Isolation of fungal cellulase gene transcript from Penicillium spinulosum
A Master’s Thesis
Presented to the faculty of The College of Science and Mathematics Colorado State University – Pueblo
In Partial Fulfillment of the requirements for the degree of Master of Science in Biochemistry
By
Srivatsan Parthasarathy
Colorado State University – Pueblo
May, 2018
ACKNOWLEDGEMENTS
I would like to thank my research mentor Dr. Sandra Bonetti for guiding me through my research thesis and helping me in difficult times during my Master’s degree. I would like to thank Dr. Dan Caprioglio for helping me plan my experiments and providing the lab space and equipment. I would like to thank the department of Biology and Chemistry for supporting me through assistantships and scholarships. I would like to thank my wife Vaishnavi Nagarajan for the emotional support that helped me complete my degree at Colorado State University – Pueblo.
III
TABLE OF CONTENTS
1) ACKNOWLEDGEMENTS …………………………………………………….III
2) TABLE OF CONTENTS …………………………………………………….....IV
3) ABSTRACT……………………………………………………………………..V
4) LIST OF FIGURES……………………………………………………………..VI
5) LIST OF TABLES………………………………………………………………VII
6) INTRODUCTION………………………………………………………………1
7) MATERIALS AND METHODS………………………………………………..24
8) RESULTS………………………………………………………………………..50
9) DISCUSSION…………………………………………………………………….77
10) REFERENCES…………………………………………………………………...99
11) THESIS PRESENTATION SLIDES……………………………………………...113
IV
ABSTRACT
Cellulose and cellulosic materials constitute over 85% of polysaccharides in landfills. Cellulose is also the most abundant organic polymer on earth. Cellulose digestion yields simple sugars that can be used to produce biofuels. Cellulose breaks down to form compounds like hemicelluloses and lignins that are useful in energy production. Industrial cellulolysis is a process that involves multiple acidic and thermal treatments that are harsh and intensive. Enzymatic breakdown of cellulose is regarded as the most productive method for cellulolysis as it can occur under environmentally benign conditions. Cellulolytic enzymes, cellulases, are produced naturally by several organisms and synthesized industrially for commercial applications. Fungi are major producers of cellulases because of their requirement to contact and utilize plant products through cellulolysis. Our lab identified a cellulase synthesized by Penicillium spinulosum that has a higher activity as compared to other conventional fungal sources of cellulase. The study described here focuses on isolating the gene that codes for this fungal cellulase using a genetic approach. Cellulase gene targets were identified using degenerate primer PCRs and sequences having similarity to cellulases were selected. These PCR primers were then used to identify regions in fungal RNA that encoded cellulase. These regions were used to identify a possible coding sequence that can be constructed using cDNA libraries to yield a gene that codes for a functional cellulolytic protein. This study improves the understanding of the genetics of a cellulase gene in P. spinulosum and yields products that can be used to produce the high-activity cellulase in vitro.
V
LIST OF FIGURES
Figure No. Figure Name Page Number 1. Penicillium spinulosum on cellulose 4 2. Electroin micrograph of Penicillium mycelia 5 3. Penicillin structure 6 4. Cellulose monomer structure 9 5. Mechanism of action of cellulose oxidases 11 6. Mechanism of action of cellulose phosphorylase 12 7. Cellulolysis reaction 12 8. Fungal cellulase crystal structure 14 9. 5’ 3’ RACE reaction overview 18 10. Biofuel production pipeline 22 11. a Genomic DNA agarose gel electrophoresis 55 11. b DNA quantification 55 12. a Annealing temperature optimization 56 12. b Annealing temperature for all primer sets 56 12. c Expanded view of gradient PCR 57 13. a RNA agarose gel electrophoresis 61 13. b Analysis of two different RNA isolations 61 13. c pH optimization for RNA isolation 62 13. d Optimal RNA bands 62 14. a cDNA in agarose gel electrophoresis 63 14. b RT-gradient PCR in agarose gel electrophoresis 65 14. c RT-PCR of all primer sets 65 15 E. coli colonies after transformation 67 16. a Screening of transformants using primer A 68 16. b Screening of transformants using primer B 68 16. c Screening of transformants using primer C 68 16. d Screening of transformants using primer D 68 17. a RACE reaction in primer G 71 17. b RACE reaction repeated using same G primers 71 18 PCR using mixed batch of primers 72 19. a Genomic DNA contamination in RNA isolation 74 19. b Effect of pH of phenol in RNA isolation 74 19. c Effect of incubation times in RNA isolation 75 19. d Effect of number of ethanol washes in isolation 75 19. e Optimal RNA prep. in gel electrophoresis 76 20. Comparison of genomic DNA isolation 83 21. Overview of TA cloning 91 22. TA cloning strategy 92 23. RACE reaction overview 94
VI
LIST OF TABLES
Table No. Table Name Page Number 1. Standard Growth media composition 25 2. Probe sequences of cellulase DNA 29 3. PCR reaction mixture 31 4. RT master mix composition 37 5. Cloning reaction components 38 6. RACE buffer mix 42 7. 5’ RACE cDNA reaction 42 8. 3’ RACE cDNA reaction 43 9. RACE master mix 43 10. RACE product PCR 44 11. Nested Mixed batch PCR mix 45 12. Optimal annealing temperatures 58 13. BLAST analysis of amplified sequence 69 14. Optimization of RNA isolation protocol 90 Scheme 1. P. spinulosum gene isolation strategy 79
VII
INTRODUCTION
1
Cellulose is the most abundant carbohydrate polymer on earth and comprises a major portion of
the biomass in landfills. It has been found that plants annually generate 180 billion tons of cellulose
worldwide (Sticklen 2008). According to the Environmental Protection Agency (EPA), up to 1,600
landfill sites have been created in the USA which accommodate up to 250 million tons of cellulosic
waste in 2010. The use of cellulose and cellulosic byproducts in modern times is extensive and
therefore, the modification of cellulose and its byproducts and the disposal of these materials in a
cost- and energy-effective manner are a major topic in environmental and biomass conversion
literature. Cellulose is notably resistant to depolymerization by chemical means. Much of the
recent literature deals with methods that treat cellulose from different sources with a combination
of chemical and enzymatic treatments to reduce its crystallinity and size (Cheng, Varanasi et al.
2011). Most of these applications warrant the breakdown of cellulose, a polymer of glucose subunits linked through β-1,4-linkages. One of the most efficient ways to breakdown cellulose is by using cellulases, which are enzymes found in bacteria isolated from ruminant stomachs and fungi. Use of these enzymes not only increase the yield of the reaction but also helps in minimizing the hazardous effluents that are obtained as a result of other harsher processes like using high
temperature and pressures (Deguchi 2006) or hydrolysis using very low pH acids (Fan 1987).
Previous research in Dr. Bonetti’s lab detailed the isolation of a fungal cellulase protein from
Penicillium spinulosum. A P. spinulosum protein band (ca. 105 kDa) containing β-glucosidase
activity, obtained from size exclusion chromatography, was characterized by HPLC/MS/MS. This
band showed homology to two P. chrysogenum peptides (Wheeler et al. 2011). This led to the
hypothesis that isolation of the transcribing portions of a P. spinulosum cellulase gene may help
reconstruct the gene sequence and improve the bioavailability of the enzyme using molecular
cloning strategies. This knowledge can then be used in several applications that have immense
2 potential and benefit in environmental and industrial applications. Examples of these cellulase applications include digestion of landfill wastes and reduction of landfill size, conversion of cellulosic wastes to biofuel feedstock, and modification of carbohydrate-rich food, paper or wood products.
FUNGI
Fungi are a group of organisms that belong to a kingdom of eukaryotic organisms. Although the classification of fungi as a separate kingdom started in the early 18th century, the importance of mycology grew only during the late 19th century (Bruns 2006). Fungi can range from being microscopic to macroscopic. The most important characteristic that demarcates fungi from other kingdoms like plants, animals, protists and bacteria is the presence of a cell wall made of chitin.
There are other characteristics that make it a monophyletic group, which is a group with a common ancestor (Hibbett, Binder et al. 2007). In the field of mycology, all fungal organisms come under a group of “eumycetes” that differ from myxomycetes (slime molds) and oomycetes (water molds)
(McGinnis and Tyring 1996). Previous classification of organisms into different kingdoms was based on certain morphological and observable features but with the advances in molecular techniques, classification started to be based on the ribosomal genes. Recent classifications of fungi and other organisms are also based on DNA sequences (Hibbett, Binder et al. 2007).
Most fungi grow as hyphae which are cylindrical structures that contain nuclei and are the basic unit of every fungus. These hyphae form interconnected networks through apical budding and branching that lead to the formation of mycelia (Harris 2008). Even though hyphae and mycelia are microscopic, the network becomes extensive which makes the mycelia visible or macroscopic.
These mycelia usually bear a spore-bearing fruiting body called sporangia at their tips. The fungi
3
are classified into Basidiomycetes, Ascomycetes and Zygomycetes according to the types and
shapes of sporangia or the fruiting body (Heitman 2006).
Figure 1- Association between Penicillium and wheat bran surface (Suresh , 2015).
Fungi differ from plants in many ways. One of the most important differences is that the fungal
organisms lack chloroplasts (Storck and Alexopoulos 1970). Chloroplasts are organelles that are responsible for plants being autotrophic. Without chloroplasts, fungi depend on other sources for food, which makes them heterotrophic. Fungi need a substratum to grow on that is rich in carbon and water (Blackwell 2011). This is the reason why most of the fungal molds and mushrooms,
4
which are largely representative of the fungal community, grow on materials such as plants that are rich in carbon and water (Fig. 1). This makes sense because fungal cell walls are largely composed of different kinds of carbohydrate polymers like alpha and beta glucans, chitins and mannans which may not be digested by fungal cellulases (Qin 2009). Fungi have the ability to release enzymes or proteins that are capable of breaking down the chains of sugars in their food sources which are rich in carbon, thus allowing them to utilize the polysaccharides for anchorage and other purposes. These polysaccharide-degrading enzymes mostly belong to the class of enzymes known as cellulases (Keller, Turner et al. 2005). This type of enzyme, a fungal cellulase, will be the major focus and the foundation for this research.
Penicillium
Penicillium is a genus of ascomycetous fungi that has their spores stored in a sac-like structure
called “ascus”- thus the name ascomycete. This genus is among the most commercially used fungi
due to medicinal use (Drews 2000).
http://www.uoguelph.ca/~gbarron/MISC2004/penicill.htm
Figure 2 - Electron micrograph of Penicillium mycelia with asci and conidia. This type of fungus was first described in 1809 as Penicillium which means “Painter’s brush” in
Latin (Link 1809) because of the shape of their conidiophores (asexual fruiting body) (Fig. 2) This
genus is also used in the food industry because of its ability to produce polysaccharide-degrading
5
enzymes like cellulases, and as most foods contain carbohydrate components, the breakdown of
polysaccharides is necessary for proper food digestion (Keifer 2008). The pretreatment of
agricultural silage with xylanases and cellulases has been proven to improve the nutritional value
of the grains and other foods, and improves and aids the digestive process in human gut and in
other animals.
Penicillin
One of the most important chemicals that revolutionized the field of medicine is penicillin. This
antibiotic was named after its fungal source Penicillium. In 1928, Professor Alexander Fleming serendipitously discovered that the presence of a Penicillium species responsible for inhibiting the
growth of certain gram positive bacteria (Fleming 2001). Due to its use as an antibiotic, penicillin
is regarded as one of the most important discoveries of the 20th century (Drews 2000). Professor
Alexander Fleming received the Nobel Prize in medicine for his work in 1945. Professors Florey and Chain were the first to purify and concentrate the antibiotic and make it available for human consumption. The structure of the beta lactam ring in penicillin that disrupts bacterial cell wall formation is seen in Fig. 3. The use of this antibiotic has waned because many patients are allergic to penicillin and many microorganisms have developed resistance to penicillin (Bhattacharya
2010).
R =Alkyl group
Wikipedia.org
Figure 3 - Backbone structure of penicillin.
6
Commercial applications of Penicillium species
Recently, there have been many commercial uses of Penicillium species that are reported in varied
industries ranging from fermentation to pharmaceutical industry. P. camemberti and P. roqueforti
are molds found in different cheese varieties. Some of the Penicillum molds produce anti-fungal
agents. P. citrinum is another important Penicillium species that yields a chemical called citrinin
(Wyllie 1945). This is actually a nephrotoxin and, as it is isolated from a fungal species, it is also referred to as a mycotoxin. Citrinin is usually used in laboratories as a reagent that induces mitochondrial permeability and also disrupts respiration by acting on Complex III in the respiratory chain (Chagas, Oliveira et al. 1992). P. simplicissium is a fungal species that helps in plant growth by inducing systemic defense mechanisms in plants against plant pathogens. This
Penicillium species is also referred to as plant-growth promoting fungus (PGPF) (Hossain, Sultana et al. 2007). Some of the Penicillium species causing rots and fungal diseases are dangerous because of the release of fungal toxins called mycotoxins. Penicillium expansum causes soft rots in apples and other fruits (Lewis, Pierson et al. 1963). Penicillium species are a major producer of cellulase enzymes, which allow them to anchor to the surface of plants and survive without added nutrition. Recently there has been an emergence of penicillin resistant strains of bacteria, which have been creating problems in lot of animals and humans (McNulty, Boyle et al. 2007). Penicillin derivatives are now used as therapeutic options to avoid the allergic reactions due to penicillin therapy and to combat resistance to the penicillinases (Schiavino, Nucera et al. 2009).
Penicillium spinulosum
Due to the numerous applications of the Penicillium species, they have been studied and researched extensively. There are a lot of Penicillium species which have several applications and Penicillium
7
spinulosum is one of them. One of the most important applications of P. spinulosum is its use in
taxonomy and classification. P. spinulosum is used as a model organism in the evolutionary classification of fungal organisms (Kim, You et al. 2014). This species is also known to release
spores that may cause obstruction in the lungs and lead to inflammatory disorders (Jussila,
Komulainen et al. 2002). This fungal species produces higher amounts of fats than other fungi
(Shimi, Singh et al. 1959). The fat production in P. spinulosum is also seen to increase with
exposure to cane molasses showing a possible connection between the carbohydrate source and
fat production in fungal species (Khan and Walker 1961). P. spinulosum also results in allergic
and potentially lethal reactions in sensitive individuals. A recent case of ulcerative keratinitis
suggests an allergic reaction caused in the human body as a result of exposure to the P. spinulosum
spores. This is caused when an overexposure to this species affects the eyes by causing
inflammatory reactions in the cornea, the front part of the eye (Thomas 2003). The spores of this
species are also known to cause a serious case of otomycosis in which the outer ear canal is infected
(Talwar, Chakrabarti et al. 1988). P. spinulosum is an excellent consumer of cellulose, produces cellulase, which recently was reported to be of a higher activity than the cellulases from traditional sources such as Penicillium chrysogenum (Wheeler et al. 2011).
CELLULOSE
Cellulose is an organic compound that is made up of repeating glucose units. As it is a polymer of glucose monosaccharides, cellulose (Fig. 4) is a polysaccharide which is made of repeating D- glucose units linked in a β (1-4) manner (1994).
8
Wikipedia.org
Figure 4 - Cellulose showing cellolbiose repeating units. Cellulose is a major component of plant cell walls and algal cell walls. In plants, the cellulose is
often linked to other polymers including xylans and the phenolic lignins. Cellulose is also found
in traces in oomycetes and is secreted in small amounts by certain types of bacteria and is the most
abundant organic polymer found in nature because of its abundance in plants and trees (Klemm,
Heublein et al. 2005). Cellulose is used in a lot of different types of industries because of the
variation in available structures like amorphous and crystalline forms. Cellulose was first used to produce a fiber called rayon, which is also called artificial silk. This revolutionized the textile industry and now cellulose is an indispensable part of the textile industry (Klemm, Heublein et al.
2005). Cellulose is also an important component of paper and hence the paper industry also utilizes cellulose. It is employed in making paper, paperboards and card stocks (Sponsler 1923). Cellulose is also the main component of cotton fiber. Cellulose is also used in pharmaceutical industry where it is an important component of the inactive fillers used when making a capsule (Niwa, Takaya et
al. 1995). Humans cannot degrade cellulose like most of the ruminant animals. Ruminant animals
have cellulolytic microbes in their gut that aid in cellulose digestion whereas humans utilize
cellulose to excrete other waste. In this case, cellulose is used to bind other waste materials together
and is commonly referred to as “dietary fiber” (Joshi and Agte 1995). Cellulose is also an integral
part of several scientific research processes. Some of the thin layer chromatography techniques for
separating biomolecules require cellulose fibers to be the stationary phase. Cellulose is also used
9
in some techniques of liquid filtration. Apart from the direct use of cellulose, the polysaccharide
can be converted to different simple sugars that have their own commercial applications.
Clostridium species use cellulose and break it down into simple sugars, and then ferment the sugars
into butanol, which is an energy source that is not prevalent in nature (Nakayama, Kiyoshi et al.
2011). Cellulose can also be broken down into glucose, a monosaccharide, that can then be
converted to glycerol (Negoi, Trotus et al. 2013). This glycerol has its own applications in the
manufacture of wax and candles. Recently it was shown that glycerol can be converted to ethanol
by a simple fermentation process. This ethanol can then be used as biofuel. Thus, it is possible to
optimize a method of manufacturing biofuel using cellulose from landfill waste and other
cellulosic waste (Yazdani and Gonzalez 2007). This requires a complete breakdown of cellulosic
wastes which can be achieved by enzymatic methods through cellulases and other hydrolases,
many of which have fungal origins.
FUNGAL CELLULASES
Cellulase is the general name given to a group of enzymes that catalyze the hydrolysis of cellulose
and other related polysaccharides. The cellulases are also given different names such as endo-1,4-
beta-D-glucanase, beta-1,4-glucanase, beta-1,4-endoglucan hydrolase etc. depending on the the
enzymatic mechanism, source, and method of production. The mode of action of cellulases is the
hydrolysis of the 1,4 beta-D-glucosidic linkages in cellulose (Jermyn 1953). Based on the mode
of action, the enzymes can be descriptively categorized as follows:
1) Endocellulases – This type of enzyme mainly cleaves the internal amorphous sites in
cellulose in a random fashion. This results in the formation of new chain ends. Cellulase 9A from
Thermobifida fusca (TfCel9A) is one such example of endocellulases (Irwin, Shin et al. 1998).
10
2) Exocellulases – This type of enzyme cleaves two or four glucose residues in cellulose from
the ends of chains produced by the action of endocellulases. This enzyme can also be referred to
as a cellobiohydrolase (CBH). Since it cleaves a polysaccharide into disaccharides, the resulting
products after the action of this enzyme are cellobiose residues. Recently CBHs were also shown
to produce tetrasaccharides (Zverlov, Schantz et al. 2005) or cellotetraoses. Glucanases or β-
glucosidases also belong to this group of enzyme. There are two types of exocellulases based on
the sides from which the enzyme digests. The enzyme which digests processively from the
reducing end is referred to as CBHI and the enzyme which digests processively from the non-
reducing end is referred to as CBHII (Berghem and Pettersson 1973).
3) Cellobiases – This is a group of enzymes which cleaves the product of exocellulases,
cellobiose, into individual monosaccharides (glucose). These are usually found in association with
other endo or exocellulases.
