monoUbs to a substrate. (C) Reactions as in B, except with wild-type Ub that can either be transferred to multiple substrate lysines and be incorporated into polyUb chains (D-E) Reactions as in (B-C) expect using NL.2 for NEDD4L. (F) Reactions as in B, except using the corresponding version of WWP1 and UbV P2.3, showing little effect of UbV on processive but enhanced distributive substrate modification with multiple mono Ubs. (G) Reactions as in C, except using the corresponding version of WWP1, showing enhanced distributive substrate modification. (H-I) Limited effects of UbV NL.1 or NL.2 on polyUb chain formation by a version of NEDD4L, assayed by using a substrate harboring a single lysine acceptor site (S- WBP2-1K*). (J) Reactions as H except with corresponding version of WWP1 and UbV P2.3 showing UbV stimulation of Ub chain elongation in distributive reactions.

62 Figure S12 A His-Ub + + + + + + + + + + HA-RAC1-Q61L + + + + + + + + + + Myc-HACE1 - + + + + + + + + + Flag-wt Ub ------Flag-HA.1 ------UbV Flag-HA.2 ------Flag-HA.3 ------MW (kDa) 72 55 IP: His IB: HA 35

Total, IB: HA 25 Total, IB: Myc 130 Total, IB: Flag 17 B MG132 + + MG132 + + Tet-induced UbV: - + UbV:Tet-induced - + Flag-HU.1 Flag-HU.1 IB: HUWE1 IB: HUWE1 Total cell lysate IB: Flag Total cell lysate IB: c-Myc (HUWE1 substrate)

IB: HUWE1 IP: Flag IB: Actin IB: Flag IB: Flag

C MG132 D

Myc-WWP2 - + + + + + HA-Ub - - + + + + Flag-wt Ub - - - + - - Flag-P2.1 - - - - + - Myc-WWP2 + + + + + UbV Flag-P2.3 - - - - - + PTEN - + + + + Flag-wt Ub - - + - - Flag-P2.1 UbV - - - + - Flag-P2.3 - - - - + WB: HA IP: Myc WB: Myc

WB: PTEN WB: Myc

WB: Myc WB: Flag Input WB: Flag WB: Tubulin Figure S12. UbVs interfere with HECT E3 activity in cells. Related to Figure 5. (A) WWP2 activators UbV P2.1 and P2.3 promote the poly-ubiquitination of WWP2 in vivo. 293T cells were transfected with constructs encoding HA-Ub and Myc-WWP2 together with constructs encoding Flag-Ub/P2.1/P2.3. Cells were treated with 10 µM MG132 for 6 hrs. Whole cell lysates were subjected to immunoprecipitation with anti-Myc antibody and followed by western blotting using indicated antibodies. (B) WWP2 activators UbV P2.1 and P2.3 promote the degradation of WWP2 and PTEN. 293T cells were transfected with constructs encoding Myc-WWP2 together with Flag-Ub/P2.1/P2.3. 24 hrs after transfection, cell lysates were immunoblotted with the indicated antibodies. (C) Western blotting analysis of HACE1-mediated Rac1 ubiquitination efficiency with and without HACE1 inhibitors UbV HA.1, HA.2 or HA.3. CHO cells were transfected with expression vectors for Histidine-tagged ubiquitin (His-Ub), together with HA-Rac1Q61L, myc-HACE1 and Flag-Ub/HA.1/HA.2/HA.3. His-Ub crosslinked forms of Rac1Q61L were purified (IP – anti-His), resolved on SDS-PAGE and detected by immunoblot with anti-HA antibody (IB – anti-HA for ubiquitinated Rac1). Lower panels: Immunoblot (IB) with anti-HA, anti-myc or anti-Flag were performed in parallel to verify quantities of protein expression. (D) HUWE1 inhibitor UbV HU.1 interacts with and stabilizes HUWE1 and it substrate Myc. The HCT116 cell line used stably expressed HU.1 (tet inducible). 24 hrs after induction, total lysate (2 mg) was immunoprecipitated with anti-Flag antibody (4 µg) and immunoblotted with antibodies against endogenous HUWE1 and ectopically expressed Flag-HU.1. Western blotting analysis of endogenous HUWE1, Myc and Actin are shown in the right panel.

