DOCSLIB.ORG

Caffeine Metabolism and Cytochrome P450 Enzyme Mrna Expression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Caffeine Metabolism and Cytochrome P450 Enzyme Mrna Expression Caffeine metabolism and Cytochrome P450 enzyme mRNA expression levels of genetically diverse inbred mouse strains Neal Addicott - CSU East Bay, Michael Malfatti - Lawrence Livermore National Laboratory, Gabriela G. Loots - Lawrence Livermore National Laboratory Metabolic pathways for caffeine 4. Results 1. Introduction (in mice - human overlaps underlined) Metabolites 30 minutes after dose Caffeine is broken down in humans by several enzymes from the Cytochrome Caffeine (1,3,7 - trimethylxanthine) O CH3 (n=6 per strain) CH3 6 N Paraxanthine/Caffeine N 7 Theophylline/Caffeine *Theobromine/Caffeine P450 (CYP) superclass of enzymes. These CYP enzymes are important in Theophylline 1 5 0.06 0.06 0.06 8 (7-N-demethylization) (1,3 - dimethylxanthine) 2 4 9 3 O N 0.05 0.05 0.05 activating or eliminating many medications. The evaluation of caffeine O H N 1,3,7 - trimethyluricacid CH 3 O CH3 N CH eine Peak Area Peak eine eine Peak Area eine Cyp1a2 3 CH 0.04 Area Peak eine 0.04 0.04 f f N f metabolites in a patient has been proposed as a means of estimating the activity 1 7 3 (3-N-demethylization) N Cyp3a4 N1 7 (8-hydrolyzation) 8 OH 0.03 0.03 0.03 of some CYP enzymes, contributing to genetics-based personalized medicine. O 3 N N Cyp1a2 3 O N Paraxanthine (1-N-demethylization) N 0.02 0.02 0.02 CH3 (1,7 - dimethylxanthine) CH3 O CH3 0.01 0.01 0.01 CH3 Theophylline Peak Area / Ca Peak Theophylline Paraxanthine Peak Area / Ca The frequency and distribution of polymorphisms in inbred strains of mice N Area / Ca Peak Theobromine 7 paraxanthine peak area /caffeine peak area /caffeine paraxanthine peak area theophylline peak area /caffeine peak area /caffeine theophylline peak area N1 Theobromine 0 0 peak area /caffeine peak area theobromine 0 0 C57BL/6JC57BL BALB/cJBALB CBA/JCBA/J DBA/2JDBA/2J . 0 C57BL BALB CBA/J DBA/2J . 0 C57BL BALB CBA/J . (3,7 - dimethylxanthine) C57BL/6J BALB/cJ CBA/J DBA/2J C57 BALB CBA DBA often mirrors the variety in genotypes found in human populations. 3,6,8-trimethylallantoin *While retention times were similar, not all sample peaks O CH 3 3 Mouse Strain Mouse Strain Mouse Strain O N were recognized as theobromine by the HPLC software. N H Mouse Strain N N 7 (error bars represent a 90% confidence interval using Student's t = 2.015) H 1 Nat1 • The DBA/2J strain may be a slow metabolizer by a significant amount. • rtPCR (not a quantitative method) did not ? Nat2 3 This project hopes to determine whether four inbred strains have enough inter- O N Nat3 N Xdh Other time points besides 30 minutes after dose may be able to confirm. reveal any obvious inter-strain differences in Cyp1a2 CH3 • The BALB/cJ strain metabolized caffeine into theophylline by a significantly gene expression (no strains are null for a gene). strain differences in both their metabolite phenotypes and expression of mouse AFMU 3,7-dimethyluricacid larger amount than other strains. BALB/cJ's paraxanthine level was not * See "sample gel electrophoresis" figure. Cyp1a2 Xdh significantly greater than C57BL/6J or CBA/J, but significant differences may CYP enzymes to support additional investigations. spontaneous Cyp2a12 7-methylxanthine arise through additional sampling or at other time points. • qPCR data is still pending as of 8/4/2011. Cyp2a4 Xdh • While the theobromine levels appear reliable within each strain, the Cyp2a5 AAMU amounts detected are close to the limits of the device's detection range and 2. Background 1-methylxanthine 7-methyluricacid should not be weighted too heavily in the consideration of the data. Xdh Elimination Routes for Top 200 Prescribed Drugs Relative CYP strengths metabolizing caffeine in human liver microsomes 1-methyluricacid Primary Principal P450 Involved Elimination Route Hepatic Pathway in Metabolism 100 Pathway Preference of human CYP Enzymes for caffeine catalysis 1,7-dimethyluricacid Adapted from: http://www.genome.jp/kegg-bin/show_pathway? 