sign in sign up
<<
Home , Hodgkin lymphoma, Lymphocytosis, Lymphoma

Leukemia (1998) 12, 1026–1030  1998 Stockton Press All rights reserved 0887-6924/98 $12.00 http://www.stockton-press.co.uk/leu MINI-REVIEW

Large cell complicating persistent polyclonal J Roy1, C Ryckman1, V Bernier2, R Whittom3 and R Delage1

1Division of , 2Department of , Saint Sacrement Hospital, 3Division of Hematology, CHUQ, Saint Franc¸ois d’Assise Hospital, Laval University, Quebec City, Canada

Persistent polyclonal B cell lymphocytosis (PPBL) is a rare immunoglobulin (Ig) M with a polyclonal pattern on protein lymphoproliferative disorder of unclear natural history and its electropheresis. cell analysis displays the pres- potential for B cell malignancy remains unknown. We describe the case of a 39-year-old female who presented with stage IV- ence of the CD19 antigen and surface IgM with a normal B large cell lymphoma 19 years after an initial diagnosis of kappa/lambda ratio. In contrast to CLL, CD5 is absent. There PPBL; her disease was rapidly fatal despite intensive chemo- is an association between HLA-DR 7 and PPBL in more than therapy and stem cell transplantation. Because we had two-thirds of the patients but the reason for such an associ- recently identified multiple bcl-2/lg gene rearrangements in ation remains unclear.3,6 There has been one report of PPBL blood mononuclear cells of patients with PPBL, we sought evi- occurring in identical female twins.7 No other obvious genetic dence of this oncogene in this particular patient: bcl-2/lg gene rearrangements were found in blood mononuclear cells but not predisposition or familial inheritance has yet been described in lymphoma cells. Owing to the possible role of Epstein–Barr and there is no consistent chromosomal abnormality reported (EBV) in the pathogenesis of PPBL, we also hypothesized in these patients. our patient might have an EBV-related lymphoproliferative dis- To date, the pathogenesis of PPBL remains undetermined. order. Despite serologies consistent with past exposure to this The presence of binucleated cells, the accumulation of virus, it was not found in lymphoma cells using a sensitive mature-looking B over time and the indolent polymerase chain reaction technique. We conclude that non- Hodgkin’s lymphoma may occur during the course of PPBL. course of PPBL are characteristics reminiscent of low-grade However, longer follow-up in more patients will be needed in in leukemic phase and prompted us to explore order to better clarify the risk of hematologic malignancy in the role of the bcl-2 oncogene in this condition. Bcl-2 is parti- patients with PPBL. cularly important in lymphoid malignancies: 85% of follicular Keywords: polyclonal lymphocytosis; non-Hodgkin’s lymphoma; and approximately 20% of large cell lymphomas have a trans- bcl-2; Epstein–Barr virus location which juxtaposes the bcl-2 gene of chromosome 18 to the Ig gene locus located on chromosome 14.8,9 This t(14;18) results in the overexpression of the bcl-2 protein with Introduction consequently the accumulation of clonal B cells by inhibition of or .10,11 Using a poly- Persistent polyclonal B cell lymphocytosis (PPBL) is a syn- merase chain reaction (PCR) assay targeting the usual break- drome that was originally described in 1982.1 It occurs almost point regions of the t(14;18),12 we recently performed an exclusively in women2 and is usually diagnosed in their analysis of the bcl-2/lg gene rearrangements on DNA isolated second or third decade. Subjects with PPBL are most often from peripheral blood mononuclear cells (PBMC) obtained identified after referral to the hematologist for evaluation of from six patients with PPBL diagnosed at our institution mild to moderate lymphocytosis. Clinically, the affected between 1975 and 1994.13 Interestingly, we found that the patients are either asymptomatic or have minor non-specific bcl-2/lg gene was rearranged in all six patients, with multiple complaints such as or malaise; most, but not all, are rearrangements in five of them.13 Sequence analysis con- cigarette smokers.3–5 Physical examination is usually within firmed the specificity of the fragments for the bcl-2/lg translo- normal limits except for mild in some cases, cation and the presence of multiple rearrangements