Figure S13. NEDD4L UbVs modulate cellular ENaC protein levels. Related to Figure 5. (A) Western blot analysis of expression levels of NEDD4L UbV NL.1 or NL.3. (B) Cell surface levels of ENaC analyzed by ELISA in the above tagged αβγENaC- MDCK cells co-expressing (or not) NL.1 or NL.3. Cycloheximide (CHX, 44.4 µM) was added at time zero to inhibit protein synthesis. Cell surface ENaC was analyzed with anti-HA antibody to detect αENaC. Values are mean ± SEM (N = 4). (C) Transduction of NL.1 and NL.3 ubiquitin variant constructs altered the morphology and surface area of mouse distal colon organoids. Mouse colonic organoids transduced with either control or ubiquitin variant (NL.1 or NL.3) constructs were mechanically dissociated and rendered down to single cells through treatment with Accutase. These cells were re- embedded in Matrigel, fed with complete media, and growth was observed at the indicated times points through epifluorescent microscopy. (D) Three ENaC subunits were expressed in the organoids derived from the colon of the mice but not in the Ileum (negative control).

Figure S14. Cell migration screen identified RhoB as a functional substrate of NEDD4L. Related to Figure 6. (A) Expression of NL.1 destabilizes RhoB but not Rac1. Western blot analysis of whole-cell extracts from HCT116 cells with Dox- inducible, stable expression of NL.1. In the top two panels, the blot was probed with antibodies detecting RhoB and Actin as control. In the bottom two panels, the blot was probed with antibodies detecting Rac1 and Actin as control. (B) RhoB is ubiquitinated by NEDD4L in vitro. Meanwhile, NL.1 stimulated the activity of NEDD4L. NEDD4L, NEDD4, and SMURF1WW(all)-HECT (pre-mixed for 15 min with or without NL.1) were incubated for 1 hour at room temperature with E1 (UBE1), E2 (UBE2L3), ATP, Ub, and GST-RhoB. Western blots were probed with an anti-RhoB antibody to detect mono- and poly-ubiquitinated RhoB.

65 Table S1. Human and yeast HECT E3 ligases. Related to Figure 1.

Name Domain Associated Diseases Notable Substrates Ubv Structure selection Human HECT E3s ITCH C2-WW-HECT Autoimmune diseases Notch, JunB, c-Jun Yes NEDD4 C2-WW-HECT Cancer RNA Pol-II, FGFR1, Cbl-b Yes NEDD4L C2-WW-HECT Liddle’s syndrome ENaC, Smad2/4, NCC Yes SMURF1 C2-WW-HECT Cancer RhoA, MEKK2, Smads Yes SMURF2 C2-WW-HECT Cancer SnoN, TGFβ receptor, Smads, RhoA Yes WWP1 C2-WW-HECT Cancer p53, KLF2/5 Yes WWP2 C2-WW-HECT Cancer PTEN, Notch3, Oct4 Yes HECW1 C2-WW-HECT N.A. DVL1, ERBB4 Yes HECW2 C2-WW-HECT N.A. p73 Yes HERC1 RLD-SPRY-WD40-HECT N.A. TSC2 Yes HERC2 RLD-ZnF-HECT Angelman-like diseases Claspin, USP33, NEURL4 Yes HERC3 RLD-HECT N.A. N.A. No HERC4 RLD-HECT N.A. N.A. Yes HERC5 RLD-HECT N.A. HIV-1 Gag (ISGylation) No HERC6 RLD-HECT N.A. N.A. Yes HACE1 Ankyrin repeat-HECT Cancer, Huntington disease Rac1, Optineurin Yes HUWE1 UBA-WWE-BH3-HECT Cancer p53, N-Myc, MCL-1 Yes UBE3A E6 binding-HECT Cancer, Angelman syndrome p53, Arc No UBE3B IQ-HECT Kaufman oculocerebrofacial syndrome N.A. No UBE3C IQ-HECT N.A. N.A. Yes EDD1 UBA-ZnF-PRBC-HECT Cancer TopBP1, Paip2, ATMIN Yes KIAA0317 Filamin-HECT N.A. N.A. Yes HECTD1 Ankyrin repeat-HECT N.A. PIPKIγ90, HSP90 Yes HECTD2 HECT N.A. N.A. No HECTD3 DOC-HECT Cancer Caspase-8, Tara No HECTD4 HECT N.A. N.A. No G2E3 PhD/RING-HECT N.A. N.A. No TRIP12 WWE-HECT Cancer ARF, Sox6 No Yeast HECT E3s Rsp5 C2-WW-HECT - Sna3, Sec23 Yes Hul4 HECT - N.A. No Hul5 HECT - cytosolic misfolded proteins No Tom1 HECT - Cdc6 No Ufd4 HECT - ubiquitin-fusion proteins No Table S2. Sequences of NEDD4 family HECT E3 Ubv binders. Related to Figure 1.

