Wos - Scopus Universidad Nacional De Cuyo Facultad De Ciencias Agrarias Rector Decana Prof

Tomo 50 Revista de la Facultad de Ciencias Agrarias N° 1 Año 2018

WoS - Scopus Universidad Nacional de Cuyo Facultad de Ciencias Agrarias Rector Decana Prof. Ing. Agr. Daniel Pizzi Prof. Ing. Agr. Concepción Arjona

Director a Dra. Ing. Agr. María Flavia Filippini (UNCUYO, Argentina) Editora asistente Prof. Ing. Agr. Adriana I. Caretta (UNCUYO, Argentina) Editora asistente en Lengua Inglesa M. Sc. Inés Pilar Hugalde (INTA, Argentina) Editores asociados Dra. Adriana Abril (Universidad Nacional de Córdoba, Argentina) Dr. Edmundo Bordeu (Po versidad Católica, Chile) Dr. Ing. Agr. Guido Fernando Botta (Universidad Nacional de Luján, Argentina) Dr. Marcelo Cabido (IMBIV-Universidad Nacional de Córdoba, Argentina) M. Sc. Ing. Agr. Juan Bruno Cavagnaro (UNCUYO, CONICET, Argentina) Dra. Edi Defrancesco (Università degli Studi di Padova, Italia) Dr. Pablo Delgado Sánchez (Universidad Autónoma de San Luis Potosí, México) Dr. José Diaz Osorio (Universidad de Talca, Chile) Dr. Ing. Agr. Alejandro J. Gennari (UNCUYO, Argentina) Dr. Ing. Agr. Alberto Daniel Golberg (Universidad Nacional de La Pampa, Argentina) Dr. Ing. Agr. Ricardo W. Masuelli (UNCUYO, INTA, CONICET, Argentina) M. Sc. Ing. Agr. José Morábito (UNCUYO, INA, Argentina) Dr. Ing. Agr. Hernán Ojeda (Agro-Montpellier, Francia) Dra. Marta Paris (Universidad Nacional del Litoral, Santa Fe, Argentina) Dr. Ing. Agr. Pablo H. Pizzuolo (UNCUYO, Argentina) Dr. Enrique Sánchez (INTA, Argentina) Dr. Hernán Vila (INTA, Argentina) Dr. Pablo Villagra (UNCUYO, CONICET, Argentina) Dr. Eduardo G. Virla (PROIMI-Biotecnología, CONICET, Argentina) Comité editor Dr. Jorge Alcalá Jáuregui (Universidad Autónoma San Luis Potosí, México) Dra. Mónica Balzarini (UNCórdoba, CONICET, Argentina) M. Sc. Ing. Agr. Mónica Bauzá (UNCUYO, Argentina) Dra. Mónica Bertiller (Centro Nacional Patagónico, CENPAT, Argentina) Dr. Luis Del Vitto (Universidad Nacional de San Luis, Argentina) Dr. Ing. Agr. Claudio Galmarini (UNCUYO, CONICET, INTA, Argentina) Ing. Agr. Juan Carlos Guevara (UNCUYO, CONICET, Argentina) Dra. María Dolores Lettelier (UNCUYO, Argentina) M.Sc. Ing. Agr. Víctor Lipinski (UNCUYO, INTA, Argentina) Prof. Luis López Valladares (Universidad de Chile, Santiago de Chile) Dr. Luis Marone (UNCUYO, CONICET, Argentina) Dra. Ing. Agr. Liliana E. Martínez (UNCUYO, Argentina) Dr. Ferdinando Pimpini (Università degli Studi di Padova, Italia) Ing. Agr. José Rodríguez (UNCUYO, Argentina) Dr. José Roldán Cañas (Universidad de Córdoba, España) Prof. Ing. Agr. Santiago Sarandón (Universidad Nacional de La Plata, Argentina) M. Sc. Ing. Agr. Fabio Tacchini (UNCUYO, Argentina) M. Sc. Ing. Agr. Rosana Vallone (UNCUYO, INTA, Argentina)

Coordinadora Diseño y autoedición Prof. Claudia Lépez Dis. Grá enda R do Fontes

odriguez • Hugo Leonar Centro de Facultad de Ciencias Agrarias Ediciones Ref. N° Académicas Universidad Nacional de Cuyo

Facultad de Ciencias Agrarias UNCuyo B I B L I O T E C A [email protected] Hemos recibido por CANJE DONACIÓN SUSCRIPCIÓN Received by EXCHANGE GIFT SUBSCRIPTION Nous avons reçu par ECHANGE DONATION SUBSCRIPTION REVISTA DE LA FACULTAD DE CIENCIAS AGRARIAS Vol.: 50 N°: 1 Año: 2018 Nos está faltando Missing issues Il nous manque Enviamos a ustedes Sending you Nous envoyons Dirección correcta Correct address Adresse correcte Fecha Firma Date Signature Date Signature Los envíos posteriores dependen de la devolución de esta tarjeta. Solicitamos canje .

Papel reciclado Recycled paper Further mailings depend on the return of this card. Please exchange . Les expéditions ultérieures dépendent du renvol de cette carte. Nous demandons l'échange .

REVISTA DE LA FACULTAD DE CIENCIAS AGRARIAS PARA SUSCRIBIRSE, COMPLETAR ESTE FORMULARIO TO SUBSCRIBE, COMPLETE THIS FORM POUR FAIRE LA SUBSCRIPTION, COMPLÉTER CE FORMULAIRE Valor de la suscripción Un año (dos números) Subscription price One year (two issues) US$ 60.00 Valeur de la subscription Un anneé (deux numéros) Nombre / Institución Name / Institution Nom / Institution Dirección Address Adresse Teléfono / Fax Telephone / Fax Telephone / Fax Cheque / Giro Nº Banco Check / Money Order Nº Bank Cheque / Change Nº Banque

A la orden de Asociación Cooperadora de la Facultad de Ciencias Agrarias To the order of Alte. Brown 500 (M5528AHB) - Chacras de Coria A l'ordre Mendoza - Argentina Fecha Firma Date Signature Papel reciclado Recycled paper SUSCRIPCIÓN - SUBSCRIPTION Date Signature Tarjeta Postal Post Card Carte Postale

BIBLIOTECA Facultad de Ciencias Agrarias Universidad Nacional de Cuyo Almirante Brown 500 Chacras de Coria, Mendoza República Argentina M5528AHB

Tarjeta Postal Post Card Carte Postale

BIBLIOTECA Facultad de Ciencias Agrarias Universidad Nacional de Cuyo Almirante Brown 500 Chacras de Coria, Mendoza República Argentina M5528AHB Revista de la Facultad de Ciencias Agrarias

Universidad Nacional de Cuyo Ficha de Catalogación (Escala: 1:1)

Revista de la Facultad de Ciencias Agrarias. -- T. 1, n° 1, 1949 - Mendoza : Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo, 1949 -

v. : il; 24 cm

Semestral ISSN 0370-4661 CDU 63

Consultas referidas a los artículos de la Revista de la Facultad de Ciencias Agrarias (UNCUYO), deben remitirse a: Centro Coordinador de Ediciones Académicas (UNCUYO) Almirante Brown 500 Chacras de Coria Mendoza (Argentina) M5528AHB Tel: (54 261) 413-5000 - Int. 1220 e-mail: [email protected] web: http://revista.fca.uncu.edu.ar http://bdigital.uncu.edu.ar La correspondencia relacionada con la distribución y/o canje, debe dirigirse a: Biblioteca de la Facultad de Ciencias Agrarias (UNCUYO) Almirante Brown 500 Chacras de Coria Mendoza (Argentina) M5528AHB Tel.: (54 261) 413-5000 - Int. 1117 Fax: (54 261) 496-0469 e-mail: [email protected] El contenido de los artículos que aparecen en esta Revista es responsabilidad de sus autores. Prohibida su reproducción total o parcial sin autorización del editor. La Revista de la Facultad de Ciencias Agrarias de la Universidad Nacional de Cuyo publica artículos originales e inéditos, escritos en español o inglés, cuya temática está relacionada con la ingeniería agronómica, ciencias de los alimentos y los recursos naturales renovables.

El material que se publica pertenece tanto a investigadores de la propia institución así como de otras facultades y centros de investigación del país y del extranjero.

La inserción de los artículos está sometida a las normas internacionales vigentes, con referato por parte de especialistas en cada disciplina.

La Revista de la Facultad de Ciencias Agrarias de la UNCUYO está categorizada por el CAICYT (Centro Argentino de Información Científica y Tecnológica del CONICET) en el Nivel Superior de Excelencia (Categoría 1).

Esta publicación está indizada en:

• Wos (Web of Science) • Scopus & Embase • SciELO Argentina( ) • Núcleo Básico de Revistas Científicas Argentinas • REDALyC Red de Revistas Científicas de América Latina y el Caribe • DOAJ (Directory of Open Access Journals) • LATINDEX • Bulletin de l'O.I.V. (Revue signalétique internationale) • VITIS-VEA (Viticulture and Enology Abstracts) • AGRIS-F.A.O. • CAB Abstracts • CABI Full Text • Ulrich's International Periodicals Directory • International Society for Pest Information (ISPI) • Agri2000 de SIDALC • Science Citation Index Expanded • Journal Citation Reports/Science Edition • Biological Abstracts • BIOSIS Previews • CABELLS Evaluadores 2018

Pablo Abbate - INTA Carina V. González - CONICET Diego Rodil - INTA Pablo Aceñolaza - UNEntre Ríos Mirian del Pilar Gonzalez - Adriana Rodriguez - UBA Cintia Acuña - INTA UNRosario María Eugenia Rodriguez - Germán Aguado - INTA Silvina Greco - UNCuyo UNCuyo Juan Agustin Alvarez - CONICET Eduardo Grünwaldt - CONICET Julieta Rojas - INTA Felipe Andreazza - UFederal de María Cándida Iglesias - UNNE Catalina Romay - UBA Viçosa MG, Brasil Adriana Kantolic - UBA Héctor Gustavo Rosatto - UBA María Elena Aradas - INTA Armando Llop - INA Ricardo Sager - INTA Pablo Asprelli - INTA Gabriel Lorenzo - UBA Yolanda Salinas Moreno - Lucrecia Avilés - UNComahue Gabriela Lucero - UNCuyo INIFAP-México Ernesto Barrera - UBA Marcos G. Maiocchi - UNNE Adriana Saluso - INTA Mario A. Barrientos - Liliana Marbán - UBA Adriana Salvo - CONICET UNCórdoba Carlos Marfil - UNCuyo Gerardo Sanchez - INTA Germán Berone - INTA Laura Martínez - INTA Rosa María Sánchez Nájera - UAM Mauricio Buccheri - INA Edel Matteoda - UNRío Cuarto Diego Santos - INTA Claudio Budde - INTA María Cristina Mondino - INTA Carmen Sartor - UNCuyo Guillermo Cabrera Walsh - Marcos Mora González - UChile FUEDEI Gustavo Sbarra - UBA Gabriela Moreno - CONICET Gabriel Céccoli - CONICET Sergio Segura Calero - USevilla- Ignacio Mundo - IANIGLA María Fernanda Cingolani - España UNLa Plata Yisa Ochoa - UAAAN Felicitas Silvetti - UNCórdoba Susana Coper - UACH Alfredo Ohanian - UNRío Cuarto Ester Simonetti - UBA Patricia Cornaglia - UBA Mariano Ordano - FMLillo- Ana Srur - CONICET Tucumán José Enrique CosTerrer - Catherine Tauber - Cornell IMIDA-España Alejandro Pannunzio - UBA University, Ithaca, NY Fernanda Covacevich - INTA Carlos Parera - INTA Oscar Terenti - INTA Carlos Coviella - UNLuján Carlos B. Passera - UNCuyo Gonzalo Torres-Tejerizo - UNLP Verónica Farreras - CONICET Hilda Pedranzani - UNSan Luis Ana Eugenia Thea - UNMisiones Gabriela Fasciglione - UNMar Patricia Perelmann - CONICET Claudia Travaglia - UNRío del Plata Martín Pérez - INTA Cuarto Guillermo Ferrer - UNCórdoba Mauricio Ponce Donoso - Martín Uliarte - INTA Paula Ferrere - INTA UTalca Jorge Valdéz - INTA María Eugenia Ferrero - José Portela - INTA Gabriel Valentini - INTA CONICET Fernando Ramos Gourcy - UAA- Leonardo Vanzetti - INTA México Gustavo Ferro - UCEMA Lorena Vivanco - UCuenca- Diana Frezza - UBA Silvia Ratto - UBA Ecuador Cristian Geldes - UAlberto Cecilia Rebora - UNCuyo Antonio Weibel - INTA Hurtado-Chile Carmen Reguilón - FMLillo- Alejandra Yommi - INTA Alberto Martín Gochez - INTA Tucumán Revista de la Facultad de Ciencias Agrarias Universidad Nacional de Cuyo

TOMO 50(1) -

JUNIO 2018

ÍNDICE Genética y mejoramiento vegetal

Development and characterization of SSR markers for Trichloris crinita using sequence data from related grass species Desarrollo y caracterización de marcadores moleculares SSR para Trichloris crinita usando secuencias de gramíneas filogenéticamente cercanas

EcofisiologíaP. Carolina Kozub, K. y Barboza, manejo J. B. de Cavagnaro, cultivos P. F. Cavagnaro...... 1

Assessment of soil properties, plant yield and composition, after different type and applications mode of organic amendment in a vineyard of Mendoza, Argentina Evaluación de propiedades edáficas químicas, biológicas, rendimiento y composición vegetal en un viñedo de Mendoza (Argentina) con diferentes tipos y modos de aplicación de abono orgánico

InfluenciaL. E. Martínez, de R.la C.vid Vallone, (Vitis viniferaP. N.Piccoli, L.) S.sobre E. Ratto. cultivos ...... de cobertura: un modelo biomatemático 17 de la transición de amensalismo a comensalismo Influence of grapevine (Vitis vinifera L.) on cover crops: a biomathematical model of the transition of amensalism to comensalism

A. Quiroga, E. Uliarte (ex aequo)...... 33 C. R. Bageta, M. Alberto, C. Sartor, A. Cecconato, A. Bevaqua, M. Tirador, M. Garriga, V. Nodaro, Evaluación de crecimiento, rendimiento y calorimetría de biomasa de Miscanthus x giganteus (Poaceae) establecido en el centro-sur de Chile Evaluation of growth, yield and calorific value of Miscanthus x giganteus (Poaceae) biomass established in south central of Chile

EfectoF. Muñoz, del J. Cancino,momento R. Rodríguez, de cosecha R. Olave.sobre ...... la calidad hortícola de tubérculos de topinambur 47 (Helianthus tuberosus L.) conservados a campo y en cámara frigorífica Harvest time effect on horticultural quality of topinambur (Helianthus tuberosus L.) kept in the soil or in cold storage L. Ibarguren, C. Rebora, M. Alberto...... 61 Physiological and production responses of olive (Olea europaea L.) cv. Frantoio under regulated deficit irrigation on a semiarid mediterranean weather condition (Cholqui, Maipo Valley, Chile) Respuestas fisiológicas y productivas en olivo (Olea europaea L.) cv. Frantoio bajo riego deficitario controlado en condiciones de un clima mediterráneo semiárido (Cholqui, Valle del Maipo, Chile)

RecursosC. Kremer, L. Reyes, naturales T. Fichet, V.y Garcíaambiente de Cortázar, J. Haberland...... 73

Traffic of harvester combines: effect on maize yields (Zea Mays L.) and soil compaction under direct sowing system Tráfico de cosechadoras: efecto sobre los rendimientos de maíz (Zea Mays L.) y compactación del suelo bajo el sistema de siembra directa

G. F. Botta, A. Tolón-Becerra, F. Bienvenido, E. R. D. Rivero, D. A. Laureda, E. E. Contessotto, AnálisisR. A. Fonterosa, de la eficiencia D. W. Agnes. física, ...... económica y social del agua en espárrago (Asparagus officinalis L.85) y uva (Vitis vinífera) de mesa del DR-037 Altar-Pitiquito-Caborca, Sonora, Mexico 2014 Analysis of physical, economic and social water efficiency in asparagus (Asparagus officinalis L.) and grape (Vitis vinifera) fruit from DR-037 of Altar-Pitiquito-Caborca, Sonora, Mexico 2014

J. L.Ríos Flores, B. E. Rios Arredondo, J. E. Cantú Brito, H. E. Rios Arredondo, S. Armendáriz Erives, CapacityJ. A. Chávez of Rivero, two vegetative C. Navarrete species Molina, of R. heavy Castro metal Franco. accumulation ...... 101 Capacidad de dos especies vegetativas en la acumulación de metales pesados

J. Alcalá Jáuregui, J. C. Rodríguez Ortíz, A. Hernández Montoya, M. F. Filippini, E. Martínez Carretero, EconomíaP. E. Diaz Flores. y ...... política agraria 123

Development programs for female farmers: identifying clusters for the case of Chile's "Education and training program for rural women" Programas de desarrollo dirigidos a agricultoras: identificando clústeres para el caso del programa "Formación y capacitación para mujeres campesinas" de Chile

AS. comparisonBoza, T. Muñoz, between M. Cortés, tourists' M. Rico, profiles J. Muñoz. in two...... Italian wine routes 141 Una comparación entre los perfiles de los turistas de dos rutas del vino italiano

ConocimientoL. Galletto...... científico y políticas de conservación: interrelaciones en las razas ganaderas 157 autóctonas españolas en peligro de extinción Scientific knowledge and conservation policies: interrelationships in the Spanish livestock autochthonous endangered breeds

TheJ. Perea, falling C. Barba, production M. Luque, of A. mexican González, cacao E. Angón, analyzed A. García. through ...... the lens of Mincerian earnings 171 function in the context of social capital of smallholders La caída de la producción del cacao mexicano analizada a través de la función Minceriana en el contexto del capital social de pequeños productores

T. Hes, S. Mintah, H. Sulaiman, J. S. Banda Arrieta, J. Ramírez Esquivel, T. Martínez Saldaña, J. M. Aguirre López...... 185 Influencia de factores contextuales en la adopción de modelos de agricultura insustentables. La incorporación del invernáculo en agricultores platenses Influence of contextual factors in the adoption of models of unsustainable agriculture. The adoption of the greenhouse in farmers in the horticultural belt of La Plata

ProducciónM. L. Blandi, R. M. y Rigotto, sanidad S. J. Sarandón. animal ...... 203

Change of collembolan (Hexapoda: Collembola) community structure related to anthropic soil disturbance Cambio de la estructura de la comunidad de colémbolos (Hexapoda: Collembola) en relación con el disturbio antrópico de los suelos

TecnologíasR. V. Sandler, L. B. Falco, agroindustriales C. A. Di Ciocco, R. Castro Huerta, C. E. Coviella...... 217

Análisis de datos sensoriales de tomate triturado con lógica difusa y técnicas multivariadas Sensory data analysis crushed tomatoes with fuzzy logic and multivariate techniques M. I. Césari,

ProductionN. of B. cured, Ventrera, voided A. Gámbaro. meat sausage ...... with apple pomade added (Malus domestica) and233 its impact in nutritional and sensorial values Elaboracion de embutido cárnico curado sellado al vacío con pomasa de manzana (Malus domestica) y su valoración nutricional y sensorial

AnalysisN. Loyola, of C. someAcuña, physical, D. Fuentes, chemical M. Arriola. and ...... microbiological aspects of honey samples produced 249 and consumed in Turkey Análisis de algunos aspectos físicos, químicos y microbiológicos de las muestras de miel producidas y consumidas en Turquía

PerspectivasS. Bakirdere, T. Yaroglu, N. Tirik, M. Demiroz, A. Karaca...... 263

Proposal for severe injury reduction targets in Spain by territory and sector. The importance for rural areas of traffic accident Propuesta de objetivos territoriales y sectoriales de reducción de heridos graves. Importancia de los accidentes de tráfico en áreas rurales

I. Flores-Parra...... 273 M. D. Ramírez Román, X. Bolívar Lastra-Bravo, A. Tolón-Becerra, F. Bienvenido-Bárcena, Revisión

Sustainable use of rangelands of the Mendoza plain (Argentina) Uso sustentable de los pastizales de la llanura de Mendoza (Argentina)

J. C. Guevara, O. R. Estevez...... 295 Normas para la presentación de artículos. p.309 SSRRev. FCAmarkers UNCUYO for. Trichloris2018. 50(1): crinita 1-16. ISSN impreso 0370-4661. ISSN (en línea) 1853-8665.