4) Oxidative cellulases – Another form of degradation of the cellulose polymer is by
depolymerization using oxidative enzymes and radicals. These groups of enzymes usually operate
by metal-dependent mechanisms (Nono, Ohno et al. 1991). Cel61B was isolated from Hypocrea
jecorina is one such example (Karkehabadi, Hansson et al. 2008).
Figure 5 – Mechanism of action of cellulose oxidases.
11
HO HO HO HO HO O O O O O HO HO O HO O OH HO HO HO O Cellulose = (Glucose) n HO
2- Cellulose HPO4 phosphorylase
HO HO HO HO HO O O HO O O HO O O O P OH HO HO O OH HO O O OH HO Glucose 1-phosphate 1. Cellulose = (Glucose) n-1
Figure 6 – Mechanism of action of cellulose phosphorylases. 5) Cellulose phosphorylases – These are a set of enzymes that depolymerize cellulose using phosphate groups instead of water (Reichenbecher, Lottspeich et al. 1997). Recently a set of
Cellobionic acid phosphorylases (CBAP) were isolated from various bacterial and fungal sources and their crystal structure was identified (Nam, Nihira et al. 2015).
The products of cellulases according to enzyme type are shown in Figures. 5 through 7.
Wikipedia.org
Figure 7 - Cellulolysis reactions.
12
Apart from all these types of cellulases, some of the enzymes are differentiated based on the
mechanisms they use to break down cellulose polymers. Based on this, the enzymes can be
classified as progressive or non-progressive types. In the progressive type of cellulase, the enzyme
continues to interact with the same strand of polysaccharide until it is completely broken down
into glucose monomers. On the other hand, the non-progressive type of cellulases act on different strands of polysaccharide even after some of the strands are completely hydrolyzed into monomers
(Bayer, Chanzy et al. 1998). Mostly cellulases operate by depolymerizing cellulose to beta-D- glucose, which is called complete cellulolysis. In many bacteria, the cellulase is in a complex consisting of all five types of cellulases that were described above. These supramolecular complexes are commonly referred to as cellulosomes that are about 3000 kDa in size and contain
26-30 chains of 38-210 kDa polypeptides. So far, cellulosome enzymes are found to be coded by a sequence of 19 genes in anaerobic fungi (Bayer, Chanzy et al. 1998). Cellulases help break down the outer cell wall of plants in the guts of herbivorous animals where they are produced by symbiotic bacterial populations. Apart from ruminants, most other animals, including humans, do
not have the capacity to breakdown cellulose, as they do not produce endogenous cellulases. The
usual mechanism for breakdown of cellulose is by employing the process of fermentation. This
process requires more energy than the actual amount of energy obtained by breaking down
cellulose and hence is an energy-requiring process (Robert and Bernalier-Donadille 2003).
Mode of Action
There are many models proposed for the mode of action of cellulases in the hydrolysis of cellulose
polymers, but the most accepted modes of action are the diffusion model and swelling model. X-
ray crystallographic studies suggest that fungal cellulases have a two-domain structure (Fig. 8).
13
One is the catalytic domain (CD) and the other is the cellulose binding domain (CBD). These two
domains are connected by a flexible linker which has three disulfide bridges that have a strong
functional significance (Sulzenbacher, Shareck et al. 1997, Sonan, Receveur-Brechot et al. 2007).
CD CBD
Wikipedia.org
Figure 8 - X-ray crystal structure of fungal cellulase with CD and CBD domains labeled. In the diffusion model, the substrate has to be insoluble so that the enzyme diffuses over the
substrate in a caterpillar-like fashion. The cellulose binding domain was found to have a major
role in this diffusion mechanism (Jervis, Haynes et al. 1997). But some of the cellulases from other
sources lack the cellulose binding domain. These are mostly endoglucanases. This absence of a
cellulose-binding domain makes them swell on the surface of the substrate and hence is called the
swelling model. This mechanism does not require the substrate to be insoluble (Sulzenbacher,
Shareck et al. 1997). Recently, a lot of research has focused on finding the signature sequences of cellulase DNA that code for these domains. These sequences can help recreate the protein or even manipulate its function for use in applications (Watanabe, Noda et al. 1998). As mentioned above, cellulose, in its depolymerized form, has many applications. As the cellulase enzymes catalyze the depolymerization of cellulose, the amount of research on this class of proteins has drastically increased. Most of this research focuses on the parts or subunits of these proteins that can help in increasing the efficiency and bioavailability of cellulases.
14
PREVIOUS RESEARCH
Recently, Wheeler et al. 2008, reported that a high activity cellulase enzyme was isolated from the
P. spinulosum source. Cellulase-containing fractions were isolated using ion exchange and size exclusion chromatography and subsequently concentrated and analyzed using SDS-PAGE. The
105 kDa band which contained the protein of interest was then digested prior to peptide analysis.
The peptide sequences were analyzed using HPLC/MS/MS at the Proteomics and Metabolomics
Facility at Colorado State University, Fort Collins. The analysis identified peptide sequences that were matched with 95% certainty for genus and analogous protein size to that of Peniciliium chrysogenum glycohydrolases. These peptide sequences having the greatest homology to fungal hydrolases and beta-glucosidases are shown below using protein sequence alignment with the global protein sequence data.
Fungal Peptide Homology for 105 kDa Protein Band
Penicillium marneffei has been reclassified as Talaromyces marneffei. These sequences were taken as the base sequences for the in vitro recreation of the cellulase gene that may assist in optimizing the bioavailability and in vitro production of the cellulase proteins or certain domains of the whole protein.
15
MOLECULAR BIOLOGY TECHNIQUES
Molecular biology techniques are used in many biochemical and biomedical studies. Molecular
biology is a science that deals with the study of molecular interactions in a biological unit where the changes in a system are based on the changes in fundamental constituents like DNA, RNA and proteins. By studying the molecular basis of a particular cell function or of any biological unit, one can recreate the events as happening inside the unit to test for changes in behavior, function, and metabolism. The foundation of any molecular biological study stems from the central dogma of biology that states that the DNA inside the nucleus is transcribed into RNA which gets translated into proteins in the cytoplasm. Thus, the primary sequence of the DNA is only indirectly responsible for the overall function of the protein that is guided by other events like transcription where the RNA is synthesized from the DNA blueprint and further processed by capping, tailing and splicing which lead to the retention of only the sequences that are required for the generation of proteins (exons) while the rest is discarded (introns). However, this does not preclude further processing of the nascent protein by posttranslational modification. The sequences of this mRNA
(RNA with only exons) can also be used to track the nature of proteins. Most of the tools of molecular biology are based on these three biomolecules - DNA, RNA and proteins and hence track their presence and can quantify and locate the protein of interest. Most of the techniques used
in this project are related to molecular biology and they include techniques such as
1) PCR
2) Reverse transcription
3) Gel electrophoresis
16
4) BLAST
5) Cloning and transformation, and
6) Sequencing.
These techniques were used in a manner specific to the biomolecule of interest in the project and
are described below.
1) PCR – Polymerase chain reaction (PCR) is a technique in which a portion of the DNA can
be amplified to yield millions of copies of DNA. This is done by isolating the DNA and using
oligonucleotide primers that are 18-21 base pairs (bp) long, bind to complementary sequences and
initiate DNA amplification of the specific sequence. Amplification occurs by a process of
thermocycling where changes in temperature lead to separation and annealing of DNA strands and
lead to amplification of the DNA of interest. This method is popular world-wide as it is used in a many applications from forensic DNA analyses to genetic screening for diseases (Saiki, Gelfand et al. 1988).
2) RACE PCR – Rapid Amplification of cDNA Ends (RACE) PCR is a type of PCR that is usually employed to find the sequence of a full-length gene that codes for a whole protein or subunits of a protein. It was first introduced by Schaefer (Schaefer 1995). The usage of both the 5' and the 3' RACE procedure was first demonstrated using the human actin gene family (Chenchik,
Diachenko et al. 1996). This method uses the RNA sequence which is reverse-transcribed to DNA
whose sequence is complementary to RNA and hence called complementary DNA (cDNA) and
the ends of this cDNA are used to isolate the transcribing region. There are two different strategies
for using RACE-PCR and which strategy is employed depends on the RNA ends targeted. The 5’
RACE utilizes an anti-sense gene specific primer (GSP) that binds to the RNA and forms a
template cDNA. After this reaction, enzyme terminal deoxynucleotidyl transferase (TdT) adds a
17
string of nucleotides, which can then be used for further amplification using PCR. In the 3’ RACE,
the poly-A tail that exists in all eukaryotic mRNAs is utilized for the cDNA synthesis and then a
Figure 9 – Overview of 5’ RACE (Left) and 3’ RACE (Right) PCRs (SMARTer RACE cDNA kit.CloneTechlabs).
special adapter sequence is designed to bind to the 5’ end, which is later used in the PCR
amplification. This is clearly elucidated in Fig. 7. There has been a lot of evidence where this
strategy is used to isolate specific sequences that belong to the gene or which amplifies the whole gene itself. There are lot of cases in which RACE has yielded subunits of a complex protein that can be reconstructed using different subunits. Previous research suggests that the use of the RACE reaction is one of the most efficient ways to isolate fragments of a cellulase enzyme. Inoue et. al. used this strategy to isolate portions of a cellulase gene from a symbiotic protist, Coptotermes formosanus (Inoue, Moriya et al. 2005). Similarly, a cellobiohydrolase (CBH) gene from
Chaetomium thermophilum has been isolated using RACE-PCR by Li et. al (Li, Li et al. 2009). 3'
RACE-PCR was selectively used in cloning, characterization and expression of the first
Penicillium echinulatum cellulase gene by Rubini et al. (Rubini, Dillon et al. 2010). Thus, RACE-
18
PCR was chosen to be the optimal method for this study which involves identifying cellulase-
related DNA fragments from a Penicillium species.
3) Reverse transcription –Transcription is a process which happens in all living organisms
where the DNA is used as a template to create RNA. This process requires an enzyme RNA
polymerase which catalyzes the polymerization of ribonucleotides. In some cases, viruses use a
special enzyme called reverse transcriptase to do the reverse process where RNA is used as the
template and a complementary DNA or cDNA strand is transcribed. This process is used in vitro
where reverse transcriptase is used with RT buffers provided by the manufacturer to catalyze the
conversion of RNA to cDNA (Temin and Mizutani 1970).
4) Agarose gel electrophoresis – This is a technique for visualization of biomolecules. This
technique uses the molecular sieving effect for separating and visualizing nucleic acids. This
technique separates the biomolecule based on their molecular size-to-charge ratio (Aaij and Borst
1972). A DNA reference ladder that has DNA fragments of known specific sizes is run in the gel
to provide a reference point to determine the relative size of the target DNA fragment. In the case of an agarose gel, the gel is made, along with a fluorescent dye called ethidium bromide, that intercalates with the DNA and allows the DNA to be visualized as a fluorescent band when analyzed under UV light.
5) BLAST – BLAST stands for Basic Local Alignment Search Tool. This is an online
bioinformatics tool that is often used to compare unknown sequences with the known sequences
using sequence alignment software. This program can identify the origin or the source and
sometimes even the identity of the DNA. This sequence alignment tool uses local alignment where
the sequence can be matched with reported sequences stored in a database like GenBank or other
nucleotide sequence databases. Based on the similarity of sequence, a calculated score is given
19
using an elaborate matrix algorithm and this score determines the level of similarity and how the
sequence in question is related to database sequences (Altschul, Gish et al. 1990).
6) Cloning – Cloning is a process by which the genetic material of a particular organism can
be manipulated. Most often in the lab, the cloning strategy used is molecular cloning where a
segment of foreign DNA usually capable of coding a protein that is not endogenous to the host
organism (vector) is integrated with chromosomal or extrachromosomal DNA (plasmid). The gene
of interest is carefully ligated into the recipient DNA at a specific sequence downstream from
promoters and other elements that will ensure its expression. This integrated DNA complex is
called a chimera which can express your protein of interest using the normal cellular transcription
and translation factors and enzymes. Molecular cloning is useful in a lot of applications and is
ubiquitous in most of the research labs involved in molecular biological studies.
7) DNA Sequencing – The most used technique is the Sanger’s automated sequencing
strategy. In this technique, the nucleotides are tagged with a fluorescent dye and contain the
dideoxy ribose nucleotides intended for DNA polymerization. The dideoxy nucleotides leads to
chain termination in a DNA sequence. This leads to the formation of a pattern of DNA sequences,
which when read at particular wavelengths, help identify the actual sequence of the DNA. Since
most of the protein amino acid sequence is based on the sequence of genomic DNA, knowing the
DNA sequence is of primary importance in any proteomics study. Because the cDNA copy of the
gene is the direct coding sequence of protein, knowing this sequence is of utmost importance.
SIGNIFICANCE
The work describes our investigations to identify portions of a fungal (Penicillium) cellulase gene.
Our interest in this research is due to the intense commercial importance of cellulases and their
20
environmental role in mitigation of landfill wastes. Elucidation of the coding sequence of a fungal
cellulase would provide an avenue for commercial production of enzymes that can be used to
breakdown cellulosic wastes in landfills with the ultimate goal of optimizing bioconversion of
these waste products to biofuels. The Bonetti lab has recently reported the production of cellulases
by P. spinulosum and P. fellutanum, that have been found to be highly active at 50 °C and pH 5.0,
which are useful parameters for industrial processes. The lab had successfully isolated cellulases
from P. spinulosum and P. fellutanum using size exclusion and ion exchange chromatography
columns. A cellulase fraction from P. spinulosum was sent out for partial protein sequencing.
Segments of protein sequences obtained by HPLC/MS/MS were analyzed and the corresponding
DNA sequences were found. These DNA segments were then used to design primers that were
capable of identifying gene segments closely related to a particular protein family (degenerate
primers), in this case, cellulases. In this thesis, we seek to isolate the transcribing portion of this
cellulase gene in P. spinulosum so as to clone the coding sequences of the gene in order to optimize
the availability of the enzyme for future studies. This study mainly focuses on collection of DNA
and RNA sequences in the form of cDNA that are closely related to the cellulase or beta-
glucosidase gene family which can later be utilized in studies of cellulase genes from particularly,
P. spinulosum.
We hypothesize that finding the transcribing portion of a high activity cellulase gene from P.
spinulosum can help us regenerate the gene and optimize its biological production and function.
There has been work done previously on other organisms with similar goals. Some have used
Southern blots using radioactive probes to detect the right gene but most of them have used the
RACE-PCR technique that will be used in this study as well (Cass, 1990; Chenchik, 1996). This
study can help find the optimal sequences necessary to isolate the appropriate coding regions from
21
the genomic DNA or RNA. Future research can also involve finding various segments of the
cellulase gene and combining them to express the protein.
Through this study, we aim to increase the production and availability of this high activity enzyme
so that can be used in various applications. Some of these applications are as follows. Fungal
cellulases have been the key ingredient in finding new sources of alternative energy using
biological starting materials. Cellulases have been used in the conversion of lignocellulosic
materials into subunits that can be used to obtain biofuels (Dashtban, Schraft et al. 2009).
Figure 10 - Schematic diagram of biofuel production from biomass.
22
A detailed overview of the process for obtaining biofuel through the use of fungal cellulases is
shown above (Fig. 10). This process of obtaining biofuels has gained importance because of the
abundance of cellulosic materials present in nature. On average, 40-50% of municipal solid wastes
(MSW) is cellulosic (Barlaz, 1998). It is hypothesized that using a molecular biology approach,
the gene responsible for cellulases can be isolated and its bioavailability can be optimized and can
be used to convert cellulosic materials found in wastes to usable biofuels.
Because this proposed study utilizes a reverse-transcription approach to isolate the sequences
associated with the gene, the information gained can also lead to targeted modifications of
conventional gene segments such as promoters leading to increased transcription and production
of a desired protein. Studies on viruses have validated this approach and resulted in the creation
and the use of novel promoters to increase the yields of proteins synthesized by vectors and cell
lines (Ke 2012). Our investigations could prove to be a foundation for the molecular
characterization of fungal cellulase genes and associated sequences as this is the first study of the cellulase coding genes in this organism (Penicillium spinulosum). Production of cellulase protein via recombinant methods is also likely to provide sufficient enzyme to explore the mechanisms of the P. spinulosum enzyme by additional methods including studying the enzyme’s kinetics, biochemistry and crystal structure, which can ultimately provide a more detailed picture of the structure and function of a fungal cellulase. In addition, our investigations would inform comparisons of sequence homology between the P. spinulosum cellulase and other cellulases including those from plant and animal fungal pathogens.
23
MATERIALS AND METHODS
24
FUNGAL CELL CULTURE
P. spinulosum was grown in the laboratory’s Standard Growth Media that has a specific
composition of nutrients including salts and sugars, some of which are required in larger quantities
(macronutrients) and some in very small quantities (micronutrients). The composition of the
Standard Growth Media is given below. In some instances, the media was modified and sucrose was substituted for the glucose (Sucrose Standard Growth Media).
Table 1. Standard Growth Media Composition
NUTRIENTS CONSTITUENTS CONCENTRATION CONCENTRATION
(mM) (g/L)
Macronutrients
Carbon Glucose, C6H12O6 320 57.6
Nitrogen NH4Cl 80 4.3
Phosphorus Na2HPO4 20 2.8
Sulfur Na2SO4 2 0.28
Buffer/Chelator Sodium citrate, 12.5 3
C3H4OH(COOH)2COONa
Citric acid, C6H8O7 12.5 2.2
Potassium K2CO3 3 0.42
25
Magnesium MgCO3 4 0.34
Sodium NaCl 20 1.2
Micronutrients (ppm) (mg/L)
. Iron Fe2SO4 7H2O 10 50
Zinc ZnCl2 5 10.4
. Manganese MnCl2 4H2O 5 18
. Molybdenum (NH4)6Mo7O24 4H2O 2 3.7
. Calcium CaCl2 5H2O 0.5 1.8
. Copper CuSO4 5H2O 0.4 1.6
Vanadium NH4VO3 0.2 0.46
Boron H3BO3 0.1 0.57
. Chromium Cr2(SO4)3 12H2O 0.1 0.93
. Nickel NiCl2 6H2O 0.1 0.4
. Cobalt CoCl2 6H2O 0.1 0.4
The principal carbon source (glucose) was prepared in distilled and deionized water that was half
of the total media volume. The rest of macro- and micro-nutrients were prepared in the other half
of the volume of distilled and deionized water. The carbon source and the salt solutions were
26
autoclaved at 121ºC for 25 min and combined aseptically after cooling. The overall
carbon/nitrogen molar ratio equaled 26:1 according to standard published protocol (Salt, 1985).
The pH of the solution was checked after autoclaving and combining the salts and sugar solutions
to determine whether the pH of the overall solution is 5.95. After cooling, the media was
distributed into smaller 500 mL wide-mouthed Erlenmeyer flasks to which 200 mL of media was
added to each flask. Each of the flasks containing liquid media was inoculated with 500 μL of a
prepared fungal spore suspension containing 0.12% (w/v) Tween 20 and 0.9% (w/v) NaCl. The
fungal cultures after inoculation were grown in a shaker for 8 days at room temperature and at
approximately 250 rpm. After 8 days, the fungal culture media was vacuum-filtered to isolate the
fungal mycelia from the media. The mycelia were weighed and stored in a -80 ºC freezer prior to
nucleic acid extraction.