Region 1 Region 2 Region 3 Tail 2 4 6 8 9 10 11 12 14 42 44 46 47 48 49 62 63 64 66 68 70 71 72 73 74 75 76 77 78 Ub.WT Q F K L T G K T T R I A G K Q Q K E T H V L R L R G G * * NEDD4 (N4) Ubv.N4. 2 - - - M R R E S S - F T ------K - - P - R Q Y Ubv.N4. 4 - - - - A - W G ------R Y D Q - - G ------Ubv.N4. 5 - Y - - - R - - - - - V ------S Y ------NEDD4L (NL) Ubv.NL.1 R - R P - R - - - V - - - N R P - - - Y F M - - - - L E N Ubv.NL.2 - L - P - W Q - F V - H - - K H H - N Y F - K - P - L - D Ubv.NL.3 - - W - F R - P I ------Ubv.NL.4 Y Y W - F R ------A L ------ITCH (IT) Ubv.IT.2 H L - - R - - - - - L G - N K - - - N Y L - - R L - S K F Ubv.IT.3 - - I H - W R - - - L - R Q K - - D - - - - I R - V S K R Ubv.IT.4 ------L S - I - G - - R - - K S Y L M - - - - V S R Ubv.IT.6 P L Q - R - Q S I F - - R T H - - G - Y L - - F H - T V A SMURF1 (S1) Ubv.S1.1 H - - - - - R V - T L G - - - Y - V - Y L Y - - - - - E L Ubv.S1.2 - - Q Y - W E ------Q - P - Q S Y ------Ubv.S1.3 R - Q F - W - - - T ------V S Y M F - - - - R S S Ubv.S1.4 ------T L S - - - - Q V - Y L F - - - - L R H Ubv.S1.5 - - - - P - - S I T L - - - R - N G - Y M F ------SMURF2 (S2) Ubv.S2.1 - - - - - R - - - I V - - - S - - G S W K ------Ubv.S2.2 - - - P - R - S A I ------M Q I Y L R - - P R V H A Ubv.S2.3 - C - P - R - L N - L - - - - - Q - - Y - K ------Ubv.S2.4 L - W F K - N - - - - - R - - L - - - L - R ------Ubv.S2.5 - S - - S - - N - L - V - - N L - Y - Y L K G I - - R E K WWP1 (P1) Ubv.P1.1 H - - - R - W S - I - - R - K - E K S Y F - - - L R K S R Ubv.P1.2 E - - - S - - S - L L G - R - K Y - - S L F - - - - Y K V Ubv.P1.3 R S Y - P - - - K L - - - R ------M - - - - - K A K Ubv.P1.4 P L - - R - Q S I F - - R - H - - R - Y F - - F H - M V A WWP2 (P2) Ubv.P2.1 - - - F - W ------L N - - Y I - - - P - F S V Ubv.P2.2 L - - F K W I ------K N R S - - - - - P - - R R Ubv.P2.3 - L - F - W ------K M G S Y - - - - P - Q R I Ubv.P2.4 - L - - - L - - A - F V - - - H N - - Y A - - - P V N R L HECW1 (W1) Ubv.W1.1 - S - - - - L S - I - - S - K H - - I - L R - - P D S H T Ubv.W1.2 - L R - - R - - C ------G R - L K - - P W R R T Ubv.W1.3 T - - - R R T - - Q - G A - K K N Q S - L K K - L V T P L Ubv.W1.4 T - - - R R T - - Q - G A - K K N Q S - L K K - L V T P L HECW2 (W2) Ubv.W2.1 - V G - - - - P - L - - - - - R R Q I S - M - - - - D K P Ubv.W2.2 - L G ------N A I T F - - - - I M T V Ubv.W2.3 - V G - - - - P - L - - - - - R R Q I S - M - - - - D K P Ubv.W2.4 P I G ------N - N - S T - - - R H V V R N Rsp5 (R5) Ubv.R5.1 - L - P A ------T - - - - - V - - - K - - P P S V V Ubv.R5.2 R L - P - R - - N K - V - - P - - - - Y - F - - P V P R K Ubv.R5.3 - A - P - R Q ------K - - P - H S D Ubv.R5.4 - - - P - R - S S ------P - T I K Ubv.R5.5 H - - P - R - - I - - - - T - - N Y - - - R - - P - K S R Ubv.R5.6 - L - P L A - D R - - L - - - - - A N Y - R - - P - M K W Table S3. Sequences of other HECT Ubv binders. Related to Figure 1.