Development and characterization of SSR markers for Trichloris crinita using sequence data from related grass species

Desarrollo y caracterización de marcadores moleculares SSR para Trichloris crinita usando secuencias de gramíneas filogenéticamente cercanas

Perla Carolina Kozub 1, Karina Barboza 2, Juan Bruno Cavagnaro 1, Pablo Federico Cavagnaro 2, 3

Originales: Recepción: 04/12/2017 - Aceptación: 07/05/2018

Abstract

Trichloris crinita is among the most important native forage grasses in arid regions of America. Despite its importance, molecular resources and sequence data are extremely scarce in this species. In the present study, SSR markers were developed using available DNA sequences from grass taxa phylogenetically-related to Trichloris (Eleusine coracana, Cynodon dactylon and ‘Cynodon dactylon x Cynodon transvaalensis’). Marker transferability was evaluated in a panel of eight T. crinita of expected size in T. crinita, whereas transferability to other grass speciesaccessions ranged and from five 12closely-related (in Chloris castilloniana species. Of )the to 28105 SSRs SSR (in primer Eleusine pairs coracana evaluated,). Six 16 of theamplified 16 SSR products markers successfully transferred to T. crinita (37.5%) were polymorphic, and were further used to assess genetic diversity in eight T. crinita accessions. The analysis revealed a total of 23 SSR alleles (3.83 alleles/locus), allowing the discrimination of all T. crinita accessions,

(and range) values for observed (Ho) and expected heterozygosity (He) were 0.53 (0.0-1.0)with pair-wise and 0.63 genetic (0.48-0.79), similarities respectively. ranging from 0.35 to 0.81 (Jaccard coefficient). Mean

Keywords Chloridoideae

• forage grass • genetic diversity • marker transferability • microsatellites 1 Universidad Nacional de Cuyo (UNCuyo). Facultad de Ciencias Agrarias (FCA). Instituto de Biología Agrícola de Mendoza (IBAM). Consejo Nacional de

de Coria. Mendoza M5528AHB. Argentina. Investigaciones Científicas y Técnicas (CONICET). Almirante Brown 500. Chacras

2 ConsejoSan Carlos. Nacional Mendoza de Investigaciones5567. Argentina. Científicas [email protected] y Técnicas (CONICET). Instituto 3 UniversidadNacional de NacionalTecnología de AgropecuariaCuyo. Facultad (INTA)de Ciencias E.E.A. Agrarias. La Consulta. Instituto Ex rutade Horticultura. 40 Km 96.

Tomo 50 • N° 1 • 2018 1 P. C. Kozub et al.

Resumen

Trichloris crinita es una importante gramínea forrajera, nativa de regiones áridas del continente americano. A pesar de su importancia, no existen herramientas moleculares ni marcadores moleculares SSR (“simple sequence repeats”) a partir de secuencias nucleo- secuencias nucleotídicas disponibles para esta especie.Trichloris En este (Eleusine estudio, coracana se desarrollaron, Cynodon dactylon y ‘Cynodon dactylon x Cynodon transvaalensis’) y se evaluó su transferibilidad entídicas ocho de accesiones especies filogenéticamentede T. crinita y cinco cercanas especies a de gramíneas cercanamente emparen- esperado en T. crinita, mientras que la transferibilidad a otras especies varió entre 12 (entadas. Chloris De los castilloniana 105 pares de) y cebadores28 SSRs (en evaluados, Eleusine coracana16 amplificaron). De los productos 16 SSRs transferibles del tamaño a T. crinita, seis . - tieron diferenciarfueron todas polimórficos las accesiones y se de utilizaron T. crinita, para analizar el grado de diversidad entregenética pares en ocho de accesiones accesiones de de 0,35esta especiea 0,81 (Jaccard).El análisis Se reveló obtuvieron 23 alelos, valores los cuales medios permi de heterocigosidad observada y esperada de 0,53 y 0,63 respectivamente.con valores de similitud genética

Palabras clave Chloridoideae •

gramínea forrajera • diversidad genética • transferibilidad • microsatélites Introduction

Trichloris crinita (Chloridoideae, phenotypes from natural populations, Poaceae) is one of the most important followed by their characterization based native grass species in arid regions of South on traits of interest, such as biomass America, due to its extensive area of distri- production (5), forage quality (7, 27), and bution (25), good forage quality (7, 27), drought resistance (12). Data from a recent and resistance to drought (13), tram- study (16), demonstrating that T. crinita is a pling and grazing by wild and domestic sexually-propagated autogamous species, animals (4). These characteristics and encourages the practice of conventional its competing aggressiveness among breeding strategies in the species. Along other native grasses (22), have led to with this, the possibility of developing a widespread utilization of T. crinita in molecular markers for assisting selection range grazing and revegetation projects in may accelerate T. crinita breeding goals. arid environments (24). Molecular resources in T. crinita are Despite its importance, advances in very scarce. To date, only two studies genetic research and breeding of T. crinita regarding the use of molecular markers have been limited, mainly due to the in this species have been published scarcity of molecular resources and the fact that the species mode of reproduction was unknown until very recently. The genetic(5, 16). Thediversity first study,in a T. publishedcrinita germplasm in 2006, main approach used to improve T. crinita collectionused AFLP (4), markers whereas for a characterizingmore recent has been the selection of interesting study by Kozub et al. (2017) used simple

2 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita sequence repeats (SSR) markers for Objectives inferring about the mode of reproduction of this species. The present work reports 1) To develop SSR markers for on the development and evaluation, at Trichloris crinita using sequence data various levels, of the SSR markers used in from Eleusine and Cynodon species. the latter report. 2) To evaluate marker transferability SSRs are robust and informative across T. crinita-related taxa. PCR-based markers and they are generally 3) To assess SSR polymorphism and genetic diversity in T. crinita accessions. level of polymorphism, reproducibility andfavored codominant over AFLPs dueinheritance to their higher(18). These markers have been successfully Materials and methods used for multiple genetic and breeding purposes in many crop species, including Source of sequence data, microsatellites grapevine (19), carrot (6), alfalfa (12) and search and primer design soybean (3). However, the development All the available genomic of SSR markers generally requires DNA sequences (GSS) of Eleusine coracana sequence data to search and detect SSR (633 sequences; 0.4 Mbp), Cynodon dactylon (404 sequences; 0.2 Mbp) SSR. In the case of T. crinita, using sequence and ‘Cynodon dactylon x Cynodon databasesmotifs, and to designidentify primers SSRs is flankingnot feasible the transvaalensis’ (92 sequences; 0.04 Mbp) since very few sequences are available for were downloaded from the NCBI database the species (only 34 T. crinita sequences on April 15, 2016. These species were are available at the NCBI database). selected based on their phylogenetic The use of sequence data from related proximity to T. crinita and the availability taxa for developing SSR markers in a of sequences in the database. species lacking sequence information has been widely used in plants, with program MISA (31). Only perfect micro- variable degrees of success, generally satellites,SSR motifs with a were basic identified motif of 2-6 using nt, and the increasing success rate with the phylo- a minimum length of 12 nt (for di-, tri-, genetic proximity between SSR donor and tetranucleotides), 15 nt (for pentanu- and target species (15). This approach cleotides), and 18 nt (for hexanucleotides) has been particularly successful in the were considered. Poaceae family, where SSR markers were The position of the detected SSRs in developed for numerous orphan species, the genomic sequence was recorded, and using sequences from economically important cereal crops (34, 35). This designed. These SSR loci were selected strategy may also be effective for becauseprimers they pairs had flanking larger number 105 SSRs of repeat were developing SSR markers for T. crinita units, as this feature has been associated using the available sequence data from with higher polymorphism rate (6). phylogenetically related genera, such as Eleusine and Cynodon.

Tomo 50 • N° 1 • 2018 3 P. C. Kozub et al.

For primer design, the software Primer3 v.4.0.0 (32) was used, using parameters to generate amplicons 2 μl 10 × DNA polymerase buffer, 1.6 μl of 200-500 bp, and primer length of dNTPs (2.5 mM each), 1 μl 5μM of each 22-30 nt with Tm of 55-62°C and GC wereprimer, programmed 0.3 μl Taq as polymerase follows: initial at 3 dena U/μl- content of 30-50 %. Other parameters turationand 2.5 μl at of 94°C genomic for 30DNA. sec, Thermocyclers followed by used the program default values. 40 cycles of 94°C for 45 sec, appropriate annealing temperature for 30 sec, and 72°C Plant materials Trichloris crinita accessions Agarose (3%) gel electrophoresis used for 1 min; and a final step of 72°C for 4 min. (CynodonEight dactylon, Eleusine coracana, for visualization of the amplicons. A 100 bp Eleusineand five indica, related Chloris grass gayana species, and ladderethidium (Invitrogen) bromide (4 was ul/100 used ml as of size TAE marker. buffer) Chloris castilloniana) from the Germplasm Denaturing polyacrylamide (6%) gel electro- Bank of Native Grasses (GBNG) at the phoresis was run at 1500 V, 60 W and 40 mA Argentine Institute for Research in Arid for 3 hours. Silver staining was performed Regions (IADIZA) (Mendoza, Argentina), and the gels were photographed for later were used in this study. Characteristics genotype analysis. SSR allele sizes were esti- of these plant materials -used for marker mated by comparisons with a 100 bp DNA development, evaluation of marker trans- ladder (Invitrogen). ferability across species, and analysis of genetic diversity within T. crinita- are SSR marker analysis presented in table 1 (page 5). For analysis of marker transferability across species, 105 SSR primer pairs DNA extraction and PCR and gel were evaluated using as template for electrophoresis conditions PCRs genomic DNA from eight T. crinita For DNA extraction, fresh young leaves of a single plant from each accession were related grass species (table 1, page 5). harvested and immediately ground in PCRaccessions products and were five resolved phylogenetically- by agarose liquid nitrogen with a mortar. gel electrophoresis. An SSR marker The resulting powder (~20 mg) was was considered transferable to a target used for DNA isolation according to Murray and Thompson (1980). DNA concentration amplicons of expected size, were observed and purity were determined with a Picodrop inspecies that whenspecies. positive For theamplifications accessions withand spectrophotometer (PicoPet 01), and DNA SSRs that failed to produce amplicons of integrity was evaluated by 0.9% agarose expected size or yielded no PCR products gel-electrophoresis. DNA samples were at all, a second round of PCRs was performed, and if the same results were observed, they were recorded as "negative dilutedPCR to reactionsa final concentration were performed of ~30 ng/µl in PCR reactions". and used as template in PCR amplifications.

20 μl final volume containing 11.6 μl water,

4 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita

Table 1. Species and accessions used for SSR marker development, and analyses of marker transferability and genetic diversity Tabla 1.

Especies y accesiones utilizadas para el desarrollo de los marcadores SSR, Accession Number Species análisis de transferibilidad yComments diversidad / remarks genética. References (IADIZA-GBNG)

Medium biomass production. Medium Tc-3 (5, 9) Trichloris crinita drought resistance. High biomass production. Medium Tc-4 (5, 9) Trichloris crinita drought resistance.

Trichloris crinita Tc-7 High biomass production. (9)

Trichloris crinita Tc-8 (9)

Low biomass production. Tc-9 (2, 9) Trichloris crinita quality. Low biomass production. Good forage High biomass production. High drought Tc-12 (5, 9) Trichloris crinita resistance. Medium biomass production. Medium Tc-17 (5, 9) Trichloris crinita drought resistance. High biomass production. Medium Tc-24 (5, 9) Trichloris crinita drought resistance.

South American native grass. High forage Chloris castilloniana Chc-01 (32) quality. No available SSRs for this species.

ChlorisLillo & gayanaParodi Important forage grass native to Khunt (Rhodes Chg-01 tropical and subtropical Africa. No (33) grass) available SSRs for this species. SSR donor species / Native to Africa. Used Eleusine coracana - as cereal crop in arid/semi-arid regions. Ec-01 (finger millet) African native C4 grassweed of rain-fed Eleusine indica agriculture. Very few SSRs available for (34, 35) (goosegrass) this species. Ei-01 SSR donor species / Important Cynodon dactylon Cd-01 perennial grass, widely cultivated in - (Bermuda grass) warm regions.

C. dactylon x C. - SSR donor species. - transvaalensis *

Species used for marker development (i.e., SSR donor species) are indicated in bold. * ‘C. dactylon x C. transvaalensis’ was only used as a source of DNA sequence for marker development but was not included in the analyses of marker transferability and/ or genetic diversity. IADIZA-GBNG: Argentine Institute for Research in Arid Regions- Germplasm Bank of Native Grasses. C. dactylon x C. transvaalensis’ fue utilizada para el desarrollo de marcadores, pero no fue incluida en los análisis de Las especies utilizadas para el desarrollo de marcadores están indicadas en negrita. * ‘ IADIZA-GBNG: Instituto Argentino de Investigación en Regiones Áridas - Banco de Germoplasma de Pastos Nativos. transferibilidad y/o diversidad genética.

Tomo 50 • N° 1 • 2018 5 P. C. Kozub et al.

Hardy-Weinberg equilibrium. Three cate- (i.e., SSRs that produced amplicons of gories of He expectedSSRs size) with in positiveall T. crinita amplifications accessions and the related grass species were established valuesto describe [low (He the ≤ polymorphism 0.3), moderate selected for further analysis of marker level(0.3 < at He each ≤ 0.5) SSR and locus. high It (0.5 must < He)] be noted were polymorphism and genetic diversity. For that analyses of Ho and He was restricted to the T. crinita germplasm. generated and resolved by denaturing polyacrylamidethis, SSR amplification gel (6%) electrophoresis, products were run at 1500V, 60W and 40 mA for 3 hours. Results The gels were stained with silver nitrate and photographed for later analysis. SSR A total of 105 primer pairs were allele sizes were estimated by comparison with a DNA size ladder. genomic sequence of three grass species The genetic diversity analysis was phylogenetically-relateddesigned flanking SSRs to detectedTrichloris in performed on eight T. crinita accessions [Eleusine coracana (65 SSRs), Cynodon - dactylon (21 SSRs) and ‘C. dactylon x netically-related to Trichloris. The latter C. transvaalensis speciesand five were other included grass speciesin the phylogeanalysis SSRs corresponded to di- (37%), tri- (27%), as putative out-groups. Marker data for tetra- (29%) and’ pentanucleotides (19 SSRs)]. The selected(7%). each locus and accession were recorded, and a binary matrix with information on SSR marker transferability across the presence or absence of SSR alleles grass species was constructed and used for estimating The number and percentage of trans- pair-wise genetic similarities among the ferable SSR markers from each donor species to T. crinita accessions and 5 other grasses are presented in table 2 (page 7). accessions (Jaccard coefficient) (28), using- In total, 16 markers, representing 15.2% laritiesthe software among XLSTAT the taxa v.2016.05.33324. was constructed of the SSRs tested, were transferable usingA dendrogramthe Unweighted reflecting Pair Group genetic Method simi to T. crinita (i.e with arithmetic Average (UPGMA) products of expected size in T. crinita accessions). Of these,., 16 markersseven SSRs amplified were Based on the SSR band patterns, developed from E. coracana, six from andprocedure considering with the T. XLSTAT crinita software. as a tetra - C. dactylon, and three from ‘C. dactylon ploid species (26), observed (Ho) x C. transvaalensis’. Table 3 (page 8-9), and expected (He) heterozygosity presents further information on the values were estimated for each marker, 16 SSRs that were successfully transferred according to Bever and Felber (1992) to T. crinita, including primer sequence, annealing temperature, repeat motif, 10,000 Monte Carlo simulations. He was expected and observed amplicon lengths, usedwith theas a programmeasure ATETRAof the level 1.0 of (33) polymor using- number of alleles, and observed (Ho) and phism in each locus, despite the absence of expected (He) heterozygosity values for each marker.