in all but although the incidence of this finding increases with the use one patient. Since the publication of these results, five of radiologic imaging. Patients with PPBL are commonly mis- additional patients have been studied with similar findings.14 diagnosed to have chronic lymphocytic (CLL) or Bcl-2 protein expression by Western blot analysis was also non-Hodgkin’s lymphoma (NHL) in leukemic phase, and increased in all patients studied. Our data suggest that inhi- some have even received before a clear diag- bition of apoptosis might well be the underlying mechanism nosis of PPBL is made. Although believed to be a rare entity, leading to B cell accumulation in patients with PPBL. Ident- we have been identifying one to two new cases of PPBL per ifying bcl-2/lg gene rearrangements in patients with PPBL is year at our institution, which suggests a higher prevalence also of practical relevance for the clinician because this find- than initially reported. ing further increases the risk of confusion with other patients Laboratory investigation of patients with PPBL reveals the having low-grade NHL in leukemic phase. presence of polyclonal B cell lymphocytosis with otherwise The exact mechanisms leading to bcl-2/lg gene rearrange- normal hematologic parameters. Characteristic binucleated ment in PPBL remain uncertain at the present time, but cells are found in variable numbers on careful blood smear chronic viral has been suggested as a possible con- examination. In addition, all patients have increased levels of tributing event. Of note, it has been previously shown that the latent membrane protein (LMP)-1 gene of the Epstein–Barr virus (EBV) can induce bcl-2 expression.15 Other findings Correspondence: J Roy, CHA, Pavillon Saint-Sacrement, 1050 chemin incriminating EBV include reports in which viral DNA has ´ Sainte-Foy, Quebec (Qc), Canada G1S 4L8; Fax: 418 682 7961 been amplified by PCR and identified in lymphoid cells Received 22 September 1997; accepted 12 February 1998 obtained from two patients with PPBL using in situ hybridiz- Lymphoma following B cell lymphocytosis J Roy et al 1027 ation.16,17 An EBV-positive line has also been established from another patient with PPBL.18 The potential for malignancy in PPBL remains unknown. Until now, only one case of neoplasia occurring in a patient with PPBL has been reported. Lawlor and colleagues19 have indeed described a case of pulmonary blastoma, a rare malig- nant tumor of combined mesenchymal and epithelial origin. The ultrastructural study of the lymphocytes using electron microscopy20 and the presence of bcl-2/lg gene rearrangement are findings supporting the hypothesis that PPBL might in fact be a pre-malignant disorder of the B cell population. We report the first case of large cell lymphoma in a patient with PPBL and describe the molecular features associated with the tumor.

History

Figure 1 Shown is a typical binucleated cell found in patients with In 1975, a 20-year-old female smoker was referred to our ¨ institution for lymphocytosis of unclear etiology. At that time, persistent polyclonal B cell lymphocytosis (May–Grunwald–Giemsa, ×1000). clinical findings included intermittent fatigue and a barely pal- pable on physical examination. The initial was only remarkable for 25.8 × 109/l leukocytes, of which 51% were mature lymphocytes with several showing med and histologic examination revealed the presence of a characteristic binucleated nuclei; bone marrow aspirate was large cell lymphoma. The showed partial diffuse normal. An ultrasound of the abdomen revealed isolated mild infiltration by a population of monomorphic large cells with splenomegaly. Cell surface marker analyses performed on round nuclei containing three to five small peripheral nucleoli multiple occasions over the following years revealed the pres- and a moderate amount of basophilic cytoplasm. The large ence of polyclonal B cell lymphocytosis (B cells ranging from non-cleaved centrofollicular cells were accompanied by few 5.3 to 12.2 × 109/l with normal kappa/lambda ratio) with posi- immunoblasts characterized by nuclei with a prominent tive surface IgM. HLA-typing revealed the patient was positive nucleolus. Mitoses were numerous (Figure 2). for the HLA-DR 6 and 7 antigens. In