Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press The Rat Genome Contains a p53 Pseudogene: Detection of a Processed Pseudogene Using PCR Janis E. Hulla Pacific Northwest Laboratory, Richland, Washington 99352 The pS3 gene is the most frequent- Mutations, deletions, and rearrange- the most frequently mutated gene in ly mutated gene in human cancer. ments of the p53 gene have been human cancers.O 1) Increasing evidence Our investigation of this gene in found in a variety of human tu- suggests that aberrant expression can radiation-induced tumors led to the mors. (~-m) It now appears that p53 is result in either a gain of transforming discovery of a processed pseudo- gene in the rat genome. We amplified eight coding exons of the pS3 gene using rat liver DNA as template, and, in each case, one major amplification product was apparent on agarose gels. When we selected primers to amplify frag- ments containing more than one exon, two major products were ap- parent. In each case, the size of the larger amplification product was consistent with that of the ex- pected p53 fragment. The sizes of the shorter amplification products suggested that these fragments are amplified from a processed p$3 pseudogene. When the blotted frag- ments were probed with sequences internal to the amplification pri- mers, both the gene and putative FIGURE 1 A single fragment is amplified when PCR primers flank only one exon of the rat pseudogene fragments were seen. p53 gene. Regions of the gene amplified are indicated by lines on the gene structure diagram. Sequences of the shorter coampll- Amplification products were separated electrophoretically using a 2% agarose gel and stained cons have high homology with the with ethidium bromide. The table below outlines the contents of each lane along with the pS3 cDNA and cross Intron splice expected and apparent sizes of the amplified fragments. Lanes I and 10 contain molecular junctions. These findings suggest size markers. Predicted molecular sizes are based on the structures of the mouse and human that the rat genome contains a pro- p53 genes. Sizes are given in numbers of base pairs. Sizes of the fragments observed on the cessed pS3 pseudogene. The data gel are estimates based on the resolution of the markers. The sequences of the PCR primers demonstrate the usefulness of the are shown in Table 1. polymerase chain reaction for revealing processed pseudogenes, PRIMERS SIZE and suggest that the pseudogene LANE FLANK EXONS (PREDICTED/OBSERVED) can be used as an Internal control 2 4 291/290 when amplifying the rat pS3 gene. 3 S 204/200 4 6 133/130 S 7 131/130 6 8 1SS/1SO 7 9 95/100 8 10 128/130 9 11 102/100 1:251-2549 by ColdSpring Harbor Laboratory Press ISSN 1054-9803/92$3.00 PCR Methods and Applications 25 1 Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press potential or a loss of tumor suppress- Table 1. PCR primer sequences. ing activity. (12A3) We are investigating the role of pS3 in radiation-induced exon uvstream sequencg tumors. In the process of using the polymerase chain reaction (PCR) to 2 ATGGAGGATTCACAGTCGGATAT amplify this gene, we uncovered evi- dence of a processed p53 pseudogene 4 CCACCACAGCGACAGGGT in the rat genome. Processed pseudo- 5 TACTCAATTrCCCTC AATAA genes arise through a mechanism whereby a spliced mRNA is reverse- 6 GCCT~CTCCCCAA transcribed and subsequently inserted into the genome. (14) Therefore, a pro- 7 GTCGGCTCCGACTATACCACTATC cessed pseudogene lacks intervening 8 TGGGAATCTTCTGGGAC GGG sequences but may contain noncoding exons or 3' untranslated regions. A 9 CACTGCCCACCAGCACAAGC p53 pseudogene has previously been ATCCGTGGGCGTGAGCGCTTC characterized from a 3.3-kb fragment 10 of the mouse genome. (is) Both mouse 11 CTACCCGAAGACCAAGAAG and rat pseudogenes are colinear with the cDNA and possess no introns. The exon downstream sequence data presented exemplify the potential 4 CGTGCACATAACAGACTFGG of PCR to identify processed pseudo- genes, and suggest that the pseudogene 5 CGTCACCATCAGAGCAACG can be used as an internal control when amplifying fragments of the rat 6 CTCAGGTGGCTCATACGGTAC pS3 gene. 7 CTGGAGTCTTCCAGCGTG METHODS 8 CTCTCTI'rGCACTCCCTGGGGGC The gene structure of the rat p53 gene 9 CTTAAGGGTGAAATATFCTCCATC is not reported. We deduced the loca- tions of splice junctions in the rat gene 10 CTGGAGTGAGCCCTGCT by assuming that the relative positions and sizes of introns are conserved 11 GTCTGAGTCAGGCCCCA through evolution (Fig. 1 ).(16) PCR primers were synthesized to have se- quences identical to the rat cDNA at nucle-oside triphosphates were from recommendations. Sequenase Version the beginning and end of the putative Perkin-Elmer Cetus (Norwalk, Con- 2 (United States Biochemical, Cleve- exons. 