6 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita x ζ C 3 5 8 (%) Mean (15.4) (23.1) (12.1) (65), 3 5 6 C. dactylon 14 (9.2) Tc-24 (15.8) (23.8) (13.3) 3 5 6 14 Trichloirs crinita crinita Trichloirs accessions and E. coracana (9.2) Tc-17 (15.8) (23.8) (13.3) (21) and ‘ 3 4 5 12 (7.7) Tc-12 (15.8) (19.0) (11.4) C dactylon 3 6 7 16 Tc-9 (15.8) (28.6) (10.8) (15.2) (65), Trichloris crinita Trichloris 2 5 6 13 Tc-8 (9.2) (10.5) (23.8) (12.4) Trichloris crinita Trichloris E. coracana 3 4 5 12 Tc-7 (7.7) (15.8) (19.0) (11.4) ’ (19). 2 5 6 13 Tc-4 (9.2) (10.5) (23.8) (12.4) 2 4 5 11 (19) Tc-3 (7.7) (10.5) (10.5) ’ (19). C. transvaalensis x 6 10 10 26 (9.2) (52.6) (47.6) (24.7) Cynodon dactylon C. dactylon 3 4 5 C. transvaalensis five other grasses. five 12 (19) (7.7) (15.8) (11.4) Chloris y otras cinco gramíneas. y otras Number (%) of transferable SSRs Number (%) of transferable castilloniana (21) and ‘ 1 6 7 14 (5.3) (28.6) (10.8) (13.3) Chloris gayana dactylon porcentaje de SSRs positivos no fue calculado para esta especie. no fue calculado para positivos de SSRs porcentaje 2 2 24 28 (9.5) (10.5) (36.9) (26.6) Eleusine coracana ’ was only used as a source of sequence data for developing SSR markers, but was not included in the transferability assay, assay, not included in the transferability but was SSR markers, developing of sequence data for used as a source only ’ was 1 3 therefore, the number and percentage of positive SSRs were not calculated for this species. for not calculated were SSRs of positive the number and percentage therefore, 15 19 (18) (5.3) (14.3) (23.1) indica ’ fue utilizada para el desarrollo de marcadores pero no fue incluida en los análisis de transferibilidad, por lo tanto, el número y el número por lo tanto, no fue incluida en los análisis de transferibilidad, pero de marcadores el desarrollo ’ fue utilizada para Eleusine The percentage of positive SSRs amplified in each species was calculated on the basis of 105 total SSRs tested. tested. SSRs on the basis of 105 total calculated amplified in each species was SSRs of positive The percentage † 19 * (%) (47.6) (36.9) 10/21 24/65 Positive / Positive total SSRs SSRs total C. transvaalensis x El porcentaje de SSRs con amplificación positiva en cada especie fue calculado sobre la base de un total de 105 SSRs evaluados. de 105 SSRs la base de un total en cada especie fue calculado sobre con amplificación positiva de SSRs El porcentaje † C. transvaalensis x † Number (and percentage) of transferable SSR markers from each donor species to each donor species to from SSR markers of transferable Number (and percentage) . Número (y porcentaje) de marcadores SSR transferibles de cada especie donante a las accesiones de de cada especie donante SSR transferibles (y de marcadores . Número porcentaje) x C. dactylon Valores medios y porcentajes calculados sobre la base de número de SSR desarrollados a partir de cada una de las especies donantes a partir de cada una las especies donantes de SSR desarrollados la base de número calculados sobre medios y porcentajes Valores Total (%) Total C. dactylon C. dactylon E. coracana ζ * ‘ Table 2. Table C. dactylon Donor species Mean and percentage values calculated on the basis of the SSR markers developed from the donor species from developed on the basis of SSR markers calculated values Mean and percentage C. transvaalensis ζ Tabla 2 Tabla *‘

Tomo 50 • N° 1 • 2018 7 P. C. Kozub et al. , all i.e. 0 1 0 0 0 0 Ho 0.45 Trichloris crinita, crinita, Trichloris 0 0 0 0 , and number of He 0.59 0.79 0.22 1 5 6 1 1 1 1 A 59 ) are denoted in italics. denoted ) are Tm (°C) 56.8 59.8 53.2 60.5 58.6 57.2 Trichloris crinita Trichloris ) para cada locus SSR en accesiones de ) para He Primer sequence (5'- 3') Primer sequence ) y esperada ( ) y esperada accessions. Ho F: AATATGGTATGCCTGAGATTCAAGCTCA F: R: GTTCCAATAATTGGTGGGTTCTGTAG F: AAAACGGGTCCATCCATGTTGATGC F: R: TAGGCTTCGTCACAGAATTTTATCTGCCT CAGAAAATCACAGTTCAGATTACTG F: R: AGTTCTTTTGTACCCTTTATAAGACATCT F: ACTCGAATGAGGGAGGCATTGCTACA F: R: CTTGTTTCTCAAGTAGCTCCTCTTGCC F: ACCATCATAGAGTCATGAGATGTAACCTT F: R: ATAGCTAGCTGAGGTCGATGTAGAAGCT F: ATGAGATGTAACCTTTGATGAAACAAACT F: TTTGACCCTCTTCTGTAGTGGTGGAAGCA R: CTAACACCATCATAGAGTCATGAGATGT F: R: CGATGTAGAAGCTTTTTGACCCTCTTCT 110 270 250 300 400 Obs. y las demás gramíneas) se indicaron con letras itálicas. con letras se indicaron y las demás gramíneas) 139-165 128-140 Trichloris crinita. Trichloris ) heterozygosity values estimated for each SSR locus in a collection of for estimated values ) heterozygosity size (bp) PCR product product PCR 243 191 179 303 240 197 230 Exp. He crinita Trichloris T. crinita T.

C. dactylon x C. dactylon x C. dactylon x C. dactylon Donor species C. transvaalensis C. transvaalensis C. transvaalensis Eleusine coracana Eleusine coracana Eleusine coracana Eleusine coracana ) and expected ( ) and expected se indicaron en negrita. Los SSRs que amplificaron exitosamente en todos los materiales del panel de transferibilidad transferibilidad de panel del materiales los todos en exitosamente amplificaron que SSRs Los negrita. en indicaron se collection are denoted in bold. SSRs that amplified successfully across all the taxa of the transferability panel ( of the transferability all the taxa across that amplified successfully in bold. SSRs denoted collection are Ho , todas las accesiones de , todas Motif i.e. Eleusine indica, Eleusine coracana, Chloris castilloniana, Chloris gayana, Cynodon dactylon Chloris gayana, Chloris castilloniana, Eleusine coracana, Eleusine indica, (AC)28 (TG)23 (TG)42 (TGA)8 (TGA)8 (TGA)8 ( (TGA)11 T. crinita crinita T. T. crinita T. SSR GSSR-2 GSSR-8 marker GSSR-51 GSSR-52 GSSR-53 GSSR-44 accessions, GSSR-11 Information for 16 genomic SSR markers (GSSRs) successfully transferred to to transferred successfully (GSSRs) 16 genomic SSR markers for Information T. crinita T. Información de los 16 marcadores SSR genómicos (GSSRs) que fueron exitosamente transferidos a transferidos exitosamente que fueron SSR genómicos (GSSRs) de los 16 marcadores Información alleles (A), and observed ( alleles (A), and observed número de alelos (A), y valores de heterocigosis observada ( observada de heterocigosis de alelos (A), y valores número Table 3. Table Polymorphic markers in the markers Polymorphic Tabla 3. Tabla Los marcadores polimórficos en polimórficos marcadores Los

8 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita ., all i.e Trichloris Trichloris , and number 0 0 0 0 0 Ho 0.61 0.83 0.50 0.31 0 0 0 0 He 0.66 0.70 0.49 0.56 0.48 4 1 3 1 1 2 3 1 2 A ) are denoted in italics. denoted ) are Tm (°C) 59.5 61.5 60.7 59.8 58.9 57.6 56.4 54.5 60.2 Trichloris crinita Trichloris ) para cada locus SSR en accesiones de ) para He ) y esperada ( ) y esperada Primer sequence (5'- 3') Primer sequence Ho accessions. F: TAGGAATTCGCCGCCGAATCTTTCGAT F: R: TTGCCATTTGAAATAGGCTCCATCT F. TATGAATCACGAGGTCATCGCAGCA F. R: TTTTGCTTTCTGCAAGTCCTCATCAGGCG F: ATCGCCGAACATTGAGATGGACGA F: R: ACGTCATGTAGTGCGTGTATCGGTTACA CTCTGACTTGTTTAGGCCTAGTAGC F: R: TAGTTACCGGCGTGTGTGCTTGTATCGTT F: ACTGCCTACTTACTGTCAGCAAGGCAA F: R: GAGCAGGGGACTCAACAATATCTTA F: AAATGCTTGATTAGCTAAGGGGAGA F: R: TACGGTTCCCAGTTCGACACATTGTT TTGATTGATTCGTCTTACCATTTCCGC F: R: GAAACAAAACCATCCTCTACAGGT F: TTGATTGATTCGTCTTACCATTT F: R: ACAAAACCATCCTGTACAGGTCACA F: TATGAGAGAAACGAACCGGTAGGAGACT R: TACGGTTCCCAGTTCGACACATTGTT 350 400 180 Obs. y las demás gramíneas) se indicaron con letras itálicas. con letras se indicaron y las demás gramíneas) Trichloris crinita. Trichloris 540-550 600-610 170-180 170-180 180-190 187-190 ) heterozygosity values estimated for each SSR locus in a collection of for estimated values ) heterozygosity size (bp) He PCR product product PCR 294 298 642 180 164 187 184 181 187 crinita Trichloris Exp. T. crinita T. ) and expected ( ) and expected Donor species Cynodon dactylon Cynodon dactylon Cynodon dactylon Cynodon dactylon Cynodon dactylon Cynodon dactylon Eleusine coracana Eleusine coracana Eleusine coracana se indicaron en negrita. Los SSRs que amplificaron exitosamente en todos los materiales del panel de transferibilidad transferibilidad de panel del materiales los todos en exitosamente amplificaron que SSRs Los negrita. en indicaron se Ho collection are denoted in bold. SSRs that amplified successfully across all the taxa of the transferability panel ( of the transferability all the taxa across that amplified successfully in bold. SSRs denoted collection are ., todas las accesiones de ., todas i.e Eleusine indica, Eleusine coracana, Chloris castilloniana, Chloris gayana, Cynodon dactylon Chloris gayana, Chloris castilloniana, Eleusine coracana, Eleusine indica, ( Motif T. crinita crinita T. (GCA)6 (CATC)4 (GATC)4 (CACG)3 (CGGC)3 (TTGC)3 (TTGC)3 (GCGT)4 (AGCT)3 T. crinita T. Information for 16 genomic SSR markers (GSSRs) successfully transferred to to transferred successfully (GSSRs) 16 genomic SSR markers for Information SSR accessions, Información de los 16 marcadores SSR genómicos (GSSRs) que fueron exitosamente transferidos a transferidos exitosamente que fueron SSR genómicos (GSSRs) de los 16 marcadores Información marker GSSR-76 GSSR-80 GSSR-89 GSSR-90 GSSR-94 GSSR-93 GSSR-72 GSSR -77 GSSR-100 T. crinita T. número de alelos (A), y valores de heterocigosis observada ( observada de heterocigosis de alelos (A), y valores número of alleles (A), and observed ( of alleles (A), and observed Polymorphic markers in the markers Polymorphic Table 3 (cont.). Table crinita, crinita, Tabla 3 (cont.). Tabla Los marcadores polimórficos en polimórficos marcadores Los

Tomo 50 • N° 1 • 2018 9 P. C. Kozub et al.

The extent of marker transferability sample set of eight T. crinita accessions across grass species was associated with varying in forage biomass production and the phylogenetic proximity between morphological traits (table 1, page 5). donor and target species (table 2, page 7). These polymorphic SSRs yielded a total Thus, markers developed from E. coracana of 23 alleles. The number of alleles per sequences were more transferable to SSR locus (A) varied from two to six, with Eleusine species (~ 23-37% of transferable SSRs) than to Chloris (5-7%) (He) ranged from 0.48 to 0.79, with and Cynodon (6%). Similarly, SSRs meana mean of 3.8.0.63, Expected whereas heterozygosities observed developed from Cynodon sequence data heterozygosities (Ho) ranged from 0.0 to (i.e., from C. dactylon and ‘C. dactylon 1.0, with mean of 0.53 (table 3, page 8-9). x C. transvaalensis’) had highest trans- GSSR-11 (A = 6, He = 0.79) and GSSR-100 ferability to C. dactylon (~ 48-53% of (A = 2, He = 0. 48) were the most and the transferable SSRs), with reduced success least polymorphic markers, respectively. rate observed in Chloris (~ 5-29%) and Analysis of these types of data, including

Eleusine (~5-14%). He, Ho FIS) Overall, regardless of sequence source, were used in a previous study with these SSRs toand infer the about inbreeding the reproductive coefficient mode ( Eleusine indica, 28 in Eleusine coracana, of T. crinita. 1419 inSSR Chloris markers gayana amplified, 12 in Chlorissuccessfully castillo in- Considering all the markers (i.e., poly- niana, and 26 in Cynodon dactilon. Further morphic and monomorphic SSRs), the information on these SSR markers is mean number of alleles per locus was 2.12, with a range of one to six. Mean He was 0.28 Material-Tables S1-S5, including primer and ranged from 0.0 to 0.79, whereas mean sequence,presented inannealing Electronic temperature, Supplementary SSR Ho was 0.23 and ranged from zero to one motifs, amplicon lengths, and sequence (table 3, page 8-9). Nine SSRs (56%) had He source (donor species and sequence IDs values lower than 0.3 (low polymorphism), at NCBI). two SSRs (12%) exhibited values between Four SSR markers, namely GSSR-51, 0.3 and 0.5 (moderate polymorphism) and GSSR-52, GSSR-53, and GSSR-93 (table 3, He values higher than 0.5 (high level of polymorphism). size in all the accessions and species fiveGenetic SSRs (31%) diversity had and relatedness evaluatedpage 8-9), amplified(table 1, productspage 5), ofsuggesting expected among T. crinita accessions was evaluated that they may be useful for comparative by estimating pair-wise genetic simi- analysis among Chloridoideae species. accessions. Genetic similarity (GS) values SSR polymorphism and genetic diversity rangedlarities (Jaccardfrom 0.35 coefficient) (between amongTc-3 and the in Trichloris crinita Tc-17, indicating that these were the two Six of the 16 SSRs (37.5%) that were most genetically different accessions) to successfully transferred to T. crinita 0.81 (between Tc-3 and Tc-4, the geneti- were polymorphic -as resolved by cally closest accessions). The mean GS polyacrylamide gel electrophoresis- in a among all T. crinita accessions was 0.57.

10 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita

A phenogram, constructed on the basis Within T. crinita, all the accessions of six polymorphic SSRs depicted genetic were clearly discriminated. By clustering relations among T. crinita accessions and the accessions with more than 60% genetic similarity (GS=0.6), three groups T. crinita accessions were clearly separated of accessions were revealed. Cluster I fromfive relatedthe other grass grasses species (used (figureas outgroups), 1). All grouped 75% of the accessions, whereas including two close relatives of Trichloris groups II and III had one accession each. (Chloris castilloniana and Chloris gayana), indicating a coherent genetic clustering of the taxa.

Roman numbers indicate groups discriminated at 60% genetic similarity. For Trichloris crinita, taxa are indicated by the accession number, followed by a letter indicating whether they have high (H, > 120 g dry matter/plant), medium (M, between 60 and 120 g DM/plant), or low et al. (5). Trichloris crinita, se indica el número(L, less de accesión than 60 gseguido DM/plant) de una biomass letra que yield, indica according si es de to alta Cavagnaro (H, > 120 g materia seca/planta), Los números romanos indican grupos de accesiones con ≥ 60% de similitud genética. Para forrajera, de acuerdo con Cavagnaro et al. (5). media (M, entre 60 y 120 g MS/planta) o baja (L, menos de 60 g MS/planta) productividad de biomasa Figure 1. Phenetic relations among eight Trichloris crinita accessions and 5 phylogenetically-related grass species (outgroups) obtained from SSR marker data,

Figura 1. Trichloris crinita y 5 especies using UPGMA cluster analysis of the JaccardTrichloris similarity, obtenidas coefficient. sobre la base de Relaciones fenéticas entre ocho accesiones de de gramíneas filogenéticamente-relacionadas con datos de marcadores SSRs. El análisis de agrupamiento usó la metodología UPGMA y el coeficiente de similitud genética de Jaccard.

Tomo 50 • N° 1 • 2018 11 P. C. Kozub et al.