Region 1 Region 2 Region 3 Tail 2 4 6 8 9 10 11 12 14 42 44 46 47 48 49 62 63 64 66 68 70 71 72 73 74 75 76 77 78 Ub. WT Q F K L T G K T T R I A G K Q Q K E T H V L R L R G G * * HERC1 (H1) Ubv. H1.2 L - N F M R Y P - - - S - - - K ------Ubv. H1.3 - L - P M R - S ------H N K - - L V I - - A W S T HERC2 (H2) Ubv. H2.2 - R - - - - N S - - - - W - E K - W F ------N - Y Ubv. H2.3 H - S G A - V S I S F V - N R - - A - - M - - - L - M - Q HERC4 (H4) Ubv. H4.1 ------P I W S K Y Ubv. H4.2 - V ------Y - D - Y - - - F P Y P K Y Ubv. H4.3 D I - - N ------H - T I - - - - P P W A Y T Ubv. H4.4 ------V S Y - Y - P L W S T Q HERC6 (H6) Ubv.H6.1 K S E H S D - - I - F S - - - - R V R - - F ------HACE1 (HA) Ubv. HA.1 - - H - - - - I R - L R S - - L - - W R I ------Ubv. HA.2 - - - I - W H P ------H G - F - F T R - - R M V Ubv. HA.3 H - - - K - M G A ------G I - R - I - - V S R S HUWE1 (HU) Ubv. HU.1 - - V P G V - S ------Q K - F L - - T L - S I A Ubv. HU.2 H - - - P - - I ------V N N W - - I H - D F K UBE3C (3C) Ubv. 3C.2 H - - - I V Q I P - - - - - I L R D - Y L F ------Ubv. 3C.3 D - S - - V N - P ------W R L ------HECTD1 (D1) Ubv.D1.1 L C V V - - L - - G V - - M K - - - S - - V S - P V R S S Ubv.D1.2 - L R - - - - - R - - - - M R - G F P G - - - - L R V E L Ubv.D1.3 - - - V S - - - N G - - R - R - D - N - - - T - V - R N L Ubv.D1.4 A L - V - - N S - G L - R T R - - A - - - R T - - - T D T EDD1 (ED) Ubv. ED.3 S - I F - R - P - I - - - - K - - - S Y F - - - - - A K V Ubv. ED.7 - S V - - R P ------R D - - Q S - F F - - - - S V S KIAA0317 (KI) Ubv. KI.1 L - N R P W - - S I F G - - - P N K I - R - - P - I K R Q Ubv. KI.2 - - Q - M - D N S - - - D N - K - K H L L - - P - - Y R S Ubv. KI.3 - - - - I - Y - P ------C Q - N - A F P - P - D E E Ubv. KI.4 - - - F S - - Y - - T V A - - - - G A R I - Q R - - N H D Table S4. EC50 values of Ubvs binding to immobilized cognate HECT E3 ligases. Related to Figure 1.