07) The PCR primers were 17- to necticut). All reactions used a final land, Ohio) was used for sequencing by 23-mers consisting of the cDNA se- concentration of 0.2 ~tM for each the dideoxy method. (19) Both strands quences flanking sites considered most primer and 1 ~tg of template DNA. were sequenced using overlapping frag- likely to be splice junctions (Table 1). Each assay consisted of 35 cycles of ments of the pseudogene as templates. We used an Applied Biosystems Inc. 94~ for 1 min, 58~ for 1 min, and (Foster City, California) model 380A 72~ for 1 min or 1.5 min for frag- RESULTS synthesizer. Some oligonucleotides ments larger than 1000 bp. To generate We effectively amplified eight of the were synthesized to contain an amine template for sequence analysis, a PCR individual coding exons using freshly group on the 5' end, and Aminolink II fragment tentatively identified as pseu- isolated rat liver DNA as template (Fig. (Applied Biosystems Inc.) was used for dogene was isolated from a gel and 1). The identities of the bands were these terminal additions. The linked used as template for a second am- confirmed by probing with 1S-base se- oligonucleotides were subsequently plification. A biotinylated primer was quences located internal to the pri- biotinylated by adding 50-fold excess incorporated at this step to facilitate mers. We also amplified larger frag- of NHS-LC-Biotin II (Pierce Chemical isolation of single-stranded sequencing ments to include intervening se- Co., Rockford, Illinois) according to a template. All amplifications included quences within the most highly con- previously published procedure. (18) Ex- negative controls consisting of amplifi- served region of the gene (Fig. 2). (16) cess biotin was removed by spin cation cocktail and sterile deionized Two major bands are apparent when dialysis. water added in lieu of template DNA. primers flank more than one exon. Amplification reactions used ge- For sequencing, single-stranded Molecular sizes are consistent with the nomic rat liver DNA as template ex- DNA was isolated from PCR assays deduced gene structure. The larger tracted with an Applied Biosystems' with strepavidin-coated magnetic bands amplify from the p53 gene. The model 340A nucleic acid extractor; Taq beads (Dynal Inc., Great Neck, New shorter bands apparently amplify from DNA polymerase, reaction buffer, and York) according to the manufacturer's a processed pseudogene. Their sizes are 252 PCR Methods and Applications Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press of a rodent ancestor of mouse and rat since the mouse also has a processed pseudogene.OS) We are now taking advantage of the pseudogene's sequence homology with the p53 gene. The pseudogene is providing us with an internal control as we screen for gene aberrations. This is made possible because the same set of primers amplify both gene and pseu- dogene. By including at least one in- tron, gene fragments are distinguished from the smaller pseudogene fragment as shown in Figure 2. If the gene con- tains a deletion or mutation in at least one of the priming sites, it is not amplified. A corresponding aberration in the pseudogene would be extremely rare, therefore the pseudogene ampli- fies. Under these conditions, there is no need to amplify a second gene as often done to assure the integrity of the template DNA. These data highlight some impor- tant considerations for using PCR to FIGURE 2 Two major products are amplified by primers that flank more than one exon of the rat pS3 gene. Regions of the gene and pseudogene amplified are indicated by lines on the detect genetic aberrations. Since the in- gene structure graphic. Amplification products were separated electrophoretically on a 1.5% dividual exons of the p53 gene are not agarose gel and stained with ethidium bromide. The table below outlines the contents of distinguished from pseudogene ampli- each lane along with the expected and observed sizes of the amplified fragments. Lane 1 con- cons (Fig. 1), alternative primer sites tains molecular size markers. Predicted molecular sizes are based on the structures of the must be selected to assure gene/pseu- mouse and human p53 genes. Sizes given are in numbers of base pairs. Fragment sizes ob- dogene specificity. Additionally, our served are estimates based on the resolution of the markers. The sequences of the PCR findings emphasize the need to elimi- primers are shown in Table 1. nate all contaminating DNA when analyzing mRNA by RT-PCR. This is particularly important when processed Primers Gene size Pseudogene size pseudogene sequences closely resemble Lane flank exons (predicted/observed) (predicted/observed) the cDNA of the functional gene as they do in the rat p53 gene.(2~ 2 2 and 4 749/750 389/375 3 5 and 6 397/396 317/320 4 7 and 9 741/750 341/340 ACKNOWLEDGMENTS 5 8 and 9 310/320 230/225 We thank Dr.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages5 Page
-
File Size-