5. Discussion 1-N-demethylation CYP1A2 > CYP2D6 > CYP2C8 > CYP2C19 > CYP3A5 9% This work represents the first steps of a larger investigation, and the BALB/cJ and 75 3-N-demethylation CYP1A2 > CYP3A4 > CYP2C9 > CYP2C8 > CYP2D6 > CYP2E1 Cytochrome P450 Enzymes 75% DBA/2J strains have emerged as candidate model organisms for human CYP 70% 7-N-demethylation CYP1A2 > CYP2D6 > CYP2C9 > CYP2E1 > CYP2A6 > CYP3A5 polymorphisms detectable by caffeine metabolite levels. In the next stage, eleven 50 % C-8-hydroxylation CYP1A2 > CYP2B6 > CYP2E1 > CYP2D6 > CYP2C18 > CYP3A4 additional mouse strains will be examined for mRNA expression levels. (Source: Kot and Daniel. 2008) 37% 25 CYP1A2 is the primary enzyme responsible for caffeine metabolism in mice and While paraxanthine was expected to be the primary metabolite, after thirty minutes humans - eliminating 87% of caffeine at normal concentrations in mice3. 0 theophylline was detected at similar levels. Data will need to be collected two hours 0 1 2 3 4 5 6 7 8 9 10 CYP2A6, CYP2E1, and CYP3A4 have been shown to play a role in caffeine Hepatic (liver) P450X Axis CYP1A2 metabolism in humans, and in wild-type mice the orthologous genes are after injection for a closer comparison to published paraxanthine/caffeine ratios. A (figure adapted from Zanger et. al. 2008) CYP3A4/5 expressed in similar patterns4 but may not have the exact same roles in caffeine Image from: http://en.wikipedia.org/wiki/File:CytP450Oxidase-1OG2.png 1,3,7-Trimethyluric acid standard will be prepared and checked against existing Several polymorphic CYP proteins outside of this metabolism. Rat caffeine metabolism has significantly different characteristics. study's scope have already been characterized in chromatogram data. A small peak near theobromine is a likely possibility. CYP % of CYP in human liver Orthologous CYP in mouse Caucasian populations with enough detail to warrant Overall process of project clinical dosing decisions based on CYP genotype1. The CYP1A2 15-18% Cyp1a2 Overall process of project Identified candidate mouse strains will have their mRNA sequences determined to Inject mouse current understanding of CYP1A2 and CYP3A4/5 CYP2A6 6-17% Cyp2a5 Collect more carefully characterize polymorphisms that could influence catalytic activity. genetics still needs more development before being with caffeine (Plasma) CYP2E1 9% Cyp2e1 Blood applied to personalized medicine. Caffeine metabolism CYP3A4 18-40% Cyp3a11 (specifically Paraxanthine/Caffeine ratios) serves as a Analyze plasma for caffeine/ 2 (Source: Hrycay and Bandiera 2009 clinically recognized indicator of CYP1A2 activity . Wait 30 metabolites with HPLC Check for statistical References minutes correlation between 1. Zanger U, Turpeinen M, Klein K, and Schwab M. Functional pharmacogenetics/genomics of human 3. Methods Check for mRNA gene expression cytochromes P450 involved in drug biotransformation. Analytical and Bioanalytical Chemistry 2008; 392: expression with rtPCR and metabolism 1093-1108. 100 Representation of a typical Chromatogram Result Protocol for HPLC Samples Product 2. Fuhr U, Rost K, Engelhardt R, Sachs M, Liermann D, Belloc C, Beaune P, Janezic S, Grant D, Meyer U, and 1 Forward Primer (+) Reverse Primer (-) Collect Liver and Gene Length (bp) 0.9 Quantify mRNA Images from: Staib A. Evaluation of caffeine as a test drug for CYP1A2, NAT2, and CYP2E1 phenotyping in man by in vivo 80 Solvent B (Organic) http://ohioline.osu.edu/vme-fact/0023.html 0.8 Brain tissue http://www.flickr.com/photos/_intellinuts_/212714053/ 5' AGAGGTTGGCCACTTCGAACCA 3' 5' TCCTCTGCACGTTAGGCCATGT 3' non-polar Cyp1a2 495 http://www.flickr.com/photos/fiddledydee/3267271237/ versus in vitro correlations. Pharmacogenetics 1996; 6, 159-176. 