sign in sign up
<<
Home , CYP2C18, CYP2E1

and P450 mRNA expression levels of genetically diverse inbred mouse strains Neal Addicott - CSU East Bay, Michael Malfatti - Lawrence Livermore National Laboratory, Gabriela G. Loots - Lawrence Livermore National Laboratory

Metabolic pathways for caffeine 4. Results 1. Introduction (in mice - human overlaps underlined) Metabolites 30 minutes after dose Caffeine is broken down in humans by several from the Cytochrome Caffeine (1,3,7 - trimethylxanthine) O CH3 (n=6 per strain) CH3 6 N Paraxanthine/Caffeine N 7 /Caffeine */Caffeine P450 (CYP) superclass of enzymes. These CYP enzymes are important in Theophylline 1 5 0.06 0.06 0.06 8 (7-N-demethylization) (1,3 - dimethylxanthine) 2 4 9 3 O N 0.05 0.05 0.05 activating or eliminating many medications. The evaluation of caffeine O H N 1,3,7 - trimethyluricacid CH 3 O CH3 N CH eine Peak Area Peak eine eine Peak Area eine Cyp1a2 3 CH 0.04 Area Peak eine 0.04 0.04 f f

N f metabolites in a patient has been proposed as a means of estimating the activity 1 7 3 (3-N-demethylization) N Cyp3a4 N1 7 (8-hydrolyzation) 8 OH 0.03 0.03 0.03 of some CYP enzymes, contributing to genetics-based personalized medicine. O 3 N N Cyp1a2 3 O N Paraxanthine (1-N-demethylization) N 0.02 0.02 0.02 CH3 (1,7 - dimethylxanthine) CH3 O CH3 0.01 0.01 0.01 CH3 Theophylline Peak Area / Ca Peak Theophylline Paraxanthine Paraxanthine Peak Area / Ca The frequency and distribution of polymorphisms in inbred strains of mice N Area / Ca Peak Theobromine 7 paraxanthine peak area peak paraxanthine /caffeine area peak theophylline peak area peak theophylline /caffeine area peak N1 Theobromine 0 0 theobromine area peak /caffeine area peak 0 0 C57BL/6JC57BL BALB/cJBALB CBA/JCBA/J DBA/2JDBA/2J . 0 C57BL BALB CBA/J DBA/2J . 0 C57BL BALB CBA/J . (3,7 - dimethylxanthine) C57BL/6J BALB/cJ CBA/J DBA/2J C57 BALB CBA DBA often mirrors the variety in genotypes found in human populations. 3,6,8-trimethylallantoin *While retention times were similar, not all sample peaks O CH 3 3 Mouse Strain Mouse Strain Mouse Strain O N were recognized as theobromine by the HPLC software. N H Mouse Strain N N 7 (error bars represent a 90% confidence interval using Student's t = 2.015) H 1 Nat1 • The DBA/2J strain may be a slow metabolizer by a significant amount. • rtPCR (not a quantitative method) did not ? Nat2 3 This project hopes to determine whether four inbred strains have enough inter- O N Nat3 N Xdh Other time points besides 30 minutes after dose may be able to confirm. reveal any obvious inter-strain differences in Cyp1a2 CH3 • The BALB/cJ strain metabolized caffeine into theophylline by a significantly expression (no strains are null for a gene). strain differences in both their metabolite phenotypes and expression of mouse AFMU 3,7-dimethyluricacid larger amount than other strains. BALB/cJ's paraxanthine level was not * See "sample gel electrophoresis" figure. Cyp1a2 Xdh significantly greater than C57BL/6J or CBA/J, but significant differences may CYP enzymes to support additional investigations. spontaneous Cyp2a12 7-methylxanthine arise through additional sampling or at other time points. • qPCR data is still pending as of 8/4/2011. Cyp2a4 Xdh • While the theobromine levels appear reliable within each strain, the Cyp2a5 AAMU amounts detected are close to the limits of the device's detection range and 2. Background 1-methylxanthine 7-methyluricacid should not be weighted too heavily in the consideration of the data. Xdh Elimination Routes for Top 200 Prescribed Drugs Relative CYP strengths metabolizing caffeine in human liver microsomes 1-methyluricacid Primary Principal P450 Involved Elimination Route Hepatic Pathway in Metabolism 100 Pathway Preference of human CYP Enzymes for caffeine catalysis 1,7-dimethyluricacid Adapted from: http://www.genome.jp/kegg-bin/show_pathway? 5. Discussion 1-N-demethylation CYP1A2 > CYP2D6 > CYP2C8 > CYP2C19 > CYP3A5 9% This work represents the first steps of a larger investigation, and the BALB/cJ and 75 3-N-demethylation CYP1A2 > CYP3A4 > CYP2C9 > CYP2C8 > CYP2D6 > CYP2E1 Enzymes 75% DBA/2J strains have emerged as candidate model organisms for human CYP 70% 7-N-demethylation CYP1A2 > CYP2D6 > CYP2C9 > CYP2E1 > CYP2A6 > CYP3A5 polymorphisms detectable by caffeine metabolite levels. In the next stage, eleven 50 % C-8-hydroxylation CYP1A2 > CYP2B6 > CYP2E1 > CYP2D6 > CYP2C18 > CYP3A4 additional mouse strains will be examined for mRNA expression levels. (Source: Kot and Daniel. 2008) 37% 25 CYP1A2 is the primary enzyme responsible for caffeine metabolism in mice and While paraxanthine was expected to be the primary metabolite, after thirty minutes humans - eliminating 87% of caffeine at normal concentrations in mice3.

