DOCSLIB.ORG

The Rat Genome Contains a P53 Pseudogene: Detection of a Processed Pseudogene Using PCR Janis E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Rat Genome Contains a P53 Pseudogene: Detection of a Processed Pseudogene Using PCR Janis E Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press The Rat Genome Contains a p53 Pseudogene: Detection of a Processed Pseudogene Using PCR Janis E. Hulla Pacific Northwest Laboratory, Richland, Washington 99352 The pS3 gene is the most frequent- Mutations, deletions, and rearrange- the most frequently mutated gene in ly mutated gene in human cancer. ments of the p53 gene have been human cancers.O 1) Increasing evidence Our investigation of this gene in found in a variety of human tu- suggests that aberrant expression can radiation-induced tumors led to the mors. (~-m) It now appears that p53 is result in either a gain of transforming discovery of a processed pseudo- gene in the rat genome. We amplified eight coding exons of the pS3 gene using rat liver DNA as template, and, in each case, one major amplification product was apparent on agarose gels. When we selected primers to amplify frag- ments containing more than one exon, two major products were ap- parent. In each case, the size of the larger amplification product was consistent with that of the ex- pected p53 fragment. The sizes of the shorter amplification products suggested that these fragments are amplified from a processed p$3 pseudogene. When the blotted frag- ments were probed with sequences internal to the amplification pri- mers, both the gene and putative FIGURE 1 A single fragment is amplified when PCR primers flank only one exon of the rat pseudogene fragments were seen. p53 gene. Regions of the gene amplified are indicated by lines on the gene structure diagram. Sequences of the shorter coampll- Amplification products were separated electrophoretically using a 2% agarose gel and stained cons have high homology with the with ethidium bromide. The table below outlines the contents of each lane along with the pS3 cDNA and cross Intron splice expected and apparent sizes of the amplified fragments. Lanes I and 10 contain molecular junctions. These findings suggest size markers. Predicted molecular sizes are based on the structures of the mouse and human that the rat genome contains a pro- p53 genes. Sizes are given in numbers of base pairs. Sizes of the fragments observed on the cessed pS3 pseudogene. The data gel are estimates based on the resolution of the markers. The sequences of the PCR primers demonstrate the usefulness of the are shown in Table 1. polymerase chain reaction for revealing processed pseudogenes, PRIMERS SIZE and suggest that the pseudogene LANE FLANK EXONS (PREDICTED/OBSERVED) can be used as an Internal control 2 4 291/290 when amplifying the rat pS3 gene. 3 S 204/200 4 6 133/130 S 7 131/130 6 8 1SS/1SO 7 9 95/100 8 10 128/130 9 11 102/100 1:251-2549 by ColdSpring Harbor Laboratory Press ISSN 1054-9803/92$3.00 PCR Methods and Applications 25 1 Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press potential or a loss of tumor suppress- Table 1. PCR primer sequences. ing activity. (12A3) We are investigating the role of pS3 in radiation-induced exon uvstream sequencg tumors. In the process of using the polymerase chain reaction (PCR) to 2 ATGGAGGATTCACAGTCGGATAT amplify this gene, we uncovered evi- dence of a processed p53 pseudogene 4 CCACCACAGCGACAGGGT in the rat genome. Processed pseudo- 5 TACTCAATTrCCCTC AATAA genes arise through a mechanism whereby a spliced mRNA is reverse- 6 GCCT~CTCCCCAA transcribed and subsequently inserted into the genome. (14) Therefore, a pro- 7 GTCGGCTCCGACTATACCACTATC cessed pseudogene lacks intervening 8 TGGGAATCTTCTGGGAC GGG sequences but may contain noncoding exons or 3' untranslated regions. A 9 CACTGCCCACCAGCACAAGC p53 pseudogene has previously