0.7 expression with qPCR Caffeine 60 0.6 er A 5' ACCGTTGCCTTGCTTGTCTGGA 3' 5' AAACCTCCGCACGTCCTTCCAT 3' 3. Buters J, Tang B, Pineau T, Gelboin H, Kimura S, and Gonzalez F. Role of CYP1A2 in caffeine f Cyp2e1 366 0.5 % Bu 40 0.4 pharmacokinetics and metabolism: studies using mice deficient in CYP1A2. Pharmacogenetics 1996; 6: 291-296. % Buffer A % Buffer NAT2 5'AAGACCGGGAGAGAACAGCACAAC3' 5'TAGCCCGTATCTGGTGCTGAAGGA3' 223 Solvent A (Aqueous) 0.3 Sample gel electrophoresis of rtPCR products Absorbance Unit (AU) at 277nm 4. Hrycay EG, and Bandiera SM. Expression, function and regulation of mouse Cytochrome P450 Enzymes: 20 polar 0.2 Paraxanthine Theophylline Cyp3a11 5'ACAAACAAGCAGGGATGGACCTGG3' 5'TGTGACAGCAAGGAGAGGCGTTT3' 269 0.1 Comparison with Human Cytochrome P450 Enzymes. Current Drug Metabolism 2009; 10: 1151-1183. Absorbance Units (AU) at 277nm Absorbance 0 0 10 11 12 13 14 15 16 17 18 19 20 21 0 5 10 15 20 25 30 35 40 Cyp2a5 5' GCTTCGAATGATGCTGGGAAGCT 3' 5' AACAGAAAGCCATAGCGCAGGG 3' 345 5. Kot M, and Daniel W. The relative contribution of human cytochrome P450 isoforms to the four caffeine Time (minutes) Time from sample injection (min) Time from sample injection (min) Time from injection (minutes) oxidation pathways:An in vitro compareative study with cDNA-expressed P450s including CYP2C isoforms . High Performance Liquid Chromatography (HPLC) Reverse Transcriptase Polymerase Chain Reaction (rtPCR) and Biochemical Pharmacology 2008; 76: 543-551. • Blood sample was centrifuged to isolate plasma Quantitative Real Time Polymerase Chain Reaction (qPCR) • Proteins were precipitated using 100% Methanol (200 !l of MeOH + 100 !l plasma) • Tissue Samples were preserved after collection in 3ml of RNALater® and stored at -4°C • Protein-free precipitate was evaporated and reconstituted in 50!l 10% Methanol • ~30mg of tissue was homogenized in TRIzol and purified to total mRNA using • 40!l of reconstituted sample was injected into HPLC device. QIAGEN RNeasy columns and reagents. Yield ranged from 1.2-4.0 !g mRNA/!l water. C57BL/6J BALB/cJ CBA/J DBA/2J C57BL/6J BALB/cJ CBA/J DBA/2J C57BL/6J BALB/cJ CBA/J DBA/2J Acknowledgements C57BL/6J BALB/cJ CBA/J DBA/2J Non-polar compounds are attracted to the analytical column and take longer to reach the • Total cDNA for each sample was made using Invitrogen's SuperScript™ First-Strand C57BL/6J BALB/cJ CBA/J DBA/2J detector.
Load more

Recommended publications
  • NIH Public Access Author Manuscript Pharmacogenet Genomics
    NIH Public Access Author Manuscript Pharmacogenet Genomics. Author manuscript; available in PMC 2013 February 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Pharmacogenet Genomics. 2012 February ; 22(2): 159–165. doi:10.1097/FPC.0b013e32834d4962. PharmGKB summary: very important pharmacogene information for cytochrome P450, family 2, subfamily C, polypeptide 19 Stuart A. Scotta, Katrin Sangkuhlc, Alan R. Shuldinere,f, Jean-Sébastien Hulotb,g, Caroline F. Thornc, Russ B. Altmanc,d, and Teri E. Kleinc aDepartment of Genetics and Genomic Sciences bCardiovascular Research Center, Mount Sinai School of Medicine, New York, New York cDepartments of Genetics dBioengineering, Stanford University, Stanford, California eDivision of Endocrinology, Diabetes and Nutrition, University of Maryland School of Medicine fGeriatric Research and Education Clinical Center, Veterans Administration Medical Center, Baltimore, Maryland, USA gDepartment of Pharmacology, Université Pierre et Marie Curie-Paris 6, INSERM UMR S 956, Pitié-Salpêtrière University Hospital, Paris, France Abstract This PharmGKB summary briefly discusses the CYP2C19 gene and current understanding of its function, regulation, and pharmacogenomic relevance. Keywords antidepressants; clopidogrel; CYP2C19*17; CYP2C19*2; CYP2C19; proton pump inhibitors; rs4244285 Introduction The cytochrome P450, family 2, subfamily C, polypeptide 19 (CYP2C19) gene is located within a cluster of cytochrome P450 genes (centromere-CYP2C18-CYP2C19-CYP2C9- CYP2C8-telomere) on chromosome 10q23.33. The CYP2C19 enzyme contributes to the metabolism of a large number of clinically relevant drugs and drug classes such as antidepressants [1], benzodiazepines [2], mephenytoin [3], proton pump inhibitors (PPIs) [4], and the antiplatelet prodrug clopidogrel [5]. Similar to other CYP450 genes, inherited genetic variation in CYP2C19 and its variable hepatic expression contributes to the interindividual phenotypic variability in CYP2C19 substrate metabolism.