addition, Southern blot The patient received three cycles of , and PCR analysis of the heavy chain Ig gene performed on adriamycin, and (CHOP), but and blood mononuclear cells in 1991 confirmed the B cell pro- recurred shortly after: a control CT showed par- liferation was polyclonal. The patient remained clinically tial response. The patient then received salvage chemotherapy stable until 1991 when she was lost to follow-up. with , , Ara-C and In November 1994, the patient consulted for left-sided (ESHAP) and two cycles of vincristine, prednisone, etoposide pleuritic chest pain. She also complained at that time of night and mitoxantrone, after which the CT scan showed significant sweats, and a 6-kg . Vital signs were nor- reduction of the lung lesions but progressive disease in the mal except for hyperthermia at 38.7°C. There were no pal- left kidney. Despite overall sub-optimal response, the patient pable nodes, but the spleen was then enlarged at 4 cm below underwent autologous blood stem cell transplantation after a costal margin. Laboratory examinations revealed a leukocyte conditioning regimen consisting of high-dose cyclophos- count of 8.2 × 109/l with 49% lymphocytes, a of phamide, etoposide and . The post-transplant 81 g/l with features of of chronic disease and normal course was uneventful with prompt engraftment. However, B platelets. The sedimentation rate was much increased at symptoms reappeared on day +25 and the patient died on day 138 mm. Multiple rouleaux and typical binucleated lympho- +47 from progressive disease. cytes were identified on blood smear (Figure 1). The LDH was At autopsy, an 8 × 12 cm mediastinal lymphomatous mass increased at 596 U/l (normal Ͻ334 U/l). The total IgM level was found with direct extension to the ascending aorta, the was increased at 21.4 g/l (normal Ͻ2.0 g/l) with monoclonal , the trachea, both lungs, the pericardium, IgM on immunofixation and slightly decreased IgA and IgG the left cardiac atrium and the left parietal pleura. In addition, levels. On bone marrow , there was trilineage hyper- there was extensive involvement of the splenic, peri-hepatic, plasia with two small paratrabecular lymphomatous aggre- and retroperitoneal lymph nodes with contiguous infiltration gates. EBV serology was consistent with past exposure to the of the left kidney and adrenal gland. Finally, there was also virus with IgG anti-VCA and anti-EBNA titers of 1/2000 and massive involvement of the and the spleen (weights of 1/80, respectively. 2610 g and 1460 g, respectively). A chest X-ray showed mediastinal enlargement with bilat- eral basal pulmonary lesions. There were several 3 cm nodes in the anterior and a 10 × 20 cm mass adhering Materials and methods to the left pericardium on chest computer tomographic (CT) scan. An echocardiogram revealed the presence of a moderate Tissue samples pericardial effusion without signs of tamponade. The abdo- men CT scan showed splenomegaly, , a mass All blood and tumor samples were obtained after informed infiltrating the left kidney and a few enlarged retroperitoneal consent. PBMC were isolated by centrifugation over Ficoll– nodes. A bone scan was normal. Hypaque (Pharmacia, Piscataway, NJ, USA) from our patient A through was perfor- in 1991 and in 1994 (prior to chemotherapy) and from normal Lymphoma following B cell lymphocytosis J Roy et al 1028

Figure 2 Lymph node biopsy showing on the right an infiltrate of malignant cells consistent with large cell lymphoma (hematoxylin and eosin, ×400).

healthy volunteers. Tumor samples were collected at lym- least three times. In addition, a control containing all PCR phoma presentation and autopsy and stored in liquid nitrogen. reagents and water was included in all experiments. Evaluation of clonality was assessed by PCR analysis of the chain determining region 3 (CDR3) of the human Ig heavy chain gene according to a modified technique described by Brisco et al.22 After RNA extraction and reverse transcription Immunohistochemical studies were done using a modification of either Raji cells (ATCC, Rockville, MD, USA), lymphoma of the avidin–biotin–peroxydase complex (ABC) method.21 cells or PBMC from normal subjects, cDNA was amplified Monoclonal against CD20 (Dako, Carpinteria, CA, with the FR3A primer 