Ubv EC50 95% Ubv inhibitors EC50 95% confidence Ubv EC50 (nM, 95% confidence modulators (nM, confidence (NEDD4 (nM, intervals (nM) (other HECT) mean) intervals (nM) (NEDD4 mean) intervals (nM) HECT) mean) HECT) Ubv.N4.2 6.7 5.43 to 8.29 Ubv.NL.3 15.6 14.78 to 16.44 Ubv.HA.1 68.7 65.49 to 72.08 Ubv.N4.4 57.5 48.73 to 67.80 Ubv.NL.4 18.5 16.87 to 20.38 Ubv.HA.2 7.0 6.72 to 7.36 Ubv.N4.5 20.8 16.30 to 26.44 Ubv.IT.2 2 1.50 to 2.73 Ubv.HA.3 4.7 4.36 to 5.02 Ubv.NL.1 0.7 0.61 to 0.76 Ubv.IT.3 3.9 3.49 to 4.44 Ubv.HU.1 11.9 10.30 to 13.66 Ubv.NL.2 0.5 0.49 to 0.54 Ubv.IT.4 2.8 2.32 to 3.43 Ubv.HU.2 135.2 124.8 to 146.4 Ubv.P2.1 5.7 4.48 to 7.27 Ubv.IT.6 11.4 10.20 to 12.64 Ubv.H1.2 2.7 2.59 to 2.87 Ubv.P2.2 111.8 95.29 to 131.1 Ubv.S1.1 5.5 5.03 to 6.04 Ubv.H1.3 1.5 1.44 to 1.61 Ubv.P2.3 4.9 4.56 to 5.27 Ubv.S1.2 0.3 0.28 to 0.34 Ubv.H2.2 29.2 27.56 to 31.02 Ubv.P2.4 755.7 376.1 to 1519 Ubv.S1.3 0.2 0.16 to 0.21 Ubv.H2.3 404.6 368.1 to 444.7 Ubv.R5.1 1.9 1.71 to 2.05 Ubv.S1.4 3.4 2.72 to 4.17 Ubv.H4.1 14.8 9.15 to 23.85 Ubv.R5.2 0.4 0.37 to 0.44 Ubv.S1.5 10.7 9.45 to 12.22 Ubv.H4.2 26.6 18.12 to 38.99 Ubv.R5.3 1.6 1.53 to 1.74 Ubv.S2.1 55.8 50.84 to 61.16 Ubv.H4.3 4.8 3.16 to 7.24 Ubv.R5.4 0.7 0.67 to 0.77 Ubv.S2.2 9.62 8.84 to 10.46 Ubv.H4.4 12.2 8.47 to 17.46 Ubv.R5.5 0.8 0.70 to 0.84 Ubv.S2.3 48.9 43.65 to 54.70 Ubv.H6.1 254 236.7 to 272.6 Ubv.R5.6 7.1 6.66 to 7.64 Ubv.S2.4 3.9 3.68 to 4.20 Ubv.3C.2 12.1 10.86 to 13.52 Ubv.S2.5 12.7 11.73 to 13.82 Ubv.3C.3 0.5 0.47 to 0.52 Ubv.P1.1 0.7 0.64 to 0.73 Ubv.ED.3 1.6 1.50 to 1.63 Ubv.P1.2 44.7 41.65 to 47.87 Ubv.ED.7 14.0 12.58 to 15.47 Ubv.P1.3 6.3 5.77 to 6.80 Ubv.D1.1 23.2 21.25 to 25.21 Ubv.P1.4 2.6 2.46 to 2.67 Ubv.D1.2 10.1 9.14 to 11.04 Ubv.W1.1 1.0 0.99 to 1.08 Ubv.D1.3 6.8 6.01 to 7.80 Ubv.W1.2 0.75 0.71 to 0.79 Ubv.D1.4 2.3 1.97 to 2.61 Ubv.W1.3 2.3 2.03 to 2.54 Ubv.KI.1 165.3 152.5 to 179.2 Ubv.W1.4 1.7 1.59 to 1.75 Ubv.KI.2 160.7 146.9 to 175.7 Ubv.W2.1 3.6 3.49 to 3.79 Ubv.KI.3 30.4 28.96 to 31.86 Ubv.W2.2 1.1 1.06 to 1.21 Ubv.KI.4 299 276.2 to 323.6 Ubv.W2.3 4.8 4.25 to 5.41 Ubv.W2.4 13.9 12.38 to 15.61

Note: In the figures, data are represented as mean ± S.D. of three independent experiments. Table S5. Binding affinities of HECT domain and Ubvs. Related to Figure 1. Ligands Analytes KD Ligands Analytes KD Ub 141.2 ± 15.5 µM Ub 181.9 ± 14.6 µM NL.1 9.7 ± 1.9 nM S1.3 3.2 ± 0.8 µM NL.2 30.7 ± 7.0 nM S1.4 1.2 ± 0.2 µM SMURF2HECT NEDD4LHECT 841.0 ± 94.6 nM, S1.5 1.1 ± 0.1 µM NL.3 (16.6 ± 7.6 µM)* S2.4 420.1 ± 39.2 nM

NL.4 817.2 ± 104.0 nM, S2.5 471.2 ± 27.7 nM

(12.1 ± 6.9 µM)* Ub 112.2 ± 19.2 µM N4.2 9.3 ± 0.8 µM IT.2 11.8 ± 1.3 µM ITCHHECT N4.4 53.1 ± 6.8 µM IT.3 23.4 ± 3.6 µM N4.5 5.0 ± 0.8 µM IT.4 1.7 ± 0.2 µM Ub 183.6 ± 42.4 µM Ub 185.7 ± 28.8 µM NL.1 212.2 ± 55.4 nM HACE1HECT HA.2 284.9 ± 36.9 nM NL.2 229.9 ± 83.7 nM HA.3 575.5 ± 106.0 nM HECT NEDD4 NL.3 6.0 ± 1.0 µM Ub 532.9 ± 180.7 µM