    [Show full text]
  • Identification and Characterization of CYP2C18 in the Cynomolgus Macaque (Macaca Fascicularis)
    NOTE Toxicology Identification and Characterization of CYP2C18 in the Cynomolgus Macaque (Macaca fascicularis) Yasuhiro UNO1)*, Kiyomi MATSUNO1), Chika NAKAMURA1), Masahiro UTOH1) and Hiroshi YAMAZAKI2) 1)Pharmacokinetics and Bioanalysis Center (PBC), Shin Nippon Biomedical Laboratories (SNBL), Kainan, Wakayama 642–0017 and 2)Laboratory of Drug Metabolism and Pharmacokinetics, Showa Pharmaceutical University, Machida, Tokyo 194–8543, Japan (Received 3 August 2009/Accepted 15 September 2009/Published online in J-STAGE 25 November 2009) ABSTRACT. The macaque is widely used for investigation of drug metabolism due to its evolutionary closeness to the human. However, the genetic backgrounds of drug-metabolizing enzymes have not been fully investigated; therefore, identification and characterization of drug-metabolizing enzyme genes are important for understanding drug metabolism in this species. In this study, we isolated and char- acterized a novel cytochrome P450 2C18 (CYP2C18) cDNA in cynomolgus macaques. This cDNA was highly homologous (96%) to human CYP2C18 cDNA. Cynomolgus CYP2C18 was preferentially expressed in the liver and kidney. Moreover, a metabolic assay using cynomolgus CYP2C18 protein heterologously expressed in Escherichia coli revealed its activity toward S-mephenytoin 4’-hydrox- ylation. These results suggest that cynomolgus CYP2C18 could function as a drug-metabolizing enzyme in the liver. KEY WORDS: cloning, CYP2C18, cytochrome P450, liver, monkey. J. Vet. Med. Sci. 72(2): 225–228, 2010 Cytochrome P450 (CYP) is a superfamily of some of the Such species differences also could be explained by func- most important drug-metabolizing enzymes and consists of tional disparity of the orthologous CYPs between the two a large number of subfamilies [14]. In humans, the CYP2C species, such as, if an ortholog to human CYP with low (or subfamilies contain important enzymes that metabolize no) expression and drug-metabolizing activity, for example approximately 20% of all prescribed drugs [3].
    [Show full text]
  • Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid
    Comprehensive Summaries of Uppsala Dissertations from the Faculty of Pharmacy 231 _____________________________ _____________________________ Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid Cloning, Expression and Catalytic Properties of CYP4F8 and CYP4F21 BY JOHAN BYLUND ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2000 Dissertation for the Degree of Doctor of Philosophy (Faculty of Pharmacy) in Pharmaceutical Pharmacology presented at Uppsala University in 2000 ABSTRACT Bylund, J. 2000. Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid: Cloning, Expression and Catalytic Properties of CYP4F8 and CYP4F21. Acta Universitatis Upsaliensis. Comprehensive Summaries of Uppsala Dissertations from Faculty of Pharmacy 231 50 pp. Uppsala. ISBN 91-554-4784-8. Cytochrome P450 (P450 or CYP) is an enzyme system involved in the oxygenation of a wide range of endogenous compounds as well as foreign chemicals and drugs. This thesis describes investigations of P450-catalyzed oxygenation of prostaglandins, linoleic and arachidonic acids. The formation of bisallylic hydroxy metabolites of linoleic and arachidonic acids was studied with human recombinant P450s and with human liver microsomes. Several P450 enzymes catalyzed the formation of bisallylic hydroxy metabolites. Inhibition studies and stereochemical analysis of metabolites suggest that the enzyme CYP1A2 may contribute to the biosynthesis of bisallylic hydroxy fatty acid metabolites in adult human liver microsomes. 19R-Hydroxy-PGE and 20-hydroxy-PGE are major components of human and ovine semen, respectively. They are formed in the seminal vesicles, but the mechanism of their biosynthesis is unknown. Reverse transcription-polymerase chain reaction using degenerate primers for mammalian CYP4 family genes, revealed expression of two novel P450 genes in human and ovine seminal vesicles.