been ATCCGTGGGCGTGAGCGCTTC characterized from a 3.3-kb fragment 10 of the mouse genome. (is) Both mouse 11 CTACCCGAAGACCAAGAAG and rat pseudogenes are colinear with the cDNA and possess no introns. The exon downstream sequence data presented exemplify the potential 4 CGTGCACATAACAGACTFGG of PCR to identify processed pseudo- genes, and suggest that the pseudogene 5 CGTCACCATCAGAGCAACG can be used as an internal control when amplifying fragments of the rat 6 CTCAGGTGGCTCATACGGTAC pS3 gene. 7 CTGGAGTCTTCCAGCGTG METHODS 8 CTCTCTI'rGCACTCCCTGGGGGC The gene structure of the rat p53 gene 9 CTTAAGGGTGAAATATFCTCCATC is not reported. We deduced the loca- tions of splice junctions in the rat gene 10 CTGGAGTGAGCCCTGCT by assuming that the relative positions and sizes of introns are conserved 11 GTCTGAGTCAGGCCCCA through evolution (Fig. 1 ).(16) PCR primers were synthesized to have se- quences identical to the rat cDNA at nucle-oside triphosphates were from recommendations. Sequenase Version the beginning and end of the putative Perkin-Elmer Cetus (Norwalk, Con- 2 (United States Biochemical, Cleve- exons. 07) The PCR primers were 17- to necticut). All reactions used a final land, Ohio) was used for sequencing by 23-mers consisting of the cDNA se- concentration of 0.2 ~tM for each the dideoxy method. (19) Both strands quences flanking sites considered most primer and 1 ~tg of template DNA. were sequenced using overlapping frag- likely to be splice junctions (Table 1). Each assay consisted of 35 cycles of ments of the pseudogene as templates. We used an Applied Biosystems Inc. 94~ for 1 min, 58~ for 1 min, and (Foster City, California) model 380A 72~ for 1 min or 1.5 min for frag- RESULTS synthesizer. Some oligonucleotides ments larger than 1000 bp. To generate We effectively amplified eight of the were synthesized to contain an amine template for sequence analysis, a PCR individual coding exons using freshly group on the 5' end, and Aminolink II fragment tentatively identified as pseu- isolated rat liver DNA as template (Fig. (Applied Biosystems Inc.) was used for dogene was isolated from a gel and 1). The identities of the bands were these terminal additions. The linked used as template for a second am- confirmed by probing with 1S-base se- oligonucleotides were subsequently plification. A biotinylated primer was quences located internal to the pri- biotinylated by adding 50-fold excess incorporated at this step to facilitate mers. We also amplified larger frag- of NHS-LC-Biotin II (Pierce Chemical isolation of single-stranded sequencing ments to include intervening se- Co., Rockford, Illinois) according to a template. All amplifications included quences within the most highly con- previously published procedure. (18) Ex- negative controls consisting of amplifi- served region of the gene (Fig. 2). (16) cess biotin was removed by spin cation cocktail and sterile deionized Two major bands are apparent when dialysis. water added in lieu of template DNA. primers flank more than one exon. Amplification reactions used ge- For sequencing, single-stranded Molecular sizes are consistent with the nomic rat liver DNA as template ex- DNA was isolated from PCR assays deduced gene structure. The larger tracted with an Applied Biosystems' with strepavidin-coated magnetic bands amplify from the p53 gene. The model 340A nucleic acid extractor; Taq beads (Dynal Inc., Great Neck, New shorter bands apparently amplify from DNA polymerase, reaction buffer, and York) according to the manufacturer's a processed pseudogene. Their sizes are 252 PCR Methods and Applications Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press of a rodent ancestor of mouse and rat since the mouse also has a processed pseudogene.OS) We are now taking advantage of the pseudogene's sequence homology with the p53 gene. The pseudogene is providing us with an internal control as we