DNA ISOLATION
After the mycelia were harvested, DNA had to be isolated in order to probe for cellulase fragments
using the degenerate primers designed. The DNA isolation was accomplished using
MasterPureTM Yeast DNA isolation kit from EPICENTRE Biotechnologies (Cat. No.
MPY80200). The DNA isolation procedure from the mycelia using this kit is described below.
Cells (mycelia) were weighed out and 0.5-1 g of cells were placed in a microcentrifuge tube. To
this sample, 300 μL of Yeast Cell Lysis Buffer (provided with the kit) and 1 μL of RNase A (5
g/L) were added and the mixture was vortexed. The suspended cells were incubated at 65 ºC
for 15 min to break open the cells. This step ensured that thick fungal cell walls were lysed. Cell
suspensions were then incubated on ice for 5 min and 150 μL of MPC protein precipitation reagent
(provided with the kit) was added and mixed well by vortexing for 10 sec. The mixture was
27
centrifuged at 10,000 rpm at 4 ºC for 10 min. The supernatant was transferred into a clean
microcentrifuge tube and 500 μL of isopropanol was added and mixed well by inverting the tubes
6-8 times. The reaction was centrifuged at 10,000 rpm for 10 min and the supernatant was
decanted. The pellet was washed with 500 μL of 70% ethanol by centrifuging the mixture at 10,000
rpm for 3 min. The supernatant was discarded and the ethanol wash was repeated. Ethanol was
removed completely using an air incubator at 37 °C for 15 min. To the dried pellet, 35 μL of 1X
TE buffer was added to dissolve DNA, as DNA is soluble in this buffer, and the nucleic acid
solution was stored at either -20 ºC or -80 ºC.
PRIMER DESIGN
Primers are important for initiation of DNA synthesis from selected template DNA in PCR
reactions. The primer sequence dictates which region of the DNA will be amplified during the
PCR process. The primer was designed using a bioinformatics tool called Primer3Plus
(http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi/). This is an online bioinfor-
matics tool that is free to access and use.
Sequences amplified using the degenerate primers were entered in the online (Primer3Plus)
software. Specific primer sets can be obtained if one of the primers was picked using the protein
sequence. Factors like GC content, melting temperature, sequence redundancy and GC cap were
carefully chosen to optimize the PCR efficiency to ensure maximum amplicon yield and accurate
sequence amplification. GC content is an indicator of how strong the primer anneals to the template
DNA as the base pairs have a triple bond between them, making it a stronger bond than A-T. A
50% GC content ensures that there is optimal binding between primer and the template that is
neither too strong nor too weak. A DNA melting temperature around 60C is important to ensure
28 that there is annealing (as it is harder to anneal at very high temperatures) and that there is no non- specific binding (impurities or non-specific nucleotides can bind to template DNA at low temperatures, resulting in false-priming).
Primers initially designed were based on the peptide sequence obtained from purified cellulase and resulted in a list of degenerate DNA sequences from which the optimal primer sets were identified.
The cellulase sequences used as the basis for primer design were based on protein sequence alignment with the global protein sequence data and are as follows:
The following degenerate primer sequences seen in Table 2 were used to probe for cellulase
DNA in P. spinulosum mycelia.
Table 2. List of Probe Sequences for Cellulase DNA
Primer name Primer Sequence Primer amount (nmol)
GRev60-559-F AACATGCTACCCCCTTCCTC 32.3
GRev60-559-R GGGTCAGGAAATCACTCGAA 27.8
FRevFirst123-F GAGCTCGGATCCACTAGTAACG 29.6
FRevFirst123-R TATCCTCAATTCGCCCTTG 33
29
ERev62-560-F GACCCGCTTAAACAACATGC 28.6
ERev62-560-R GGGTCAGGAAATCACTCGAA 27.2
DRev60-244-F GTCTACCGGACACTTTCACGA 42.1
DRev60-244-R CGGATTTGTCGCAGATTCAG 34.6
CRev60-388-F ACCCATGGCCAGACAGATAC 35.1
CRev60-388-R AATTGTCGCGACTTGTCATC 34
Brev-56-231-F TAGCGCGTTTACCGTAGCTA 38.9
Brev-56-231-R CGGGTTTGTCATGTGCTG 38.4
ARev64-450-F AGGTCTTCCTGATCGAAGCA 34
ARev64-450-R CGGCTCACTATCGTGTTTCA 38.1
PCR
The designed forward and reverse primers were used as markers for the start and the end of
amplification in the PCR reactions. Since the major goal of the project was to isolate fragments of
cellulase gene, PCR will consistently be used throughout the project. PCR reactions were carried
out in an EasyStart PCR tube according to Mix-in-a-Tube protocol provided along with the kit
(Cat. No – 6022-11).
30
Table 3. PCR Reaction Mixture
REAGENTS VOLUME (L)
Taq polymerase (2 units) 2
Forward primer (50 M) 1
Reverse Primer (50 M) 1
DNA (1g) 4
Deionized molecular biology grade water 17
The PCR reaction mixture is described without the PCR buffer and MgCl2 as these were already
present in the reaction tubes. The reaction mixture contained the following chemicals in specific
amounts as given above.
A. Gradient PCR
Because DNA yields obtained from sucrose (carbon source) media were higher than those from
glucose media, the sucrose-containing media’s fungal DNA was used as template for the gradient
PCR reactions that would determine the optimal annealing temperatures for each of the primers.
The PCR reaction was set up the same way in the EasyStart PCR tube as described in the previous
PCR protocol. The temperature cycle was set up differently as the PCR reaction was carried out in
a Stratagene Robogradient Thermocycler using the following cycle parameters:
Step 1: 94 ºC for 1 min.
31
Step 2: 94 ºC for 30 secs.
Step 3: 42 ºC – 60 ºC (at 2 ºC increments) for 45 sec.
Step 4: 72 ºC for 1 min.
Repeat Steps 2 to Steps 4 for 35 cycles.
Step 5: 4 ºC until cycling is terminated
The PCR tubes were removed from the thermocycler, holes were punctured in wax layer and the
underlying solution was used for detection of amplified DNA sequences by agarose gel
electrophoresis.
The PCR Reaction mixture was added to the top of the wax in the Easystart PCR tube. The PCR
reaction was performed using the following temperature cycle. The particular annealing
temperatures were decided based on a gradient temperature PCR which determined the optimal
annealing temperature. The gradient PCR thermocycler conditions were as follows:
Step 1: 94 ºC for 1 min.
Step 2: 94 ºC for 30 sec.
Step 3: 55 ºC for 45 sec.
Step 4: 72 ºC for 1 min.
Repeat Steps 2 to Steps 4 for 35 cycles.
Step 5: 4 ºC until cycle is terminated.
32
After the reaction cycles were completed, the PCR tubes were removed from the apparatus, holes
were punctured in the wax layer and the underlying solution was used for analysis of amplified
DNA sequences by agarose gel electrophoresis.
B. Agarose Gel Electrophoresis of PCR Products
A 1 % (w/v) agarose gel was cast by dissolving 1 g of agarose in 100 mL 1X TBE buffer and
heating it for 2 min. After the agarose was completely dissolved, the mixture was cooled for 5-10
min, 1 μL ethidium bromide (10 g/mL) was added and the gel was poured in the gel caster and
allowed to set for 30 min. The gel tray was filled with the running buffer (1X TBE). A10 μL
aliquot of the DNA sample was mixed with 2 μL of gel loading dye (6X) and loaded onto the cast
gel that was suspended in the running buffer. The gel electrophoresis was run at 100 V for 45 min.
The gel, after exposure to UV radiation, was imaged using a gel doc system (BioRad), which is an
imaging platform where the agarose gel is exposed to the UV light and ethidium bromide-linked
DNA bands are visualized and digitally recorded.
C. DNA Quantitation
To identify and represent DNA quantities as values, two methods were followed.
i) UV-visible spectrophotometric reading – DNA molecules are made of repeating units
of nucleotides, which consist of ribose sugars with nitrogenous bases containing
aromatic ring structures. These chemical components absorb light at far-UV range.
Other biomolecules, as opposed to DNA or RNA, absorb UV radiations at different
wavelengths. The ratio of absorbances at 260 nm and 280 nm indicate the purity of
33
DNA. The unknown DNA concentration is calculated by performing a standard curve
of absorbance at 280 nm using known DNA concentrations.
ii) ImageJ image analysis software – DNA run using agarose gel electrophoresis are
visualized as fluorescent bands when exposed to UV irradiation. These band intensities
are directly proportional to the concentration of DNA. The intensities of these DNA
bands can be found by calculating the pixel intensities across the bands using Pixel
Inspector (PI) application in the ImageJ software. This software measures pixel
intensity of the band and subtracts it from the background intensity in their x,y,z co-
ordinate location. These pixel intensities can be compared between various bands to
correlate them to the DNA concentration in each lane.
RNA ISOLATION (RI) PROTOCOLS
A. RI Procedure I
The RNA isolation protocol was adopted from Ganesan et. al which is routinely used to isolate
total RNA from recalcitrant yeast cells. An extensive description of Penicillium spinulosum RNA
isolation is provided below.
Frozen stocks of P. spinulosum cells (mycelia) were weighed and 1 g of the cells were transferred
to 1.5 mL microcentrifuge tubes. After thawing on ice, cells were resuspended in 270 μL of sodium
acetate buffer and 30 μL of 10% SDS (v/v), followed by the addition of 0.40 g of 0.5-0.6 mm
diameter glass beads. The mixture was then treated with 300 μL of hot phenol (pH 4.5-5.5
equilibrated with deionized water and heated to 65 °C). Vortex mixings consisting of a 1 min
vortex and 5 min incubation were repeated 6 times. The tubes were cooled in ice for 2 min and
mixed with 300 μL chloroform/isoamyl alcohol (24:1, v/v) by vortexing for 30 sec and were
34
centrifuged at 17,000 rpm for 5 min. The supernatant was treated with a 0.10 volume of 3 M
sodium acetate buffer (pH 7.2) and 2.5 volumes of 100% ethanol (200 proof), vortexed and
incubated at -70 ºC for 15 min. This mixture was then centrifuged at 17,000 rpm for 10 min at 4
ºC. The supernatant was discarded and 300 μL of 75% ethanol was added to the pellet, and
centrifuged at 17,000 rpm for 5 min at 4 ºC. This ethanol wash procedure was repeated twice. The
supernatant was discarded and the pellet was dried at 45 ºC for 10 min. The isolated RNA pellet
was diluted in 30 L of TE buffer and stored at -80 ºC until further use.
B. RI Procedure II
A second RNA isolation procedure was tried in order to optimize mRNA recovery. P.spinulosum cells were weighed and 1 g of these cells were taken in a 1.5 mL microcentrifuge tubes. The cells were treated with 300 L of hot phenol (pH of 4.5-5.5 equilibrated with deionized water and heated to 65 ºC). The mixture was heated at 65 ºC for 5 min and vortexed for 1 min (vortex mixing). This was repeated twice. The mixture was resuspended in 270 L of sodium acetate buffer, and 30 L of 10% (v/v) SDS, followed by the addition of 0.40 g of 0.5-0.6 mm diameter glass beads. Vortex mixings were performed 6 times. The reaction was centrifuged at 17,000 rpm for 5 min and the supernatant was treated with 300 L of chloroform/isoamyl alcohol (24:1, v/v) by vortexing for
30 sec, followed by centrifugation at 17,000 rpm for 5 min. The supernatant was treated with 0.10 volume of 3 M sodium acetate buffer of pH 5.2 and 2.5 volumes of 100% ethanol (200 proof), vortexed and incubated at -70 ºC for 15 minutes. This mixture was then centrifuged at 17,000 rpm for 10 min at 4 ºC. The supernatant was discarded and 300 L of 75% ethanol was added to the pellet, centrifuged at 17,000 rpm for 5 min at 4 ºC. This ethanol wash was repeated twice. The
35
supernatant was discarded and the pellet was dried at 45 ºC for 10 min. The RNA pellet is diluted
in 30 L TE buffer and stored at -80 ºC until further use.
C. RNA Sample Preparation
The RNA samples stored at -80 ºC were taken and thawed at room temperature. The samples were
denatured at 65 ºC for 10 min. RNA sample, 4-5 L was mixed with 16 L of the RNA loading
buffer.
D. RNA Gel Electrophoresis
For a 1% RNA gel, the following chemicals were mixed and heated in a microwave oven until the
agarose dissolved.
0.5 g agarose
5 ml 10X RNA gel buffer
35 mL deionized water
To the ingredients above, 9.5 mL of formaldehyde was added and the resulting mixture was cooled
down for 5 min. Formaldehyde was added to make sure the RNA was in a denatured state and had
not folded into hairpin or bent structures. Ethidium bromide was added just before pouring the gel
in a gel caster. The gel was then prepared in a gel caster and allowed to set for 30 min. The gel
was run in 1X RNA gel buffer at 65 V for 30 min.
36
REVERSE TRANSCRIPTION
The reverse transcription reaction was carried out according to the Omniscript Reverse
Transcription Reaction Kit (Cat. No. - 205110). All chemicals and enzymes except the cDNA
template were provided with the kit.
A Master Mix was prepared according to Table 4 below and used for the synthesis of cDNA. The
chemicals were mixed in the specific order shown.
Table 4. Master Mix Components
COMPONENTS OF THE MASTER MIX VOLUME (L)
10X Buffer RT (Kit provided) 2
dNTP mix (5 mM each dNTP) 2
OligodT primer (10 μM) 2
RNase inhibitor (10 units/μL) 1
Omniscript Reverse transcriptase (4 Units/L) 1
RNase-free water 7
RNA template (1g) 5
37
The reaction was mixed by vortexing for 5 sec and subsequently centrifuged at 5000 rpm for 10
sec. The reaction was incubated at 37 ºC for 60 min and placed in ice for 10 min. The cDNA was
then stored at -80 ºC until subjected to PCR.
RT-PCR (Reverse Transcription Polymerase Chain Reaction)
PCR was performed on the cDNA synthesized and hence the name Reverse Transcription
Polymerase Chain Reaction. The RT-PCR was carried out under the same conditions as the previous PCR (Refer to IVA.). In each reaction, 5 μL of cDNA was used and made up to 25 μL
with deionized molecular biology grade water.
CLONING
Cloning experiments on the DNA products obtained from the PCR of cDNA were carried out
according to the TOPO TA cloning kit for sequencing obtained from Invitrogen (Cat. No. – K
4530-20).
The following chemicals were mixed in the following order and to prepare the cloning reaction
and are shown in Table 5.
Table 5. Cloning Reaction Components
REAGENTS VOLUME (μL)
PCR product 3
Salt solution (provided with the kit) 1
Water 1
38
TOPO vector (provided with the kit) 1
(10 ng/L)
The cloning reaction was incubated at room temperature (22 ºC - 25 ºC) for 5 min. The cloning
reaction mixture was then cooled in ice for 5-10 min before transformation.
A. Transformation
Transformations were performed using the One shot competent cells protocol with the one shot
chemically competent E.coli cells (provided with the kit) from Invitrogen. The TOPO cloning
reagent, 2-3 μL, was added to the one shot chemically competent E. coli cells vial after thawing
the cells on ice. The vial was placed in ice and incubated for 10 min. The vial was heat shocked at
42 ºC in a water bath for 30 sec. The reaction was immediately placed on ice and 250 μL of S.O.C.
(super optimal broth with catabolite repression) media was aseptically added. The tube was
incubated at 37 ºC in a shaker at 100 rpm for 1 hr. Competent cells in tubes were plated on LB
kanamycin plates and incubated at 37 ºC for 18 hr. The TOPO vector carries a kanamycin resistant
gene marker. Colonies in the plate were picked and cultured in 10 mL of LB kanamycin broth to
select for plasmid minipreps (kanamycin final concentration = 50 g/mL).
B. Plasmid Miniprep
Plasmid Miniprep was performed according to the Qiagen QIAprep Miniprep kit with the buffers
provided along with the kit. (Cat No. 27104). The P1, P2, N3, PB, PE and EB buffers were
provided with the kit.
39
Bacterial cultures in 10 mL of LB Kanamycin broth were transferred to 1.5 mL microcentrifuge
tubes and were centrifuged at 10,000 rpm for 3 min. The supernatant was discarded. To the
bacterial pellet, 250 μL P1 buffer was added. To this, 250 μL of P2 buffer was then added and
mixed by inverting the microcentrifuge tube 4 to 6 times. For the cell lysis reaction, 350 μL of N3
buffer was added to this mixture and immediately mixed by inverting the tube for 4 to 6 times.
The reaction was centrifuged at 13,000 rpm for 10 min. The supernatants were taken and applied
onto QIAprep spin columns, centrifuged at 13,000 rpm for 30-60 sec and the flow-through was
discarded. The QIAprep spin columns were each washed by adding 0.5 mL of PB buffer to remove
trace nuclease activity and carbohydrate content in the prep by centrifuging at 13,000 rpm for 30-
60 sec. The flow-through was discarded. An additional wash was done by adding 0.75 mL of PE
buffer and centrifuging at 13,000 rpm for 30-60 sec to remove salts. Again, the flow-through was discarded. Before the final elution step, the column was centrifuged at 15,000 rpm for 1 min to remove residual wash buffers in the spin columns. Finally, the DNA in the spin column was eluted using 50 μL of EB buffer. Each spin column was placed over a clean 1.5 mL microcentrifuge tube,
50 μL of EB buffer was added. The column wth the DNA was allowed to stand for 1 min, which was followed by centrifugation at 13,000 rpm for 1 min. The flow-through was collected and agarose gel electrophoresis was performed on sample of the DNA to check for the presence of the plasmid. A PCR reaction was done on the isolated plasmid according to the Methods Section IVA.
M13 forward and M13 (-20) reverse primers (provided with the kit) were used for the PCR. The
PCR reaction products were run on agarose gels to find the length of the amplicons. The length should be around 201bp more than the expected length of the inserted fragment because the primers already amplify a 201bp region of the cloning vector. This was done to confirm integration of the DNA fragment into the vector.
40
C. Glycerol Stock Preparation
After finding the correct clones which had the right length of PCR amplicon after miniprep, the
transformed E. coli containing the plasmid of interest were stored as glycerol stocks that could be
used in the future for applications such as DNA sequencing. The following steps were followed to
prepare the glycerol stocks of the clones. First, 500 μL of each clone culture was placed in a screw
top vial. Then, 500 μL of sterilized and cooled 40% (v/v) glycerol was added to and mixed with
the culture in the screwtop vial. The mixtures were stored in a -80 ºC freezer until future use.
DNA SEQUENCING
DNA sequencing was performed by sending the DNA samples using M13F and R primers to the
CUGI (Clemson University Genomics Institute) at Clemson University. The DNA sequencing
facility at CUGI utilizes the Sanger sequencing strategy using ABI sequencers. The results were
displayed in both FASTA and sequence wave formats.
The results were further analyzed using the BLAST online software for analyzing the sequence
alignment with the known database of nucleotide sequences to find the closest hit with known
cellulase-related DNA sequences.
RACE-PCR
A. cDNA Preparation
RACE-PCR (Rapid Amplification of cDNA ends-Polymerase Chain Reaction) was carried out
using the SMARTer RACE cDNA amplification kit from Clontech Laboratories, Inc. All the
buffers except the RNA, cDNA template and gene specific primers were provided with the kit.
41
A RACE buffer reaction mix was initially prepared to be used for multiple reactions at the same
time. The following chemicals were added in the order and amounts given below in Table 6.