No clear association was found between However, these comparisons are not the clustering of the taxa and the accessions biomass production, as reported previously known to present higher transferability, - becausesurprising, coding since EST-derivedregions are SSRs more are tering and the geographical origin of the conserved among related species, than taxausing (data AFLP not markers presented). (5), nor between clus SSRs developed from genomic sequence (GSSRs) (8, 9). Thus, transfer rates of the GSSRs developed in this study, although still Discussion relatively low, are comparable with cross- genera transferabilities of GSSRs reported previously in Apiaceae (22-42%) (6), on the development of SSR markers in Rosaceae (20%) (29), Asteraceae [17.6% TrichlorisThe present crinita study, an isimportant the first reportforage Helianthus annuus) grass from arid and semi-arid regions of Carthamus tinctorius America. Due to the lack of sequence data andbetween Fabaceae sunflower [~ 23-24% ( among mungbean for this species, the markers developed (andVigna safflower radiata (), common bean (Phaseolus)] (11), herein used available genomic sequences vulgaris), and soybean (Glycine max (GSS) from other phylogenetically- Six of the 16 SSRs successfully trans- related grasses of the Chloridoideae ferred were polymorphic in a collection)] (30). subfamily, namely Eleusine coracana, of eight phenotipically-diverse T. crinita Cynodon dactylon and ‘C. dactylon x accessions (table 1, page 5), revealing two C. transvaalensis’. Nearly 15% (16/105) to six alleles per SSR, with a mean of 3.83. of the total SSRs evaluated were success- The level of polymorphism at each fully transferred to T. crinita, with transfer locus was estimated by means of the rates ranging from 10.8% (for markers expected heterozygosity (He), instead of developed from E. coracana sequences) the ‘polymorphism index content’ (PIC) to 28.6 % (for C. dactylon markers). These traditionally used for estimating SSR poly- values are seemingly low, as compared morphism in diploid species, because esti- with previously reported cross-genera mation and interpretation of the PIC in SSR transfer rates within Poaceae polyploids, such as the tetraploid T. crinita, subfamilies. For example, transferability is particularly complex, as discussed by et al. (2007). These and other authors species, tef (Eragrostis tef) and bermuda grassof EST-SSRs (Cynodon between dactylon two), was Chloridoideae ~ 32% (35). correlationLiu (r = 0.9917, p < 0.01) between He(23) and have PIC reported in tetraploids, strong and suggesting significant Pooideae subfamily was also higher than in that He can be used effectively for esti- theSimilarly, present transferability study, with transfer of EST-SSRs rates in from the mating the level of polymorphism in SSR 27% [from wheat (Triticum aestivum) to loci in tetraploids. Thus, for the six poly- harding grass (Phalaris aquatica morphic markers of our study, the degree [from tall fescue (Festuca arundinacea) of polymorphism ranged from moderate to Kentucky bluegrass (Poa pratensis)] to 68% (He =0.48), in one SSR, to high (He = 0.56- as well as in Panicoideae, with 79-100% He of of transferred markers among maize,)], 0.63 (table 3, page 8-9). It must be noted sorghum and earl millet (35). that0.79), these in five polymorphic SSR loci, withSSRs awere mean used in a previous study for calculating inbreeding

12 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita

FIS) values in T. crinita Thus, in decreasing order of phylogenetic accessions, as a means for inferring about proximity to Trichloris; Chloris, Cynodon thecoefficient species reproductive ( behavior (16). and Eleusine were associated with the The relatively low number of poly- Trichloris cluster at GS values of 0.18, 0.13, morphic loci observed (6/16) may be partially due to the autogamous nature Chloris and Trichloris are close relatives of T. crinita (16). Also, the sample set of and 0.05,the two respectively genera share (figure many 1, page morpho 11). - accessions selected for marker analysis logical features. This has led to contro- in this study (table 1, page 5) may have versies of whether Chloris and Trichloris are limited the detection of more poly- the same genus (1) or whether they should morphic SSRs. be regarded as different genera (21). In other words, if larger and more The results from the SSR cluster analysis, genetically diverse T. crinita germplasm demonstrating a clear separation of all were evaluated (e.g., in natural popula- Trichloris accessions from the two Chloris tions, or using germplasm collections from different geographical origins), additional and the fact that GS values between all the polymorphic markers and new alleles may Trichlorisspecies, at taxa GS ofand 0.18 C. castilloniana(figure 1, page (mean 11), be revealed. GS = 0.15; range = 0.12-0.17) and C. gayana The SSR analysis revealed considerable (GS mean = 0.21; range = 0.18-0.30) were genetic variation among T. crinita very low, support the separation of Chloris accessions, with pair-wise GS values and Trichloris as two distinct genera. ranging from 0.35 to 0.81. These results In addition to the 16 SSRs transferred are in full agreement with those reported to T. crinita, 12 and 14 SSR markers could by Cavagnaro et al. (2006), indicating GS be transferred to Chloris castilloniana values of 0.31 to 0.92 among 20 T. crinita and Chloris gayana - tronic Supplementary Material-Tables , respectively (Elec (Jaccard)accessions was using used AFLP in both markers. studies, It must and markers developed for these orphan thatbe noted the eight that theaccessions same GSused coefficient in the grassS1-S5). species. These Additionally, represent these the first markers SSR present study were among the plant mate- were polymorphic -and they were able rials used by Cavagnaro et al. (2006). to discriminate- between the two Chloris The SSR-based cluster analysis clearly separated all the grass genera into distinct The high resolution observed for thesespecies SSRs (figure in separating1, page 11). the two Chloris their genetic relatedness to Trichloris, and species (at a GM value < 0.50) suggest that amonggroups themselves, (figure 1, page in full 11), agreement and depicted with current phylogenetic and taxonomic rela- characterizing genetic diversity in intra- tionships in the Chloridoideae (10, 14). they may be useful for fingerprintingC. gayana and C. castilloniana. specific plant collections of

Tomo 50 • N° 1 • 2018 13 P. C. Kozub et al.

The positive SSRs in Cynodon dactylon projects of Trichloris crinita and -perhaps- (26 SSRs), Eleusine coracana (28 SSRs) related grass species. Successful applica- and E. indica (19 SSRs), adds potentially tions of these markers for progeny testing new informative markers to the molecular toolkit of these species. were recently reported in a study aimed atand elucidating estimation the of reproductive inbreeding coefficients system of T. crinita (16). In addition, these SSRs can Conclusions be used for assisting breeding programs of this species. It is expected that the SSR markers developed in this study will be instrumental in a number of genetic research

References

Chloris (Gramineae). Brigham Young University Science Bulletin Biological Series. 19: 1-133. 1.2. Bever,Anderson, J. D.; Felber,D. E. 1974. F. 1992. Taxonomy The theoretical of the genus population genetics of autopolyploidy. Oxford Surveys

in Evolutionary Biology. 8: 185-185. 3. Bruno, C.;Universidad Balzarini, M. Nacional 2010 Distancias de Cuyo. Mendoza. genéticas Argentina. entre perfiles 42(2): moleculares 171-182. obtenidos desde 4. Cavagnaro,marcadores J. B.; Dalmasso, multilocus A. 1983. multialélicos. Response to Revistadifferent de intensity la Facultad and frequency de Ciencias of cutting Agrarias. in native grasses of Mendoza. Pappophorum caespitosum and Trichloris crinita. Deserta. 7: 203-218.

among varieties of the native forage grass Trichloris crinita 5. Cavagnaro,morphological P. F.; Cavagnaro, characters, J. B.; Lemes, and J. quantitative L.; Masuelli, agronomicR. W.; Passera, traits. C. B. Genome. 2006. Genetic 49: 906-918. diversity 6. Cavagnaro, P. F.; Chung, S. M.; Manin, S.; Yildiz, M.; Ali, A.; Alessandro, based onM. AFLPS.; Iorizzo markers, M.; Senalik, D. A.; Simon, P. W. 2011. Microsatellite isolation and marker development in carrot - genomic distribution, linkage mapping, genetic diversity analysis and marker transferability across Apiaceae. BMC Genomics. 12: 386.

7. Cerqueira, E. D.; Sáenz, A. M.; Rabotnikof, C. M. 2004. Seasonalversus nutritive genomic value derived of native microsatellite grasses of Argentinemarkers for Calden genotyping Forest Range. wild andJournal cultivated of Arid Environments.barley. Genetic 59: Resources 645-656. and Crop 8. Chabane, K.; Ablett, G. A.; Cordeiro, G. M. 2005. EST 9. Chen, X.; Cho, Y.; Mc Couch, S. 2002. Sequence divergence of rice microsatellites in Oryza and Evolution.other plant 52: species. 903-909. Molecular Genetics and Genomics. 268: 331-343.

10. Columbus,(Gramineae): J. T.; Cerros-Tlatilpa, a preliminary R.; study Kinney, based M. on S.; nuclear Siqueiros-Delgado, ribosomal internal M. E.; transcribed Bell, H. L.; Griffith, M. P.; Refulio-Rodriguez, N. F. 2007. Phylogenetics of Chloridoideae

spacer and chloroplast trnL-F sequences.Transferability Aliso: A Journal of non-genic of Systematic microsatellite and Evolutionary Botany. 23: 565-579. 11. García-Moreno, M. J.; Velasco, L.; Pérez-Vich, B. 2010. and gene-based sunflower markers to safflower. Euphytica. 175: 145-150.

14 Revista de la Facultad de Ciencias Agrarias SSR markers for Trichloris crinita

12. Grandón, N. G.; Alarcón, Y.; Moreno, M. V. Arolfo, V.; Orodizzi, A.; Basigalup, D. H. Gieco, J. O.; Bruno, C. 2013. Genetic diversity among alfalfa genotypes (Medicago sativa dormant cultivars using SSR markers and agronomic traits. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 45(2): L.) 181-195. of non-

three varieties of Trichloris crinita (Poaceae) a forage grass from the arid Monte region 13. Greco, S. A.; Cavagnaro, J. B. 2002 Effects of drought in biomass production and allocation in matK sequences. ofSystematic Argentina. Botany. Plant Ecology.26: 386-405. 164: 125-136. 14.15. Hilu,Kalia, K. R. W.; K.; Alice, Rai, L. M. A. K.:2001. Kalia, A phylogeny S.; Singh, ofR., Chloridoideae Dhawan, A. K.(Poaceae) 2011. Microsatellite based on markers: An

overviewReproductive of the biology recent progressof the innative plants. forage Euphytica. grass 177: Trichloris 309-334. crinita (Poaceae; 16. Kozub, Chloridoideae).P. C.; Barboza, K.; Plant Galdeano, Biology. F.; 19: Quarin, 444-453. C. L.; Cavagnaro, J. B.; Cavagnaro, P. F. 2017.

autotetraploid alfalfa (Medicago sativa 17.18. Mahajan, Liu, Z. P.; Liu,R.; Gupta, G. S.; Yang,P. 2012. Q. C. Molecular 2007. A novelmarkers: statistical their methoduse in tree for assessingimprovement. SSR variation Journal of in Forest Science. 58: 137-144. L.). Genetics and Molecular Biology. 30: 385-391.

de vid (Vitis vinifera 19. Martinez,la L.;Facultad Cavagnaro, de Ciencias P. F.; Masuelli, Agrarias. R. Universidad W. 2006. Caracterización Nacional de Cuyo. molecular Mendoza. de variedadesArgentina. 38(1): 77-86. L.) de calidad enológica por marcadores microsatélites. Revista de 20. Murray, M. G.; Thompson, W. F. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8: 4321-4325.

Buenos Aires, Argentina. 21. Nicora, E. G.; Rúgolo de Agrasar, Z. E. 1987. Los géneros de gramíneas de América austral. on grazing capacity in Argentina. Journal of Range Management. 45: 480-482. 22. Passera, C. B.; Borsetto, O.; Candia, R. J.; Stasi, C. R. 1992. Shrub control and seedling influences different farms as revealed by microsatellite markers. Acta Genetica Sinica. 31: 591-595. 23. Qu, L. J.; Wu, G. Q.; Li, X. Y.; Yang, N. 2004. Conservation efficiency of local chicken breeds in

24. Quiroga, E.; Blanco, L.; Orionte, E. 2009. Evaluación de estrategias de rehabilitación de pastizales1: 201-239. áridos. Ecología Austral. 19: 107-117. 25.26. Roig,Roodt, F. R.;A. 1971.Spies, Flora J. J. 2003. y vegetación Chromosome de la Reserva studies Forestalin the grass de Ñacuñán. subfamily La Chloridoideae. vegetación. Deserta. II. An analysis of polyploidy. Taxon. 52: 736-746.

values in three ecotypes of Trichloris crinita, a native forage grass of the arid zones 27. Silva Colomer,of Argentina. J.; Cavagnaro, Proceedings J. B.; of Lemes, the XVI J.; International Medero, M. 1989.Grassland Productivity Congress. and Montpellier. nutritive France. 815-816. 28. Sneath, P. H. A.; Sokal, R. R. 1973. Numerical Taxonomy. San Francisco. California.

(SSR) markers for genetic mapping of raspberry and blackberry. Journal of the 29. Stafne, E.American T.; Clark, Society J. R.; Weber, for Horticultural C. A.; Graham, Science. J.; Lewers, 130: 722-728. K. S. 2005. Simple sequence repeat 30. Tangphatsornruang, S.; Somta, P.; Uthaipaisanwong, P.; Chanprasert, J.; Sangsrakru, D.; Seehalak, W.; Sommanas, W.; Tragoonrung, S.; Srinives, P. 2009. Characterization of microsatellites and gene contents from genome shotgun sequences of mungbean (Vigna radiata

development and (L.) characterization Wilczek). BMC Plant of gene-derived Biology. 24: 137.SSR-markers in barley (Hordeum 31. Thiel, T.;vulgare Michalek, W.; Varshney, R.; Graner, A. 2003. Exploiting EST databases for the

L.). Theoretical and Applied Genetics. 106: 411-422.

Tomo 50 • N° 1 • 2018 15 P. C. Kozub et al.

32. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B. C.; Remm, M.; Rozen; S. G. 2012 Primer3-new capabilities and interfaces. Nucleic Acids Research. 40: e115.

33. Van Puyvelde, K.; Van Geert, A.; Triest, L. 2010. ATETRA, a new software program to analyse tetraploid microsatellite data: comparison with TETRA and TETRASAT. Molecular Ecologyfrom major Resources. cereal crops 10: 331-334. to minor grass species for germplasm characterization and 34. Wang, M.evaluation. L.; Barkley, Plant N. A.; Genetic Yu, J. Resources.K. 2005. Transfer 3: 45-57. of simple sequence repeat (SSR) markers

35. Zeid, M.; Yu, J. K.; Goldowitz, I.; Denton, M. E.; Costich, D. E.; Jayasuriya, C. 2010. Cross-amplification of EST-derived markers among 16 grass species. Field Crops Research. 118: 28-35. Acknowledgments

Nacional de Cuyo, Proyectos 06A/476 and 06A/569. Perla Carolina Kozub is a fellow of the The work was supported by grants from Secretaría de Ciencia, Técnica y Posgrado, Universidad

Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET).

16 Revista de la Facultad de Ciencias Agrarias OrganicRev. FCA UNCUYO.amendment 2018. application 50(1): 17-32. in ISSNa vineyard impreso of 0370-4661. Mendoza ISSN (en línea) 1853-8665.

Originales: Recepción: 03/06/2017 - Aceptación: 28/10/2017 Abstract Research on grapevines has indicated that organic amendment application (OAA) increases the nutrient content of soil and plant tissue. Microbial functional groups are extensively used as soil fertility indicators because they are highly sensitive to changes in climatic and management conditions and they accurately represent entire biological processes. The goal of the present study was to evaluate the interactive effects of OAA on microbiological and chemical properties of soil and plants of a vineyard in Mendoza, Argentina. The following factors were evaluated: type of organic amendment (compost or vermi compost), application mode (surface or carried out using a factorial randomized complete block design. The following soil parameters wereburied) analyzed and frequency before and of after application OAA: microbial (one or abundance two applications). related to The the field carbon experiment and nitrogen was cycle, total microbial activity, salinity and fertility. Yield, pruning weight, trunk diameter and nutritional variables of the vine were determined at the end of the assay. The results showed that microorganisms were not affected by the type of amendment, the application method or frequency. After OAA, the total abundance of microorganisms was similar, and soil salinity was not affected. Phosphorus depended on the strategy or combinations. Total phosphorus in petioles was higher after one or two buried applications (0.43% and 0.39%, respectively). In conclusion, OAA to irrigated soil of arid areas in Mendoza, Argentina, could be considered a promising supplementary treatment to increase the nutrient content in soil and vine. Keywords

1 Institutocompost •Nacional vermi compost Tecnología • microorganisms Agropecuaria. Estación• grapevine Experimental • organic fertilizers Mendoza. San Martín 3853. (5507). Mendoza. Argentina. [email protected] 2 Universidad Nacional de Cuyo. Facultad Ciencias Agrarias. Almirante Brown 500. M5528AHB. Mendoza. Argentina. 3 Universidad Nacional de Buenos Aires. Facultad de Agronomía. Avda. San Martín 4453. (1417). Buenos Aires. Argentina.