NL.4 11.8 ± 4.5 µM 117.7 ± 61.8 nM, HUWE1HECT HU.1 N4.2 4.2 ± 0.4 µM (2.96 ± 5.56 µM)* N4.4 93.2 ± 10.4 µM HU.2 78.9 ± 8.9 nM N4.5 9.2 ± 2.3 µM Ub 141.4 ± 5.2 µM Ub 274.0 ± 35.2 µM R5.1 319.1 ± 28.3 nM WWP1HECT P1.1 322.9 ± 60.3 nM R5.2 59.3 ± 6.5 nM

P1.3 134.6 ± 23.3 nM Rsp5HECT R5.3 68.2 ± 5.0 nM P2.1 244.5 ± 40.7 nM R5.4 125.9 ± 14.7 nM

P2.3 232.0 ± 49.0 nM R5.5 342.7 ± 75.7 nM Ub 350.5 ±78.2 µM R5.6 26.1 ± 5.4 nM *: Second binding affinities provided in P1.1 1.6 ± 0.1 µM parentheses. HECT WWP2 P1.3 no binding P2.1 104.5 ±19.1 nM P2.3 78.5 ±15.5 nM

Table S6. List of constructs used in this study. Related to Experimental Procedures.

Constructs and expression tag Descriptions Used for HECT E3 NEDD4L residues 529-955 were cloned into pET28-MHL and Avi-tag was added to His-NEDD4LHECT-Avi Ubv selection and ELISA the C-term for in vivo biotinylation to facilitate protein immobilization His-SMURF1HECT-Avi SMURF1 residues 340-753 were cloned into pET28a-LIC and modified as above Ubv selection and ELISA His-SMURF2HECT-Avi SMURF2 residues 369-748 were cloned into pET28-MHL and modified as above Ubv selection ELISA WWP2 residues 486-866 were cloned into pET28-MHL and Avi-tag was added to His-WWP2HECT-Avi Ubv selection and ELISA the C-term for in vivo biotinylation to facilitate protein immobilization His-HECW1HECT-Avi HECW1 residues 1226-1601 were cloned into pET28a-LIC and modified as above Ubv selection and ELISA His-HECW2HECT-Avi HECW2 residues 1190-1572 were cloned into pET28-MHL and modified as above Ubv selection and ELISA His-HERC1HECT-Avi HERC1 residues 4480-4861 were cloned into pET28a-LIC and modified as above Ubv selection and ELISA His-HERC2HECT-Avi HERC2 residues 4459-4834 were cloned into pET28a-LIC and modified as above Ubv selection and ELISA His-HERC4HECT-Avi HERC4 residues 669-1057 were cloned into pET28a-LIC and modified as above Ubv selection and ELISA His-HERC6HECT-Avi HERC6 residues 629-1022 were cloned into pET28a-LIC and modified as above Ubv selection and ELISA His-HACE1HECT-Avi HACE1 residues 420-909 were cloned into pET28-MHL and modified as above Ubv selection and ELISA His-HUWE1HECT-Avi HUWE1 residues 3940-4374 were cloned into pET28a-LIC and modified as above Ubv selection and ELISA His-UBE3AHECT-Avi UBE3A residues 518-875 were cloned into pET28-MHL and modified as above ELISA His-UBE3CHECT-Avi UBE3C residues 690-1079 were cloned into pET28-MHL and modified as above Ubv selection and ELISA His-EDD1HECT-Avi EDD1 residues 2383-2799 were cloned into pET28-MHL and modified as above Ubv selection and ELISA His-KIAA0317HECT-Avi KIAA0317 residues 428-823 were cloned into pET28-MHL and modified as above Ubv selection and ELISA His-HECTD1HECT-Avi HECTD1 residues 2106-2610 were cloned into pET28-MHL and modified as above Ubv selection and ELISA WWP1 residues 1-922 cloned into pGEX-4T1 which thrombin cleavage site was Ubv selection ELISA, GST-TEV-WWP1FL replaced by TEV cleavage sequence. and biochemical assays GST-TEV-NEDD4FL NEDD4 residues 1-900 (UniProt: P46934-4) cloned as above Biochemical assays GST-TEV-HACE1FL HACE1 residues 1-909 cloned as above Biochemical assays GST-SMURF1ΔC2 Gift from Dr. Abiodun Ogunjimi Biochemical assays GST-TEV-Rsp5FL RSP5 residues 1-809 cloned as above Ubv selection