Table 6: RACE Buffer Mix Components
REAGENTS VOLUME (μL)
5X First-strand buffer 4
DTT (25 mM) 2
dNTP Mix (10 mM) 2
The following reagents were mixed in separate microcentrifuge tubes and added to begin the
reactions.
Table 7: 5’ RACE READY cDNA Reaction Components
REAGENTS VOLUME (μL)
RNA 2.75
5’-CDS Primer A 1
42
Table 8: 3’ RACE READY cDNA Reaction Components
REAGENTS VOLUME (μL)
RNA 3.75
3’-CDS Primer A 1
The contents were mixed briefly by vortexing the RACE mixture tubes for 5 sec. The tubes were
incubated at 72 ºC for 3 min and 42 ºC for 2 min in order, respectively, to remove secondary
structures from RNA and to promote primer annealing. Next, the tubes were centrifuged at 14,000
rpm for 10 sec. For only the 5’ RACE ready cDNA reaction, 1 μL of SMARTer IIA oligo mix was
added and mixed by vortexing for 5 sec. A RACE Master Mix was prepared by using the RACE
Buffer Mix prepared at the start of this section. The following chemicals were added in the order
and amounts given below and are shown below.
Table 9. RACE Master Mix Composition
REAGENTS VOLUME (μL)
RACE Buffer Mix 8
RNase inhibitor (40 units/L) 0.5
SMARTScribe Reverse Transcriptase 2
(100 units)
43
To each of the 5’ and 3’ RACE READY cDNA reaction tubes, 5.25 μL of the RACE Master Mix
was added. The tubes were vortexed for 5 sec and the reactions were incubated at 42 ºC for 90
min. The tubes were then heated at 70 ºC for 10 min. Finally, 50 μL of TE buffer was added to
each of the tubes and the products were stored at -20 ºC.
B. PCR of RACE Protocol Products
The following reaction mixture shown in Table 10 was added to each of the EasyStart PCR tubes
and PCR was performed according to procedures depending on different primers and template
cDNA.
Table 10. RACE Product PCR Reaction Mixture Components
REAGENTS VOLUME (μL)
Taq polymerase 2
Universal primer mix 5
Deionized molecular biology grade water 13
To this reaction mixture, 5’ and 3’ cDNA prepared from the reverse transcription reaction (4 μL)
was used alternatively with gene specific primers, specifically, G forward and G reverse primers
(1 μL), that were the primers ordered from the first PCR step. This procedure included the
following 4 PCR reactions:
5’ cDNA with G forward primer
44
5’ cDNA with G reverse primer
3’ cDNA with G forward primer
3’ cDNA with G reverse primer
PCR was carried out according to the method listed under the gradient PCR section. PCR
products were then analyzed by agarose gel electrophoresis.
NESTED MIXED BATCH PCR
The following PCR reaction mix was prepared according chemicals and amounts given below in
order to amplify DNA sequences flanked by overlapping primer sequences. PCR was carried out
according to the protocol established in the gradient PCR section. PCR products were then
subjected to agarose gel electrophoresis.
Table 11. Nested Mix Batch PCR Reaction Mixture Components
REAGENTS VOLUME (μL)
Taq polymerase 2
Forward primer (each of A,B,C,D,E,F and G) 1
Reverse Primer (each of A,B,C,D,E,F and G) 1
DNA 4
Deionized molecular biology grade water 5
45
BUFFER LIST
1X TE Buffer
10 mM Tris base – 1.21 g
1 mM EDTA - 0.29 g
Deionized water – 1 L
Buffer pH was adjusted to 8.
10X TBE Buffer
0.9 M Tris base – 108 g
0.9 M Boric acid – 55 g
0.02 M EDTA Disodium salt – 7.5 g
Deionized water – 1 L
Buffer pH was adjusted to 8.3.
1X TBE Buffer
100 mL of 10X TBE buffer and 900 mL Deionized water = 1 L 1X TBE buffer
Sodium Acetate Buffer
50 mM Sodium acetate – 4.1 g
10 mM EDTA – 2.9 g
46
Deionized water – 1 L
RNA Loading Buffer
Formamide – 1000 μL
Formaldehyde – 350 μL
10X RNA gel buffer – 100 μL
10X loading dye buffer – 200 μL
Ethidium bromide – 5 μL
10X Loading Dye Buffer
Bromophenol Blue – 0.035 g
Glycerol – 3 mL
1 mM EDTA - 0.0029 g
Deionized water – 7 mL
10X RNA Gel Buffer
200 mM MOPS – 41.85 g
50 mM Sodium acetate – 4.1 g
10 mM EDTA – 2.9 g
Buffer pH was adjusted to 7.
47
1X RNA Gel Buffer
100 mL of 10X RNA gel buffer and 900 mL of deionized water = 1 L 1X RNA gel buffer
S.O.C Media
Bacto Tryptone – 20 g
Bacto Yeast Extract – 5 g
5 M NaCl – 2 mL
1 M KCl – 2.5 mL
1 M MgCl2 – 10 mL
1 M MgSO4 – 10 mL
1 M glucose – 20 mL
Deionized water - 955.5 mL
The media was sterilized by autoclaving.
LB Kanamycin Broth
Bacto-tryptone – 10 g
Yeast extract – 5 g
NaCl – 10 g
48
Deionized water 1 L
The pH was adjusted to 7.5.
The broth was sterilized by autoclaving.
50 mg/mL Kanamycin – 1 mL (added after autoclaving and cooling the media to room
temperature)
LB Kanamycin Plate
Bacto-tryptone – 10 g
Yeast extract – 5 g
NaCl – 10 g
Agar – 15 g
Deionized water 1 L
The pH was adjusted to 7.5.
The agar mixture was sterilized by autoclaving.
50 mg/mL Kanamycin – 1 mL (added after autoclaving and cooling the media to room
temperature)
The kanamycin-agar mixture was poured into petri plates and allowed to cool until solid.
49
RESULTS
50
PRIMERS DESIGNED BASED ON PREVIOUS FINDINGS
The research described herein was focused on the isolation of DNA sequences that are associated
with the cellulase genes in P. spinulosum. Even though the method concentrated on identifying the
sequence from the transcribed regions of RNA or cDNA, the initial study verified the presence of
a set of genomic DNA sequences that are related to P. spinulosum cellulase genes. This was done by using DNA primers whose design was based on partial protein sequences for the fungal cellulase obtained by Wheeler et al. The amplification of genomic DNA sequences was verified using these DNA primers. Genes encoding proteins whose sequence is unknown are usually identified by a mix of oligonucleotides that contains multiple primers which span a range of nucleotide sequences corresponding to known partial protein sequences. The variation in these sequences result from the wobble in the third oligonucleotide in each codon specifying each amino acid and in the fact that amino acids are specified by multiple codons. These arrays of primers are referred to as degenerate primers. Degenerate oligonucleotide primers amplified certain P. spinulosum genomic DNA sequences and these sequences were analyzed using BLAST searches.
Specific primers were then designed based on the putative cellulase gene sequences obtained from the BLAST search. Some of the criteria that had to be considered to design optimal primers were
GC content, primer length and product length (Dieffenbach, Lowe et al. 1993). The problem of
GC content can be avoided using several other chemicals but the simplest approach is to design primers with 40-50% GC content (Varadaraj and Skinner 1994). An optimal primer set was chosen for each of the amplified clones and selected for degenerate primer-PCR using the online primer designing software Primer3Plus as shown in Table 2. This bioinformatics tool also provided options for optimizing the other primer parameters discussed above.
51
The primers ordered could differ in concentration due to differences in primer length, nucleotide composition and the protocols used by automated oligonucleotide synthesizers. The designated primers were ordered and stored in aliquots at concentrations of 50 µM. The dilutions were made according to the formula shown in Table 2 using doubly distilled water. These primer solutions were stored at -80˚C and fresh aliquots were used for each PCR reaction.
The short peptide sequences based on which these primers were designed are shown below.
These peptides were mapped to cellulase coding regions in similar fungal species, Penicillium, with the exception of the third sequence which is found in Talaromyces marneffei (formerly named
Penicillium marneffei). This cellulase region, along with short peptide sequences, were used to design oligonucleotide primer combinations, that have sequences similar to the identified peptide sequences.
P. spinulosum CULTURES
Fungal spores, obtained from Czapek-Dox plates, were suspended in a Tween-20-NaCl ( 0.12/0.9,
% w/v) solution. These spores were cultured to produce mycelia in two different liquid media in which the media composition differed only in carbon source (sucrose and galactose). It was previously shown that changes in carbon sources in fungal growth media can lead to changes in a biochemical and physiological characteristics and in fungal development (Yu, Zhu et al. 2011). In
52
previous studies, it had been noted that the yield of proteins like cellulases is higher in mycelia
cultured in media containing sucrose as the carbon source compared to galactose. Based on this finding, it was hypothesized that the total cellulase DNA yield would be greater when the carbon source in media was sucrose. Thus, two separate fungal cultures were prepared, one having sucrose as the media carbon source and the other using galactose instead. No observable difference in the dry weights of the mycelia was observed between the two cultures, however, previously cell morphology has been shown by scanning electron microscopy to be altered in galactose cultured cell (Cho, 1999).
Improved DNA yield when sucrose was used as the carbon source
The primers, mentioned in Table 2, which were stored at -80˚C, were used to amplify sequences from genomic DNA. According to the MolecularBioProducts, Inc. (Cat. No.-6022) PCR reaction kit instructions, 10-500 pg of genomic DNA should be sufficient to produce observable DNA amplification. DNA isolation, which was performed according to the MasterPure TM Yeast DNA
isolation kit from EPICENTRE Biotechnologies (Cat, No.- MPY80200), yielded 3-5 µg of total
DNA. DNA isolated was mixed with a 10X loading buffer (see Methods) in 1:6 ratio in which one
part of the dye is mixed with 5 parts of amplicon as suggested by Sambrooke et al.
To test the hypothesis that DNA yield increases when sucrose was used as the media carbon
source, the genomic DNA was visualized by running 5 µL of DNA in agarose gel electrophoresis
as shown in Fig 11a. The genomic DNAs in the figure were obtained from two genomic DNA
isolations, i.e., that originated from cells grown in media containing either one of two carbon
sources - sucrose or galactose. As the result suggests, the differences between the DNAs obtained
from the different media were minor, but the DNA band obtained from the sucrose media cells
53
was a slightly more intense band than that of the DNA obtained from cells cultured in galactose
media. These bands were also quantified using the ImageJ software using the Pixel Inspector
application as shown in Fig. 11b. Thus, sucrose is the preferred carbon source for optimal DNA
yield. As DNA will be used as the starting material for downstream processing like PCR, DNA
obtained from mycelia grown in a growth media containing sucrose as a carbon source will be
used.
This genomic DNA obtained from the sucrose media mycelia was then used for the PCR reaction
with the previously prepared specific primer aliquots. In accordance with PCR reaction tube
vendor specifications, 10-500 pg of genomic DNA would be sufficient to successfully amplify the
fungal DNA and obtain observable DNA agarose gel bands using the primers in Table 2.
GRADIENT PCR YIELDED OPTIMAL ANNEALING TEMPERATURES
Genomic DNA (10 ng in 4 µL of TE buffer; quantified using UV-Vis spectrometry and diluted
using TE buffer) was used for the PCR to ensure the efficiency of the PCR. Insufficient amounts
of DNA not only reduces the production of amplicons but can also lead to false positives according
to Robertson et al. (Robertson and Walsh-Weller 1998). Separate PCR reactions using different
sets of primers were performed using the same genomic DNA template. Annealing temperature
optimization is one of the most important criteria for the success of PCR reactions. Finding the
optimal annealing temperature defines the sensitivity of the PCR, which is the ability to produce
optimal amounts of the specific amplicon, (Rychlik, Spencer et al. 1990), and thus was explored
in our studies (Fig 12a - c).
54
Figure 11a – Media carbon source effect on genomic DNA isolation. Agarose gel electrophoresis of genomic DNA obtained from P. spinulosum cultures showing Gen. DNA 1, genomic DNA isolated from cells grown in media containing sucrose as the carbon source and Gen. DNA 2, genomic DNA isolated from cells grown in media containing galactose as the carbon source. The standard used was a Pst λ ladder (Lad). Bands were detected with ethidium bromide, a fluorescent dye that is visible under UV light.
Figure 11b – Pixel intensities of bands from agarose gel electrophoresis were calculated using Pixel Inspector application in ImageJ software. Flowthrough (FT) from the isolation process were included as negative controls.
55
Figure 12a – The gel picture shows the bands of genomic DNA isolated from cells grown in media containing sucrose as the carbon source. The brightest band (comparatively) was observed when the annealing temperature was 56˚C showing the optimum temperature for PCR amplification using primer set C. The bands were of the correct size (comparing with ladder) and the negative control shows that there was no impurity in the primers and the primers do not self-anneal.
Figure 12b - Agarose gel electrophoresis of temperature optimization experiments performed on genomic DNA isolated from sucrose media fungal cells using primer sets A-G. Gradient PCR experiments show the effects of varying annealing temperatures from 50-64°C as in Figure 12a.
56
Figure 12c - Expanded view of gradient PCR results for individual primer sets shown in Fig. 12b.
After determining the optimal carbon source was sucrose for future genomic DNA isolation, gradient PCR reactions were performed using each set of primers tested at 8 different annealing temperatures, ranging between 50 and 64˚C in increments of 2˚C (Dieffenbach, Lowe et al. 1993).
The results of the PCR annealing temperature optimization experiments with DNA obtained from mycelia grown in sucrose media are shown in Fig 12a–c. After the PCR, the amplicons were
57
visualized using agarose gel electrophoresis by loading 10 µL of the PCR reaction mixture with 2
µL of DNA loading dye. In Fig 12a, the brightness of the band initially increased with increase in
annealing temperature up to 56˚C and then started to become less intense. Fig 12b shows the results
of gradient PCR with A-G primer sets. The F primer set did not give any band in the PCR and
hence was discarded for future use as there were 6 other primer sets that successfully amplified
the putative cellulase gene fragments. Fig 12c shows the same result but is displayed individually
to contrast the difference in annealing temperature. The annealing temperature at which the DNA
band was most intense and after which the intensity dropped was taken as the optimal annealing
temperature for each primer. The optimal annealing temperatures for each of the primer sets is
displayed in Table 12. This gradient PCR technique was helpful in identifying an optimal
annealing temperature for each of the PCR reactions. Identifying the optimal annealing
temperature can increase the efficiency of PCR several-fold (Rychlik, Spencer et al. 1990).
TABLE 12 – Optimal Annealing Temperatures for Cellulase Primer Sets
Amplicon NAME PRODUCT LENGTH OPTIMUM TEMPERATURE. (bp) (˚C)
A 384 56
B 163 54
C 216 60
D 184 56
E 169 58
58
F 112 -
G 156 56
Note: Primer sets with the expected length of amplicon and the optimal annealing temperature were determined using the gradient PCR.
RNA ISOLATION PROTOCOL WAS OPTIMIZED FOR P. spinulosum
The nucleic acids, both DNA and RNA, have a triplet code that is translated into proteins as amino
acid sequences. The major difference between DNA and RNA is that DNA contains certain
sequences called introns that are not translated into proteins but are removed after DNA is
transcribed into mRNA. This process of removal of introns and retaining just the exons (coding
region) in mRNA is known as splicing (Green 1986). The process of isolating the coding region
of a gene can be refined by isolating mRNA and amplifying segments of the translatable gene as
compared to doing the same procedure with genomic DNA. The process of RNA isolation is
similar to the process of DNA isolation but the isolation of the two nucleic acids uses different
solvents due to the fact that RNA is more polar than DNA. As the RNA was to be isolated from a
fungal species, the method followed was that of Mannan et al. (Amin-ul Mannan, Sharma et al.
2009), which was used to isolate RNA from recalcitrant yeast cells. The RNA isolated was total
RNA and hence contained ribosomal and transfer RNA along with messenger RNA. The
secondary structures of RNA were removed by heating and treating RNA with chemicals such as
formaldehyde to convert the RNA into single stranded RNA without any secondary structures.
This is one of the reasons for using formaldehyde gels for resolving and visualizing RNA (Lehrach,
Diamond et al. 1977). The RNA was run in a formaldehyde gel and visualized using UV light as
shown in Fig 13a. The results show that the RNA isolated had a band in the same region as the cell
59
debris (RNA CT) fraction, which was used as the negative control. The RNA was expected to
contain a double band because of the presence of ribosomal RNA bands with two different sizes,
but the presence of single band called into question the purity of the isolated RNA. Double bands denote the presence of ribosomal RNA bands which is the majority of RNA of a specific size in a cell, where the two bands belong to the 25S and 18S rRNA (Grierson and Hemleben 1977), which are 4 kb and 2 kb long, respectively. The absence of a conclusive result was likely the result of the degrading action of the chemicals used. But the presence of RNA could also be verified by using agarose gel electrophoresis, where a 2% (w/v) agarose gel was used to resolve RNA in an electric field of 200 V for 15 min. The agarose gel bands obtained of the same RNA isolations are shown in Fig. 13b. No double bands were obtained and the result is contrary to the expected double bands.
As the RNA bands were not completely visible, an alternative method to isolate RNA was pursued.
Initially the RNA isolation procedure followed was for yeast cells. It was hypothesized that better lysing of the cell walls of the fungal organism (P. spinulosum) would help improve the yield and purity of RNA obtained. Hence, a revised method was used that increased both the number of vortex mixing steps along with length of the initial exposure of the cells to hot acidic phenol, the latter which had been performed only in later steps in the initial RNA isolation attempts. The remaining steps were repeated as previously. The yield and purity of the RNA using the revised procedure were visualized on agarose gel electrophoresis as before. As shown in Fig 13c, the two bands were distinctly visible and the intensity of the bands indicates that RNA yields were greatly improved by following the new method, which is RI Procedure II in Methods Section. The RNA sample was diluted to obtain better separation of the bands in the picture. The samples were diluted to 30% (v/v) using a 1X TE buffer in which 7 µL of 1X TE buffer was added to 3 µL of sample.
60
The gel electrophoresis image of diluted RNA samples is shown in Fig. 13d. This RNA was used
for the reverse transcription reactions that probed for intron-less coding cellulase gene sequences.
Figure 13a – Agarose gel electrophoresis of total RNA isolated from P. spinulosum sucrose culture mycelia. The first five lanes contain the same RNA sample; RNA isol. 2 represents RNA from another isolation. RNA CT 1 & 2 represent the collected pellets that have to be discarded after the ethanol wash and that do not have RNA. Visualization of bands was performed with ethidium bromide with uv light (310 nm).
Figure 13b - Agarose gel electrophoresis of P. spinulosum sucrose media RNA isolated and run in formaldehyde gels from two different isolation attempts (RNA isol. 1 and RNA isol. 2). Note the absence of double RNA bands in each lane.
61
Figure 13c – Formaldehyde/agarose gel electrophoresis of two RNA isolation trials using the modified isolation protocol. The gel showed the presence of two intense bands. The improved intensity of the observed bands was likely due to the high concentration and yield of RNA.
Figure 13d – Formaldehyde/agarose gel electrophoresis of diluted RNA 2 sample from Fig. 13c. Dilution of the RNA2 improved the resolution of the RNA bands in the gel that are due to 2 and 4 kb RNA.