screen for gene aberrations. This is made possible because the same set of primers amplify both gene and pseu- dogene. By including at least one in- tron, gene fragments are distinguished from the smaller pseudogene fragment as shown in Figure 2. If the gene con- tains a deletion or mutation in at least one of the priming sites, it is not amplified. A corresponding aberration in the pseudogene would be extremely rare, therefore the pseudogene ampli- fies. Under these conditions, there is no need to amplify a second gene as often done to assure the integrity of the template DNA. These data highlight some impor- tant considerations for using PCR to FIGURE 2 Two major products are amplified by primers that flank more than one exon of the rat pS3 gene. Regions of the gene and pseudogene amplified are indicated by lines on the detect genetic aberrations. Since the in- gene structure graphic. Amplification products were separated electrophoretically on a 1.5% dividual exons of the p53 gene are not agarose gel and stained with ethidium bromide. The table below outlines the contents of distinguished from pseudogene ampli- each lane along with the expected and observed sizes of the amplified fragments. Lane 1 con- cons (Fig. 1), alternative primer sites tains molecular size markers. Predicted molecular sizes are based on the structures of the must be selected to assure gene/pseu- mouse and human p53 genes. Sizes given are in numbers of base pairs. Fragment sizes ob- dogene specificity. Additionally, our served are estimates based on the resolution of the markers. The sequences of the PCR findings emphasize the need to elimi- primers are shown in Table 1. nate all contaminating DNA when analyzing mRNA by RT-PCR. This is particularly important when processed Primers Gene size Pseudogene size pseudogene sequences closely resemble Lane flank exons (predicted/observed) (predicted/observed) the cDNA of the functional gene as they do in the rat p53 gene.(2~ 2 2 and 4 749/750 389/375 3 5 and 6 397/396 317/320 4 7 and 9 741/750 341/340 ACKNOWLEDGMENTS 5 8 and 9 310/320 230/225 We thank Dr.
Load more

Recommended publications
  • The Genomic Structure and Expression of MJD, the Machado-Joseph Disease Gene
    J Hum Genet (2001) 46:413–422 © Jpn Soc Hum Genet and Springer-Verlag 2001 ORIGINAL ARTICLE Yaeko Ichikawa · Jun Goto · Masahira Hattori Atsushi Toyoda · Kazuo Ishii · Seon-Yong Jeong Hideji Hashida · Naoki Masuda · Katsuhisa Ogata Fumio Kasai · Momoki Hirai · Patrícia Maciel Guy A. Rouleau · Yoshiyuki Sakaki · Ichiro Kanazawa The genomic structure and expression of MJD, the Machado-Joseph disease gene Received: March 7, 2001 / Accepted: April 17, 2001 Abstract Machado-Joseph disease (MJD) is an autosomal relative to the MJD gene in B445M7 indicate that there are dominant neurodegenerative disorder that is clinically char- three alternative splicing sites and eight polyadenylation acterized by cerebellar ataxia and various associated symp- signals in MJD that are used to generate the differently toms. The disease is caused by an unstable expansion of the sized transcripts. CAG repeat in the MJD gene. This gene is mapped to chromosome 14q32.1. To determine its genomic structure, Key words Machado-Joseph disease (MJD) · 14q32.1 · we constructed a contig composed of six cosmid clones and CAG repeat · Genome structure · Alternative splicing · eight bacterial artificial chromosome (BAC) clones. It spans mRNA expression approximately 300kb and includes MJD. We also deter- mined the complete sequence (175,330bp) of B445M7, a human BAC clone that contains MJD. The MJD gene was found to span 48,240bp and to contain 11 exons. Northern Introduction blot analysis showed that MJD mRNA is ubiquitously expressed in human tissues, and in at least four different Machado-Joseph disease (MJD) is an autosomal dominant sizes; namely, 1.4, 1.8, 4.5, and 7.5kb.