5ЈACACGGC(C/T)(G/C)TGTATTA- USA), CD45RO (Dako), CD74 (Clonab, Denville, NJ, USA), CTGT3Ј and the Ig VLJH primer 5ЈGTGACCAGGGT/ and Bcl-2 antigens (Dako) were used at a dilution of 1/100, NCCTTGGCCCCAG3Ј for 40 cycles. RNA extraction quality 1/100, 1/50, and 1/400, respectively. Kappa and lambda light control was assessed using glucose 3-phosphate dehydrogen- chains polyclonal antibodies (both Dako) were used at a ase (G3PDH) primers 5ЈTGAAGGTCGGAGTCAACGGA- dilution of 1/500. TTTGGT3Ј and 5ЈCATGTGGGCCATGAGGTCCACCAC3Ј with the same amplification conditions. Epstein–Barr nuclear antigen-1 (EBNA-1) gene analysis was PCR Studies done according to the technique described by Finke et al.23 After RNA extraction of Raji cells (positive control), PBMC Bcl-2/lg gene rearrangement analysis was performed after from normal subjects (negative control) or lymphoma cells, DNA extraction from PBMC or tumor samples using standard cDNA obtained after reverse transcription was amplified for procedures and a PCR technique described by Gribben et al.12 30 cycles using EBNA-1 5ЈAGCGATAGAGCAGGGCCC- Briefly, 1 ␮g of DNA was used for each PCR analysis. The first CGCAGA3Ј and 5ЈCAAAACCTCAGCAAATATATGAGT3Ј pri- round of amplification of 25 cycles was performed using mers. One microliter of the first amplification product was either bcl-2-specific primers 5ЈCAGCCTTGAAACATT- used for the second round of amplification with GATGG3Ј for the major breakpoint region (MBR) or 5ЈTCAGGGTGATGGAGGCA3Ј and 5ЈACAATGGACTCC- 5ЈCGTGCTGGTACCACTCCTG3Ј for the minor cluster region CTTAGC3Ј oligonucleotides. (mcr) in combination with the Ig heavy chain JH primer 5ЈACCTGAGGAGACGGTGACC3Ј. For the second round of amplication of 30 cycles, 5 ␮l of the first PCR product was Results used in the presence of the MBR primer 5ЈTATGGTGGTTTGACCTTTAG3Ј or the mcr primer The lymphoma cells both from the initial lymph node biopsy 5ЈGGACCTTCCTTGGTGTGTTG3Ј and of the JH primer and autopsy specimens revealed a B cell phenotype, with 5ЈACCAGGGTCCCTTGGCCCCA3Ј. Cells of the H-2 cell line CD20 and CD74 surface antigens expression and cytoplasmic (kindly provided by Dr JG Gribben, Dana-Farber Insti- lambda light chain restriction. In contrast, the cells were nega- tute, Boston, MA, USA) and PBMC from healthy volunteers tive for the pan antigen CD45RO. Cell monoclonality were used as positive and negative controls, respectively. All of tumor samples was confirmed by PCR analysis of the CDR3 PCR products in this report were further characterized by aga- of the human Ig heavy chain gene (Figure 3). The same analy- rose gel electrophoresis, and each sample was analyzed at sis was performed on the patient’s PBMC at presentation prior Lymphoma following B cell lymphocytosis J Roy et al 1029

Figure 3 Molecular analyses of peripheral blood mononuclear cells (PBMC) and lymphoma cells (L). Positive and negative controls are represented by + and − abbreviations. Upper left: Shown are two rearrangements in the major breakpoint region of the bcl-2 gene in PBMC. No rearrangement is observed in lymphoma (L) cells. H-2 cell line and PBMC from healthy volunteers were used as + and −, respectively. Upper right: Presence of a clonal proliferation in tumor cells (L) as evidenced by PCR analysis of the CDR3 of the immunoglobulin heavy chain gene. A polyclonal pattern is seen in PBMC. H-2 cell line and PBMC from healthy volunteers were used as + and −, respectively. Lower left: Absence of EBNA-1 mRNA as determined by RT-PCR in the tumor (L). Raji cells and PBMC from normal volunteers were used as + and −. Lower right: Glucose 3-phosphate dehydrogenase RT-PCR analysis used for RNA quality control. Raji cells and PBMC from normal volunteers were used as represented by + and −. to chemotherapy but no monoclonal population was In addition, our recent observation of multiple bcl-2/lg gene identified. rearrangements in all patients studied with PPBL further sug- In this particular patient, we had previously found the pres- gests that PPBL might in fact be a pre-malignant condition.13 ence in PBMC of two bcl-2/lg gene rearrangements in 1991.13 The absence of bcl-2/lg gene rearrangement in this particular We then sought evidence of bcl-2 rearrangements in blood NHL indicates that the tumor did not arise from a previously and tumor cells in order to verify whether this lymphoma was translocated , thus suggesting an unrelated event. Never- arising from a bcl-2 translocated clone or not. Two rearrange- theless, it is possible that B cell accumulation over time might ments in the MBR of the bcl-2 gene were again identified in increase the risk of other subsequent illegitimate recombi- PBMC collected on admission prior to chemotherapy (Figure nations and favor the development of a B cell malignancy. 