0 theophylline was detected at similar levels. Data will need to be collected two hours 0 1 2 3 4 5 6 7 8 9 10 CYP2A6, CYP2E1, and CYP3A4 have been shown to play a role in caffeine Hepatic (liver) P450X Axis CYP1A2 metabolism in humans, and in wild-type mice the orthologous are after injection for a closer comparison to published paraxanthine/caffeine ratios. A (figure adapted from Zanger et. al. 2008) CYP3A4/5 expressed in similar patterns4 but may not have the exact same roles in caffeine Image from: http://en.wikipedia.org/wiki/File:CytP450Oxidase-1OG2.png 1,3,7-Trimethyluric acid standard will be prepared and checked against existing Several polymorphic CYP outside of this metabolism. Rat caffeine metabolism has significantly different characteristics. study's scope have already been characterized in chromatogram data. A small peak near theobromine is a likely possibility. CYP % of CYP in human liver Orthologous CYP in mouse Caucasian populations with enough detail to warrant Overall process of project clinical dosing decisions based on CYP genotype1. The CYP1A2 15-18% Cyp1a2 Overall process of project Identified candidate mouse strains will have their mRNA sequences determined to Inject mouse current understanding of CYP1A2 and CYP3A4/5 CYP2A6 6-17% Cyp2a5 Collect more carefully characterize polymorphisms that could influence catalytic activity. genetics still needs more development before being with caffeine (Plasma) CYP2E1 9% Cyp2e1 Blood applied to personalized medicine. Caffeine metabolism CYP3A4 18-40% Cyp3a11 (specifically Paraxanthine/Caffeine ratios) serves as a Analyze plasma for caffeine/ 2 (Source: Hrycay and Bandiera 2009 clinically recognized indicator of CYP1A2 activity . Wait 30 metabolites with HPLC Check for statistical References minutes correlation between 1. Zanger U, Turpeinen M, Klein K, and Schwab M. Functional pharmacogenetics/genomics of human 3. Methods Check for mRNA P450 involved in drug biotransformation. Analytical and Bioanalytical Chemistry 2008; 392: expression with rtPCR and metabolism 1093-1108. 100 Representation of a typical Chromatogram Result Protocol for HPLC Samples Product 2. Fuhr U, Rost K, Engelhardt R, Sachs M, Liermann D, Belloc C, Beaune P, Janezic S, Grant D, Meyer U, and 1 Forward Primer (+) Reverse Primer (-) Collect Liver and Gene Length (bp) 0.9 Quantify mRNA Images from: Staib A. Evaluation of caffeine as a test drug for CYP1A2, NAT2, and CYP2E1 phenotyping in man by in vivo 80 Solvent B (Organic) http://ohioline.osu.edu/vme-fact/0023.html 0.8 Brain tissue http://www.flickr.com/photos/_intellinuts_/212714053/ 5' AGAGGTTGGCCACTTCGAACCA 3' 5' TCCTCTGCACGTTAGGCCATGT 3' non-polar Cyp1a2 495 http://www.flickr.com/photos/fiddledydee/3267271237/ versus in vitro correlations. Pharmacogenetics 1996; 6, 159-176. 0.7 expression with qPCR Caffeine 60 0.6

er A 5' ACCGTTGCCTTGCTTGTCTGGA 3' 5' AAACCTCCGCACGTCCTTCCAT 3' 3. Buters J, Tang B, Pineau T, Gelboin H, Kimura S, and Gonzalez F. Role of CYP1A2 in caffeine f Cyp2e1 366 0.5 % Bu 40 0.4 pharmacokinetics and metabolism: studies using mice deficient in CYP1A2. Pharmacogenetics 1996; 6: 291-296.