    [Show full text]
  • Complete Article
    The EMBO Journal Vol. I No. 12 pp. 1539-1544, 1982 Long terminal repeat-like elements flank a human immunoglobulin epsilon pseudogene that lacks introns Shintaro Ueda', Sumiko Nakai, Yasuyoshi Nishida, lack the entire IVS have been found in the gene families of the Hiroshi Hisajima, and Tasuku Honjo* mouse a-globin (Nishioka et al., 1980; Vanin et al., 1980), the lambda chain (Hollis et al., 1982), Department of Genetics, Osaka University Medical School, Osaka 530, human immunoglobulin Japan and the human ,B-tubulin (Wilde et al., 1982a, 1982b). The mouse a-globin processed gene is flanked by long terminal Communicated by K.Rajewsky Received on 30 September 1982 repeats (LTRs) of retrovirus-like intracisternal A particles on both sides, although their orientation is opposite to each There are at least three immunoglobulin epsilon genes (C,1, other (Lueders et al., 1982). The human processed genes CE2, and CE) in the human genome. The nucleotide sequences described above have poly(A)-like tails -20 bases 3' to the of the expressed epsilon gene (CE,) and one (CE) of the two putative poly(A) addition signal and are flanked by direct epsilon pseudogenes were compared. The results show that repeats of several bases on both sides (Hollis et al., 1982; the CE3 gene lacks the three intervening sequences entirely and Wilde et al., 1982a, 1982b). Such direct repeats, which were has a 31-base A-rich sequence 16 bases 3' to the putative also found in human small nuclear RNA pseudogenes poly(A) addition signal, indicating that the CE3 gene is a pro- (Arsdell et al., 1981), might have been formed by repair of cessed gene.
    [Show full text]
  • 1 Retrotransposons and Pseudogenes Regulate Mrnas and Lncrnas Via the Pirna Pathway 1 in the Germline 2 3 Toshiaki Watanabe*, E
    Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press 1 Retrotransposons and pseudogenes regulate mRNAs and lncRNAs via the piRNA pathway 2 in the germline 3 4 Toshiaki Watanabe*, Ee-chun Cheng, Mei Zhong, and Haifan Lin* 5 Yale Stem Cell Center and Department of Cell Biology, Yale University School of Medicine, New Haven, 6 Connecticut 06519, USA 7 8 Running Title: Pachytene piRNAs regulate mRNAs and lncRNAs 9 10 Key Words: retrotransposon, pseudogene, lncRNA, piRNA, Piwi, spermatogenesis 11 12 *Correspondence: [email protected]; [email protected] 13 1 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press 14 ABSTRACT 15 The eukaryotic genome has vast intergenic regions containing transposons, pseudogenes, and other 16 repetitive sequences. They produce numerous long non-coding RNAs (lncRNAs) and PIWI-interacting 17 RNAs (piRNAs), yet the functions of the vast intergenic regions remain largely unknown. Mammalian 18 piRNAs are abundantly expressed in late spermatocytes and round spermatids, coinciding with the 19 widespread expression of lncRNAs in these cells. Here, we show that piRNAs derived from transposons 20 and pseudogenes mediate the degradation of a large number of mRNAs and lncRNAs in mouse late 21 spermatocytes. In particular, they have a large impact on the lncRNA transcriptome, as a quarter of 22 lncRNAs expressed in late spermatocytes are up-regulated in mice deficient in the piRNA pathway. 23 Furthermore, our genomic and in vivo functional analyses reveal that retrotransposon sequences in the 24 3´UTR of mRNAs are targeted by piRNAs for degradation.