Tomo 50 • N° 1 • 2018 17 L. E. Martinez, R. C. Vallone, P. N. Piccoli, S. E. Ratto

Resumen La aplicación de abonos orgánicos (AAO) en viñedos es una práctica frecuente para aumentar el contenido de nutrientes del suelo y planta. Los grupos funcionales micro- bianos se utilizan ampliamente como indicadores de fertilidad del suelo porque son altamente sensibles a las condiciones climáticas y culturales, y son los responsables de los procesos biológicos. El objetivo de este estudio fue evaluar si estas premisas son válidas en las condiciones de la experiencia en un viñedo de Mendoza (Argentina). Los abonos empleados fueron compost y vermicompost con dos tipos de aplicación (super- medidos en suelo fueron: abundancia microbiana relacionada con el ciclo del carbono yficial nitrógeno; y enterrado) actividad y frecuencia microbiana de total;aplicación variables (una de y dossalinidad aplicaciones). y fertilidad. Los Enindicadores el cultivo se midió rendimiento, peso de poda, diámetro del tronco y contenido de nutrientes. El diseño experimental fue factorial de bloques completos al azar. La abundancia y actividad microbiana no se vieron afectadas por el tipo de abono, el modo o la frecuencia de aplicación. La salinidad del suelo no fue afectada por AAO. El fósforo en el suelo, respondió a las diferentes estrategias combinadas de aplicación. El fósforo total en los pecíolos fue mayor después de una o dos aplicaciones enterradas (0,43% y 0,39%, respectivamente). Los resultados indican la estabilidad de la actividad y abundancia microbiana en relación con la aplicación de los abonos en un suelo con coberturas nutritivos del cultivo y sobre la economía de los recursos. vegetales. La aplicación de OAA demostró efectos beneficiosos sobre los indicadores Palabras claves

compost • vermi compost • microorganismos • vid • abonos orgánicos Introduction

Organic amendment applications (OAA) of amendment, dose, application and as a sustainable vineyard management aim frequency. Microbial functional groups to preserve soil fertility and non-renewable (MFG) are extensively used as soil fertility resources, as well as optimization of indicators because they are highly sensitive land use. Organic amendments used in to changes in climatic and management agriculture are manure, compost and conditions, and they accurately represent vermi compost. The latter two products entire biological processes. For example, are stable and obtained through a dynamics of nitrogen availability can composting process. Addition of compost be precisely determined by measuring or vermi compost to soil increases organic matter (OM) and nutrient concentration (5, 7, 8, 10, 11, 27). Studies in grapevines abundance of nitrifiers and nitrogen- have indicated that OAA increase the unanimouslyfixing microorganisms. respond to changes nutrient content of soil and plant (21, producedIn contrast, in soil because ammonifiers their population do not 22). The effect of this agronomic practice is very heterogeneous (1). respect chemical and microbiology aspect Despite the low OM of soils in of the soils, depends on the crop, type Mendoza, Argentina, there is limited

18 Revista de la Facultad de Ciencias Agrarias Organic amendment application in a vineyard of Mendoza information about the effects of OAA on Materials and Methods soil properties and grapevine growth and yield. Composting and vermicomposting Experimental site and soil characteristics could be a viable recycling strategy The study was carried out in a vineyard for agricultural and industrial organic located in Mendoza, Argentina (32°35' S residues. As regards vermicomposting, and 68°31' W) during two consecutive earthworm activity results in stabilized growing seasons. The average annual OM that differs from the initial substrate. precipitation of the experimental site is structure, a high nutritional value and a in January is 28.9°C. The vineyard was greatThe diversity end product of microorganisms has a fine particulate (6, 26). planted245 mm with and cv. the Sauvignon average Blanc temperature in 1986 A local study with vermi compost and using a typical planting density of 2.5 m compost of the same original material did between plants and rows, which have not demonstrate any difference in nutrition a north-south orientation. Plants were or microorganism abundance (2). Appli- guided by a horizontal canopy training cation of organic amendments is usually in system ("parral") and single Guyot pruned holes or furrows near the plant roots (9). with 30 buds per plant. Vines were Phosphorus is a nutrient required by the surface-irrigated and the inter-row areas plant, but in calcareous soils it is rapidly were planted with cover crops: Avena transformed into compounds unavailable sativa, Hordeum vulgare and Vicia sativa. for the plant (12, 16). The cover crops were sown in winter However, Martínez and Nazrala (1968), and they were cut at the end of the season. concluded that surface application of this In summer, growth of spontaneous element was optimal for soil fertility. vegetation covered the inter-rows. Soil was Other studies have demonstrated positive effects of compost mulch applications on loam texture, mixed, calcareous, thermal soil fertility and vineyard quality (21). andclassified it belongs as Typic to the Torrifluvents Las Compuertas with seriea silt Morlat (2008), assayed the response (24, 25). of vineyard nutrients after several years of OOA to determine an effect of Experimental design and treatments consecutive applications. The goal of the current study was out using a randomized complete block to assess the effect of different organic designThe with field three experiment factors and was four carried repli- amendments on the microbiological and cates. Blocks were oriented so that the chemical properties of soil and plants of a energy gradient was perpendicular to vineyard in Mendoza, Argentina. the irrigation factor. Homogeneity of the The type of amendment (compost vs. plants was measured through the trunk vermicompost), application technique diameter. The following factors were (surface vs. buried application) and appli- applied: cation frequency (one vs. two applications) - Type of organic amendment: compost were assayed for their effect on chemical (C) and vermi compost (V). and microbiological characteristics of the - Application mode: surface (S) and soil and on grape plant growth and yield. buried (B). - Frequency of application: one and two applications.

Tomo 50 • N° 1 • 2018 19 L. E. Martinez, R. C. Vallone, P. N. Piccoli, S. E. Ratto

Treatments resulted from combina- Soil sampling tions of the three factors. Each experi- Soil of each experimental plot was sampled once prior to each OAA (one adjacent plants distributed throughout per year, for two consecutive years). Soil threemental consecutive plot corresponded rows. All measurements to fifteen samples (500 g) were collected from the top layer (0-20 cm) of each plot. In addition, four control plots were left Field-moist samples were immediately withoutwere performed OAA. on the five central vines. transported to the laboratory, dried for The piles were formed with chicken 24 h and subsequently passed through a manure and poplar sawdust to standardize 2 mm sieve. Subsamples of each plot were the C/N ratio to 30. stored at 5°C for microbiological, physico- The piles were 1.50 m high and 30 m chemical and chemical analyses. long. Temperature and humidity of the piles were maintained at 50°C and 50%, Chemical soil analysis respectively, trough regular aeration and The pH of the soil was determined in irrigation. After 60 days, the piles were saturated soil paste and the electrical divided into two, each one, 20 m long, 1 m conductivity (EC) in saturated extract wide and 0.35 m high. (22). Oxidizable organic carbon (OOC) One half was left to continue with the was determined according to the Walkley- same maturation process (composting) Black method. Total nitrogen (TN) was and the other half was placed in vermi- measured using the Kjeldahl method. composting beds for maturation. Vermi- Available phosphorus (P) was extracted composting beds were inoculated from water through bubbling with carbon with approximately 30,000 worms m-2 (Eisenia foetida) and irrigated to maintain using ascorbic acid supplemented with humidity at approximately 80%. molybdate.dioxide and quantifiedExchangeable colorimetrically potassium Composting beds were harvested after (K) was extracted with 1 M ammonium 120 days and vermicomposting beds after acetate, pH 7. All methods have been 180 days, respectively. Both products previously described by Page et al. (1982). were sieved (2mm) and packed until application (table 1, page 21) (2). Microbiological soil analysis Two application methods were assayed: - 1- In buried, OAA was placed in a 20 cm deep furrow which was then covered with measuredAbundance by the of most nitrifiers, probable ammoninumber soil. Soil was furrowed and spread by a fiers and cellulolytic microorganisms was tractor equipped with a grading grid. - 2- In surface, OAA was also placed in a ganismsmethod in(NFO) specific were liquid determined culture by media. plate furrow, but in this case it was manually countingSaccharolytic (3). Total and nitrogen-fixingmicrobial activity microor (TMA) covered with dry cover crop residues. The was determined by soil respiration (4). application rate in both cases waslow: 8 Mgha-1. The applications were performed one per year, for two consecutive years.

20 Revista de la Facultad de Ciencias Agrarias Organic amendment application in a vineyard of Mendoza

Table 1. Chemical and microbiological characteristics of compost and vermicompost obtained from a mixture of chicken manure + poplar sawdust and shavings. Tabla 1. Características químicas y microbiológicas de compost y vermicompost obtenidos de una mezcla de cama de pollo y aserrín.

Compost Vermicompost Humidity (%) 48.9 57.6 Organic matter (%) 25.7 29.0 Total Nitrogen (g kg-1) 17.3 16.2 Total Phosphorus (g kg-1) 15.0 15.4 Total Potassium (g kg-1) 3.5 1.9 Total Sodium (g kg-1) 4.1 3.5 Total Calcium (g kg-1) 135.2 114.9 Total Magnesium (g kg-1) 9.4 7.3 Nitrate as nitrogen (mg kg-1) 965.6 809.4 Ammonium as nitrogen (mg kg-1) 39.5 28.4 Total Carbon/Total nitrogen 8.6 10.4 Electrical conductivity (1:5) (dS m-1) 1.4 0.8 pH (1:5) 7.13 7.00

-1 Saccharolytic microorganisms (log10 g ) 0.48 0.30 -1 Cellulolytic microorganisms (log10 g ) 3.65 2.78 -1 N2-Fixing microorganisms (log10 g ) 0.00 2.97 -1 Ammonifying microorganisms (log10 g ) 3.15 2.48 -1 Nitrifying microorganisms (log10 g ) 2.31 0.00

Vine growth and yield parameters Total nitrogen was analyzed using the During the harvest at the end of the Kjeldahl method. Total phosphorus (P) was measured colorimetrically and K plants of each experimental plot were was determined using atomic absorption extracted.second growth During period, dormancy, clusters pruning from was five spectroscopy (AAS). weighed and the trunk diameter of the plants was measured. Statistical analysis Data analysis was conducted with analysis Nutritional analysis of leaf petioles of variances (ANOVA) using INFOSTAT Inveraison at the end of the second software version 2010. Main effects and growth period, adult and healthy leaves levels, and Fisher's LSD test was used to node were extracted from the plant. calculateinteractions differences were assessed between for means. significance located between the fifth and seventh

Tomo 50 • N° 1 • 2018 21 L. E. Martinez, R. C. Vallone, P. N. Piccoli, S. E. Ratto

Results

Soil parameters Available P of the soil differed among dominant, followed in number by saccha- the type of amendment and application rolyticBefore and OAA, cellulolytic soil ammonifiers microorganisms were procedure combinations. It was observed that this nutrient was in the lowest content respiration was low before OAA (table 2, in buried compost (4.00 mg kg-1) (table 4, pageand, to23). a lowerThe soil degree, had a sandy nitrifiers; loam also texture, soil a slightly alkaline pH, was not saline and presented no sodium or chloride toxicity pageVine 25, productivityand figure 1, page 26). risk (table 3, page 24). Initial fertility The yield vine productivity (table 5, was satisfactory in TN content, high page 27), was satisfactory in all treat- exchangeable K level, but low available ments respect to the normal yield of high P content. Soil OM was relatively high quality grapevine varieties. With regard to compared to normal values of soils in the the application method, pruning weight of area, as result probably, of the permanent plants that had received surface compost plant cover (table 4, page 25). application (2.13 kg pl-1) was higher than that of plants after buried compost Biological and chemical characteristics (1.49 kg pl-1). Contrary, the trunk diameter after OAA was larger in plants that had received a Microorganisms were not affected by single buried vermi compost application the type of amendment, the application method or frequency of application. After Total K measured in leaf petioles was OAA, the total microorganisms abundance 15%(figure higher 2, page (p=0.0072) 29; table 5, pagein plots 27). with was similar between them, while at the amendment applications than in plots without it (control plots). dominant. Soil salinity was not affected by Total P content was higher in one OAAbeginning and, EC of andthe assay,chloride ammonifiers content did were not and two buried applications (0.43% and increase after OAA. 0.39%, respectively) compared to one The compost and vermi compost used surface application (table 4, page 25 and in the experiment were slightly saline and the application dose was low (table 1, was observed between the application page 21). methodfigure 1, andpage frequency. 26). A significant interaction

22 Revista de la Facultad de Ciencias Agrarias Organic amendment application in a vineyard of Mendoza ) -1 week ns ns ns ns ns ns ns -1 g SR 2 0.26 ± 0.04 0.36 ± 0.09 0.41 ± 0.14 0.36 ± 0.16 0.40 ± 0.14 0.36 ± 0.16 0.37 ± 0.15 0.40 ± 0.14 (mgCO ) -1 g ns ns ns ns ns ns ns 10 (log Nitrifiers 0.99 ± 0.38 1.89 ± 0.41 2.35 ± 0.80 2.27 ± 0.60 2.25 ± 0.52 2.36 ± 0.85 2.09 ± 0.73 2.52 ± 0.60 ) -1 g ns ns ns ns ns ns ns 10 (log 9.42 ± 0.15 5.43 ± 0.58 4.79 ± 0.47 4.79 ± 0.67 4.79 ± 0.65 4.79 ± 0.50 4.71 ± 0.69 4.87 ± 0.42 Ammonifiers ) -1 g 10 ns ns ns ns ns ns ns -Fixers 2 (log N 5.94 ± 0.28 7.13 ± 0.13 7.09 ± 0.40 7.26 ± 0.20 7.20 ± 0.30 7.16 ± 0.35 7.12 ± 0.30 7.23 ± 0.35 ) -1 g 10 ns ns ns ns ns ns ns Soil respiration, ns: not significant Soil respiration, 1.47 ± 0.56 5.43 ± 0.58 3.85 ± 0.68 4.16 ± 0.71 3.96 ± 0.80 4.05 ± 0.61 3.87 ± 0.67 4.14 ± 0.73 Cellulolytic Fisher's LSD Test p ≤ 0.05). Test Fisher's LSD Mo's (log Mo's SR: SR: Respiración edáfica, ns: no significativa. SR: Respiración ) -1 g desviación estándar, n = 4; Fisher Test p ≤ 0,05). n = 4; Fisher Test estándar, desviación 10 ns ns ns ns ns ns ns 5.18 ± 0.25 6.06 ± 0.16 6.29 ± 0.41 6.34 ± 0.47 6.25 ± 0.49 6.38 ± 0.38 6.29 ± 0.33 6.34 ± 0.53 Saccharolytic Mo's (log Mo's Abundancia de microorganismos de suelo y actividad microbiológica, antes y después de la AAO (valor medio ± (valor y después de la AAO antes microbiológica, de suelo y actividad de microorganismos Abundancia Abundance of soil microorganisms (mo's) and microbiological activity before and after OAA (means ± SD, n = 4; (means ± SD, OAA and after before activity and microbiological (mo's) of soil microorganisms Abundance M F TxM TxF MxF TxMxF Before OAA Before Control (T) Type Compost Vermicompost Mode (M) Buried Surface (F) Application frequency One application applications Two T Tabla 2. Tabla Table 2. Table

Tomo 50 • N° 1 • 2018 23 L. E. Martinez, R. C. Vallone, P. N. Piccoli, S. E. Ratto ns ns ns ns ns ns ns SAR 1.81 ± 0.20 1.71 ± 0.16 1.79 ± 0.16 1.74 ± 0.20 1.72 ± 0.18 1.78 ± 0.17 1.96 ± 0.20 1.94 ± 0.19 ) -1 L c ns ns ns ns ns ns ns (mmol 16.46 ± 3.43 14.70 ± 2.36 15.30 ± 3.28 15.86 ± 2.84 15.93 ± 3.16 15.24 ± 2.96 16.76 ± 3.90 14.7 ± 10.29 Calcium + Magnesium ) -1 L c ns ns ns ns ns ns ns Sodium 4.93 ± 0.99 4.76 ± 0.88 4.81 ± 1.01 4.89 ± 0.87 4.94 ± 0.95 4.76 ± 0.93 5.67 ± 1.08 4.97 ± 1.62 (mmol ) odio; ns: no significativa; * significativo (p ≤ 0,05). * significativo odio; ns: no significativa; -1 S L c elation, ns: not significant; * significant (p ≤ 0.05) R ns ns ns ns ns ns ns Chloride 4.78 ± 1.11 4.12 ± 0.97 4.61 ± 1.20 4.29 ± 0.96 4.61 ± 1.03 4.29 ± 1.14 4.51 ± 0.48 3.99 ± 0.92 (mmol dsorción de dsorción A bsorption A * ns ns ns ns ns ns pH odium S 7.63 ± 0.19a 7.75 ± 0.12b 7.71 ± 0.19 7.66 ± 0.15 7.67 ± 0.16 7.71 ± 0.18 7.70 ± 0.13 7.50 ± 0.07 ) -1 ns ns ns ns ns ns ns EC (dSm léctrica, SAR: Relación de Relación léctrica, SAR: E onductivity, SAR: SAR: onductivity, 1.44 ± 0.29 1.30 ± 0.16 1.39 ± 0.31 1.35 ± 0.16 1.35 ± 0.16 1.38 ± 0.29 1.39 ± 0.19 1.59 ± 0.81 C Valores medios seguidos de letras distintas indican diferencias significativas (P ≤0,05). significativas distintas indican diferencias medios seguidos de letras Valores Means followed by different letters within the same column are significantly different (P ≤ 0.05). different significantly within the same column are letters different by Means followed EC: Electrical Soil salinity and sodicity before and after OAA (means ± SD, n = 4; Fisher's LSD Test p ≤ 0.05). Test n = 4; Fisher's LSD (means ± SD, OAA and after Soil salinity and sodicity before EC: Conductividad EC: Conductividad Table 3. Table T Two applications Two M Application frequency (F) Application frequency One application F TxM Surface TxF Mode (M) Buried MxF Vermicompost TxMxF Type (T) Type Compost Control Before OAA Before Salinidad y sodicidad edáfica antes y después de la AAO (valor medio ± desviación estándar, n = 4; Fisher Test p ≤ 0,05). n = 4; Fisher Test estándar, medio ± desviación (valor y después de la AAO Salinidad y sodicidad edáfica antes Tabla 3. Tabla