62
REVERSE TRANSCRIPTION (RT)
RNA has all the required sequences for amplifying the required gene fragments, but it is unstable due to its chemical structure and single stranded architecture. This makes RNA less conducive to be used directly for any downstream reactions. To avoid any of these issues, RNAs were used to generate complementary DNA templates which could form hybrid structures consisting of one
RNA strand and its complementary DNA strand. Reverse transcriptase catalyzes the formation of cDNA from an RNA template, and this cDNA will be used in gene expression studies. cDNA is more stable than RNA and hence can be used for PCR reactions (Bustin 2000). First strand cDNA synthesis was done by using an Omniscript RT kit that utilizes 1µL of an enzyme called RNA- dependent DNA polymerase or reverse transcriptase. After the reaction, the cDNA generated was detected by agarose gel electrophoresis (shown in Figure 14a).
Figure 14a - Agarose gel electrophoresis of cDNA obtained through RT reactions. The smears are due to the degraded RNA template and differing sizes of cDNA.
63
The procedure used 3 µL of the cDNA with 0.5 µL of loading dye in a 1% agarose gel. RNA from
the second RNA isolation were divided into seven aliquots of cDNA. These were placed in seven
different RT reaction tubes in order to provide adequate amounts of cDNA for future PCR
reactions. The result, as shown in Fig. 14a, the presence of a smear is due to varying lengths of
cDNA and shearing and degradation of RNA used as template. The cDNA generated was then
used as template for a gradient PCR with each of the forward primers of all primer sets with the
reverse primer being oligodT. OligodT is a string of nucleotide “T” which will bind to the
complementary polyA sequence. This experiment was designed to make sure that amplicons
contain sequences amplified between the middle and the end of the cDNA because the cDNA 3’-
end contains a polyA sequence that is complementary to the 5’-oligodT amplicon end. Gradient
PCR for each and every primer set was used to identify the optimal annealing temperature. Figure
14b shows the agarose gel electrophoresis of the gradient PCR products generated with primer set
B. PCR sample, 10 µL, was loaded onto the gel with 2 µL of loading dye. The optimal annealing
temperature was found to be 56˚C. For the reaction yield to be optimal, the extension time was
also altered and each and every PCR was carried out in increments of 1 min. The maximum yield
was found using a 3 min extension time, which was then subsequently used as the established
condition for the gradient PCR runs. Finally, PCR for all other primer sets were carried out at 46˚C
with 3 min extension times. Figure 14c shows the amplicons obtained using primers A, C, D, E,
F, G and OligodT.
64
Figure 14b - Agarose gel electrophoresis of cDNA-PCR products using forward B primer (B fwd) and oligodT (OdT) as the reverse primer. The reaction was carried out with a 3 min extension time. Note the optimal annealing temperature of 56°C.
Figure 14c – Agarose gel electrophoresis of cDNA-PCR amplicons obtained from PCR with all the other sets of primers (A, C-F) with OligodT as reverse primer. The reactions were carried out with a 3 min extension time using an annealing temperature of 46°C.
65
CLONING
Successful plasmid ligation and transformation into competent E. coli for DNA replication
A cloning reaction was carried out using the TOPO TA cloning kit from Invitrogen, which is
primarily used for cloning amplicons that will be sequenced. This kit helps in cloning PCR
amplicons without overhangs created by restriction digestions, and in screening of multiple bands
observed in the PCR reactions. In this reaction, the amplicons were cloned into a vector named
the TOPO vector, which was then transformed into competent E. coli DH5α cells and grown on
LB kanamycin plates. Colonies on these plates that are kanamycin-resistant are considered to have
the vector with or without the target sequence cloned into them. The antibiotic resistant colonies
were then picked off the plate and grown separately in LB kanamycin broth so that bacteria in each
of the colonies are multiplied and can be used for DNA extraction. The first step in this process
was to clone the PCR amplicons into TOPO vectors. This was done using the cloning Master mix
containing the vector, the salt solution, and water to which the PCR product was added and
incubated for 5 min. To check whether the cloning was successful and for subsequent downstream
processing, the PCR product after cloning, was transformed into DH5α cells by a heat-shock
method and plated on LB kanamycin plates. Figure 13 shows the presence of colonies in the
positive control and test plate. The positive control plate is supposed to contain the positive control
plasmid pUC 19 where the ampicillin-resistance factor resides, thus the colonies grow in LB amp
(ampicillin) plates and the test plates have colonies containing the kanamycin-resistance factor-
containing vector. However, the negative control, which did not contain any plasmid, was not able
to produce any colonies on any of the antibiotic screening plates.
66
Figure 15 – E. coli colonies obtained after cloning and transformation of vector along with the insert - PCR amplicon. Negative control, positive control and Test (T1) plates for the B-primer set amplicon are displayed. All the plates used LB agar as the medium and ampicillin as the antibiotic. Miniprep was performed to sequence the amplicon
After transforming the vector with the PCR amplicon into bacterial cells, the colonies were picked
and individual colonies were inoculated into 5-10 mL LB kanamycin broth tubes to identify the
amplicons that were transformed into bacterial colonies. Overnight cultures were prepared and
cultured in a 37°C shaker at 100 rpm for 12-18 hr. These were centrifuged to harvest the cells.
Plasmids were isolated from the harvested cells in a process called miniprep. Miniprep is a process
67 of isolating plasmids from bacterial cells, mostly using alkaline lysis method. The plasmids, after miniprep, were checked by using electrophoresis to ensure that they were the proper size to account for the addition of the desired DNA insert. These plasmids were then used as templates for PCR with the M13 primers provided. The PCR conditions used were according to the instructions provided in the Invitrogen TOPO TA cloning kit (Cat. No.- K 4530-20) but the extension time was set as 3 min to reproduce previous amplification procedures. Fig 16a shows the bands obtained from the electrophoresis of 10 µL of amplicons obtained from the above PCR reaction with 2 µL of loading dye. This procedure was followed for all the clones and agarose electrophoresis gels were used to check that the amplicons were correctly cloned. These results are displayed in Fig.
16b-d. After checking, glycerol stocks were prepared of clones and mailed to the CUGI sequencing facility for DNA sequencing.
a b
c d
Figures 16a-d - Gel electrophoresis of PCR with M13 primers of clones (Cl.) isolated using respectively, primers A, B, C and D, and G.
68
BLAST ANALYSIS The sequences from the CUGI facility were obtained in FASTA format. The DNA sequences were
entered into the BLAST software as queries and searched for the closest hit. The amplicons were
checked to see if they were of fungal origin or closely related to the cellulase family of enzymes.
The results of the BLAST searches are displayed in Table 13. The clone containing the amplicon
obtained with the G primer has the highest similarity to sequences of fungal origins and most
importantly, to a Penicillium source. Clone G was selected for further studies to probe for the
coding sequence of gene segments using the RACE-PCR technique as its DNA sequence was a
close hit and also matched the predicted DNA sequence obtained from the protein sequences.
Table 13 - BLAST Analysis of Region Amplified by Primers
Number Primer name Similar Organism Similar Protein
1 A Burkholderia Hypothetical protein cenocipacia
2 B Escherichia coli Hypothetical protein
3 C Escherichia coli Membrane protein YcfT
4 D Escherichia coli Fumarase reductase
5 G Penicillium Hypothetical protein digitatum, Penicillium chrysogenum
69
RACE-PCR WAS PERFORMED TO IDENTIFY TRANSCRIPT CODING REGION
The RACE-PCR is a method used to isolate and amplify segments of RNA using gene-specific
primers. The segment amplified by clone G was found to be closely related to a gene of fungal and
mainly Penicillium origin. For this reason, the G primer was used as gene-specific primer and
probed for the cellulase gene fragments using RACE-PCR. For increased specificity and higher
yield, the RACE reaction was performed using a commercially available RACE-PCR kit. As
described in the Methods Section, separate reactions containing different combinations of the G
primer set were used in the 5' and 3' RACE reactions. As shown in Fig. 17a, the 3’ reaction yielded
a positive reaction with the G forward primer but the 5' reaction did not yield any results. The
bands obtained near the bottom of the gel in the 5' RACE were too small to be considered as an
amplicon and were discounted as background. The 3' RACE reaction yielded an amplicon that was
600-800 bp long and as it was comparatively larger than its 5’ counterpart, that former amplicon
was stored for sequencing. The last two lanes containing 3' G forward RACE reaction were not
consistent with expected results due to leaks in the gel wells. Next, the RACE-PCR was performed
with freshly isolated RNA and the products were examined by electrophoresis. The results are
shown in Fig. 17b. These reactions were then cloned into the TOPO vector and will be sequenced.
Mixed batch PCR was performed to corroborate the RACE PCR findings
This method was followed to make sure that a fragment of the gene, irrespective of whether it is
intron-less, can be isolated using the specifically-designed primers. This involves the use of
genomic DNA as the template and the PCR was performed using all primer sets. The primer sets
70
were allowed to amplify genomic DNA and this random amplification was expected to yield an
amplicon based on the DNA segments flanking the primer. The results are shown in Fig. 18.
Figure 17a - Duplicates of 5' and 3' RACE-PCR reactions with G forward (G fwd) and G reverse (G rev) primers.
Figure 17b - RACE-PCR reactions repeated with freshly isolated RNA displaying 1- 3 kilobase (kb) bands. Note all except the 5’-RACE-PCR G-forward products were of the appropriate size for a DNA plasmid containing the vector.
71
Figure 18 - Gel electrophoresis of genomic DNA (Gen. DNA) amplified by a mixed batch of all primer sets. The number of non-specific amplifications at lower temperatures displayed in terms of bands are significantly reduced as the temperature increases. The amplicons at almost 1 kb size were chosen to look for fungal cellulase sequences.
72
RNA ISOLATION TROUBLESHOOTING Isolation of RNA isolation is more difficult than DNA isolation because of the shorter half-life and
lower stability of RNA relative to DNA (Bernstein, Khodursky et al. 2002). Steps like cell lysis
during nucleic acid isolation that use chemicals like phenol and chloroform can easily degrade
RNA. This makes each and every step crucial for recovery of RNA. There can be a lot of pitfalls
during RNA isolation. The yields of RNA can be low thus making it tough to visualize the isolated
RNA. Prevalence of RNase in the environment can easily lead to the degradation of RNA. This can either lead to shearing of the RNA, which should be visualized by the presence of a double band when visualized in agarose gels. Another important problem in RNA isolation is the presence of impurities that can hinder the native structure, stability and yield of RNA. Conditions for RNA isolation may require specific salt concentrations, pHs and solvents. Experimental conditions like time and temperature of incubation and number of ethanol washes must also be monitored.
Experiments were conducted to further troubleshoot the isolation of RNA and are described here.
The RNA obtained, 4 µL, was run on an agarose gel and visualized as shown in Fig. 19a. The single band obtained near the top of the gel represents the cell debris or genomic DNA but not the
RNA. Acidic phenol is commercially available as two pH – 4.4 and 6.6 solutions. Fig. 19b shows the RNA isolation performed using phenol solutions at pH 4.4 and 6.6. RNA is visualized as a double band at a location in the gel that corresponds to nucleic acid that is approximately 3 kb in size. RNA isolated using the phenol solution at pH 4.4 shows a better RNA yield as compared to pH 6.6. RNA isolation involved vortex mixing to lyse the cells by hydrolyzing the chitinaceous cell walls of fungi. These vortex mixings followed incubation of cells with hot acidic phenol and sodium acetate buffer at 65˚C. Incubation times of 2, 4, 6 and 8 min at 65˚C with phenol and acetate buffer were tested for efficacy of RNA recovery. Results are shown in Fig. 19c. The bands intensify with increase in incubation time with hot phenol. The number of ethanol washes was also
73 optimized by performing RNA isolation with two and three ethanol washes as displayed in Fig.
19d. The amount of RNA bands observed in the gel after the third ethanol wash was significantly greater than that obtained after the second wash. The RNA isolation executed after optimizing the steps as described was revealed by electrophoresis to increase the yield of high-quality RNA.
These results are found in Fig. 19e.
Figure 19a – Agarose gel displays the RNA isolated from 2 different isolations. None of the isolations yielded the expected double band. The single bands near the wells are of the cell debris and genomic DNA which should not be present.
Weak RNA band in the sample treated with phenol of pH 4.4 is shown.
Figure 19b - Effect of phenol solution pH on RNA isolation. Lane 1: RNA isolated using hot acidic phenol equilibrated to a final pH of 6.6. Lane 2: RNA isolated using hot acidic phenol equilibrated to a final pH of 4.4.
74
Figure 19c - RNA isolated using protocols in which the incubation times during vortex mixings with phenol and sodium acetate buffer were 2, 4, 6 and 8 min. The concentration of isolated RNA gradually increases as the incubation time increases but the RNA still looks degraded.
Figure 19d - RNA isolated after the second and third 75% ethanol washes. The RNA bands increase after the third wash comparatively. The single bands near the wells are of the cell debris and genomic DNA which should not be present.
75
Figure 19e - High yield of RNA double band obtained after optimizing the (ethanol) washing and hot phenol extraction steps discussed above.
76
DISCUSSION
77
RESEARCH AIMS OR GOALS
The goals of this research project were (1) to locate a gene for an exo-β-glucopyranosidase or
exocellulase in the genome of the fungal organism Penicillium spinulosum, and (2) to isolate and
study the expression of the gene in vectors. This thesis describes the progress of the research
towards these goals.
APPROACHES OR STRATEGIES FOR ACHIEVING AIMS
The experimental approach to isolating a cellulase gene from P. spinulosum involved first
designing degenerate oligonucleotide primers based on proteomic analyses of an exo-β-
glucosidase isolated from the organism. These primer sequences were used to probe the fungal
genome and to selectively amplify putative cellulase or β-glucosidase sequences using the PCR
technique. PCR products were then sequenced. Using BLAST-N and BLAST-X analyses of the
DNA clones, sequences were selected to generate optimal primers that could be used with a cDNA
library to generate larger cellulase gene fragments. Lastly, the RACE PCR technique was used to
span and amplify the total cellulase gene. Scheme 1 shows the steps taken to achieve the desired
results. The approaches and the progress towards the goals are described in the sections below.
SELECTION OF FUNGAL ORGANISM
The fungal organism used for this study was the Ascomycete Penicillium spinulosum. In the recent past, although the number of researchers working on the genomic aspects of mycology has increased, DNA sequences of some of the fungal organisms like P. spinulosum have not yet been
fully explored and made available into the scientific literature. P. spinulosum is found to produce
78
Design degenerate primers for the cellulase gene of interest (BLAST)
Amplify the sequences which complement the fungal genomic DNA (PCR)
Select the PCR products corresponding to fungal cellulase by BLASTX
Design the specific primers required for amplification of these sequences
a) Dilute the primers to 50 µM concentrations
b) Determine the optimal annealing temperature for each primer (temperature gradient PCRs)
Amplify putative cellulase DNA and clone the PCR products into vectors. (Topo vectors)
Use Topo vectors for comparing the sequences to the cDNA library of the fungal genome
Scheme 1 – General strategy for isolation of the P. spinulosum cellulase gene sequences
79
spores that react with inflammatory mediators in our body leading to clinical manifestations as
with other potential pathogenic fungal species like P. chrysogenum and Aspergillus species (Jusilla
2002). Systemic fungal infections or mycoses are largely observed with Aspergillus species and
occur usually in immunocompromised individuals. Fungal spores may also cause a range of other
clinical complications in the respiratory tract, eyes and ears. There are a very few fungal spores
that cause ear infections, otomycoses, at inner auditory lobes and P. spinulosum is known to be
one among them (Howard 2002). Scientific inquiry directed toward Penicillium species could
clarify their role in clinical manifestations of disease and knowledge of molecular pathways in
fungi could be used to design better drugs for treatment of mycoses.
Apart from the clinical implications, fungi, and especially Penicillium spp. are known among all
of the microbiota to be extremely efficient at depolymerizing carbon intensive biomass such as
cellulose, the main component of landfills. These fungi have the potential to convert cellulose, a
polymer that is unusually difficult to digest by chemical means, into small glucan oligosaccharides,
that could be used as feedstocks for conversion into ethanol and other biofuels. Penicillium fungi
have been shown to produce glycohydrolases including cellulases that are capable of
depolymerizing cellulose and other complex polysaccharides. Specifically, cellulase secretion
from P. spinulosum was found to be enhanced relative to other common cellulase sources like P.
chrysogenum (Wheeler et al.,2011). The intracellular processes that contribute to the increased
cellulase synthesis in P. spinulosum have not been extensively studied, however, investigations
have identified several biomolecular pathways by which cellulase secretions could occur both
intracellularly and extracellularly (Punt 1991). Studies of cellulase secretion levels in P.
spinulosum could also lead to identification of diverse intracellular and extracellular secretion
mechanisms that operate at the biomolecular level in fungal species. Previous research has shown
80
that P. spinulosum cultures are especially adept at producing cellulolytic enzymes and culture
conditions that were conducive to production of exocellulases were investigated and optimized by
Bonetti and coworkers. In addition, previous research in our laboratory elucidated partial protein
sequences of a fungal cellulase. The partial cellulase sequence information made it possible to probe the entire P. spinulosum genome for a cellulase coding sequence using degenerate and specific primers.
SELECTION OF NUCLEIC ACID (DNA/RNA) PROBES
Initial studies in this project probed for sequences of β-glucosidases using genomic DNA. The use of DNA is integral to the definition of the whole gene function as cellulase-related genes are found to be arranged closer to each other in other fungal organisms (Michael Thon 2007). Another reason for using genomic DNA instead of RNA in the beginning was that RNA undergoes a process named alternative splicing which can rearrange the order of coding regions (exons) in RNA. Using genomic DNA makes it chemically easier to isolate DNA sequences and DNA also has a relatively high half-life as compared to RNA. RNA is also an easy target for degradation. For all the above reasons, initial studies involved the use of genomic DNA and hence the yield of genomic DNA had to be optimized to increase the availability of the biomolecule for the ensuing investigations.
GROWTH MEDIA
It is known that the yield of certain biomolecules in the cells like DNA, RNA and proteins can be
modulated by manipulating the constituents of growth media. It has been shown in the past that
changes in the media carbon source affect the total concentration of lipids in the cells grown in
such media (Yeh 2012). The same can be observed for other biomolecules, mainly DNA. Karasawa
et al. optimized the carbon source and also certain growth factors to optimize the gene expression
81 of cellulase genes in a rare Penicillium species (Kurasawa, Yachi et al. 1992). This research also proved that the concentration of DNA increased when the concentration of nitrogen in the growth media increased. Wheeler et al. observed that cellulase yield is increased when P. spinulosum cultures were grown in the presence of sucrose as the main carbon source instead of glucose in the standard growth media. This is likely a result of catabolic repression by glucose. Catabolite repression refers to a process by which microbial populations adapt towards using only a particular carbon source by repressing enzymes required for other carbon catabolism. For this reason, our first investigation examined differences in genomic DNA yields from cells grown in media containing either sucrose or galactose as the main carbon source. The results proved that the amount of DNA isolated from cells grown in media containing sucrose as the carbon source is greater than that from cells grown in media containing galactose as the carbon source. This result may be because sucrose media cultures may have a higher growth density than galactose cultures, because galactose is not the preferred fungal carbon source under conditions where other micro- and macro-nutrients were standardized for optimal protein yield. After isolation of total genomic
DNA, DNA yields were compared using agarose gels by measuring DNA band intensities. A gel image of the confirmation experiment is shown below in Fig. 20. This finding can also be used for studies involving DNA in this fungal species as this optimized one of the criteria for DNA abundance, however, it would need to be compared to the results obtained on the unmodified standard growth media that only uses glucose as the carbon source. The use of sucrose in the media likely serves a dual purpose. It provides enough glucose to allow significant growth and thus DNA production by the fungus and also induces less of the catabolite repression (by free glucose) that would inhibit cellulase production by the fungus.