    [Show full text]
  • Long-Read Cdna Sequencing Identifies Functional Pseudogenes in the Human Transcriptome Robin-Lee Troskie1, Yohaann Jafrani1, Tim R
    Troskie et al. Genome Biology (2021) 22:146 https://doi.org/10.1186/s13059-021-02369-0 SHORT REPORT Open Access Long-read cDNA sequencing identifies functional pseudogenes in the human transcriptome Robin-Lee Troskie1, Yohaann Jafrani1, Tim R. Mercer2, Adam D. Ewing1*, Geoffrey J. Faulkner1,3* and Seth W. Cheetham1* * Correspondence: adam.ewing@ mater.uq.edu.au; faulknergj@gmail. Abstract com; [email protected]. au Pseudogenes are gene copies presumed to mainly be functionless relics of evolution 1Mater Research Institute-University due to acquired deleterious mutations or transcriptional silencing. Using deep full- of Queensland, TRI Building, QLD length PacBio cDNA sequencing of normal human tissues and cancer cell lines, we 4102 Woolloongabba, Australia Full list of author information is identify here hundreds of novel transcribed pseudogenes expressed in tissue-specific available at the end of the article patterns. Some pseudogene transcripts have intact open reading frames and are translated in cultured cells, representing unannotated protein-coding genes. To assess the biological impact of noncoding pseudogenes, we CRISPR-Cas9 delete the nucleus-enriched pseudogene PDCL3P4 and observe hundreds of perturbed genes. This study highlights pseudogenes as a complex and dynamic component of the human transcriptional landscape. Keywords: Pseudogene, PacBio, Long-read, lncRNA, CRISPR Background Pseudogenes are gene copies which are thought to be defective due to frame- disrupting mutations or transcriptional silencing [1, 2]. Most human pseudogenes (72%) are derived from retrotransposition of processed mRNAs, mediated by proteins encoded by the LINE-1 retrotransposon [3, 4]. Due to the loss of parental cis-regula- tory elements, processed pseudogenes were initially presumed to be transcriptionally silent [1] and were excluded from genome-wide functional screens and most transcrip- tome analyses [2].
    [Show full text]
  • Identification of Genetic Factors Underpinning Phenotypic Heterogeneity in Huntington’S Disease and Other Neurodegenerative Disorders
    Identification of genetic factors underpinning phenotypic heterogeneity in Huntington’s disease and other neurodegenerative disorders. By Dr Davina J Hensman Moss A thesis submitted to University College London for the degree of Doctor of Philosophy Department of Neurodegenerative Disease Institute of Neurology University College London (UCL) 2020 1 I, Davina Hensman Moss confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Collaborative work is also indicated in this thesis. Signature: Date: 2 Abstract Neurodegenerative diseases including Huntington’s disease (HD), the spinocerebellar ataxias and C9orf72 associated Amyotrophic Lateral Sclerosis / Frontotemporal dementia (ALS/FTD) do not present and progress in the same way in all patients. Instead there is phenotypic variability in age at onset, progression and symptoms. Understanding this variability is not only clinically valuable, but identification of the genetic factors underpinning this variability has the potential to highlight genes and pathways which may be amenable to therapeutic manipulation, hence help find drugs for these devastating and currently incurable diseases. Identification of genetic modifiers of neurodegenerative diseases is the overarching aim of this thesis. To identify genetic variants which modify disease progression it is first necessary to have a detailed characterization of the disease and its trajectory over time. In this thesis clinical data from the TRACK-HD studies, for which I collected data as a clinical fellow, was used to study disease progression over time in HD, and give subjects a progression score for subsequent analysis. In this thesis I show blood transcriptomic signatures of HD status and stage which parallel HD brain and overlap with Alzheimer’s disease brain.
    [Show full text]
  • NF1) Pseudogenes on Chromosomes 2, 14 and 22
    European Journal of Human Genetics (2000) 8, 209–214 © 2000 Macmillan Publishers Ltd All rights reserved 1018–4813/00 $15.00 y www.nature.com/ejhg ARTICLE Mechanism of spreading of the highly related neurofibromatosis type 1 (NF1) pseudogenes on chromosomes 2, 14 and 22 Mirjam Luijten1, YingPing Wang2, Blaine T Smith2, Andries Westerveld1, Luc J Smink3, Ian Dunham3, Bruce A Roe2 and Theo JM Hulsebos1 1Department of Human Genetics, Academic Medical Center, University of Amsterdam, The Netherlands; 2Department of Chemistry and Biochemistry, University of Oklahoma, Norman, OK, USA; 3Sanger Centre, Wellcome Trust Genome Campus, Hinxton Hall, Cambridge, UK Neurofibromatosis type 1 (NF1) is a frequent hereditary disorder that involves tissues derived from the embryonic neural crest. Besides the functional gene on chromosome arm 17q, NF1-related sequences (pseudogenes) are present on a number of chromosomes including 2, 12, 14, 15, 18, 21, and 22. We elucidated the complete nucleotide sequence of the NF1 pseudogene on chromosome 22. Only the middle part of the functional gene but not exons 21–27a, encoding the functionally important GAP-related domain of the NF1 protein, is presented in this pseudogene. In addition to the two known NF1 pseudogenes on chromosome 14 we identified two novel variants. A phylogenetic tree was constructed, from which we concluded that the NF1 pseudogenes on chromosomes 2, 14, and 22 are closely related to each other. Clones containing one of these pseudogenes cross-hybridised with the other pseudogenes in this subset, but did not reveal any in situ hybridisation with the functional NF1 gene or with NF1 pseudogenes on other chromosomes.