24 Revista de la Facultad de Ciencias Agrarias Organic amendment application in a vineyard of Mendoza ns ns ns ns ns ns ns (%) SOM 1.09 ± 0.30 1.09 ± 0.24 1.01 ± 0.26 1.16 ± 0.26 1.07 ± 0.30 1.11 ± 0.24 1.20 ± 0.18 1.20 ± 0.26 0,05). ) ≤ -1 0.05). ns ns ns ns ns ns ns ≤ (mg kg 180.6 ± 24.9 224.94±49.89 238.33 ± 46.89 220.06 ± 48.31 243.53 ± 46.47 228.38 ± 48.05 234.67 ± 49.69 211.00 ± 32.52 Soil potassium ) -1 * * ns ns ns ns ns (mg kg 1.86 ± 0.19 5.19 ± 1.84 7.41 ± 2.63 5.85 ± 2.78 6.66 ± 2.08 6.38 ± 1.99 5.85 ± 2.58 4.29 ± 1.73 Soil phosphorus ) -1 ns ns ns ns ns ns ns (mg kg 696.8 ± 114.9 Soil nitrogen 554.94 ± 59.13 595.56 ± 147.36 559.81 ± 126.06 648.94 ± 160.09 590.31 ± 149.27 618.44 ± 151.84 613.19 ± 154.52 SOM: Soil Organic Matter; ns: not significant; * significant (p Matter; SOM: Soil Organic SOM: materia orgánica del suelo; ns: no significativo; * significativo (p * significativo del suelo; ns: no significativo; orgánica SOM: materia Soil fertility before and after OAA (means ± SD, n = 4; Fisher's LSD Test P ≤ 0.05). Test n = 4; Fisher's LSD (means ± SD, OAA and after before Soil fertility Table 4. Table T*F M*F T*M*F M F T*M Before OAA Before Vermicompost Mode (M) Buried Surface (F) Application frequency One application applications Two T Control (T) Type Compost Fertilidad edáfica antes y después de la AAO (valor medio ± desviación estándar, n = 4; Fisher Test P ≤ 0,05). n = 4; Fisher Test estándar, medio ± desviación (valor y después de la AAO edáfica antes Fertilidad Tabla 4. Tabla

Tomo 50 • N° 1 • 2018 25 L. E. Martinez, R. C. Vallone, P. N. Piccoli, S. E. Ratto

9.0 Buried application Surface application 8.0 b

) 7.0 b 1 - b g 6.0 K

g 5.0 a ( m

4.0

l P 3.0 i o

S 2.0 1.0 a 0.0 Compost Vermicompost Amendment type

0.5 one application two application b 0.4 b ab a

( % ) 0.3 P

0.2 l a n t P 0.1 b 0.0 Buried Super icial Application mode �

Different letters indicate significant difference (Fisher’s LSD Test, p ≤ 0.05). Letras diferentes indican diferencias significativas (Fisher Test, p ≤ 0,05). Figure 1. Interaction between amendment (compost or vermicompost) and application -1) (a), and interaction between

(buried orphosphorus superficial) (%)for available (b). Data phosphorusshow means (mg between kg two factors (n=8). application (buried or superficial) and frequency (1 or 2 applications) for total plant Figura 1. Interacción entre tipo de abono (compost and vermicompost) and modo de -1) (a), e interacción

aplicaciónaplicaciones) (enterrado para fósforo y superficial) total vegetal para fósforo(%) (b). disponible Los datos (mgmuestran kg el valor medio entre modo de aplicaciónentre (enterrado los dos factores y superficial) mencionados y frecuencia (n=8). de aplicación (1 y 2

26 Revista de la Facultad de Ciencias Agrarias Organic amendment application in a vineyard of Mendoza ns ns ns ns ns ns ns (%) 1.83 ± 0.29 2.08 ± 0.22 2.07 ± 0.18 2.09 ± 0.21 2.06 ± 0.18 2.04 ± 0.21 2.12 ± 0.17 total potassium total * * ns ns ns ns ns total total 0.32 ± 0.04 0.35 ± 0.07 0.37 ± 0.08 0.41 ± 0.05 0.33 ± 0.08 0.35 ± 0.09 0.38 ± 0.04 phosphorus (%) ns ns ns ns ns ns ns (%) 0.76 ± 0.08 0.75 ± 0.04 0.75 ± 0.06 0.74 ± 0.05 0.77 ± 0.06 0.76 ± 0.05 0.75 ± 0.06 total nitrogen nitrogen total * * ns ns ns ns ns (cm) 6.53 ± 0.38 6.80 ± 0.58 7.05 ± 0.70 7.03 ± 0.63 6.82 ± 0.67 7.04 ± 0.69 6.81 ± 0.60 trunk diameter trunk diameter Type (T) Type Mode (M) ) -1 Application frequency (F) Application frequency Test P ≤ 0,05). Fisher Test * ns ns ns ns ns ns 1.18 ± 0.57 1.81 ± 0.80 1.88 ± 0.82 1.77 ± 0.80 1.92 ± 0.81 1.85 ± 0.82 1.84 ± 0.80 ns: not significant; * significant (p ≤ 0.05). (kg plant (kg ns: no significativo; * significativo (p ≤ 0,05). * significativo ns: no significativo; pruning weight ) -1 ns ns ns ns ns ns ns yield (kg ha (kg 5762 ± 2265 7117 ± 2028 7577 ± 2622 7265 ± 2403 7428 ± 2304 6790 ± 2066 7904 ± 2484 Rendimiento, peso de poda y diámetro de tronco de la planta de vid (valor medio ± desviación estándar, n = 4; estándar, medio ± desviación de la planta vid (valor de tronco peso de poda y diámetro Rendimiento, Yield, pruning weight, trunk diameter and nutrient content of vine (means ± SD, n = 4; Fisher's LSD Test P > 0.05). Test n = 4; Fisher's LSD of vine (means ± SD, and nutrient content trunk diameter Yield, pruning weight, Control Compost Vermicompost Buried Surface One application Two applications Two F T*M T*M*F T M T*F M*F Tabla 5. Tabla Table 5. Table

Tomo 50 • N° 1 • 2018 27 L. E. Martinez, R. C. Vallone, P. N. Piccoli, S. E. Ratto

Discussion

Biological soil characteristics Chemical soil characteristics After OAA, the microorganisms had In addition to the low content of OM, similar populations, which agrees with soil in Mendoza presents a high risk of results obtained by Filippini et al. (2012), salinity and sodicity. After OAA, saline in plots cultivated with garlic. conditions stayed within acceptable The initial high quantity of ammoni- levels indicating that this practice could be successful in these soils. At the end of major mineralization of the soil organic the experiment, the pH only decreased in nitrogen.fiers in As this a result, study available would ammonium indicate a plots that received organic amendments, would increase, which could encourage growth of different microorganisms, but compared with normal parameters of calcareousbut the difference and arid soils. was This not means significant that Consequently, after OAA soil OAA to these soils would not affect soil microorganismsespecially nitrifiers increased (20). in number, alkalinity or acidity (table 2, page 23). Available P, a soil fertility parameter, According to Noé and Abril (2008), showed higher concentrations in soils variationsexcept for ammonifiers.in the abundance of micro- after organic amendment when compared organisms after one year were closely to initial values. This effect has also been related to the climatic conditions and detected by other authors (27) and in this physiological characteristics of each MFG. case, this nutrient could be considered a sensitive indicator of OAA. are not sensitive to changes in soil because Surface OOA showed higher levels of theyAbril are (2003)an heterogeneous stated that ammonifiers functional available P in soil close to the sampling group whereas other authors observed time, while buried applications increased that this population decreased after one year of plant residues decomposition or surface applications would increase by fertilizers application (17). availablefoliar P. It P isin difficult the soil to so deduce that the whether plant Soil respiration did not show any would be able to absorb it after buried difference among the factors assayed (table amendment and prior to soil sampling. 2, page 23). Soil respiration levels were Organic matter did not increase after the similar to soil with low microbial activity application; soil OM and nitrogen were and soils with conventional tillage (19). not affected by the type, methodology or An increase in soil respiration would application frequency of the amendment. be controlled by the increased of microbial Feasible explanations could be an abundance after OAA. Cover crops could increase in soil respiration, an augmented periodically provide OM and stimulate microbial abundance after OAA, or a high microbial activity in the soil, but the effect mineralization as a consequence of high of the application of organic fertilizers temperature of arid soils (10, 17). Because is negligible. changes in soil are generally long-term effects, an increase in soil OM could be detected after several years of repeated applications or in soils without cover crops initially.

28 Revista de la Facultad de Ciencias Agrarias Organic amendment application in a vineyard of Mendoza

Nutrients, vine growth and yield After OAA, higher concentrations availability of P and its subsequent of available P in soil and plants were absorption by plants (table 5, page 27). measured. The greater uptake of P could Pinamonti (1998) observed a higher result from P mineralization near the concentration of exchangeable K in roots, especially after the buried method soil and likewise of the total potassium of application (one or two applications content in leaves after OOA. of buried vermi compost). This suggest - that could be a correlation between variations in the plant nutritional status The benefits of surface compost appli produced by OAA and intrinsic chemical Nguyencations significantlyet al. (2013), affected found thean increase pruning soil characteristics or a change in physical inweight pruning and weight so plant with growth mulched (figure compost 2). soil conditions (15, 21, 22). applications. Therefore, surface appli- The results show that buried application would favor plant growth. cation was more favorable to the

) 2.50 Buried application Surface application 1 - 2.25 b l a n t ab

g p 2.00 ( k

d 1.75 ab o

o a w 1.50 n g

n i 1.25 u r a P 1.00 Compost Vermicompost Amendment type

Different letters indicate significant difference (Fisher's LSD Test, p ≤ 0.05). Diferentes letras indican diferencia significativa (Fisher's LSD Test, p ≤ 0,05). Figure 2. Interaction between amendment (compost or vermicompost) and -1) (a). and application frequency (one or two applications) for trunk diameter (cm) (b). interaction between application (buried or superficial) for pruning weight (kg plant for trunk diameter (cm) (c). Data show means between two factors (n = 8). application (buried or superficial) and application frequency (one or two applications) Figura 2. Interacción entre tipo de abono (compost and vermicompost) y modo de -1) (a) y frecuencia de aplicación (1 y 2 aplicaciones) para diámetro de tronco (cm)(b). la interacción modo de aplicación (enterrado y superficial) para peso de poda (Kg planta diámetro de tronco (cm). c. Los datos muestran el valor medio. aplicación (enterrado y superficial) y frecuencia de aplicación (1 y 2 aplicaciones) para

Tomo 50 • N° 1 • 2018 29 L. E. Martinez, R. C. Vallone, P. N. Piccoli, S. E. Ratto

8.00 one application two application

) 7.75 ( c m

7.50 b r e

t 7.25 e 7.00 a a m i a

d 6.75 a

n k 6.50 u r 6.25 T b 6.00 Compost Vermicompost Amendment type

8.00 one application two application

) 7.75

( c m 7.50

r e

t 7.25 b

e b 7.00

a m b i

d 6.75

n k 6.50 a u r 6.25 T 6.00 c Buried Super icial

Application mode �

Different letters indicate significant difference (Fisher's LSD Test, p ≤ 0.05). Diferentes letras indican diferencia significativa (Fisher's LSD Test, p ≤ 0,05). Figure 2. cont. Interaction between amendment (compost or vermicompost) and -1) (a). and application frequency (one or two applications) for trunk diameter (cm) (b). interaction between application (buried or superficial) for pruning weight (kg plant for trunk diameter (cm) (c). Data show means between two factors (n = 8). application (buried or superficial) and application frequency (one or two applications) Figura 2. cont. Interacción entre tipo de abono (compost and

de poda (Kg planta-1) (a). frecuencia de aplicación (1 y 2 aplicaciones) para diámetrovermicompost) de tronco y modo (cm) de(b). aplicación la interacción (enterrado modo dey superficial) aplicación (enterradopara peso

de tronco (cm). c. Los datos muestran el valor medio. y superficial) y frecuencia de aplicación (1 y 2 aplicaciones) para diámetro

30 Revista de la Facultad de Ciencias Agrarias Organic amendment application in a vineyard of Mendoza

Conclusion

After organic amendment to a Vine nutrition and plant growth were vineyard with cover crops, soil microor- more sensitive to the different application ganisms were not affected by the type of strategies (type, form and frequency of amendment, the application method or application) than microbiological soil application frequency. properties. The low risk of soil salinity would be predominant, but after OAA, abundance another advantage of the use of stabilized of Beforetotal microorganisms OAA, ammonifiers was similar. were organic amendment. Presence of cover crops in the vineyard Finally, OAA to irrigated soils of arid may have played a key role in the areas in Mendoza, Argentina, could be absence of differences in microbial considered a promising supplementary activity. Phosphorus in plants improved treatment to increase the nutrient content after buried applications, because the in soil and vines. treatment facilitated absorption of more available P from the soil.

References

1. Abril, A. 2003. Are soil microorganisms good indicators of land-use impact in ecosystems?

ecosistemas?]. Ecología Austral. 13(2): 195-204. 2. Abril, A.; [¿SonNoe, L.;los Filippini, microorganismos M. F.; Cony, edáficos M.; Martinez, buenos L.indicadores 2011. Microbial de impacto dynamics productivo and fertility en los characteristics in compost from different waste and maturation processes. The Open Agriculture Journal. 5: 19-29. 3. Alef, K.; Nannipieri, P. 1995. Methods in applied soil microbiology and biochemistry. London; San Diego: Academic Press. 4. Anderson, J. 1982. Soil respiration. Miller, A. R.; Keeney, D. (Eds.). Methods of Soil Analysis. Vol 2. Chemical and Microbiological properties. American Society of Agronomy and Soil Science. Madison, WI. p 831-872. 5. Arancon, N. Q.; Edwards, C. A.; Bierman, P. 2006. strawberries: Part 2. Effects on soil microbiological and chemical properties. Bioresource Technology, 97(6): 831-840. AvailableInfluences in: of http://doi.org/10.1016/j. vermicomposts on field biortech. 2005.04.016. 6. Atiyeh, R.; Domínguez, J.; Subler, S.; Edwards, C. 2000a. Changes in biochemical properties of cow dung manure during processing by earthworms (Eisenia andrei, Bouche) and effects on seedling growth. Pedobiologia. 44(6): 709-724. Available in: http://doi. org/10.1078/S0031-4056(04)70084-0. 7. Atiyeh, R. M.; Subler, S.; Edwards, C.; Bachman, G.; Metzger, J. D. Shuster, W. 2000b. Effects of vermicomposts and composts on plant growth in horticultural container media and soil. Pedobiologia. 44(5): 579-590. Available in: http://doi.org/10.1078/S0031-4056(04)70073-6. 8. Beltrán Santoyo, M. A.; Álvarez Fuentes, G.; Pinos Rodríguez, J. M.; García Lopez, J. C.; Castro Rivera, R. 2017. Abonos obtenidos del compostado de heces de ganado bovino de leche vs. fertilizante en la producción de triticale (X Triticum secale Wittmack). Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 49(1): 95-104.

Tomo 50 • N° 1 • 2018 31 L. E. Martinez, R. C. Vallone, P. N. Piccoli, S. E. Ratto

9. Cony, M. 2005. Humus de lombriz: un abono orgánico de creciente uso en viticultura. El Vino y su Industria. 33: 84-92. 10. Filippini, M. F.; Abril, A.; Cony, M.; Noé, L.; Venier, M.; Cónsoli, D.; Vallone; R. 2012. Effects of organic amendement application on soil quality and garlic yield in Central-Western Argentina. The Open Agriculture Journal. 6: 1-8. 11. Gutiérrez-Miceli, F. A.; Santiago-Borraz, J.; Montes Molina, J. A.; Nafate, C. C.; Abud-Archila, M.; Oliva Llaven, M. A.; Dendooven, L. 2007. Vermicompost as a soil supplement to improve growth, yield and fruit quality of tomato (Lycopersicum esculentum). Bioresource Technology. 98(15): 2781-2786. Available in: http://doi.org/10.1016/j. biortech.2006.02.032.

Mendoza. Tesis de Maestría. Universidad de Buenos Aires. Buenos Aires, Argentina. 12.13. Lipinski,Martínez, V. H.; 1978. Nazrala, Diagnóstico M. 1968. de deficienciaEstudio tendiente de fósforo a determinar en suelo del la departamento mejor forma dede Sanaplicación Carlos, de estiércol y abonos químicos al viñedo. I Congreso Nacional Vitivinícola. Mendoza, Argentina. 1: 1-2. 14. Morlat, R. 2008. Long-term additions of organic amendments in a Loire Valley Vineyard. II Effects on root system, growth, grape yield, and foliar nutrient status of a Cabernet franc vine. American Journal Enology Viticulture. 59: 364-374. 15. Nguyen, T. T.; Fuentes, S.; Marschner, P. 2013. Effect of incorporated or mulched compost on leaf nutrient concentrations and performance of Vitis vinifera cv. Merlot. Journal of soil science and plant nutrition. 13(2): 485-497. Available in: https://dx.doi.org/10.4067/ S0718-95162013005000038. 16. Nijensohn, L. 1991. Fósforo extraíble con agua carbonicada en el diagnóstico del nivel de fertilidad fosfórica en suelos aluviales regadíos. Actas de la II Jornada Nacional Fósforo del suelo. Asociación Argentina de la Ciencia del Suelo. 1: 32-36. 17. Noe, L.; Abril, A. 2008. Interacción entre calidad de restos vegetales, descomposición y fertilidad del suelo en el desierto del Monte de Argentina. Ecología Austral. 18(2): 181-193. 18. Page, A. L.; Miller, R. H.; Keeney, D. R. 1982. Methods of soil analysis Part 2 Chemical and Microbiological Properties. Madison, Wisconsin USA: American Society of Agronomy Inc, Soil Science Society of America Inc. 19. Pascual, J.; Garcia, C.; Hernandez, T.; Ayuso, M. 1997. Changes in the microbial activity of an arid soil amended with urban organic wastes. Biology and Fertility of Soils. 24: 429-434. 20. Paul, E. A.; Clark, F. E. 1989. Soil microbiology and biochemistry. San Diego: Academic Press. 21. Pinamonti, F. 1998. Compost mulch effects on soil fertility, nutritional status and performance of grapevine. Nutrient Cycling in Agroecosystems. 51(3): 239-248. Available in: http:// doi.org/10.1023/A:1009701323580. 22. Ponchia, G.; Bozzolo, A.; Tateo, F.; Concheri, G. 2012. Compost Application in the vineyard and

Acta Horticulture (ISHS). 938: 437-444. 23. Richards,its L. influence 1962. Diagnóstico on soil characteristics, y rehabiliatación vegetative de suelos and salinosproductive y sódicos behaviour (Vol. ofManual grapevine. de ). Riverside, California, USA.