and ELISA His-SMURF2HECT SMURF1 residues 340-753 were cloned into pET28a-LIC Biochemical assays GST-WWP2FL WWP2 residues 1-870 cloned into pGEX-4T1 Biochemical assays His-HECW1HECT HECW1 residues 1226-1601 were cloned into pET28a-LIC Biochemical assays His-HECW2HECT HECW2 residues 1190-1572 were cloned into pET28-MHL Biochemical assays His-HERC1HECT HERC1 residues 4480-4861 were cloned into pET28a-LIC Biochemical assays His-HERC2HECT HERC2 residues 4459-4834 were cloned as above Biochemical assays His-HERC4HECT HERC4 residues 669-1057 were cloned as above Biochemical assays His-HERC6HECT HERC6 residues 629-1022 were cloned as above Biochemical assays His-HUWE1HECT HUWE1 residues 3940-4374 were cloned as above Biochemical assays His-UBE3CHECT UBE3C residues 690-1079 were cloned into pET28-MHL Biochemical assays His-EDD1HECT EDD1 residues 2383-2799 were cloned as above Biochemical assays His-KIAA0317HECT KIAA0317 residues 428-823 were cloned as above Biochemical assays His-HECTD1HECT HECTD1 residues 2106-2610 were cloned as above Biochemical assays GST-TEV-NEDD4LFL NEDD4L residues 1-911 (Uniprot: Q96PU5-2) cloned as above Biochemical assays GST-TEV-NEDD4LWW(all)-HECT D639A mutated from GST-TEV-NEDD4LWW(all)-HECT Biochemical assays D639A GST-TEV-NEDD4LWW(proximal)-HECT NEDD4L residues 487-911 cloned as above Biochemical assays GST-TEV-NEDD4LWW(proximal)-HECT D639A mutated from GST-TEV-NEDD4LWW(proximal)-HECT Biochemical assays D639A Biochemical assays, GST-TEV-NEDD4LHECT NEDD4L residues 532-911 cloned as above Octet and crystallization Biochemical assays and GST-TEV-NEDD4HECT NEDD4 residues 527-900 cloned as above Octet GST-TEV-WWP1WW(all)-HECT WWP1 residues 349-922 cloned as above Biochemical assays GST-TEV-WWP1WW(all)-HECT D607A D607A mutated from GST-TEV-WWP1WW(all)-HECT Biochemical assays GST-TEV-WWP1WW(proximal)-HECT WWP1 residues 495-922 cloned as above Biochemical assays Biochemical assays and GST-TEV-WWP1HECT WWP1 residues 537-922 cloned as above Octet GST-TEV-WWP1HECT D607A D607A mutated from GST-TEV-WWP1HECT Biochemical assays

HECT GST-TEV-WWP1 Δ5 WWP1 residues 537-917 cloned as above Crystallization Biochemical assays and GST-TEV-WWP2HECT WWP2 residues 485-870 cloned as above Octet GST-TEV-Rsp5WW3-HECT Rsp5 residues 383-809 cloned as above Biochemical assays Biochemical assays and GST-TEV-Rsp5HECT Rsp5 residues 432-809 cloned as above Octet Biochemical assays and GST-TEV-ITCHHECT Mouse ITCH residues 486-864 cloned as above Octet Biochemical assays and GST-TEV-SMURF2HECT SMURF2 residues 369-748 cloned as above Octet Biochemical assays and GST-TEV-HUWE1HECT HUWE1 residues 4005-4374 cloned as above Octet Biochemical assays and GST-TEV-HACE1HECT HACE1 residues 506-909 cloned as above Octet Full-length WWP2 was sub-cloned into Myc-tagged Gateway destination vectors Myc-WWP2 Cellular assays using standard methods HACE1 cDNA from pKH3-HACE1 was sub-cloned BamHI-EcoRI in pRK5-myc- Myc-HACE1 Cellular assays HACE1 Full length NEDD4L was sub-cloned into Myc-tagged Gateway destination vectors Myc-NEDD4L Cellular assays using standard methods His-TEV-NEDD4HECT NEDD4 residues 520-900 were cloned into pET28-MHL vector Crystallization His-TEV-ITCHHECT ITCH residues 483-862 were cloned into pET28-MHL vector Crystallization