    [Show full text]
  • Chimp Olivia.Rev1
    Olivia Knowles Page 1 Annotation of Chimp Chunk 2-7 Introduction: My partner, Michelle Miller, and I have annotated Chimp Chunk 2-7 in preparation for annotating a segment of the Drosophila mohavensis genome. We were given GENSCAN (tool that predicts the location of genes in a given sequence) output for our Chimp Chunk. In order to discover the true identity of the genes predicted by GENSCAN, we analyzed a series of sequence alignments using BLAST (Basic Local Alignment Search Tool), BLAT (BLAST – Like Alignment Tool) and ClustalW (a multiple sequence alignment program). Fig 1: GENSCANW Output for Chimp Chunk 2-7 Fig 2: Initial GENSCAN Gene Map Olivia Knowles Page 2 Results: Predicted gene Number of exons Type of feature and related Location in Chimp (bp) number predicted function Pseudogene: RNA binding 1 6288-8932 1 motif---X-linked 3 estimated by GENSCAN, but Gene ortholog: spermatogenic 2 10182-36147 in reality 2 leucine zipper 1 gene exons. Explained later 1 estimated by Pseudogene: beta-actin. GENSCAN, but Structural support for the cell 3 36292-37603 in reality 2 and key player in muscular exons. contraction Explained later Pseudogene: keratin18. Keratin is a high sulfur matrix 4 40034-77992 5 protein used in feathers scales, hair, nails, etc. Table 1: Genes Predicted by GENSCAN Summary of Predicted Gene 1 and 2: My partner, Michelle Miller, analyzed the first two predicted genes. She found that predicted gene 1 is a pseudogene of the RNA binding motif, X-linked 2 gene. Evidence for this was gathered from BLASTp, BLAT to both humans and mice, and ESTs in the region.
    [Show full text]
  • Processed Pseudogene Insertions in Somatic Cells Haig H Kazazian Jr
    Kazazian Mobile DNA 2014, 5:20 http://www.mobilednajournal.com/content/5/1/20 COMMENTARY Open Access Processed pseudogene insertions in somatic cells Haig H Kazazian Jr Abstract Processed pseudogenes are copies of messenger RNAs that have been reverse transcribed into DNA and inserted into the genome using the enzymatic activities of active L1 elements. Processed pseudogenes generally lack introns, end in a 3’ poly A, and are flanked by target site duplications. Until recently, very few polymorphic processed pseudogenes had been discovered in mammalian genomes. Now several studies have found a number of polymorphic processed pseudogenes in humans. Moreover, processed pseudogenes can occur in somatic cells, including in various cancers and in early fetal development. One recent somatic insertion of a processed pseudogene has caused a Mendelian X-linked disease, chronic granulomatous disease. Keywords: Processed pseudogenes, L1 retrotransposons, Polymorphism, Cancer, Chronic granulomatous disease Background sequence of a 5S gene of Xenopus laevis [4]. PPs are Pseudogenes are sequences present in essentially all ani- found in the genomes of many animal species [2] and mal genomes that have many characteristics of genes, have the following characteristics: 1) their sequences are but are defective for production of protein. Of course, very similar to the transcribed portion of the parent like most definitions that are 30 years old and based on gene; 2) they lack all or most introns, so they appear to incomplete information, this one has also been modified. be cDNA copies of processed mRNAs; 3) they have a We now know of many pseudogenes that are active in poly A tail attached to the 3’-most transcribed nucleo- making proteins.