3). No evidence of bcl-2/lg gene rearrangement was found in Owing to the possible role of EBV in the pathogenesis of lymphoma cells using our PCR analysis. In addition, immuno- PPBL, we investigated the possibility that our patient with peroxidase staining did not reveal Bcl-2 protein upregulation stage IV-B NHL might have an EBV-related lymphoprolifer- (data not shown). ative disorder but EBNA-1 mRNA could not be identified in EBV is a well-known agent involved in the pathogenesis of tumor cells using a sensitive PCR analysis. Although our endemic Burkitt’s lymphoma and NHL in immunocompro- results indicate this lymphoma was not EBV-induced, they do mised patients. Because EBV has also been identified in cells not exclude a possible role for EBV in the pathogenesis of of patients with PPBL,16,17 we hypothesized that our patient PPBL. Using a reverse transcriptase PCR assay, we have might have an EBV-related lymphoma. Several genes are recently shown that EBNA-1 was expressed in all seven tested believed to play a critical role for the immortalizing function patients with PPBL while only one of seven normal controls of EBV; of these, EBNA-1 is essential for viral replication and was positive.25 Similarly, a specific fragment of the LMP-1 always expressed in NHL associated with EBV.23 Despite gene was present in all seven PPBL patients but undetected adequate RNA extraction, no EBNA-1 signal could be ident- in PBMC of normal subjects. Our recent data and others16–18 ified in lymphoma cells of this patient (Figure 3). strongly support the presence of a latent EBV infection in patients with PPBL. HLA-DR7, present in most PPBL patients, might potentially play a role in facilitating viral infection. This Discussion antigen has been associated with a higher incidence of chronic persistent B and unresponsiveness to hepa- PPBL is a rare disorder of unknown etiology and unclear natu- titis B vaccines, perhaps indicating that the HLA-DR7 pheno- ral history The stability of B cell proliferation over time, a type is associated with an inadequate immune response polyclonal cell population and the usually indolent overall against this virus and possibly others as well.26,27 clinical course of these patients suggest that PPBL is a benign In summary, we describe the first case of malignant lym- condition. The emergence of a clonal population in some phoma occurring in a patient with PPBL but our molecular patients24 and our reported case of B cell NHL associated with analyses do not suggest that bcl-2 or EBV are directly involved a monoclonal serum IgM raise, however, the possibility that in lymphoma genesis. Whether patients with PPBL are indeed PPBL may potentially evolve toward an . at increased risk of hematologic malignancy remains unclear Lymphoma following B cell lymphocytosis J Roy et al 1030 at the present time and will require longer follow-up in more Multiple bcl-2/lg gene rearrangements in persistent polyclonal B- patients. Meanwhile, we believe it is mandatory to follow cell lymphocytosis. Br J Haematol 1997; 97: 589–595. these patients prospectively and report all cases of lymphoid 14 Delage R, Roy J, Jacques L, Darveau A. All patients with persistent polyclonal B-cell lymphocytosis present bcl-2/lg gene rearrange- malignancies. ments. Leuk Lymphoma 1998 (in press). 15 Larsen CJ, Seite P, Hillion J, D’Agay MF, Berger R. Some recent aspects of the molecular biology of human lymphoma. Nouv Rev Fr Hematol 1993; 35: 37–40. References 16 Chow KC, Nacilla JQ, Witzig TE, Li CY. Is persistent polyclonal B lymphocytosis caused by Epstein–Barr virus? A study with poly- 1 Gordon DS, Jones BM, Browning SW, Spira TJ, Dale NL. Persistent merase chain reaction and in situ hybridization. Am J Hematol polyclonal lymphocytosis of B lymphocytes. New Engl J Med 1992; 41: 270–275. 