% Buffer A NAT2 5'AAGACCGGGAGAGAACAGCACAAC3' 5'TAGCCCGTATCTGGTGCTGAAGGA3' 223 Solvent A (Aqueous) 0.3 Sample gel electrophoresis of rtPCR products Absorbance Unit (AU) at 277nm 4. Hrycay EG, and Bandiera SM. Expression, function and regulation of mouse Cytochrome P450 Enzymes: 20 polar 0.2 Paraxanthine Theophylline Cyp3a11 5'ACAAACAAGCAGGGATGGACCTGG3' 5'TGTGACAGCAAGGAGAGGCGTTT3' 269 0.1 Comparison with Human Cytochrome P450 Enzymes. Current Drug Metabolism 2009; 10: 1151-1183. Absorbance Units (AU) 277nm at 0 0 10 11 12 13 14 15 16 17 18 19 20 21 0 5 10 15 20 25 30 35 40 Cyp2a5 5' GCTTCGAATGATGCTGGGAAGCT 3' 5' AACAGAAAGCCATAGCGCAGGG 3' 345 5. Kot M, and Daniel W. The relative contribution of human cytochrome P450 isoforms to the four caffeine Time (minutes) Time from sample injection (min) Time from sample injection (min) Time from injection (minutes) oxidation pathways:An in vitro compareative study with cDNA-expressed P450s including CYP2C isoforms . High Performance Liquid Chromatography (HPLC) Reverse Transcriptase Polymerase Chain Reaction (rtPCR) and Biochemical Pharmacology 2008; 76: 543-551. • Blood sample was centrifuged to isolate plasma Quantitative Real Time Polymerase Chain Reaction (qPCR) • Proteins were precipitated using 100% Methanol (200 !l of MeOH + 100 !l plasma) • Tissue Samples were preserved after collection in 3ml of RNALater® and stored at -4°C • -free precipitate was evaporated and reconstituted in 50!l 10% Methanol • ~30mg of tissue was homogenized in TRIzol and purified to total mRNA using • 40!l of reconstituted sample was injected into HPLC device. QIAGEN RNeasy columns and reagents. Yield ranged from 1.2-4.0 !g mRNA/!l water. C57BL/6J BALB/cJ CBA/J DBA/2J C57BL/6J BALB/cJ CBA/J DBA/2J C57BL/6J BALB/cJ CBA/J DBA/2J Acknowledgements C57BL/6J BALB/cJ CBA/J DBA/2J Non-polar compounds are attracted to the analytical column and take longer to reach the • Total cDNA for each sample was made using Invitrogen's SuperScript™ First-Strand C57BL/6J BALB/cJ CBA/J DBA/2J detector. More polar compounds (metabolites) are forced off the column by increasing Synthesis System. Cyp1a2 - 495bp Lawrence Livermore National Laboratory: Nicole Collette, Deepa Muguresh,Vicky Walsworth concentrations of the organic buffer. • cDNA was amplified using a standard PCR protocol and the primers listed above. Cyp2e1 - 366bp Cyp3a11- 269bp Cyp2a5- 345bp NAT2 -223bp * Solvent A: 99.99% HPLC grade H20 and 0.01% Acetic Acid (pH 4) • qPCR was conducted with the same cDNA primers were ordered from Applied Cal State East Bay: David Stronck, Kathy Hahn * Solvent B: 90% Methanol, 10% Acetonitrile and 0.01% Acetic Acid (pH4) Biosystems for use with a TaqMan® qPCR device and reagents. This material is based upon work supported by the S.D. Bechtel, Jr. Foundation and by the National Science Foundation under Grant No. 0952013 and Grant No. 0934931. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the S.D. Bechtel, Jr. Foundation or the National Science Foundation. LLNL-POST-491655 This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344