Ubiquitin and variants 69 Ubvs were cloned into Gateway Entry vector pDONR221 by PCR as N-terminal Entry clone for sub- Flag-Ubv Flag tagged cloning 69 Ubvs were cloned into Gateway destination vector pET53 as N-terminal His and ELISA and biochemical His-Flag-Ubv Flag tagged assays Ub was cloned into pGEX-4T1 as above with a GSGGS linker sequence between GST-TEV-Ub Biochemical assays TEV and Ub. Biochemical assays and Untagged Ub Human ubiquitin clone is a gift from Cecil Pickart. Octet His-1Cys Ub Cysteine was inserted in front of Met1 for labeling fluorescent probe. Biochemical assays Biochemical assays, His-Ubv 29 Ub variants were cloned into pET15d or pRSF-duet with N-terminal His -tag. 6 Octet and crystallization His-N4.4 N4.4 Ubv fused with N-terminal His-tag were cloned into pET53 Crystallization His-IT.2 IT.2 Ubv fused with N-terminal His-tag were cloned into pNIC-CH Crystallization Ubv P1.1 was cloned into pGEX-4T1 as above with a GSGGS linker sequence GST-TEV-P1.1 Crystallization between TEV and Ubv. Ubv P2.3 was cloned into pGEX-4T1 as above with a GSGGS linker sequence GST-TEV-P2.3 Crystallization between TEV and Ubv. HA-Ub Gift from R. Baer Cellular assays His-Ub Ub was cloned as pRBG4-His6-ubiquitin (pCW7), Cellular assays Flag-Ub Ub was cloned into pcDNA3.1/nFlag-DEST Cellular assays Flag-P2.1 P2.1 was cloned as above Cellular assays Flag-P2.3 P2.3 was cloned as above Cellular assays Flag-HA.1 HA.1 was cloned as above Cellular assays Flag-HA.2 HA.2 was cloned as above Cellular assays Flag-HA.3 HA.3 was cloned as above Cellular assays V5-NL.1 NL.1 was cloned into the lentiviral vector pLVE/Zeo Cellular assays V5-NL.3 NL.3 was cloned into the lentiviral vector pLVE/Zeo Cellular assays 84 Ubvs (54 HECT Ubvs and 30 other Ubvs) were cloned into Gateway destination ZsGreen-Flag-Ubv Lentiviral screen lentiviral vector pLD-puro-TnZsGreen Flag-NL.1 (transient expression) NL.1 was cloned into pcDNA3.1/nFlag-DEST Cellular assays Flag-NL.1 (stable expression) NL.1 was cloned into pDEST-5'3x-FLAG-pcDNA5-FRT/TO Cellular assays

Fused sequence with C-terminal His -tag was cloned into pRSF-duet. Met1 of SUMO2-GG-UBCH5B-His 6 Biochemical assays UBCH5B (UBE2D2) is not included. Fused sequence with C-terminal His -tag was cloned into pRSF-duet. Met1 of Biochemical assays and SUMO2-GG-UBCH7-His 6 UBCH7 (UBE2L3) is not included. crystallization

E1 Human UBA1 His-tagged UBA1 clone is a gift from Cynthia Wolberger. Biochemical assays

Substrate Human WBP2 cloned into pRSF-duet with N-terminal His-MBP expression tag and His-MBP-TEV-WBP2 Biochemical assays TEV cleavage sequence. Human WBP2 169-256 (named S-WBP2-1K, S stands for short) cloned into pRSF- MBP-TEV-HisCys-S-WBP2 -1K Biochemical assays duet with MBP expression tag. Synthesized Sna3 peptide (104-128) with N-terminal biotinylation and C-terminal Biotin-Sna3 peptide Biochemical assays carboxylation. Synthesized Sna4 peptide (126-140) with N-terminal biotinylation and C-terminal Biotin-Sna4 peptide Biochemical assays carboxylation. Full-length PTEN was cloned into an S-protein/Flag/SBPtriple-tagged destination PTEN Cellular assays vector using the Gateway cloning system (Invitrogen) HA-Rac1-Q61L Rac1-Q61L was cloned as pXJ-HA-Rac1-Q61L Cellular assays GST-RhoB Gift from H. Wang Cellular assays Flag-RhoB Gift from H. Wang Cellular assays