    [Show full text]
  • Cholesterol Metabolites 25-Hydroxycholesterol and 25-Hydroxycholesterol 3-Sulfate Are Potent Paired Regulators: from Discovery to Clinical Usage
    H OH metabolites OH Review Cholesterol Metabolites 25-Hydroxycholesterol and 25-Hydroxycholesterol 3-Sulfate Are Potent Paired Regulators: From Discovery to Clinical Usage Yaping Wang 1, Xiaobo Li 2 and Shunlin Ren 1,* 1 Department of Internal Medicine, McGuire Veterans Affairs Medical Center, Virginia Commonwealth University, Richmond, VA 23249, USA; [email protected] 2 Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Fudan University, Shanghai 200032, China; [email protected] * Correspondence: [email protected]; Tel.: +1-(804)-675-5000 (ext. 4973) Abstract: Oxysterols have long been believed to be ligands of nuclear receptors such as liver × recep- tor (LXR), and they play an important role in lipid homeostasis and in the immune system, where they are involved in both transcriptional and posttranscriptional mechanisms. However, they are increas- ingly associated with a wide variety of other, sometimes surprising, cell functions. Oxysterols have also been implicated in several diseases such as metabolic syndrome. Oxysterols can be sulfated, and the sulfated oxysterols act in different directions: they decrease lipid biosynthesis, suppress inflammatory responses, and promote cell survival. Our recent reports have shown that oxysterol and oxysterol sulfates are paired epigenetic regulators, agonists, and antagonists of DNA methyl- transferases, indicating that their function of global regulation is through epigenetic modification. In this review, we explore our latest research of 25-hydroxycholesterol and 25-hydroxycholesterol 3-sulfate in a novel regulatory mechanism and evaluate the current evidence for these roles. Citation: Wang, Y.; Li, X.; Ren, S. Keywords: oxysterol sulfates; oxysterol sulfation; epigenetic regulators; 25-hydroxysterol; Cholesterol Metabolites 25-hydroxycholesterol 3-sulfate; 25-hydroxycholesterol 3,25-disulfate 25-Hydroxycholesterol and 25-Hydroxycholesterol 3-Sulfate Are Potent Paired Regulators: From Discovery to Clinical Usage.
    [Show full text]
  • Synonymous Single Nucleotide Polymorphisms in Human Cytochrome
    DMD Fast Forward. Published on February 9, 2009 as doi:10.1124/dmd.108.026047 DMD #26047 TITLE PAGE: A BIOINFORMATICS APPROACH FOR THE PHENOTYPE PREDICTION OF NON- SYNONYMOUS SINGLE NUCLEOTIDE POLYMORPHISMS IN HUMAN CYTOCHROME P450S LIN-LIN WANG, YONG LI, SHU-FENG ZHOU Department of Nutrition and Food Hygiene, School of Public Health, Peking University, Beijing 100191, P. R. China (LL Wang & Y Li) Discipline of Chinese Medicine, School of Health Sciences, RMIT University, Bundoora, Victoria 3083, Australia (LL Wang & SF Zhou). 1 Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics. DMD #26047 RUNNING TITLE PAGE: a) Running title: Prediction of phenotype of human CYPs. b) Author for correspondence: A/Prof. Shu-Feng Zhou, MD, PhD Discipline of Chinese Medicine, School of Health Sciences, RMIT University, WHO Collaborating Center for Traditional Medicine, Bundoora, Victoria 3083, Australia. Tel: + 61 3 9925 7794; fax: +61 3 9925 7178. Email: [email protected] c) Number of text pages: 21 Number of tables: 10 Number of figures: 2 Number of references: 40 Number of words in Abstract: 249 Number of words in Introduction: 749 Number of words in Discussion: 1459 d) Non-standard abbreviations: CYP, cytochrome P450; nsSNP, non-synonymous single nucleotide polymorphism. 2 DMD #26047 ABSTRACT Non-synonymous single nucleotide polymorphisms (nsSNPs) in coding regions that can lead to amino acid changes may cause alteration of protein function and account for susceptivity to disease. Identification of deleterious nsSNPs from tolerant nsSNPs is important for characterizing the genetic basis of human disease, assessing individual susceptibility to disease, understanding the pathogenesis of disease, identifying molecular targets for drug treatment and conducting individualized pharmacotherapy.