82 Figure 20 - Agarose gel electrophoresis of DNA isolated from cells grown in media containing sucrose and galactose as carbon sources. FT is the flow-through to avoid wastage in the form of impurities.
SELECTION OF PRIMERS
Another important step was to design the primer sequences that were to be used in PCR amplification of cellulase DNA. These primers, since they flanked the desired cellulase containing site, were to be tailored based on parameters like maximum affinity, optimal yield and sequence- specific amplification. The most important result that was helpful in designing these primer sequences was provided by the investigations of Wheeler et al. in which the sequence of short polypeptides derived from a 105 kDa cellulolytic protein and similar to fungal glucoside hydrolase were identified using mass spectrometry. The corresponding DNA sequences were deduced using the protein sequence based on corresponding codons from amino acid code for Penicillium species from the BLASTP database.
GC content is a major criterium for proper binding in the amplification of DNA sequences using the PCR technique, and thus, is an important consideration in primer design. The GC content is based on the number of guanines and cytosines in the nucleotide sequence. The percentage of GC
83 content was calculated and then used for finding the melting temperature of the primer binding
site. GC% has a direct relationship with melting temperature of DNA duplexes. The melting
temperature of the primer binding site increases as GC% increases. Higher melting temperatures
will lead to tighter binding and hence would hamper further amplification cycles. For this reason, it is important to determine the GC% in primers. For maximum yield and amplification, a GC% of 50% is used.
Primer length was another important criterium that had to be optimized for better amplification quality. Primers that are too long can increase both the chances of non-specific binding and unnecessarily increase the duration of PCR. Long primers may make priming more specific and may not affect the duration of PCR, while at the same time, shorter primers could have multiple binding sites in the genome which would lead to non-specific priming. Therefore, it was necessary to have primers of optimal length so as to avoid the frequency of non-specific binding and non- specific priming. This was accomplished by restricting the primer size to 18-21 bases, which had been proven to be the optimal size of a primer for a standard PCR reaction. Other types of PCRs like the touch-down PCR and long-range PCR might require longer or shorter primer lengths
(Diffenbach 1993).
Primer optimization was accomplished by using a bioinformatics tool called Primer3Plus. The sequence of DNA coding the putative cellulase protein sequences identified by Wheeler et al. was used as input for determining the primer sequences needed to flank the desired DNA sequence.
Initial primers designed were based on the protein sequences or amino acid codes in particular.
This approach was taken in order to isolate fragments of fungal genomic DNA, which would correspond to fragments of the P. spinulosum cellulase gene. These primers are known as degenerate oligonucleotide sequences or degenerate primers because they were designed not to
84 amplify a particular fragment but to amplify a set of consensus sequences. The sequences of these
primers are shown in Methods/Results Section. These degenerate primers were expected to
amplify multiple DNA fragments that might or might not belong to the same set of genes but are
expected to be related in the genome. The amplicons generated using the degenerate primers based
on the peptide sequences SINGYPLPGGGFVR, TLEYSYNDFAIAQMAR and
NVGGALPLTGREK, were sequenced and BLAST analysis was performed to yield DNA
sequences that were more homologous to sequences from Penicillium species. This procedure
probed for sequences that might yield DNA fragments that can serve as a starting point to isolate
cellulase gene sequences. Specific primers were then designed to screen for amplicons that could
be a segment of a cellulase gene. Seven different clones (A-G) were selected and used to design
specific primers.
GRADIENT TEMPERATURE PCR
Finding the optimal annealing temperature defines the sensitivity of the PCR (Rychlik, Spencer et
al. 1990). The PCR reaction ensures the isolation of a specific segment but mainly guarantees the
exponential increase in the number of DNA copies available for further studies. In order to
maximize the possibility of finding a primer set that selectively amplifies the cellulase gene
segments, it was necessary to determine the optimal temperature conditions for the PCR reaction.
As discussed by Esen et al., annealing temperature plays a major role in optimizing the PCR yield
when working with DNA sequences, specifically cellulase gene fragments from P. spinulosum in
this case. Increasing the annealing temperature beyond a threshold temperature would lead to
denaturation of DNA. Decreasing the annealing temperature could lead to non-specific annealing
and would lead to false positives. Thus, the appropriate annealing temperature was determined by
performing PCR at successive temperature increments (Esen and Bandaranayake 1998). In the
85
Results Section, Figure 12b shows that the annealing temperature was determined for each and every primer set that was designed to amplify specific sequences. Optimization of various parameters like growth media, primer design and annealing temperatures were performed to ensure the quality of amplicon after PCR. These initial investigations provided vital information that served our subsequent investigations, which used these primers at the specific optimal annealing temperatures found. These PCR gradient experiments ensured optimal isolation of the desired
DNA region through the amplification process.
Most of the annealing temperatures were found to be between 54°C to 60°C. So an average annealing temperature of 58°C was used for most of the PCR reactions as the yield was optimal at this temperature.
PUTATIVE CELLULASE GENE DNA
The BLAST results from the alignment of the amplicon sequences generated by using the degenerate primers and specific primers were evaluated based on the appearance of the sequences in the fungal DNA database. The reason for not evaluating based on the absolute fidelity of the sequences to cellulase sequences isolated so far was that the genomic DNA sequences of cellulase coding regions from Penicillium spinulosum have not yet been identified and the sequence found at the end of this study is the first report of any form of DNA sequence associated with cellulase enzyme from this fungal species. But the sequences can be compared to other organisms to see if sequences are similar to whole genome sequencing of similar organisms. This project may also yield sequence information related to genes that are involved in functions not related to carbohydrate hydrolysis but whose sequence is similar to that of the targeted peptide. Some of the results from the BLASTX analysis point to a “hypothetical protein” whose function has not been
86 studied yet and whose sequence has also not been fully elucidated. So apart from yielding cellulase
related sequences, biochemical and functional analysis of these sequences may also lead to
identification of other P. spinulosum related genes. Targeted gene identification from this isolation may represent a novel cellulase sequence that may be responsible for the higher activity of the cellulases isolated from this particular fungal organism by Wheeler et al. and that are unlike any other fungal cellulases isolated from conventional fungal sources like P. chrysogenum.
The cellulase enzyme comprises several polypeptides or segments that are expressed individually in a specific manner and are assembled as a part of post-translational protein folding. This signifies that this process is facilitated by an expression cascade assembled at the mRNA level with segments of proteins expressed by RNA sequences that are mostly arranged adjacent to each other
(Henrissat, Claeyssens et al. 1989). This type of rearrangement is precluded in DNA segments because exon-shuffling especially in cellulase genes occurs at the level of mRNA (Yague, Chow et al. 1996). DNA segments that are located at different regions in a genome can be rearranged in a specific order at the RNA level and can lead to the formation of a fully functional cellulase enzyme. For this reason, the approach in this project shifted to probing the RNA for multiple coding regions of the gene that can lead to isolation of DNA segments coding for the (cellulase) protein in question.
One of the central issues faced during this investigation was the scarcity of cellulase gene sequence information on P. spinulosum in the existing databases. For this reason, we investigated DNA
sequences from the gradient PCR even if they were only distantly related to known fungal cellulase
genes based on BLAST results. This increased the number of targets used to reconstruct the
cellulase mRNA transcript with the Reverse Transcription (RT) technique. The sequences selected
for consideration were based on investigations of identified cellulase genes in other fungal strains
87
like Trichoderma harzianum. However, DNA fragments that showed sequence similarity in
BLAST analysis might not be functionally related to the actual Penicillium cellulase gene. This
could lead to questions regarding whether the DNA sequences isolated by degenerate and standard
primers amplified regions that showed sequence similarity but were unrelated at a functional level
or exhibited differences due to transcriptional splicing event specifics. These questions would
require further investigations of the P. spinulosum genome. Elucidation of these sequences could
also show evolutionary relationships between fungal strains with elevated levels of cellulase
secretion and other conventional fungal strains upon further genomic characterization.
RNA ISOLATION
Conventional RNA isolation protocols can be used to yield either total RNA or specific types of
RNA present in an organism. The RNA isolation procedure is comprised of steps to completely
lyse the exoskeleton of the cell, separate different biomolecule classes based on their differential
solubility in respective solvents and/or varying densities. The final RNA yields depend on the
efficiency of the separation and integrity or purity of the isolated biomolecule (RNA). RNA
isolations are fraught with problems due to the greater chemical instability of RNA as compared
to other biomolecules such as DNA and proteins and the presence of contaminating RNases. Thus,
troubleshooting an RNA isolation protocol involves testing and altering the reagents used, their
concentrations, and finally the purification procedures.
The RNA isolation protocol devised by (Amin-ul Mannan, Sharma et al. 2009) was used in our
project and did not yield sufficient amounts of RNA. The likely reason for the poor RNA yield
was incomplete lysis of the hard, fungal exoskeleton made of chitin. A more efficient method for
fungal cell lysis was to increase the number of repetitions of RNA cell wall lysis steps, which in
88
this case consisted of increasing the number of incubations and vortex mixing steps (Rivas,
Vizcaino et al. 2001). This also led to the optimization of several parameters like pH of the phenol
that was used, the time period for incubation with hot acidic phenol and the number of ethanol
washes that was needed to properly isolate intact RNA bands. The details of the investigations to
troubleshoot the protocol are described below
An RNA isolation protocol must not only concentrate on delivering RNA purity but also must
yield intact or functional RNA isolates that can be used in several other downstream processes,
like cDNA synthesis and RT-PCR (Meng, Shen et al. 2012). Troubleshooting the RNA isolation
protocol by modifying the pH of the phenol solution used was the first step. Although the RNA is
more sensitive to chemical agents, harsh treatment of the cells to lyse the hard outer chitinaceous
fungal cell walls was necessary. Chitin, a major component of fungal and yeast cell walls, is very
refractory to acid treatment because typically, the N-acetyl groups may hydrolyze before the beta-
1,4-glycosidic linkages. Cell wall lysis was achieved by utilizing an acid with a lower pH that
could facilitate cleaving the exterior polysaccharide, chitin, more efficiently. Although the
appearance of RNA bands was observed, the RNA obtained was not sufficient to either be clearly
visible in the gel electrophoresis or to be used for downstream processes as the purity of the RNA
was suboptimal because DNA and cell debris bands were present in the electrophoresis gels (See
Figures 13a and b). However, according to others (Collart and Oliviero 2001), use of lower pH
phenol solutions was known to improve the purity of isolated RNA. They also optimized the
incubation times with the phenolic solution, which served to improve the quality and quantity of
RNA obtained.
Lastly, the optimization of the number of ethanol washes led to improved yields of high quality,
stable RNA as seen in Fig. 19e in the Results Section. The optimization of the number of ethanol
89
washes in an RNA isolation protocol was not previously reported. This series of troubleshooting
experiments helped to provide a thorough list of steps that can be further optimized but also served
as a complete guide to isolate RNA from Penicillium spinulosum as this is the first account of
RNA isolation from this species. Table 14 shows the optimized procedures for P. spinulosum
RNA isolation.
Table 14 - Optimization of Protocols for RNA Isolation from P. spinulosum Mycelia*
Step RNA isolation step Troubleshooting
#
1 Cell lysis – Hot acidic phenol a) Optimize the pH of phenol solution to between 6.6 and 4.4 b) Optimize the incubation time with the phenol solution between 2, 4, 6, 8 min. 2 Cell lysis – Sodium acetate N/A
3 RNA purification – Chloroform/Isoamyl N/A
alcohol
4 RNA purification – Ethanol wash (75%) Increase the number of ethanol washes from 2 to 3
*This table outlines the steps used in RNA isolation and how these steps were modified so as to increase the yield and quality of RNA obtained.
CLONING AND TRANSFORMATION
The cloning reaction used in this study is based on a cloning strategy that has lately been gaining
importance in the scientific community. The universal TA cloning strategy uses the A overhang in
the PCR insert, that is added by the nontemplate-dependent terminal transferase activity of Taq
90 polymerase to the 3' end of the insert, and the T overhang in the vector that is added by terminal
transferase reaction to the 3' end of the vector for a complementary DNA-DNA pairing. This TA
combination makes the insertion process less complex (Zhou and Gomez-Sanchez 2000). Apart
from eliminating the complexity of the reaction, the TA cloning strategy improves the efficiency
of a normal cloning reaction compared to the conventional cloning reaction and also proves to be
a viable option for both unidirectional and bidirectional cloning (Trower and Elgar 1994).
Efficiency and the accuracy of the cloning strategy are the most important reasons for using this
technique. These attributes can be further improved by employing a TOPO TA cloning kit which
uses a topoisomerase enzyme for the TA cloning procedure.
As part of this procedure, the Topoisomerase I enzyme isolated from a Vaccinia virus is non-
covalently attached to a T-vector which usually is employed in a TA cloning strategy as shown in
Fig. 21.
Figure 21 – Topoisomerase is non-covalently attached to the sequence of TA cloning vector (Topo TA cloning from ThermoFisher Scientific). This enzyme when located at the 5'-CCCTT site has a unique action of cleaving the phosphodiester
backbone of DNA at certain salt concentrations in a reaction (Shuman 1991). Being an exothermic
reaction, the energy of the phosphodiester bond cleavage is conserved in the form of a covalent bond between the 3'-phosphate group of the cleaved strand and a tyrosyl residue of the topoisomerase-I enzyme. This provides the opportunity for the insert to pair with the vector using
91
T-A DNA-complementarity. After the pairing, the phosphotyrosyl bond is attacked by the 5'- hydroxyl group of the cleaved vector strand which reverses the cleavage, breaks the bond and liberates the topoisomerase into the reaction mixture. This TA cloning strategy is outlined in Fig.
22.
Figure 22 - TA cloning strategy to clone segments of DNA into a vector (Zhou and Gomez-Sanchez 2000).
The total reaction above is irreversible because of the involvement of a covalent bond (Shuman
1994). A commercial kit was available with reagents necessary to perform the TA cloning, and hence reduced the burden to construct a T- vector, resulting in increased speed and accuracy of the whole reaction. After the cloning reaction, the transformation was performed with E. coli DH5α cells using heat-shock as heat-shock induced transformation was easier and more efficient
92 (Hanahan 1983). Our results indicated that the transformation using TOPO TA cloning was
successful and yielded the expected fungal sequences as outlined by Taylor et al. for fungal
sequences (Taylor, Herriott et al. 2007).
RT REACTION AND RACE-PCR
RACE PCR is one of the most recent PCR techniques used to amplify segments of RNA or cDNA
based on sequences already known as gene-specific primers. This technique has been successfully
used to identify segments of several transcribing regions of a gene (Yeku and Frohman 2011).
There have been several advancements in the field of genomics and transcriptomics since the
development of this PCR protocol. The work of Ma et al. marked the beginning of the use of this
technique in the case of cellulase-related gene sequences (Ma, Zhang et al. 2006). Their work
concentrated on cloning and characterizing a beta-glucosidase coding gene in cotton. This
technique was aimed at isolating two different segments that flank a common region between the
two segments. Another PCR reaction was aimed at isolating the entire gene or a gene segment of
by using the common region between the segments amplified by gene specific primers and 5' and
3' PCR. This PCR strategy was conceptually found to be similar to the TAIL-PCR (Thermal
Asymmetric InterLaced Polymerase Chain Reaction). It was also seen to be successful in isolating
and cloning two major endoglucanase genes cel7B and cel5A from a similar fungal species
Penicillium decumbens (Wei, Qin et al. 2010). RACE-PCR was unique when compared to other
PCR techniques because of the technique’s emphasis on not only the correct strand but on the
direction of amplification. RNAs isolated and reverse transcribed can be amplified from their 5’
or 3’ ends but the direction in which the gene specific primer (optimized from previous steps)
binds and acts as a primer is important for amplification. The strategy used in both sets of RACE-
PCR is outlined in Fig. 23.
93
Figure 23 – Overview of 5’ RACE (Left) and 3’ RACE (Right) PCRs (SMARTer RACE cDNA kit, CloneTechlabs). The results of the RACE-PCR experiments with P. spinulosum cellulase primers are shown in
Figs. 17 and 18 in the Results Section. Although the 5' RACE-PCR did not yield any significant amplicon from both directions using both of the gene specific primers for clone G, the 3' RACE-
PCR amplicons were selected, cloned and sequenced to probe for cellulase-related sequences using the same gene specific primer for clone G. Gel electrophoresis DNA bands of a size less than 60 bp in length were not to be considered for further use as cDNA as these size fragments increase the probability of non-specific nucleotide binding and also formation of primer-dimers.
FUTURE RESEARCH
The amplicons from 3' RACE-PCR may not only help in finding a cellulase-related gene fragments but can also serve as a foundation for future studies in which these sequences can be used to isolate related and adjacent sequences in the Penicillium spinulosum genome. Future studies may involve
94 genetic and molecular analysis using the specific primers to amplify sequences out of the genome, both RNA and genomic DNA. These sequences can then be expressed to look for proteins that might yield cellulase-related products. The work done throughout this project outlined the possibility of reconstructing the whole transcriptome associated with several cellulase-related gene sequences. In this process, several amplicons have been identified as possible sections of cellulase gene based on BLAST analysis. This project had identified and standardized protocols for specific biomolecules RNA, DNA and cDNA, from Penicillium spinulosum. The primer sequences that were designed in this project and identified to amplify cellulase related gene segments can be used in future molecular investigations to isolate and amplify these DNA segments. The sequences can also be used in conjunction with other primers that may amplify out larger sequences that may code for larger segments of the enzyme. Determining the specificity of the fragment can be useful when seeking to express the protein in larger quantities, which would increase access to the cellulolytic proteins. The production of these glycohydrolase proteins via biotechnology may make these feasible to use in the production of cellulosic biofuels like ethanol, which is one of the most important commercial applications in existence. This research can also advance the optimization of cellulase enzyme production for other commercial uses, including in food industries, as stated in the Introduction Section.
CONCLUSIONS
This study has identified, optimized and designed several parameters that will be useful in future biochemical and molecular characterization of cellulase gene from P. spinulosum. Some of the important findings from this study are listed in the following paragraphs.
95 One of the initial breakthroughs in this study came when optimizing the growth media for the growth of P. spinulosum spores. Karasawa et al. had proven that conventionally the gene expression increases in fungal sources when grown in media containing galactose and sucrose as the carbon source versus glucose. Wheeler et al. observed increased cellulase yield in P. spinulosum when the spores were grown in media having sucrose as the carbon source. Since the study concentrated on using nucleic acids for probing cellulase related sequences, an optimal growth media to isolate DNA was designed. This identified sucrose as an optimal carbon source in media for P. spinulosum DNA isolation.
Finding the optimal annealing temperature for PCR is a primer-related finding that can be used downstream for a particular primer set and template DNA combination to achieve a more sensitive
PCR. (Rychlik et al. 1990). This was tested in gradient PCR experiments and recorded for all the
7 primer sets. This bypasses troubleshooting the annealing step to optimize the PCR reaction.