    [Show full text]
  • Systematic Functional Interrogation of Human Pseudogenes Using Crispri
    Sun et al. Genome Biology (2021) 22:240 https://doi.org/10.1186/s13059-021-02464-2 RESEARCH Open Access Systematic functional interrogation of human pseudogenes using CRISPRi Ming Sun1,2†, Yunfei Wang1,3†, Caishang Zheng1†, Yanjun Wei1, Jiakai Hou1,4, Peng Zhang1,5, Wei He6,7,8, Xiangdong Lv9,10,11, Yao Ding9,10,11, Han Liang1,8,12, Chung-Chau Hon13, Xi Chen9,10,11, Han Xu1,6,7,8* and Yiwen Chen1,8* * Correspondence: Hxu4@ mdanderson.org; ychen26@ Abstract mdanderson.org †Ming Sun, Yunfei Wang and Background: The human genome encodes over 14,000 pseudogenes that are Caishang Zheng contributed evolutionary relics of protein-coding genes and commonly considered as equally to this work. nonfunctional. Emerging evidence suggests that some pseudogenes may exert 1Department of Bioinformatics and Computational Biology, The important functions. However, to what extent human pseudogenes are functionally University of Texas MD Anderson relevant remains unclear. There has been no large-scale characterization of Cancer Center, Houston, TX 77030, pseudogene function because of technical challenges, including high sequence USA Full list of author information is similarity between pseudogene and parent genes, and poor annotation of available at the end of the article transcription start sites. Results: To overcome these technical obstacles, we develop an integrated computational pipeline to design the first genome-wide library of CRISPR interference (CRISPRi) single-guide RNAs (sgRNAs) that target human pseudogene promoter-proximal regions. We perform the first pseudogene-focused CRISPRi screen in luminal A breast cancer cells and reveal approximately 70 pseudogenes that affect breast cancer cell fitness. Among the top hits, we identify a cancer-testis unitary pseudogene, MGAT4EP, that is predominantly localized in the nucleus and interacts with FOXA1, a key regulator in luminal A breast cancer.
    [Show full text]
  • Associations Between Human Disease Genes and Overlapping Gene Groups and Multiple Amino Acid Runs
    Associations between human disease genes and overlapping gene groups and multiple amino acid runs Samuel Karlin*†, Chingfer Chen*, Andrew J. Gentles*, and Michael Cleary‡ Departments of *Mathematics and ‡Pathology, Stanford University, Stanford, CA 94305 Contributed by Samuel Karlin, October 30, 2002 Overlapping gene groups (OGGs) arise when exons of one gene are Chr 22. Such rearrangements may be mediated by recombination contained within the introns of another. Typically, the two over- events based on region-specific low copy repeats. The DGS lapping genes are encoded on opposite DNA strands. OGGs are region of 22q11.2 is particularly rich with segmental duplications, often associated with specific disease phenotypes. In this report, which can induce deletions, translocations, and genomic insta- we identify genes with OGG architecture and genes encoding bility (4). There are several anomalous sequence features asso- multiple long amino acid runs and examine their relations to ciated with OGGs, including Alu sequences intersecting exons, diseases. OGGs appear to be susceptible to genomic rearrange- pseudogenes occupying introns, and single-exon (intronless) ments as happens commonly with the loci of the DiGeorge syn- genes that often result from a processed multiexon gene. drome on human chromosome 22. We also examine the degree of At least 28 genes in Chr 21 are related to diseases, as conservation of OGGs between human and mouse. Our analyses characterized in the GeneCards database (5), as are 64 genes in suggest that (i) a high proportion of genes in OGG regions are Chr 22. Specific disorders that have been mapped to genes on disease-associated, (ii) genomic rearrangements are likely to occur Chr 21 and that involve OGG structures include: amyotrophic within OGGs, possibly as a consequence of anomalous sequence lateral sclerosis (ALS, Lou Gehrig’s disease), linked to the features prevalent in these regions, and (iii) multiple amino acid GRIK1 ionotrophic kainate 1 glutamate receptor gene at 21q22 runs are also frequently associated with pathologies.