    [Show full text]
  • Identification of Novel CYP2E1 Inhibitor to Investigate Cellular and Exosomal CYP2E1-Mediated Toxicity
    University of Tennessee Health Science Center UTHSC Digital Commons Theses and Dissertations (ETD) College of Graduate Health Sciences 6-2019 Identification of Novel CYP2E1 Inhibitor to Investigate Cellular and Exosomal CYP2E1-Mediated Toxicity Mohammad Arifur Rahman University of Tennessee Health Science Center Follow this and additional works at: https://dc.uthsc.edu/dissertations Part of the Pharmacy and Pharmaceutical Sciences Commons Recommended Citation Rahman, Mohammad Arifur (0000-0002-5589-0114), "Identification of Novel CYP2E1 Inhibitor to Investigate Cellular and Exosomal CYP2E1-Mediated Toxicity" (2019). Theses and Dissertations (ETD). Paper 482. http://dx.doi.org/10.21007/etd.cghs.2019.0474. This Dissertation is brought to you for free and open access by the College of Graduate Health Sciences at UTHSC Digital Commons. It has been accepted for inclusion in Theses and Dissertations (ETD) by an authorized administrator of UTHSC Digital Commons. For more information, please contact [email protected]. Identification of Novel CYP2E1 Inhibitor to Investigate Cellular and Exosomal CYP2E1-Mediated Toxicity Abstract Cytochrome P450 2E1 (CYP2E1)-mediated hepatic and extra-hepatic toxicity is of significant clinical importance. Diallyl sulfide (DAS) has been shown to prevent xenobiotics such as alcohol- (ALC/ETH), acetaminophen- (APAP) induced toxicity and disease (e.g. HIV-1) pathogenesis. DAS imparts its beneficial effect by inhibiting CYP2E1-mediated metabolism of xenobiotics, especially at high concentration. However, DAS also causes toxicity at relatively high dosages and with long exposure times. The objective of the first project was to find potent ASD analogs which can replace DAS as a research tool or as potential adjuvant therapy in CYP2E1-mediated pathologies.
    [Show full text]
  • Regulation of Human CYP2C18 and CYP2C19 in Transgenic Mice: Influence of Castration, Testosterone, and Growth Hormone□S
    Supplemental Material can be found at: http://dmd.aspetjournals.org/cgi/content/full/dmd.109.026963/DC1 0090-9556/09/3707-1505–1512$20.00 DRUG METABOLISM AND DISPOSITION Vol. 37, No. 7 Copyright © 2009 by The American Society for Pharmacology and Experimental Therapeutics 26963/3478494 DMD 37:1505–1512, 2009 Printed in U.S.A. Regulation of Human CYP2C18 and CYP2C19 in Transgenic Mice: Influence of Castration, Testosterone, and Growth Hormone□S Susanne Lo¨ fgren, R. Michael Baldwin,1 Margareta Carlero¨ s, Ylva Terelius, Ronny Fransson-Steen, Jessica Mwinyi, David J. Waxman, and Magnus Ingelman-Sundberg Safety Assessment, AstraZeneca Research and Development, So¨ derta¨ lje, Sweden (S.L., R.F.-S.); Department of Physiology and Pharmacology, Section of Pharmacokinetics, Karolinska Institutet, Stockholm, Sweden (R.M.B., M.C., J.M., M.I.-S.); Drug Metabolism and Pharmacokinetics and Bioanalysis, Bioscience, Medivir AB, Huddinge, Sweden (Y.T.); and Division of Cell and Molecular Biology, Department of Biology, Boston University, Boston, Massachusetts (D.J.W.) Received January 29, 2009; accepted March 26, 2009 ABSTRACT: Downloaded from The hormonal regulation of human CYP2C18 and CYP2C19, which GH treatment of transgenic males for 7 days suppressed hepatic are expressed in a male-specific manner in liver and kidney in a expression of CYP2C19 (>90% decrease) and CYP2C18 (ϳ50% mouse transgenic model, was examined. The influence of prepu- decrease) but had minimal effect on the expression of these genes bertal castration in male mice and testosterone treatment of fe- in kidney, brain, or small intestine. Under these conditions, contin- male mice was investigated, as was the effect of continuous ad- uous GH induced all four female-specific mouse liver Cyp2c genes dmd.aspetjournals.org ministration of growth hormone (GH) to transgenic males.