25. SAGyP - INTA. 1990. Suelos de la República Argentina. 24.26. Romanella,Tognetti, C.; C. Laos, 1957. F.; Los Mazzarino, suelos de M.la región J.; Hernandez, del Río Mendoza. M. T. 2005. Boletín Composting de Estudios vs. vermicomposting: Geográficos. 4: 14. A comparison of end product quality. Compost Science and Utilization, 13(August 2014), 6-13. Available in: http://doi.org/10.1080/1065657X.2005.10702212. 27. Tognetti, C.; Mazzarino, M. J.; Laos, F. 2008. Compost of municipal organic waste: Effects of different management practices on degradability and nutrient release capacity. Soil Biology and Biochemistry. 40(9): 2290-2296. Available in: http://doi.org/10.1016/j. soilbio.2008.05.006.

32 Revista de la Facultad de Ciencias Agrarias Rev. FCA UNCUYO. 2018.Vitis 50(1): vinifera 33-45. ISSN impreso 0370-4661. ISSN (en línea) 1853-8665.

Influencia de la vid ( L.) sobre cultivos de cobertura: un modelo biomatemático Influencia de la vid (Vitis vinifera L.) sobre cultivos de cobertura: un modelo biomatemático de la transición de amensalismo a comensalismo

Influence of grapevine (Vitis vinifera L.) on cover crops: a biomathematical model of the transition of amensalism to comensalism

Carlos Rubén Bageta, Marcelo Alberto, Carmen Sartor, Adrián Cecconato, Alicia Bevaqua, Marta Tirador, Marcela Garriga, Verónica Nodaro, Alejandro Quiroga, Ernesto Uliarte (ex aequo).

Originales: Recepción: 23/12/2015 - Aceptación: 09/03/2017

Resumen

En este trabajo se estudia la dinámica de transición en la interacción entre vid (Vitis vinifera L.) y cultivo de cobertura. A partir de datos obtenidos en un ensayo de campo se postuló un modelo estadístico para investigar dicha interacción biológica y se pudo determinar que el sistema vid-cultivo de cobertura cambió de una interacción biológica del tipo comensalismo a otra de amensalismo, siendo la vid la que no se ve afectada. Sobre la base de esta información, se formuló un modelo biomatemático para describir esta interacción, se estimaron los parámetros del mismo y se analizó la estabilidad de los puntos de equilibrio. Se evidencia en el presente estudio que el cultivo de cobertura no afecta el crecimiento de la vid, durante el período considerado en el ensayo.

Palabras clave

Sistema dinámico • plano de fases • interacciones • vid • cultivos de cobertura • capacidad de carga • amensalismo

1 Universidad Nacional de Cuyo. Facultad de Ciencias Agrarias. Almirante Brown 500. M5528AHB. Chacras de Coria. Mendoza. Argentina. [email protected]

Tomo 50 • N° 1 • 2018 33 C. R. Bageta et al.

Abstract

In this paper, we study the dynamics of transition in the interaction between vine (Vitis vinifera - tical model to investigate such biological interaction and we could determine that the vine-cover crop L.) system and cover changed crop. Fromfrom dataa biological obtained interaction in a field essay, of commensalism we propose a type statis to another of amensalism type, being the vine not affected. Based on this information, we formulate a biomathematical model to describe this interaction, we estimate its parameters, and analyze the stability of the equilibrium points. It is evident, in this study, that the cover crop does not affect vine growth during the period considered in the essay.

Keywords

amensalism Dynamical system • phase plane • interactions • vine • green cover • carrying capacity • Introducción

La modelación matemática de la En las últimas décadas han sido publi- interacción entre dos especies biológicas cados trabajos de modelación matemática ha sido y es objeto de una gran cantidad de que abordan el problema del cambio en el trabajos de investigación tanto en el ámbito tipo de interacción. Entre ellos es posible de la Ecología como en el de la Biomatemática. citar Addicott (1981), Wolin y Lawlor Desde los trabajos originales de Alfred (1984), Hernández (1998) y Hernández Lotka (1910) y Vito Volterra (1925) hasta y Barradas (2003). Los dos últimos la actualidad se han propuesto numerosos proponen en sus trabajos, modelos de tipo y variados modelos teóricos que buscan explicar interacciones de diversos tipos como cambiar de signo según factores endó- depredación, competencia o mutualismo genosLotka-Volterra o exógenos, cuyos lo cual coeficientes permite modelar pueden entre especies como lo muestran Gillman y el cambio en el tipo de interacción entre Hails (1997) y May (1981) entre otros. dos especies. En muchos casos la modelación El énfasis de este trabajo se puso en matemática es complementada con esti- estudiar las interacciones biológicas mación estadística a partir de medi- cambiantes en el tiempo, entre las especies ciones de campo. Tradicionalmente se Vitis vinifera L. (vid) y la cobertura vegetal ha pensado que la interacción entre dos - lares (cultivo de cobertura), y el efecto que se sabe que dos especies que coexisten produceque crece la espontáneamente consociación entre en ellaslos interfi sobre enespecies un ecosistema biológicas pueden es fija. interactuar Sin embargo, de la capacidad de carga de cada una. una manera cambiante a lo largo de los El uso de coberturas vegetales en los distintos estados ontogénicos. Por ejemplo, los individuos de dos especies podrían en el manejo de los viñedos, como una tener una interacción mutualista durante herramientainterfilares esambientalmente una práctica sostenible frecuente los primeros momentos de su desarrollo con diversos objetivos. Entre estos, se y ser competidores en etapas adultas (10). destacan la capacidad para reducir la

34 Revista de la Facultad de Ciencias Agrarias Vitis vinifera

Influencia de la vid ( L.) sobre cultivos de cobertura: un modelo biomatemático erosión del suelo y los consecuentes daños Objetivos de las vides por los efectos del acarreo de Explorar la interacción biológica existente entre vid y cultivo de cobertura. disminuye el impacto de las gotas de lluvia Estudiar matemáticamente la dinámica arena (11), ya que reduce el flujo de agua, del cambio de la interacción biológica entre el cultivo de la vid y el cultivo de sobre la superficie e incrementa la tasa de cobertura sobre la base de los resultados disminuyendoinfiltración del laagua. temperatura en la super- obtenidos en el objetivo anterior, gene- Además, modifica el microclima rando para ello un modelo determinístico basado en el presentado por Hernández y elficie riesgo del cultivo, de quemaduras reduciendo de la sol cantidad e infesta de- Barradas (2003). cionesluz reflejada de ácarosen la misma (9). y Asimismo,disminuyendo es Obtener, del estudio de esta dinámica, preciso mencionar que la incorporación un valor umbral de biomasa de vid, a de cultivos de coberturas mantiene y partir del cual se produce el cambio en mejora el contenido de materia orgánica el tipo de interacción biológica entre las del suelo, reduce la incidencia de malezas, especies estudiadas. insectos y enfermedades (15). Por último, contribuye al secuestro y almacenamiento Materiales y métodos (2013, 2014), una de sus mayores limi- tantesde carbono consiste edáfico, en aunque,el consumo según extra Uliarte de En función de las hipótesis planteadas, agua, teniendo en cuenta que el cultivo de se organizó la tarea en dos etapas. En la la vid se lleva a cabo en lugares donde el primera se exploró el tipo de interacción agua es un factor limitante. entre las componentes del sistema agro- Podría suponerse que en los meses de ecológico (vid y cultivo de cobertura), con primavera verano, período en el cual la vid base en observaciones experimentales y y el cultivo de cobertura inician su creci- análisis estadístico. En la segunda etapa, se propuso un modelo matemático para el desarrollo del segundo (vale aclarar describir la interacción biológica entre quemiento el cultivo estacional, de cobertura la primera ha beneficiaríasido segado ambos componentes. en el inicio de la primavera, para que su evolución no afecte el desarrollo de la Exploración del tipo de interacción vid, lo cual es una práctica habitual en la biológica región de estudio). Se llevó a cabo un trabajo de campo A medida que avanza la estación de durante el cual se observaron las especies crecimiento, tanto la vid como el cultivo de y se midió su crecimiento. Posteriormente, cobertura aumentan su biomasa, y si este se analizaron los datos mediante métodos crecimiento no es manejado de manera adecuada, pueden producirse interac- tipo de interacción biológica entre ambos ciones antagónicas entre ellos. componentesestadísticos con del sistema el fin de agroecológico. establecer el Las hipótesis de trabajo sostienen que existe interacción biológica entre la Estudio de campo vid y el cultivo de cobertura y que esta El ensayo se realizó en un viñedo interacción cambia a partir de un valor comercial de la variedad Chardonnay, de 7 umbral de biomasa de la vid. años de implantación cuyo dosel se dispone en hileras y en planos paralelos verticales

Tomo 50 • N° 1 • 2018 35 C. R. Bageta et al.

(sistema de conducción en espaldero), lo presente trabajo, la suma del número de que permite una mayor incidencia de la toques de las mediciones en cada parcela luz solar al cultivo de cobertura y con riego se utilizaron como medida de biomasa, localizado en la planta (riego por goteo). constituyéndose como unidad de análisis la parcela. En lo sucesivo, y en virtud a en el distrito Carrizal del departamento de lo mencionado, se hará referencia a las LujánEl viñedo de Cuyo, forma Mendoza parte de una(33º16´30, finca ubicada 16´´S; biomasas de vid y cultivo de cobertura al 68º57´22, 17´´O). utilizar como variable medida el "número Se utilizó un diseño experimental en de toques". Dicha variable, por lo tanto, parcelas completamente al azar. Cada carece de las unidades utilizadas usual- parcela utilizada, mide 7 m de largo por mente para medir biomasa. 2,20 m de ancho, coincide con un claro Se consideró los puntos de medición del espaldero (conjunto de plantas de cada 0,5 m dentro de la parcela, colocando la hilera entre dos postes) y se dejó una la aguja en sentido horizontal a un metro planta en cada extremo para reducir el de altura en vid; y para el cultivo de efecto de bordes. cobertura las mediciones se realizaron de A principios del mes de diciembre manera similar, ahora colocando la aguja comenzaron las mediciones de biomasa de manera vertical a 1 m de la manguera de vid y de cultivo de cobertura con una frecuencia quincenal, culminando las totalizaron seis puntos de medición en mismas los primeros días del mes de marzo. cadade riego parcela. hacia el centro del interfilar. Se Se establecieron para el ensayo tres tratamientos: vid sola (sin cultivo de cobertura Análisis de datos Se analizaron estadísticamente los (sin plantas de vid presentes en la parcela) y datos recolectados en el trabajo de viden loscon interfilares), cultivo de cobertura cultivo de (están cobertura presentes solo campo, con el objeto de explorar las ambos cultivos en la parcela). posibles interacciones entre los dos Las parcelas con vid sola se obtuvieron componentes del sistema agroecológico: la vid y el cultivo de cobertura. Como en ambos lados de cada parcela. Las parcelas el dispositivo experimental hay tres tipos conpasando cultivo la rastrade cobertura sobre los solo, interfilares se selec dede parcelas: las que tienen solo vid, las que tienen solo cultivo de cobertura y estructura de espaldero y riego por goteo las que tienen ambos cultivos; usando la montadacionaron depero un sin sector vid deimplantada. la finca con Las la jerga agronómica, se denomina parcelas parcelas de vid con cultivo de cobertura “consociadas” a estas últimas. En este se escogieron sobre el viñedo original. análisis estadístico se estudia de qué Se establecieron cinco parcelas (repeti- forma las biomasas de cada uno de los ciones) de cada tratamiento. componentes dependen del tiempo y de la Se tomaron las mediciones de biomasa presencia o ausencia del otro componente. por el método de point quadrat presentado Esto es, de qué manera crece la biomasa por Goodall (1952). Jonasson (1998) (efecto del tiempo) y si lo hace de manera muestra que en este método el número de diferente estando presente o no el otro toques de una especie determinada tiene componente (efecto de la consociación). una alta correlación con la biomasa de la Se llevó a cabo este análisis mediante misma. Por esto, para los propósitos del el ajuste de un modelo lineal generalizado

36 Revista de la Facultad de Ciencias Agrarias Vitis vinifera

Influencia de la vid ( L.) sobre cultivos de cobertura: un modelo biomatemático de la familia Poisson. La otra técnica es (2) el ajuste de curvas de crecimiento por log( λ)= α+ βt +γtT regresión no-lineal. Ajuste de un modelo lineal generalizado de la familia Poisson. donde: Dado que las biomasas están expresadas como "número de toques toques por parcela por parcela" es adecuado abordar el λ = valor esperado del número de procesamiento estadístico modelándolas inicio del ensayo mediante variables aleatorias “Y” de tipo t = tiempo medido en días a partir del Poisson y estudiar la dependencia de sus valores esperados respecto del tiempo y T = el factor de consociación de la presencia del otro componente del númeroα = intercepto de toques condel respectomodelo del tiempo sistema. Para esto, se planteó un modelo β = tasa de variación del logaritmo del lineal generalizado de la familia Poisson consociación con función de vínculo canónica. En el γ = coeficiente de interacción tiempo- - modelo, el tiempo se incluye como una variable continua “t” medida en días a En caso de resultar significativo el pará partir del inicio del ensayo; la presencia o disminuyendometro γ, su valor la tasaestimado de variación se sumará del alloga del- ausencia del otro componente se incluye ritmocoeficiente de la βbiomasa del tiempo, respecto aumentando del tiempo, o mediante una variable indicadora “T” que denotando un efecto de la presencia del toma el valor 0 cuando el otro componente otro componente sobre el crecimiento. está ausente y 1 cuando el otro componente está presente. La variable "T" es el "factor Modelación matemática de consociación". Propuesta del modelo En este enfoque, las mediciones Sobre la base de los resultados recolectadas en el campo de biomasa estadísticos obtenidos se planteó el son realizaciones de muestras aleatorias siguiente sistema dinámico del tipo Lotka- independientes Poisson, en la parcela m-ésima, en cada tiempo de los J tiempos al propuesto en Hernández (1998) y medidos y para cada uno de los 2 niveles HernándezVolterra, que y Barradasconstituye (2003): una modificación de consociación Tk : (3) iid (1) {Y1jk ,Y2jk , ,Ymjk }  Poisson( λjk ) j =1,...,J;k =1,2;m =1,2,3,4,5 esperado del número de toques por donde: El parámetro λ representa el valor parcela. De esta manera, el predictor lineal N1 tiene 3 términos: el intercepto, un término (componente 1 del sistema) = representa la biomasa de la vid para el efecto del tiempo y un término de N2 interacción entre el tiempo y el factor de cobertura (componente 2 del sistema) = la biomasa del cultivo de consociación: r1 de la vid = la tasa intrínseca de crecimiento

Tomo 50 • N° 1 • 2018 37 C. R. Bageta et al.

r2 del cultivo de cobertura ecuación 4 debería cambiar el signo. Este =la tasa intrínseca de crecimiento considerados, la función definida en la K1 y K2 cambio se daría cuando Nj i de la vid y del cultivo de cobertura Reemplazando la ecuación 4 en la respectivamente = las capacidades de carga ecuación 3, se obtiene: (5)=b , i=1,2.

2,1 (N1 del componente 1 sobre el componente 2 α ) = la función que refleja el efecto En primer lugar, la ecuación 3 sin el

2,1 (N1) representa un sistema de ecuaciones dife- término que contiene la función α renciales desacoplado, donde el creci- En la ecuación 5.2, b2 (raíz de la alfa- miento de ambas componentes sigue función) y son constantes asociadas al curvas logísticas tradicionales. problema, el resto de las constantes y Si se supone que la asociación entre las variables se interpretan como en la ambos componentes puede alternar entre ecuación 3.

2,1 La razón de la elección de la ecuación

(N1) debe cambiar necesariamente (4). Es 5 es consecuencia del análisis estadístico. posible,ser beneficiosa incluso, o pensar perjudicial dicha , el función signo de como α Para obtener estimaciones de los pará- el efecto de la interacción biológica entre metros del sistema (ecuación 5) a partir de las soluciones del mismo, se utiliza la menos costos para el componente 2 en siguiente estrategia: en el caso de r1, r2, funciónlos dos componentes,del componente lo cual1, de es: acuerdo beneficios con K1 y K2, se estima como valores iniciales Hernández y Barradas (2003). de los mismos los parámetros que se Así, es posible interpretar su obtienen al ajustar curvas logísticas para cada componente sin consociar y se eligen

2,1 (N1) > 0, esto indica que la presencia los valores iniciales de los parámetros b2 delsignificado componente de la siguiente1 tiene una manera: contribución cuando y c2 de forma tal que estén de acuerdo con α positiva al factor de denso-dependencia 2,1 (N1), en la tasa de crecimiento per cápita del que muestra el siguiente límite: el comportamiento asintótico de α 2,1 (N1) < 0 se interpreta de la manera opuesta. componenteHernández 2; y mientras Barradas que(2003) α sugieren que una forma funcional adecuada, es: (4) A continuación, se determinan intervalos numéricos alrededor de los valores iniciales de cada parámetro y se elabora una grilla considerando todas las combinaciones posibles de valores de los pará-

Se puede ver fácilmente que bi es una raíz metros para resolver el sistema [5]. de la ecuación anterior y además es el valor Para cada combinación de valores de a partir del cual la función cambia de signo. En adelante, a estas funciones se las elaborada, se resolvió el sistema de ecua- denominará alfa-funciones. cioneslos coeficientes diferenciales proporcionada ordinarias por [5] la grillautili- Si existe cambio en la interacción zando el software R (2015), mediante la biológica entre los componentes función "ode" del paquete "deSolve" (2010).