The next major findings were the sequences that were isolated from the genomic P. spinulosum
DNA using degenerate oligonucleotide primers. Although there were many amplicons that were sequenced, after BLAST analysis only 7 clones were selected and used for analysis downstream of degenerate primer PCR. These sequences were selected based on the level of sequence similarity they possessed in comparison with the sequences that were already available in the BLAST database and their functional similarity to cellulase sequences from other fungi such as P. chrysogenum. This BLAST search also yielded sequences that were functionally similar to other enzymes like galactosidases that were not relevant to the (cellulose) sequence in question and that might prove helpful in probing for other functional sequences. There were a few other sequences, that did not overlap with any other sequences in the existing fungal databases. These sequences may prove to be both novel and related to cellulases and may fungal species specific. Therefore,
96 more functionally related cellulase sequences were chosen. The sequences identified may be used
to probe for other cellulase-related sequences and could serve as starting points for DNA-based
molecular characterization in future studies. BLAST analysis eliminated overlap with bacterial
sequences in the sequences selected for fungal cellulose investigations. This discrimination was
made to (1) prevent potential contamination with E. coli DNA as the bacillus was used as a vector in transformation studies and (2) avoid using bacterial DNA to probe for the desired peptide sequence due to the codon bias between bacterial and fungal DNA sequences, and (3) minimize
confusion between bacterial and fungal cellulases.
One of the most important conclusions this study has provided is with respect to the RNA isolation
protocol. RNA isolation comprises several steps including lysing the cells open, separating the
nucleic acids from other biological materials, selectively releasing RNA and finally purifying the
RNA. These were carried out successfully and after several rounds of troubleshooting, a conclusive
RNA isolation protocol had been tested and proven to yield increased RNA levels from P.
spinulosum. This established protocol will be useful for any reverse transcriptase (RT) reaction or
transcriptional study in this organism.
Finally, the cDNA isolated from the RT reaction with RNA was used to carry out a RACE reaction.
This investigation demonstrated the presence of an amplicon for clone G when the 3’ RACE
reaction was carried out. This selectively identified a potential segment of DNA that can be a part
of cellulase gene in P.spinulosum. The primer was obtained when probing for a cDNA sequence
corresponding to the peptide sequence obtained from the mass spectrometry analysis of the
cellulase or β-glucosidase protein purified from P. spinulosum. The PCR amplicon from PCR with
primer set G showed sequence similarity to a cellulase gene fragment from P. chrysogenum. So an
amplicon from cDNA RACE PCR is potentially expected to be a segment of a cellulase coding
97 region. This may serve as a starting point for expression studies using vectors that could express this protein and use this segment to probe for nearby cellulase gene sequences that can be used to fully reconstruct the cellulase gene.
98
REFERENCES
99 1. (1994). "FEMS Symposium on Lignin Biodegradation and Transformation. Proceedings.
Lisbon, Portugal, 18-21 April 1993." FEMS Microbiol Rev 13(2-3): 121-390.
2. Aaij, C. and P. Borst (1972). "The gel electrophoresis of DNA." Biochim Biophys Acta
269(2): 192-200.
3. Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman (1990). "Basic local
alignment search tool." J Mol Biol 215(3): 403-410.
4. Amin-ul Mannan, M., S. Sharma and K. Ganesan (2009). "Total RNA isolation from
recalcitrant yeast cells." Anal Biochem 389(1): 77-79.
5. Bayer, E. A., H. Chanzy, R. Lamed and Y. Shoham (1998). "Cellulose, cellulases and
cellulosomes." Curr Opin Struct Biol 8(5): 548-557.
6. Berghem, L. E. and L. G. Pettersson (1973). "The mechanism of enzymatic cellulose
degradation. Purification of a cellulolytic enzyme from Trichoderma viride active on
highly ordered cellulose." Eur J Biochem 37(1): 21-30.
7. Bernstein, J. A., A. B. Khodursky, P. H. Lin, S. Lin-Chao and S. N. Cohen (2002). "Global
analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using
two-color fluorescent DNA microarrays." Proc Natl Acad Sci U S A 99(15): 9697-9702.
8. Bhattacharya, S. (2010). "The facts about penicillin allergy: a review." J Adv Pharm
Technol Res 1(1): 11-17.
9. Blackwell, M. (2011). "The fungi: 1, 2, 3 ... 5.1 million species?" Am J Bot 98(3): 426-
438.
10. Bruns, T. (2006). "Evolutionary biology: a kingdom revised." Nature 443(7113): 758-761.
11. Bustin, S. A. (2000). "Absolute quantification of mRNA using real-time reverse
transcription polymerase chain reaction assays." J Mol Endocrinol 25(2): 169-193.
100 12. Chagas, G. M., B. M. Oliveira, A. P. Campello and M. L. Kluppel (1992). "Mechanism of
citrinin-induced dysfunction of mitochondria. II. Effect on respiration, enzyme activities,
and membrane potential of liver mitochondria." Cell Biochem Funct 10(3): 209-216.
13. Chenchik, A., L. Diachenko, F. Moqadam, V. Tarabykin, S. Lukyanov and P. D. Siebert
(1996). "Full-length cDNA cloning and determination of mRNA 5' and 3' ends by
amplification of adaptor-ligated cDNA." Biotechniques 21(3): 526-534.
14. Cheng, G., P. Varanasi, C. Li, H. Liu, Y. B. Melnichenko, B. A. Simmons, M. S. Kent and
S. Singh (2011). "Transition of cellulose crystalline structure and surface morphology of
biomass as a function of ionic liquid pretreatment and its relation to enzymatic hydrolysis."
Biomacromolecules 12(4): 933-941.
15. Collart, M. A. and S. Oliviero (2001). "Preparation of yeast RNA." Curr Protoc Mol Biol
Chapter 13: Unit13 12.
16. Dashtban, M., H. Schraft and W. Qin (2009). "Fungal bioconversion of lignocellulosic
residues; opportunities & perspectives." Int J Biol Sci 5(6): 578-595.
17. Dieffenbach, C. W., T. M. Lowe and G. S. Dveksler (1993). "General concepts for PCR
primer design." PCR Methods Appl 3(3): S30-37.
18. Drews, J. (2000). "Drug discovery: a historical perspective." Science 287(5460): 1960-
1964.
19. Esen, A. and H. Bandaranayake (1998). "Insertional polymorphism in introns 4 and 10 of
the maize beta-glucosidase gene glu1." Genome 41(4): 597-604.
20. Fleming, A. (2001). "On the antibacterial action of cultures of a penicillium, with special
reference to their use in the isolation of B. influenzae. 1929." Bull World Health Organ
79(8): 780-790.
101 21. Green, M. R. (1986). "Pre-mRNA splicing." Annu Rev Genet 20: 671-708.
22. Grierson, D. and V. Hemleben (1977). "Effect of 8-hydroxyquinoline on the uptake of
uridine and incorporation into RNA." Planta 134(2): 155-157.
23. Hanahan, D. (1983). "Studies on transformation of Escherichia coli with plasmids." J Mol
Biol 166(4): 557-580.
24. Harris, S. D. (2008). "Branching of fungal hyphae: regulation, mechanisms and comparison
with other branching systems." Mycologia 100(6): 823-832.
25. Heitman, J. (2006). "Sexual reproduction and the evolution of microbial pathogens." Curr
Biol 16(17): R711-725.
26. Henrissat, B., M. Claeyssens, P. Tomme, L. Lemesle and J. P. Mornon (1989). "Cellulase
families revealed by hydrophobic cluster analysis." Gene 81(1): 83-95.
27. Hibbett, D. S., M. Binder, J. F. Bischoff, M. Blackwell, P. F. Cannon, O. E. Eriksson, S.
Huhndorf, T. James, P. M. Kirk, R. Lucking, H. Thorsten Lumbsch, F. Lutzoni, P. B.
Matheny, D. J. McLaughlin, M. J. Powell, S. Redhead, C. L. Schoch, J. W. Spatafora, J.
A. Stalpers, R. Vilgalys, M. C. Aime, A. Aptroot, R. Bauer, D. Begerow, G. L. Benny, L.
A. Castlebury, P. W. Crous, Y. C. Dai, W. Gams, D. M. Geiser, G. W. Griffith, C. Gueidan,
D. L. Hawksworth, G. Hestmark, K. Hosaka, R. A. Humber, K. D. Hyde, J. E. Ironside, U.
Koljalg, C. P. Kurtzman, K. H. Larsson, R. Lichtwardt, J. Longcore, J. Miadlikowska, A.
Miller, J. M. Moncalvo, S. Mozley-Standridge, F. Oberwinkler, E. Parmasto, V. Reeb, J.
D. Rogers, C. Roux, L. Ryvarden, J. P. Sampaio, A. Schussler, J. Sugiyama, R. G. Thorn,
L. Tibell, W. A. Untereiner, C. Walker, Z. Wang, A. Weir, M. Weiss, M. M. White, K.
Winka, Y. J. Yao and N. Zhang (2007). "A higher-level phylogenetic classification of the
Fungi." Mycol Res 111(Pt 5): 509-547.
102 28. Hossain, M. M., F. Sultana, M. Kubota, H. Koyama and M. Hyakumachi (2007). "The
plant growth-promoting fungus Penicillium simplicissimum GP17-2 induces resistance in
Arabidopsis thaliana by activation of multiple defense signals." Plant Cell Physiol 48(12):
1724-1736.
29. Inoue, T., S. Moriya, M. Ohkuma and T. Kudo (2005). "Molecular cloning and
characterization of a cellulase gene from a symbiotic protist of the lower termite,
Coptotermes formosanus." Gene 349: 67-75.
30. Irwin, D., D. H. Shin, S. Zhang, B. K. Barr, J. Sakon, P. A. Karplus and D. B. Wilson
(1998). "Roles of the catalytic domain and two cellulose binding domains of
Thermomonospora fusca E4 in cellulose hydrolysis." J Bacteriol 180(7): 1709-1714.
31. Jermyn, M. A. (1953). "Fungal cellulases. III. Stachybotrys atra: growth and enzyme
production on non-cellulosic substrates." Aust J Biol Sci 6(1): 48-69.
32. Jervis, E. J., C. A. Haynes and D. G. Kilburn (1997). "Surface diffusion of cellulases and
their isolated binding domains on cellulose." J Biol Chem 272(38): 24016-24023.
33. Joshi, S. and V. Agte (1995). "Digestibility of dietary fiber components in vegetarian men."
Plant Foods Hum Nutr 48(1): 39-44.
34. Jussila, J., H. Komulainen, V. M. Kosma, J. Pelkonen and M. R. Hirvonen (2002).
"Inflammatory potential of the spores of Penicillium spinulosum isolated from indoor air
of a moisture-damaged building in mouse lungs." Environ Toxicol Pharmacol 12(3): 137-
145.
35. Karkehabadi, S., H. Hansson, S. Kim, K. Piens, C. Mitchinson and M. Sandgren (2008).
"The first structure of a glycoside hydrolase family 61 member, Cel61B from Hypocrea
jecorina, at 1.6 A resolution." J Mol Biol 383(1): 144-154.
103 36. Keller, N. P., G. Turner and J. W. Bennett (2005). "Fungal secondary metabolism - from
biochemistry to genomics." Nat Rev Microbiol 3(12): 937-947.
37. Khan, A. W. and T. K. Walker (1961). "Fat production from cane molasses by Penicillium
spinulosum: a study on substances in cane molasses interfering with fat production." Can
J Microbiol 7: 895-899.
38. Kim, H., Y. H. You, H. Yoon, Y. Seo, Y. E. Kim, Y. S. Choo, I. J. Lee, J. H. Shin and J.
G. Kim (2014). "Culturable fungal endophytes isolated from the roots of coastal plants
inhabiting korean East coast." Mycobiology 42(2): 100-108.
39. Klemm, D., B. Heublein, H. P. Fink and A. Bohn (2005). "Cellulose: fascinating
biopolymer and sustainable raw material." Angew Chem Int Ed Engl 44(22): 3358-3393.
40. Kurasawa, T., M. Yachi, M. Suto, Y. Kamagata, S. Takao and F. Tomita (1992). "Induction
of Cellulase by Gentiobiose and Its Sulfur-Containing Analog in Penicillium
purpurogenum." Appl Environ Microbiol 58(1): 106-110.
41. Lehrach, H., D. Diamond, J. M. Wozney and H. Boedtker (1977). "RNA molecular weight
determinations by gel electrophoresis under denaturing conditions, a critical
reexamination." Biochemistry 16(21): 4743-4751.
42. Lewis, J. C., C. F. Pierson and M. J. Powers (1963). "Fungi Associated with Softening of
Bisulfite-Brined Cherries." Appl Microbiol 11(2): 93-99.
43. Li, Y. L., H. Li, A. N. Li and D. C. Li (2009). "Cloning of a gene encoding thermostable
cellobiohydrolase from the thermophilic fungus Chaetomium thermophilum and its
expression in Pichia pastoris." J Appl Microbiol 106(6): 1867-1875.
44. Ma, G. J., T. Z. Zhang and W. Z. Guo (2006). "Cloning and characterization of cotton
GhBG gene encoding beta-glucosidase." DNA Seq 17(5): 355-362.
104 45. McGinnis, M. R. and S. K. Tyring (1996). General Concepts of Mycology. Medical
Microbiology. S. Baron. Galveston (TX).
46. McNulty, C. A., P. Boyle, T. Nichols, P. Clappison and P. Davey (2007). "The public's
attitudes to and compliance with antibiotics." J Antimicrob Chemother 60 Suppl 1: i63-68.
47. Meng, D. M., L. Shen, X. H. Zhang and J. P. Sheng (2012). "Isolation of high quality and
yield of RNA from Agaricus bisporus with a simple, inexpensive and reliable method."
Biotechnol Lett 34(7): 1315-1320.
48. Nakayama, S., K. Kiyoshi, T. Kadokura and A. Nakazato (2011). "Butanol production from
crystalline cellulose by cocultured Clostridium thermocellum and Clostridium
saccharoperbutylacetonicum N1-4." Appl Environ Microbiol 77(18): 6470-6475.
49. Nam, Y. W., T. Nihira, T. Arakawa, Y. Saito, M. Kitaoka, H. Nakai and S. Fushinobu
(2015). "Crystal Structure and Substrate Recognition of Cellobionic Acid Phosphorylase,
Which Plays a Key Role in Oxidative Cellulose Degradation by Microbes." J Biol Chem
290(30): 18281-18292.
50. Negoi, A., I. T. Trotus, O. Mamula Steiner, M. Tudorache, V. Kuncser, D. Macovei, V. I.
Parvulescu and S. M. Coman (2013). "Direct synthesis of sorbitol and glycerol from
cellulose over ionic Ru/magnetite nanoparticles in the absence of external hydrogen."
ChemSusChem 6(11): 2090-2094.
51. Niwa, K., T. Takaya, T. Morimoto and K. Takada (1995). "Preparation and evaluation of
a time-controlled release capsule made of ethylcellulose for colon delivery of drugs." J
Drug Target 3(2): 83-89.
52. Nono, I., N. Ohno, A. Masuda, S. Oikawa and T. Yadomae (1991). "Oxidative degradation
of an antitumor (1-3)-beta-D-glucan, grifolan." J Pharmacobiodyn 14(1): 9-19.
105 53. Reichenbecher, M., F. Lottspeich and K. Bronnenmeier (1997). "Purification and
properties of a cellobiose phosphorylase (CepA) and a cellodextrin phosphorylase (CepB)
from the cellulolytic thermophile Clostridium stercorarium." Eur J Biochem 247(1): 262-
267.
54. Rivas, R., N. Vizcaino, R. M. Buey, P. F. Mateos, E. Martinez-Molina and E. Velazquez
(2001). "An effective, rapid and simple method for total RNA extraction from bacteria and
yeast." J Microbiol Methods 47(1): 59-63.
55. Robert, C. and A. Bernalier-Donadille (2003). "The cellulolytic microflora of the human
colon: evidence of microcrystalline cellulose-degrading bacteria in methane-excreting
subjects." FEMS Microbiol Ecol 46(1): 81-89.
56. Robertson, J. M. and J. Walsh-Weller (1998). "An introduction to PCR primer design and
optimization of amplification reactions." Methods Mol Biol 98: 121-154.
57. Rubini, M. R., A. J. Dillon, C. M. Kyaw, F. P. Faria, M. J. Pocas-Fonseca and I. Silva-
Pereira (2010). "Cloning, characterization and heterologous expression of the first
Penicillium echinulatum cellulase gene." J Appl Microbiol 108(4): 1187-1198.
58. Rychlik, W., W. J. Spencer and R. E. Rhoads (1990). "Optimization of the annealing
temperature for DNA amplification in vitro." Nucleic Acids Res 18(21): 6409-6412.
59. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis
and H. A. Erlich (1988). "Primer-directed enzymatic amplification of DNA with a
thermostable DNA polymerase." Science 239(4839): 487-491.
60. Schaefer, B. C. (1995). "Revolutions in rapid amplification of cDNA ends: new strategies
for polymerase chain reaction cloning of full-length cDNA ends." Anal Biochem 227(2):
255-273.
106 61. Schiavino, D., E. Nucera, C. Lombardo, M. Decinti, L. Pascolini, G. Altomonte, A.
Buonomo and G. Patriarca (2009). "Cross-reactivity and tolerability of imipenem in
patients with delayed-type, cell-mediated hypersensitivity to beta-lactams." Allergy
64(11): 1644-1648.
62. Shimi, I. R., J. Singh and T. K. Walker (1959). "The component fatty acids of Penicillium
spinulosum fat." Biochem J 72(1): 184-187.
63. Shuman, S. (1991). "Recombination mediated by vaccinia virus DNA topoisomerase I in
Escherichia coli is sequence specific." Proc Natl Acad Sci U S A 88(22): 10104-10108.
64. Shuman, S. (1994). "Novel approach to molecular cloning and polynucleotide synthesis
using vaccinia DNA topoisomerase." J Biol Chem 269(51): 32678-32684.
65. Sonan, G. K., V. Receveur-Brechot, C. Duez, N. Aghajari, M. Czjzek, R. Haser and C.
Gerday (2007). "The linker region plays a key role in the adaptation to cold of the cellulase
from an Antarctic bacterium." Biochem J 407(2): 293-302.
66. Sponsler, O. L. (1923). "Structural Units of Starch Determined by X-Ray Crystal Structure
Method." J Gen Physiol 5(6): 757-776.
67. Sticklen, M. B. (2008). "Plant genetic engineering for biofuel production: towards
affordable cellulosic ethanol." Nat Rev Genet 9(6): 433-443.
68. Storck, R. and C. J. Alexopoulos (1970). "Deoxyribonucleic acid of fungi." Bacteriol Rev
34(2): 126-154.
69. Sulzenbacher, G., F. Shareck, R. Morosoli, C. Dupont and G. J. Davies (1997). "The
Streptomyces lividans family 12 endoglucanase: construction of the catalytic cre,
expression, and X-ray structure at 1.75 A resolution." Biochemistry 36(51): 16032-16039.
107 70. Talwar, P., A. Chakrabarti, P. Kaur, R. K. Pahwa, A. Mittal and Y. N. Mehra (1988).
"Fungal infections of ear with special reference to chronic suppurative otitis media."
Mycopathologia 104(1): 47-50.