    [Show full text]
  • Biosynthesis of New Alpha-Bisabolol Derivatives Through a Synthetic Biology Approach Arthur Sarrade-Loucheur
    Biosynthesis of new alpha-bisabolol derivatives through a synthetic biology approach Arthur Sarrade-Loucheur To cite this version: Arthur Sarrade-Loucheur. Biosynthesis of new alpha-bisabolol derivatives through a synthetic biology approach. Biochemistry, Molecular Biology. INSA de Toulouse, 2020. English. NNT : 2020ISAT0003. tel-02976811 HAL Id: tel-02976811 https://tel.archives-ouvertes.fr/tel-02976811 Submitted on 23 Oct 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE En vue de l’obtention du DOCTORAT DE L’UNIVERSITÉ DE TOULOUSE Délivré par l'Institut National des Sciences Appliquées de Toulouse Présentée et soutenue par Arthur SARRADE-LOUCHEUR Le 30 juin 2020 Biosynthèse de nouveaux dérivés de l'α-bisabolol par une approche de biologie synthèse Ecole doctorale : SEVAB - Sciences Ecologiques, Vétérinaires, Agronomiques et Bioingenieries Spécialité : Ingénieries microbienne et enzymatique Unité de recherche : TBI - Toulouse Biotechnology Institute, Bio & Chemical Engineering Thèse dirigée par Gilles TRUAN et Magali REMAUD-SIMEON Jury
    [Show full text]
  • Simulation of Physicochemical and Pharmacokinetic Properties of Vitamin D3 and Its Natural Derivatives
    pharmaceuticals Article Simulation of Physicochemical and Pharmacokinetic Properties of Vitamin D3 and Its Natural Derivatives Subrata Deb * , Anthony Allen Reeves and Suki Lafortune Department of Pharmaceutical Sciences, College of Pharmacy, Larkin University, Miami, FL 33169, USA; [email protected] (A.A.R.); [email protected] (S.L.) * Correspondence: [email protected] or [email protected]; Tel.: +1-224-310-7870 or +1-305-760-7479 Received: 9 June 2020; Accepted: 20 July 2020; Published: 23 July 2020 Abstract: Vitamin D3 is an endogenous fat-soluble secosteroid, either biosynthesized in human skin or absorbed from diet and health supplements. Multiple hydroxylation reactions in several tissues including liver and small intestine produce different forms of vitamin D3. Low serum vitamin D levels is a global problem which may origin from differential absorption following supplementation. The objective of the present study was to estimate the physicochemical properties, metabolism, transport and pharmacokinetic behavior of vitamin D3 derivatives following oral ingestion. GastroPlus software, which is an in silico mechanistically-constructed simulation tool, was used to simulate the physicochemical and pharmacokinetic behavior for twelve vitamin D3 derivatives. The Absorption, Distribution, Metabolism, Excretion and Toxicity (ADMET) Predictor and PKPlus modules were employed to derive the relevant parameters from the structural features of the compounds. The majority of the vitamin D3 derivatives are lipophilic (log P values > 5) with poor water solubility which are reflected in the poor predicted bioavailability. The fraction absorbed values for the vitamin D3 derivatives were low except for calcitroic acid, 1,23S,25-trihydroxy-24-oxo-vitamin D3, and (23S,25R)-1,25-dihydroxyvitamin D3-26,23-lactone each being greater than 90% fraction absorbed.
    [Show full text]
  • CYP2C9 Polymorphisms in Human Tumors
    ANTICANCER RESEARCH 26: 299-306 (2006) CYP2C9 Polymorphisms in Human Tumors HEIKE KNÜPFER1*, DIRK STANITZ2 and RAINER PREISS1 1University of Leipzig, Department of Clinical Pharmacology, Leipzig; 2Department of Internal Medicine, Hospital of the Paul-Gerhardt-Stiftung, Lutherstadt Wittenberg, Germany Abstract. The oxazaphosphorines cyclophosphamide (CP) derivative (phosphoramide mustard or ifosphoramide and ifosfamide (IF) are alkylating agents that require mustard) and acrolein. The mustard alkylates DNA and is bioactivation via cytochrome (CYP) P450 isoenzymes considered to be the therapeutically significant cytotoxic including CYP2C9 enzymes. The present study investigated metabolite. CYP2C9 in regard to its allelic variants in 23 tumor samples Multiple human P450 enzymes are capable of activating (10 breast tumors, 1 breast tumor cell line, 5 brain tumors, 7 oxazaphosphorines, among them CYP3A (2-5) and CYP2C glioma cell lines) with restriction fragment length enzymes (6). Four CYP2C genes have been identified – polymorphism polymerase chain reaction (RFLP-PCR). The CYP2C8, CYP2C9, CYP2C18 and CYP2C19 (7). Of those, mutant alleles of CYP2C9 were residue 144 (Arg (*1)/Cys CYP2C9 is expressed at the highest concentration in human (*2)), residue 358 (Tyr/Cys), residue 359 (Ile/Leu (*3)) and liver (8). CYP2C9 catalyzes the oxidation of diverse xenobiotic residue 417 (Gly/Asp). The frequencies of the CYP2C9*1, chemicals, such as tolbutamide, warfarin, flurbiprofen, CYP2C9*2 and CYP2C9*3 alleles in the cancer samples phenytoin, hexobarbital, diclofenac (8, 9) and also the examined were found to be 0.848, 0.152 and 0.043, anticancer agents ifosfamide and cyclophosphamide (6). respectively. No sample revealed a mutation at residue 358 or The metabolic activation of the oxazaphosphorines is 417.