1982; 307: 232–236. 17 Mitterer M, Prescota N, Fend F, Larcher C, Schwarzmann F, Coser 2 De Jaureguiberry JP, Pignon D, Galzin M, Carli P, Jaubert D, Chag- P, Huemer HP. Chronic active Epstein–Barr virus disease in a case non A. Persistent polyclonal B-cell lymphocytosis with binu- of persistent polyclonal B-cell lymphocytosis. Br J Haematol 1995; cleated lymphocytes in a male patient. Rev Med Intern 1997; 90: 526–531. 18: 258. 18 Larcher C, Fend F, Mitterer M, Prang N, Schwarzmann F, Huemer 3 Perreault C, Boileau J, Gyger M, de Bellefeuille C, D’Angelo G, HP. Role of Epstein–Barr virus and soluble CD21 in persistent ´ ´ Belanger R, Lacombe M, Lavallee R, Bonny Y, Paquin M, Brochu polyclonal B-cell lymphocytosis. Br J Haematol 1995; 90: 532– S. Chronic B-cell lymphocytosis. Eur J Haematol 1989; 42: 361– 540. 367. 19 Lawlor E, Murray M, O’Brian DS, Blaney C, Foroni L, Sarsfield P, 4 Troussard X, Flandrin G. Chronic B-cell lymphocytosis with Condell D, Sullivan F, McCann SR. Persistent polyclonal B lym- binucleated lymphocytes (LWBL): a review of 38 cases. Leuk phocytosis with Epstein–Barr virus antibodies and subsequent Lymphoma 1996; 20: 275–279. malignant pulmonary blastoma. J Clin Pathol 1991; 44: 341–342. 5 Agrawal S, Matutes E, Voke J, Dyer MJ, Khokhar T, Catovsky D. 20 Casassus P, Lortholary P, Komarover H, Lejeune F, Hors J. Ciga- Persistent polyclonal B-cell lymphocytosis. Leukemia Res 1994; rette smoking-related persistent polyclonal B lymphocytosis – a 10: 791–795. premalignant state. Arch Pathol Lab Med 1987; 111: 1001. 6 Troussard X, Valensi F, Debert C, Maynadie M, Schillinger F, Bon- 21 Azar HA, Espinoza CG. Diagnostic immunohistochemistry and net P, Macintyre EA, Flandrin G. Persistent polyclonal lympho- electron microscopy of ‘undifferentiated’ malignant tumors. In: cytosis with binucleated B lymphocytes: a genetic predisposition. Rose NR, Friedman H, Fahey JL (eds). Manual of Clinical Labora- Br J Haematol 1994; 88: 275–280. tory Immunology, 3rd edn. American Society for Microbiology: 7 Carr R, Fishlock K, Matutes E. Persistent polyclonal B-cell lympho- Washington, 1986, pp 926–930. cytosis in identical twins. Br J Haematol 1997; 96: 272–274. 22 Brisco MJ, Tan LW, Osborn AM, Morley AA. Development of a 8 Bakshi A, Jensen JP, Goldman P, Wright JJ, McBride OW, Epstein highly sensitive assay, based on the polymerase chain reaction, AL, Korsmeyer SJ. Cloning the chromosomal breakpoint of t(14;18) for rare B- clones in a polyclonal population. Br J human lymphomas: clustering around JH on chromosome 14 and Haematol 1990; 75: 163–167. near a transcriptional unit on 18. Cell 1985; 41: 899–906. 23 Finke J, Fritzen R, Ternes P, Trivedi P, Bross KJ, Lange W, Mert- ¨ 9 Cleary ML, Smith SD, Sklar J. Cloning and structural analysis of elsmann R, Dolken G. Expression of bcl-2 in Burkitt’s lymphoma cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript cell lines: induction by latent Epstein–Barr virus genes. Blood resulting from the t(14;18) translocation. Cell 1986; 47: 19–28. 1992; 80: 459–469. ˆ 10 Korsmeyer SJ. Bcl-2 initiates a new category of oncogenes: regu- 24 Delage R, Darveau A, Jacques L, Huot L, Delage JM. Chronic B- lators of cell death. Blood 1992; 80: 879–886. cell lymphocytosis of the young woman: clinical phenotypic and 11 Rowan S, Fisher DE. Mechanics of apoptotic cell death. Leukemia molecular studies in five cases (Abstract). Blood 1992; 80: 447a. 1997; 11: 457–465. 25 Delage R, Ryckman C, Darveau A. Molecular analysis of Epstein– 12 Gribben JG, Freedman AS, Woo SD, Blake K, Shu RS, Freeman Barr virus gene expression in persistent polyclonal B cell lympho- G, Longtine JA, Pinkus GS, Nadler LM. All advanced stage non- cytosis (Abstract). Blood 1997; 90: 457a. Hodgkin’s lymphomas with a polymerase chain reaction amplifi- 26 Almarri A, Batchelor JR. HLA and infection. Lancet able breakpoint of bcl-2 have residual cells containing the bcl-2 1994; 344: 1194–1195. rearrangements at evaluation and after treatment. Blood 1991; 78: 27 Desombere I, Hauser P, Rossau R, Paradijs J, Leroux RG. Nonre- 3275–3280. sponders to hepatitis B vaccine can present envelope particles to ˆ 13 Delage R, Roy J, Jacques L, Bernier V, Delage JM, Darveau A. T lymphocytes. J Immunol 1995; 154: 520–529.