71. Taylor, D. L., I. C. Herriott, J. Long and K. O'Neill (2007). "TOPO TA is A-OK: a test of
phylogenetic bias in fungal environmental clone library construction." Environ Microbiol
9(5): 1329-1334.
72. Temin, H. M. and S. Mizutani (1970). "RNA-dependent DNA polymerase in virions of
Rous sarcoma virus." Nature 226(5252): 1211-1213.
73. Thomas, P. A. (2003). "Fungal infections of the cornea." Eye (Lond) 17(8): 852-862.
74. Trower, M. K. and G. S. Elgar (1994). "PCR cloning using T-vectors." Methods Mol Biol
31: 19-33.
75. Varadaraj, K. and D. M. Skinner (1994). "Denaturants or cosolvents improve the
specificity of PCR amplification of a G + C-rich DNA using genetically engineered DNA
polymerases." Gene 140(1): 1-5.
76. Watanabe, H., H. Noda, G. Tokuda and N. Lo (1998). "A cellulase gene of termite origin."
Nature 394(6691): 330-331.
77. Wei, X. M., Y. Q. Qin and Y. B. Qu (2010). "Molecular cloning and characterization of
two major endoglucanases from Penicillium decumbens." J Microbiol Biotechnol 20(2):
265-270.
78. Wyllie, J. (1945). "A method for the rapid production of citrinin." Can J Public Health 36:
477-483.
108 79. Yague, E., C. M. Chow, M. P. Challen and C. F. Thurston (1996). "Correlation of exons
with functional domains and folding regions in a cellulase from Agaricus bisporus." Curr
Genet 30(1): 56-61.
80. Yazdani, S. S. and R. Gonzalez (2007). "Anaerobic fermentation of glycerol: a path to
economic viability for the biofuels industry." Curr Opin Biotechnol 18(3): 213-219.
81. Yeku, O. and M. A. Frohman (2011). "Rapid amplification of cDNA ends (RACE)."
Methods Mol Biol 703: 107-122.
82. Yu, A. Q., J. C. Zhu, B. Zhang, L. J. Xing and M. Li (2011). "Effects of different carbon
sources on the growth, fatty acids production, and expression of three desaturase genes of
Mortierella alpina ATCC 16266." Curr Microbiol 62(5): 1617-1622.
83. Zhou, M. Y. and C. E. Gomez-Sanchez (2000). "Universal TA cloning." Curr Issues Mol
Biol 2(1): 1-7.
84. Zverlov, V. V., N. Schantz and W. H. Schwarz (2005). "A major new component in the
cellulosome of Clostridium thermocellum is a processive endo-beta-1,4-glucanase
producing cellotetraose." FEMS Microbiol Lett 249(2): 353-358.
85. Sticklen, M. B. (2008). “Plant genetic engineering for biofuel production: towards
affordable cellulosic ethanol”. Nat. Rev. Gen. 9, 433-443.
86. S. Ali, J. Hall, K. L. Soole, et al., (1995)“Targeted expression of microbial cellulases in
transgenic animals,” in Carbohydrate Bioengineering, S. B. Petersen, B. Svensson, and S.
Pedersen, Eds., vol. 10 of Progress in Biotechnology, , Elsevier. : 279–293.
87. Timothy W. Wheeler, Sarah N. Deffit, Michael A. Kochen, Ryan T. Anderson, Sandra J.
Bonetti Dan Caprioglio. (2011). “The production of exo-β-glucosidases from Penicillium
spinulosum chemostat and liquid shake cultures” Chemistry, Biology, Colorado State
109 University-Pueblo, Pueblo, CO, Microbiology and Immunology, IUPUI, Indiana
University School of Medicine, Indianapolis, IN.
88. Amin-ul Mannan, M., S. Sharma and K. Ganesan (2009). "Total RNA isolation from
recalcitrant yeast cells." Anal Biochem 389(1): 77-79.
89. Collart, M. A. and S. Oliviero (2001). "Preparation of yeast RNA." Curr Protoc Mol Biol
Chapter 13: Unit13 12.
90. Esen, A. and H. Bandaranayake (1998). "Insertional polymorphism in introns 4 and 10 of
the maize beta-glucosidase gene glu1." Genome 41(4): 597-604.
91. Hanahan, D. (1983). "Studies on transformation of Escherichia coli with plasmids." J Mol
Biol 166(4): 557-580.
92. Henrissat, B., M. Claeyssens, P. Tomme, L. Lemesle and J. P. Mornon (1989). "Cellulase
families revealed by hydrophobic cluster analysis." Gene 81(1): 83-95.
93. Kurasawa, T., M. Yachi, M. Suto, Y. Kamagata, S. Takao and F. Tomita (1992). "Induction
of cellulase by gentiobiose and its sulfur-containing analog in Penicillium purpurogenum."
Appl Environ Microbiol 58(1): 106-110.
94. Ma, G. J., T. Z. Zhang and W. Z. Guo (2006). "Cloning and characterization of cotton
GhBG gene encoding beta-glucosidase." DNA Seq 17(5): 355-362.
95. Meng, D. M., L. Shen, X. H. Zhang and J. P. Sheng (2012). "Isolation of high quality and
yield of RNA from Agaricus bisporus with a simple, inexpensive and reliable method."
Biotechnol Lett 34(7): 1315-1320.
96. Rivas, R., N. Vizcaino, R. M. Buey, P. F. Mateos, E. Martinez-Molina and E. Velazquez
(2001). "An effective, rapid and simple method for total RNA extraction from bacteria and
yeast." J Microbiol Methods 47(1): 59-63.
110 97. Rychlik, W., W. J. Spencer and R. E. Rhoads (1990). "Optimization of the annealing
temperature for DNA amplification in vitro." Nucleic Acids Res 18(21): 6409-6412.
98. Shuman, S. (1991). "Recombination mediated by vaccinia virus DNA topoisomerase I in
Escherichia coli is sequence specific." Proc Natl Acad Sci U S A 88(22): 10104-10108.
99. Shuman, S. (1994). "Novel approach to molecular cloning and polynucleotide synthesis
using vaccinia DNA topoisomerase." J Biol Chem 269(51): 32678-32684.
100. Taylor, D. L., I. C. Herriott, J. Long and K. O'Neill (2007). "TOPO TA is A-OK: a
test of phylogenetic bias in fungal environmental clone library construction." Environ
Microbiol 9(5): 1329-1334.
101. Trower, M. K. and G. S. Elgar (1994). "PCR cloning using T-vectors." Methods
Mol Biol 31: 19-33.
102. Wei, X. M., Y. Q. Qin and Y. B. Qu (2010). "Molecular cloning and
characterization of two major endoglucanases from Penicillium decumbens." J Microbiol
Biotechnol 20(2): 265-270.
103. Yague, E., C. M. Chow, M. P. Challen and C. F. Thurston (1996). "Correlation of
exons with functional domains and folding regions in a cellulase from Agaricus bisporus."
Curr Genet 30(1): 56-61.
104. Yeku, O. and M. A. Frohman (2011). "Rapid amplification of cDNA ends
(RACE)." Methods Mol Biol 703: 107-122.
105. Zhou, M. Y. and C. E. Gomez-Sanchez (2000). "Universal TA cloning." Curr Issues
Mol Biol 2(1): 1-7.
106. S. Deguchi, K. Tsujii and K. Horikoshi, (2006) "Cooking Cellulose in Hot and
Compressed Water," Chem. Commun. 61, 3293.
111 107. Fan L., Gharpuray M.M., Lee YH. (1987) Acid Hydrolysis of Cellulose. In:
Cellulose Hydrolysis. Biotechnology Monographs, vol 3. Springer, Berlin, Heidelberg.
108. Dale Kiefer. (2008) Promoting optimal nutrition with digestive enzymes. Life
Extension Magazine.
109. Deffit, S., S. Bonetti, and D. R. Caprioglio (2009). The Optimization and
Purification of Cellulase from Penicillum fellutanum and Penicillium spinulosum. Tri Beta
Conference Durango, CO.
110. Wheeler, T. W., S. N. Deffit, M. A. Kochen, R. T. Anderson, S. J. Bonetti, and D.
Caprioglio (2011). The production of exo-β-glucosidases from Penicillium spinulosum
chemostat and liquid shake cultures. Annual Meeting of the American Society for
Biochemistry and Molecular Biology, Washington D.C., Abstract# 7350.
111. Salt, S. D. and J. E., Gander (1985). “Variations in phosphoryl substituents in
extracellular peptide-phosphogalactomannans from Penicillium charlesii G. Smith. Exp
Mycol 9: 9-19.
112. Cho, Y. J. “The purification of fungal cellulase from the fungus Penicillium
spinulosum”. University of Southern Colorado, 1999.
112 THESIS PRESENTATION SLIDES 6/11/2018
Isolation of a fungal cellulase gene transcript Srivatsan Parthasarathy
FUNGUS
• Kingdom of eukaryotes
• Non‐motile; depend on spores
• Dispersal of spores leads to propagation and growth
• Grows on Carbon‐rich substrates
• Penicillium spinulosum
(Suresh P.V., 2015)
1 6/11/2018
CELLULOSE • Earth’s most abundant organic polymer • Polysaccharide linked with glycosidic linkages • Major component of plant cell‐ wall
Gurunathan et al, 2015; Wikipedia
FUNGAL CELLULASE
• General name given to a group of enzymes that hydrolyze cellulose
• Usually 3 types i) Endocellulase – randomly cleaves cellulose internally ii) Exocellulase – Cleaves only at the ends of cellulose or disaccharides iii) Cellobiase – cleaves smaller disaccharides or tetrasaccharides into simpler sugars
• Cellulosome ‐ group of enzymes arranged as a machinery to actively degrade cellulose either for nutritional benefits or for attachment
• These enzymes are prevalently present across fungal sources –Mainly Penicillium
2 6/11/2018
Schraft et al. 2009
PREVIOUS FINDING
SDS PAGE – protein identification
HPLC‐MS‐MS
(Wheeler et al, 2008)
3 6/11/2018
HYPOTHESIS Regions from DNA can me mapped using RNA P. spinulosum genome (cellulase gene)
RNA sequence that correspond to the cellulase amino acid sequence RNA that codes for cellulase – amino acid sequence
Segments known from P. spinulosum cellulase previous studies
METHODS AND LOGIC
P. spinulosum Design the primers required for amplification of DNA sequences based on degenerate Oligo nucleotide PCR
RNA cDNA
Determine the optimal annealing temperatures to be used for subsequent PCR Amplicon A Amplicon B
Amplicon C Isolate RNA and reverse transcribe to cDNA Amplicon D Amplicon E Amplicon F Use the designed primers to amplify the cDNA and sequence Amplicon G them
Locate the sequence in the gene and use to map the gene
4 6/11/2018
RESULTS
PRIMER DESIGN
Degenerate oligonucleotide PCR
DNA sequencing and BLAST‐X
PRIMER SET A analysis
PRIMER SET B
PRIMER SET C
PRIMER SET D PRIMER SET E Primers designed PRIMER SET F
PRIMER SET G
5 6/11/2018
DNA ISOLATION
‐DNA isolated from P. spinulosum grown in media containing sucrose and galactose
‐ Biomass of both preps. Measured to be equal (300‐350g of wet biomass) Gen. DNA 1 – Sucrose ‐ 1g of cells measured and taken Gen. DNA 2 ‐ Galactose
‐ DNA isolated using MasterPure Yeast DNA purification kit from Epicentre
DNA washed using 70% P. spinulosum Cells lysed using Lysis Proteins precipitated and Isopropanol added to DNA eluted in TE buffer Ethanol cells buffer pelleted by centrifugation precipitate DNA and pelleted
DNA ISOLATION
‐DNA isolated from P. spinulosum grown in media containing sucrose and galactose
‐ Biomass of both preps. Measured to be equal (300‐350g of wet biomass)
‐ 1g of cells measured and taken
‐ DNA isolated using MasterPure Yeast DNA purification kit from Epicentre
DNA washed using 70% P. spinulosum Cells lysed using Lysis Proteins precipitated and Isopropanol added to DNA eluted in TE buffer Ethanol cells buffer pelleted by centrifugation precipitate DNA and pelleted
6 6/11/2018
PCR OPTIMIZATION FACTORS AFFECTING PCR EFFICIENCY (wrt PRIMERS): 5’ 3’ 1) GC content 3’ 5’ Primer design 2) Melting temperature 3) Annealing temperature 5’ 3’ 3’ 5’ Gradient PCR
5’ 3’ 3’ 5’
Agarose gel electrophoresis image of PCR products using primer set A
7 6/11/2018
ANNEALING TEMPERATURES
Amplicon NAME PRODUCT LENGTH OPTIMUM TEMPERATURE.
(bp) (˚C)
A 384 56
B 163 54
C 216 60
D 184 56
E 169 58
F 112 ‐
G 156 56
RNA isolation
P. spinulosum RNA
RNA isolation to be characterized
1) Hot phenol isolation method 2) Cells lysed using SDS+Glass beads based mechanism
CELL LYSIS PHASE SEPARATION RNA PURIFICATION 1) Hot phenol (@ 65 C) 1) Phenol+Chloroform+iso 1) RNA washed with 75% 2) SDS (10%) amyl alcohol ethanol 3) 0.1mm Glass beads 2) Aqueous phase 2) RNA eluted in TE buffer separated carefully
8 6/11/2018
RNA isolation
1) pH of phenol
2) Incubation during Vortexing
Initial RNA isolation Isolated RNA with no degradation (No RNA)
3) Number of ethanol washes
Reverse Transcription
‐ Reverse transcriptase ‐ RNA dependent DNA polymerase ‐ Synthesized by certain viruses ‐ Yields cDNA that is more stable than RNA and can be used for downstream PCR reactions ‐ Can be used with gene specific primer or oligodT primers
COMPONENTS OF THE MASTER MIX VOLUME (uL)
10X Buffer RT (Kit provided) 2
dNTP mix (5 mM each dNTP) 2
OligodT primer (10 μM) 2
RNase inhibitor (10 units/μL) 1
Omniscript Reverse transcriptase (4 1
Units/uL)
RNase‐free water 7
RNA template (1ug) 5
9 6/11/2018
RT‐PCR
‐ Process by which RNA is converted to cDNA and this is used as template to amplify sequences using PCR 5’ AAAAAAAAAAAAAA 3’ Oligo dT ‐ Was done to identify sites inside the coding regions that can be Gene specific forward primer amplified using gene specific primers and OligodT 3’ TTTTTTTTTTTTTTTTT 5’
‐ Optimal annealing temperatures from first gradient PCR used for this reason
2.4‐2.5Kb 2.4‐2.5Kb
1‐1.2Kb 1‐1.2Kb
TA cloning system
Plating in LB‐Kan plates Transformation and incubation at 37 C using Heat‐shock
Thermo fisher Scientific
10 6/11/2018
BACTERIAL TRANSFORMATION
Mini‐Prep – method to isolate plasmid from bacterial cultures
Colonies harvested
Grown in 10mL cultures
Sigma ‐ Aldrich
PLASMID CONFIRMATION
5’ 3’ M13R M13F 3’ 5’ PCR
No insert control – 200bp region
11 6/11/2018
BLAST ANALYSIS
Number Primer name Similar to (Organism) Similar to (Protein)
1 A Burkholderia cenocipacia Hypothetical protein
2 B Eschericia coli Hypothetical protein
3 C Eschericia coli Membrane protein YcfT
4 D Eschericia coli Fumarase reductase
5 G Penicillium digitatum, Hypothetical protein
Penicillium chrysogenum
RACE reaction
‐ Performed to map RNA sequence from limited known sequence information
‐ Can be mapped using both 5’ and 3’ ends of RNA – hence the name 5’ and 3’ RACE
‐ 5’ RACE proceeds via the use of an internal known primer that is specific to the gene of interest. SP1
‐ 5’ end is marked by addition of homopolymeric sequences or known tags for amplification
‐ 3’ RACE proceeds via the same mechanism
‐ Since 3’ end utilizes known polyA tail, homopolymeric addition or tag addition is not required Sigma Aldrich
12 6/11/2018
RACE reaction
‐ Performed to map RNA sequence from limited known sequence information
‐ Can be mapped using both 5’ and 3’ ends of RNA – hence the name 5’ and 3’ RACE
‐ 5’ RACE proceeds via the use of an internal known primer that is specific to the gene of interest. SP1
‐ 5’ end is marked by addition of homopolymeric sequences or known tags for amplification
‐ 3’ RACE proceeds via the same mechanism
‐ Since 3’ end utilizes known polyA tail, homopolymeric addition or tag addition is not required Sigma Aldrich
RNA 5’/3’ RACE reaction
5’ RACE 3’ RACE
‐ G set of primers are the only set of primers used to amplify Both performed using G forward and reverse ‐ G forward and Reverse primers used in both 5’ primers and 3’ RACE reaction
‐ Approx. 1Kb band found in 3’ RACE using G fwd primer constantly (along with 3Kb bands) NC
~ 3 Kb
~ 1 Kb ~ 1 Kb
~ 250 bp ~ 250 bp
13 6/11/2018
OVERALL MODEL
Fungal genome
Cellulase isolation and characterization Protein sequencing (Wheeler, 2008) and degenerate PCR
Predicted gene target
RNA isolation and Reverse transcription PCR reverse transcription and cloning
Predicted target RNA 5’ AAAAAAAAAAAAAA Oligo dT Sequencing and 5’ and 3’ RACE analysis PCR
Unknown Known Predicted gene
SUMMARY
‐ Characterized protein Fungal genome sequence used to map regions in the fungal genome by Cellulase isolation and characterization Protein sequencing designing primers from (Wheeler, 2008) and degenerate PCR degenerate PCR results Predicted gene target ‐ Optimized the primers to find the right annealing temperature RNA isolation and Reverse transcription PCR reverse transcription and cloning ‐ Isolated RNA and used Reverse transcription PCR (RT‐PCR) to Predicted target RNA 5’ AAAAAAAAAAAAAA isolate regions directly from Oligo dT RNA Sequencing and 5’ and 3’ RACE analysis PCR ‐ Performed 5’/3’ RACE PCR to Unknown Known identify the location in cDNA Predicted gene
14 6/11/2018
FINDINGS AND FUTURE DIRECTIONS
PREVIOUS WORK
‐ No evidence of a higher activity cellulase from P. spinulosum – Protein isolated and characterized
CURRENT PROJECT
‐ Genetic information of gene coding for cellulase completely unknown – partial sequence information known
‐ RNA isolation procedure for P. spinulosum not available – RNA isolation protocol optimized
FUTURE WORK
‐ Complete genetic information of the organism unknown to correlate the known sequences
‐ Structural details on the mechanism of cellulase from P. spinulosum unavailable
Department of Biology
COMMITTEE MEMBERS Department of Chemistry and Biochemistry Dr. Sandra Bonetti Dr. Daniel Caprioglio Dr. David Dillon Dr. Jordan Steel
Faculty and Staff Dr. Richard Farrer Dr. David Lehmpuhl Jim Carsella Stacy Righini Theresa Jiminez
15 6/11/2018
THANKS! QUESTION?
Fungal genome
Cellulase isolation and characterization Protein sequencing (Wheeler, 2008) and degenerate PCR
Predicted gene target
RNA isolation and Reverse transcription PCR reverse transcription and cloning
Predicted target RNA 5’ AAAAAAAAAAAAAA Oligo dT Sequencing and 5’ and 3’ RACE analysis PCR
Unknown Known Predicted gene
16 6/11/2018
17