    [Show full text]
  • Eagling Differential Selectivity of CYP Inhibitors Against Probe Substrates
    Br J Clin Pharmacol 1998; 45: 107–114 Differential selectivity of cytochrome P450 inhibitors against probe substrates in human and rat liver microsomes Victoria A. Eagling, John F. Tjia & David J. Back Department of Pharmacology & Therapeutics, University of Liverpool, P.O. Box 147, Liverpool L69 3GE, UK Aims Chemical inhibitors of cytochrome P450 (CYP) are a useful tool in defining the role of individual CYPs involved in drug metabolism. The aim of the present study was to evaluate the selectivity and rank the order of potency of a range of isoform-selective CYP inhibitors and to compare directly the eVects of these inhibitors in human and rat hepatic microsomes. Methods Four chemical inhibitors of human cytochrome P450 isoforms, furafylline (CYP1A2), sulphaphenazole (CYP2C9), diethyldithiocarbamate (CYP2E1), and ketoconazole (CYP3A4) were screened for their inhibitory specificity towards CYP- mediated reactions in both human and rat liver microsomal preparations. Phenacetin O-deethylation, tolbutamide 4-hydroxylation, chlorzoxazone 6-hydroxylation and testosterone 6b-hydroxylation were monitored for enzyme activity. Results Furafylline was a potent, selective inhibitor of phenacetin O-deethylation = (CYP1A2-mediated) in human liver microsomes (IC50 0.48 mm), but inhibited both phenacetin O-deethylation and tolbutamide 4-hydroxylation (CYP2C9- mediated) at equimolar concentrations in rat liver microsomes (IC50=20.8 and 24.0 mm respectively). Sulphaphenazole demonstrated selective inhibition of tolbutamide hydroxylation in human liver microsomes but failed to inhibit this reaction in rat liver microsomes. DDC demonstrated a low level of selectivity as an inhibitory probe for chlorzoxazone 6-hydroxylation (CYP2E1-mediated). DDC also inhibited testosterone 6b-hydroxylation (CYP3A-mediated) in man and rat, and tolbutamide 4-hydroxylase activity in rat.
    [Show full text]
  • Expression of CYP2S1 in Human Hepatic Stellate Cells
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 581 (2007) 781–786 Expression of CYP2S1 in human hepatic stellate cells Carylyn J. Mareka, Steven J. Tuckera, Matthew Korutha, Karen Wallacea,b, Matthew C. Wrighta,b,* a School of Medical Sciences, Institute of Medical Science, University of Aberdeen, Aberdeen, UK b Liver Faculty Research Group, School of Clinical and Laboratory Sciences, University of Newcastle, Newcastle, UK Received 22 November 2006; revised 16 January 2007; accepted 23 January 2007 Available online 2 February 2007 Edited by Laszlo Nagy the expression and accumulation of scarring extracellular Abstract Activated stellate cells are myofibroblast-like cells associated with the generation of fibrotic scaring in chronically fibrotic matrix protein [2]. It is currently thought an inhibition damaged liver. Gene chip analysis was performed on cultured fi- of fibrosis in liver diseases may be an effective approach to brotic stellate cells. Of the 51 human CYP genes known, 13 treating patients for which the cause is refractive to current CYP and 5 CYP reduction-related genes were detected with 4 treatments (e.g. in approx. 30% of hepatitis C infected CYPs (CYP1A1, CYP2E1, CY2S1 and CYP4F3) consistently patients) [2,3]. At present, there is no approved treatment for present in stellate cells isolated from three individuals. Quantita- fibrosis. tive RT-PCR indicated that CYP2S1 was a major expressed Inadvertent toxicity of drugs is often associated with a ‘‘met- CYP mRNA transcript. The presence of a CYP2A-related pro- abolic activation’’ by CYPs [1].
    [Show full text]