    [Show full text]
  • Evolution of Haplotypes at CCL3L1/CCL4L1
    Janyakhantikul et al. Genome Biology 2010, 11(Suppl 1):P20 http://genomebiology.com/2010/11/S1/P20 POSTER PRESENTATION Open Access Evolution of haplotypes at CCL3L1/CCL4L1 Somwang Janyakhantikul*, Danielle Carpenter, John AL Armour From Beyond the Genome: The true gene count, human evolution and disease genomics Boston, MA, USA. 11-13 October 2010 Background populations (Table 1). SNP genotyping and CCL3 CCL3L1 and CCL4L1 are chemokine genes, located on microsatellite assays were then carried out to define a chromosome 17q12 (Figure 1). They are copy number set of flanking markers that may predict CCL3L1/ variable genes that share 95% sequence identity with CCL4L1 CN in UK and Basque samples. The best com- their non-copy number variable paralogues CCL3 and bination of 2 flanking SNPs, rs16972085 and rs8064426, CCL4 [1]. The copy number (CN) of these genes varies can be used - to predict the CCL3L1/CCL4L1 CN in UK between populations [2] and has been shown to be asso- and Basque samples with only 70% accuracy. Although ciated with phenotypes, such as susceptibility to HIV the CCL3 microsatellite alleles are not associated with infection [2] and SLE [3]. A CCL3L1 pseudogene, also CCL3L1/CCL4L1 copy number, there is extensive allelic known as CCL3L2, is present in the CCL3L1 region. diversity in the microsatellite. Finally, to improve the This pseudogene has sequences similar to CCL3L1 gene, accuracy of CCL3L1/CCL4L1 CN prediction, the but lacks exon 1 of CCL3L11.Asaresult,itspresence CCL3L1/CCL4L1 genes were sequenced in 90 CEU sam- mightaffectcopynumber(CN)measurementandsub- ples to identify sequence variants within the copy-vari- sequent interpretations in association studies between able genes themselves.
    [Show full text]
  • Network Analysis of Pseudogene-Gene Relationships: from Pseudogene Evolution to Their Functional Potentials
    Pacific Symposium on Biocomputing 2018 Network analysis of pseudogene-gene relationships: from pseudogene evolution to their functional potentials Travis S Johnson, MS Dept. Biomedical Informatics, Ohio State University, 5000 HITS, 410 W. 10th St. Indianapolis, Indiana, 46202 [email protected] Sihong Li Dept. Biomedical Informatics, Ohio State University, 250 Lincoln Tower, 1800 Cannon Dr. Columbus, Ohio, 43210 [email protected] Jonathan R Kho Dept. Computational Science and Engineering, Georgia Institute of Technology Klaus Advanced Computing Building, 266 Ferst Dr. Atlanta, Georgia, 30332 [email protected] Kun Huang, PhD Dept. Hematology Oncology, Indiana University, 335 Regenstrief Institute, 1101 W 10th St. Indianapolis, Indiana, 46202 [email protected] Yan Zhang, PhD* Dept. Biomedical Informatics, Ohio State University, 310-B Lincoln Tower, 1800 Cannon Dr. Columbus, Ohio, 43210 [email protected] Pseudogenes are fossil relatives of genes. Pseudogenes have long been thought of as “junk DNAs”, since they do not code proteins in normal tissues. Although most of the human pseudogenes do not have noticeable functions, ~20% of them exhibit transcriptional activity. There has been evidence showing that some pseudogenes adopted functions as lncRNAs and work as regulators of gene expression. Furthermore, pseudogenes can even be “reactivated” in some conditions, such as cancer initiation. Some pseudogenes are transcribed in specific cancer types, and some are even translated into proteins as observed in several cancer cell lines. All the above have shown that pseudogenes could have functional roles or potentials in the genome. Evaluating the relationships between pseudogenes and their gene counterparts could help us reveal the evolutionary path of pseudogenes and associate pseudogenes with functional potentials.
    [Show full text]