38 Revista de la Facultad de Ciencias Agrarias Vitis vinifera

Influencia de la vid ( L.) sobre cultivos de cobertura: un modelo biomatemático Mediante la suma de los cuadrados de Luego se realizó la linealización del los residuos se evaluó la bondad del ajuste sistema (ecuación 6), calculando la matriz de cada combinación de parámetros. Jacobiana asociada al mismo, y se evaluó Se repitió este procedimiento de en los puntos de equilibrio previamente manera iterativa en todas las combina- obtenidos al resolver la ecuación 7. ciones que proporciona la grilla, eligiendo como mejor estimación de parámetros a aquella con la menor suma de cuadrados Resultados y discusión de residuos; a estas mejores estimaciones son: r1, r2, K1, K2, b2 y c2. Exploración del tipo de asociación biológica Análisis de estabilidad Reemplazando las mejores estima- vid no resulta estadísticamente diferente ciones en la ecuación 5 resulta: de ceroEl coeficiente (tabla 1). Esto de interacciónindica que las γ detasas la (6) de variación del logaritmo de la biomasa esperada para la vid sola y para la vid en

presencia del cultivo de cobertura, β y β+γ respectivamente,Este resultado no sugiere difieren, que por no ser habría nulo evidenciasel coeficiente para de interacciónasumir que γ. el cultivo de Para establecer los puntos de equi- cobertura afecta el crecimiento de la vid e librio de la ecuación 6, se resolvió el indicaría una posible indiferencia de la vid siguiente sistema, usando el software R respecto del cultivo de cobertura. (2015) y el paquete deSolve (2010): Por otra parte, en el caso del cultivo (7)

(diferentede cobertura, de elcero) coeficiente y positivo de interacción (tabla 1). Estoγ resulta indica estadísticamenteque la tasa de variación significativo del logaritmo de la biomasa esperada para el

Tabla 1. Ajuste del modelo de regresión Poisson para los componentes del sistema agroecológico Table 1. (Setting) Poisson regression model for agroecological system components

Componente α β γ 3,06 0,00424 0,00105 Vid [0,628] ns 1,27 0,0116 0,0157 Cultivo de cobertura [0,0001]*** [0,029]*

Cada celda presenta la estimación puntual[0,0001]*** y, entre corchetes, valor-p[0,026]* para la prueba de [0,0001]***la hipótesis nula de que el

Each cell presents the point estimate and, in brackets, p-value to test of the null hypothesis that the parameter parámetro es cero en verdad. ‘ns’ indica no significativo; ‘*’ significativo al nivel 5% y ‘***’ significativo al nivel 0,1%.

is really zero. 'Ns' indicates not significant; '*' significant at the 5% level and '***' significant at the 0.1% level.

Tomo 50 • N° 1 • 2018 39 C. R. Bageta et al.

Se muestra en la tabla 2, los valores de la misma tasa para el cultivo de cobertura los parámetros r1, r2, K1, K2, b2 y c2, obtenidos cultivo de cobertura solo, β, es menor que de acuerdo con el procedimiento descripto Este resultado sugiere que hay en la sección Materiales y Métodos. evidenciasen presencia para de asumir la vid, β+γun efecto (γ>0). facilitador de la vid sobre cultivo de cobertura en tanto obtuvo cuatro puntos de equilibrio para que la presencia de la primera aumenta la los Alvalores resolver de el las sistema biomasas. (ecuación Ellos 7*) son: se tasa de crecimiento del segundo. (0;0), (0;9,8), (24,638;0) y (24,638;5,641).

Se realizó el ajuste de la regresión de Llamando J (N1, N2) a la matriz jacobiana Poisson por el método de máxima verosi- asociada a [6] evaluada en cada punto de * * militud, utilizando el módulo glm del equilibrio, se obtienen matrices J (N 1, N 2) programa de computadora STATA 6.1 (2000). asociadas a cada uno de ellos. Los resultados se muestran al pie de la página. Modelación matemática En primer lugar, cada matriz tiene a sus Los resultados del análisis estadístico autovalores en la diagonal principal y se precedente permiten proponer como modelo biomatemático al presentado es distinta de cero, lo que implica que los en la ecuación 5, donde la velocidad de cuatroverifica puntos que la de parte equilibrio real de son cada hiperbólicos. autovalor crecimiento de la biomasa de la vid no De acuerdo con el Teorema de es alterada por la biomasa del cultivo de Hartman-Grobman (1991) y (1994), cobertura de acuerdo con la ecuación el espacio de fase local alrededor de 5.1. Según la ecuación 5.2, la tasa de cada punto de equilibrio hiperbólico es crecimiento de la biomasa del cultivo de topológicamente equivalente al espacio de cobertura sí es alterada por la presencia de fase de su linealización. Por lo tanto, el tipo la biomasa de la vid. El segundo término de de estabilidad de cada uno de los cuatro la ecuación 5.2 involucra una alfa-función puntos de equilibrio es capturado por el que describe la dinámica cambiante en la proceso de linealización. interacción biológica.

Parámetro Valor Intervalo de confianza Tabla 2: Valores estimados de r 0,7055 [0,68654;0,72536] los parámetros e intervalos de 1

K1 24,638 [24,629;24,648] (ecuación 5, pág 38). r2 0,2408 [0,2339;0,2477] confianza respectivos para el modelo Table 2: Estimated parameter values and K2 9,8 [7,3589;12,2411] 3,42 [2,6006;4,2394] b2 (equation 5, page 38). c 5,1 [0,1079;10,092] respective confidence intervals for model 2

J (0;0)= 0,7055 0  J (0;9,8)= 0,7055 0      0 0,2408 0 - 0,2408 J (24,638;0)=  - 0,7055 0  J (24,638;5,641)= -0,7055 0      0 0,1386 -0,0271 - 0,139 (7*)

40 Revista de la Facultad de Ciencias Agrarias Vitis vinifera

Influencia de la vid ( L.) sobre cultivos de cobertura: un modelo biomatemático La condición de estabilidad para cada Si se llama Tr a la traza de la matriz y punto de equilibrio establece que la parte Det a su determinante, se cumple que: * * real de cada autovalor de J (N 1, N 2) debe Tr [ J (24, 638; 5, 641)] < 0 y Det [J (24, 638; ser negativa, y las matrices J (0;0), J (0;9,8) 5, 641)] > 0 y además: Tr2 [ J (24, 638; 5, y J (24, 638; 0), no cumplen esa condición. 641)] - 4 Det [J (24, 638; 5, 641)] > 0, lo que Se puede asegurar entonces que estos tres puntos constituyen combinaciones (24,638;5,641) como un nodo estable (18). inestables de valores de biomasas y permite clasificar al punto de equilibrio corresponden a situaciones donde no el plano de la biomasa de vid (N1) vs. la del El diagrama de fase (figura 1) muestra coexisten las especies: o se extinguen ambas cultivo de cobertura (N2). Cada punto en el (0; 0), o una de ellas (0; 9, 8) y (24, 638; 0). plano de fase es un estado del sistema y se

Respecto del cuarto punto de equi- representa por un par ordenado (N1,N2). librio (24,638;5,641), la matriz J (24, 638; Cada trayectoria en el plano de fase 5, 641) sí respeta la condición de equi- indica un conjunto posible de sucesivos librio y por lo tanto, corresponde a una combinación estable de valores de vid y emplea el software pplane (13). cultivos de cobertura consociados. estados. Para la confección del gráfico se

En negro se representa los cuatro puntos de equilibrio. En azul se observan algunas trayectorias. En rojo y amarillo se visualizan las isoclinas correspondientes a las dos componentes del sistema. The four equilibrium points are represented in black. It can be seen in blue colour some trajectory paths. In red and yellow colours correspond to nullclines of the two components system.

Figura 1. Plano de fase cultivo de cobertura (N2) vs. vid (N1) del sistema (ecuación 6, pág. 39). Figure 1. Green cover vs. vine phase plane of system (equation 6, page 39).

Tomo 50 • N° 1 • 2018 41 C. R. Bageta et al.

Los valores del punto de equilibrio el verdeo solo, esto resulta del análisis (24,63; 5,64) representan las capacidades estadístico. de carga de cada componente del sistema. Por otro lado, se observa que la capacidad de soporte del verdeo en presencia de la vid es menor que la misma capacidad Esto se puede observar en la figura 2a. de soporte para el verdeo solo. Esto parece crecimientoA modo de comparación,de los cultivos enno consociados la figura 2b contradictorio, pero podría explicarse (estasse representa son las elcurvas gráfico de de crecimiento las curvas de por una relación cambiante entre ambas cada componente por separado). componentes; en un primer momento la vid facilita al verdeo y luego lo perjudica. Este cambio se produce a partir del valor umbral En la figura 2, comparando ambas de crecimiento del verdeo en presencia de de biomasa de vid b2 lagráficas vid es se mayor observa que que, la por misma un lado, tasa la para tasa =3,42 que es una raíz de la alfa-función (figura 3, pág. 43).

En (a) se muestran las curvas correspondientes a las soluciones del sistema [6]: rojo para la vid y azul para el cultivoLas mediciones de cobertura. realizadas En (b) en se el muestran campo (número mediciones de toques) de vid (rojo)se grafican y cultivos con: de(•)vid cobertura y (*) cultivos (azul) sinde cobertura.consociar.

of system [6] solutions: red for vine and blue for green cover. (b) shows data measures of non consociated The data (number of touches) components:are displayed vine with (red) (•) vine and and green (*) cover green (blue). cover. (a) shows the growing curves Figura 2. Curvas de crecimiento de los componentes del sistema vs. tiempo (en días): consociadas (a) y sin consociar (b). Figure 2. Growth curves of the system components vs. time (days): consociated (a) and non consociated (b).

42 Revista de la Facultad de Ciencias Agrarias Vitis vinifera

Influencia de la vid ( L.) sobre cultivos de cobertura: un modelo biomatemático 2 2 (171/50 N1-N1 ) / (1+51/10 N1 ) 0.8

0.6

0.4

0.2

-0.2

0 1 2 3 4 5 6 7 8 9 10 Nº de toques consociado (N1)

Figura 3. Alfa-función. Se observa cambio de signo en el valor de vid b2 Figure 3. Alfa-function. Change of sign is observed at the vid value b 2 = 3,42. = 3.42. Conclusiones

En concordancia con las hipótesis signo de la alfa-función (de positivo que plantean la existencia de interacción a negativo) que se produce para el valor biológica entre la vid y el cultivo de umbral de biomasa de vid b2 cobertura y que esta interacción cambia El análisis de estabilidad registra a partir de un valor umbral de biomasa que hay un único punto de=3,42. equilibrio, de la vid, los resultados del análisis (24,638;5,641), en el cual las especies estadístico permiten concluir que durante coexisten. El análisis de estabilidad el período de estudio la presencia del determina que este es un punto de equi- cultivo de cobertura no afectaría la tasa de crecimiento de la vid, sugiriendo una El hecho de que la capacidad de posible indiferencia de esta respecto del cargalibrio establede la vid (figura se haya1, pág. mantenido 41). sin cultivo de cobertura. cambios durante el ensayo, es equiva- La tasa de crecimiento del cultivo de lente a asegurar que la vid es indiferente cobertura es mayor en presencia de la vid, a la presencia del cultivo de cobertura. lo que indicaría un posible efecto facilitador Esto sugiere que el cultivo de cobertura de la vid sobre el cultivo de cobertura en no produce mermas en la producción de una primera etapa (tabla 1, pág. 39). biomasa de la vid. En el estudio del sistema dinámico Si bien, mucho se ha estudiado del se observa un cambio en la interacción efecto que las pasturas producen sobre biológica de comensalismo a amen- la vid, y viceversa, no se han encontrado salismo, evidenciado por el cambio de trabajos que presenten conclusiones de

Tomo 50 • N° 1 • 2018 43 C. R. Bageta et al. los efectos que sufren ambas al estar más estudios que permitan expandir consociadas, y es ahí donde cobra amplia el marco de datos de las componentes importancia el presente trabajo. Para consideradas abarcando otras variedades que esta modelación se convierta en una de vid y coberturas vegetales. herramienta eficiente es preciso realizar Bibliografía

1. Addicott, J. F. 1981. Stability properties of 2-species models of mutualism: simulation studies. Oecologia. 49: 42-49. 2. Gillman, M.; Hails, R. 1997. An introduction to ecological modelling: putting practice into theory.

3. Goodall, D. W. 1952. Some considerations in the use of point quadrats for the analysis of Oxford:vegetation. Blackwell Aust. J. Scientific Sci. Re., Ser. Publications. B. 5: 1-41. 4. Hernández, M. J. 1998. Dynamics of transitions between population interactions: a nonlinear interaction

5. Hernández, M. J.; Barradas, I. 2003. Variation in the outcome of population interactions: alpha-functionbifurcations and defined. catastrophes. Proc. R. Soc. J. Math. Lond. Biol. Londres. 46: 571-594. 265(1404): 1433-1440. 6. Jonasson, S. 1988. Evaluation of the point intercept method for the estimation of plant biomass. Oikos 52. 101-106. 7. Lotka, A. J. 1910. Contribution to the Theory of Periodic Reaction. J. Phys. Chem. 14(3): 271-274. 8. May, R. M. 1981. Segunda Edición. Models for two interacting populations. In Theoretical ecology: principles and applications. Ed. R.M. May. Oxford: Blackwell Science. 78-104. 9. Miller, P. R.; Williams, W. L.; Madson, B. A. 1996. Covercrops for California Agriculture. División de Agricultura y Recursos Naturales. Folleto 21510. 10. Miriti, M. N. 2006. Ontogenetic shift from facilitation to competition in a desert shrub. J Ecol 94:973-979. doi: 10.1111/j.1365-2745.2006.01138.x. 11. Olmstead, M. 2012. Cover crops for arid areas. Universidad de Florida. 12. Perko, L. 1991. Differential Equations and Dynamical Systems. Springer-Verlag. Chapter 2. 13. Polking J.; Arnold, D. 2002. Software pplane.jar - Department of Mathematics, Rice University, Houston, TX. Disponible en: 14. R Core Team. 2015. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna,http://math.rice.edu/~dfield/index.html. Austria. Disponible en: http://www.R-project.org/. 15. Secretaría de Agricultura, Ganadería, Desarrollo Rural Pesca y Alimentación (SAGARPA). Disponible en:

16. Soetaert, K.; Petzoldt, T.;http://www.sagarpa.gob.mx/desarrolloRural/Documents/fichasCOUSSA/ Setzer, W. 2010. Solving Differential Equations in R. Package de Solve Cultivos%20de%20cobertera.pdfJournal of Statistical Software. 33(9): 1-25. Disponible en: http://www.jstatsoft.org/ v33/i09/. 17. Stata Corp. 2000. Stata Statistical Software: Release 6. College Station, TX: Stata Corp L P. 18. Strogatz, S. H. 1994. Nonlinear Dynamics and Chaos. Perseus Books L. L. C. Chapters 5 and 6. 19. Uliarte, E. M.; Schultz, H. R.; Frings, C.; Pfster, M.; Parera, C.; del Monte, R. 2013. Seasonal

dynamics of CO2 balance and water consumption of C3 and C4-type cover crops compared to bare soil in a suitability study for their use in vineyards in Germany and Argentina. Agricultural and Forest Meteorology. 181: 1-16. 20. Uliarte, E. M. 2013. Especies herbáceas nativas: aportes para su cultivo como coberturas vegetales en viñedos bajo riego en Mendoza: estudios de intercambio gaseoso,

doctoral. Disponible en: https://rdu.unc.edu.ar/handle/11086/1651. eficiencia hídrica y potencial alelopático de lixiviados. Repositorio digital UNC. Tesis

44 Revista de la Facultad de Ciencias Agrarias Vitis vinifera

Influencia de la vid ( L.) sobre cultivos de cobertura: un modelo biomatemático en el uso del agua de cultivos de cobertura con especies nativas (Mendoza, Argentina), 21. Uliarte, exóticasE. M.; Parera, cultivadas C.; Alessandria, y malezas. E.;AgriScientia. Dalmasso, 31(2):A. 2014. 49-61. Intercambio gaseoso y eficiencia

Mem. Acad. Lincei Roma. 2: 31-113. 22.23. Wolin,Volterra, C. V.L.; 1925. Lawlor, Variazioni L. 1984. e fluttuazioniR. Models of del facultative numero d’individui mutualism: in densityspecieanimaliconviventi, effects. Am. Nat. 124: 843-862.

Tomo 50 • N° 1 • 2018 45 EvaluaciónRev. FCA UNCUY de MiscanthusO. 2018. 50(1): en 47-60.Chile ISSN impreso 0370-4661. ISSN (en línea) 1853-8665.

Evaluación de crecimiento, rendimiento y calorimetría de biomasa de Miscanthus x giganteus (Poaceae) establecido en el centro-sur de Chile

Evaluation of growth, yield and calorific value of Miscanthus x giganteus (Poaceae) biomass established in south central of Chile

Fernando Muñoz 1, Jorge Cancino 1, Roque Rodríguez 2, Rodrigo Olave 3

Originales: Recepción: 06/05/2016 - Aceptación: 18/10/2016

Resumen

Se establecieron cultivos experimentales de Miscanthus x giganteus en tres sitios contrastantes del centro-sur de Chile para evaluar su crecimiento y potencial energético. Al segundo año de crecimiento el cultivo presentó grandes diferencias entre sitios, altura (52,1 a 158,2 cm), rendimiento en biomasa (1,1 a 9,0 Mg ha-1), contenido de cenizas (3,8 -1). La composición química de la biomasa indicó celulosa en un 36%, hemicelulosa con 22,3% y lignina con 26,9%. El análisis elementala 9,6%) y poder indicó calorífico 41,9% de (16,64 C y 6,6% a 18,14 de H. MJ Miscanthus kg x giganteus presenta condiciones para su utilización en la generación de energía en Chile.

Palabras clave

biomasa • dendroenergía • cultivos dendroenergéticos • energía renovable

1 Universidad de Concepción. Facultad de Ciencias Forestales. Victoria 631. Concepción. Chile. [email protected] 2 Universidad de Santiago de Compostela. Escuela Técnica Superior de Lugo. España. 3 Agri-Food & Biosciences Institute. Northern Ireland. United Kingdom.

Tomo 50 • N° 1 • 2018 47 F. Muñoz, J. Cancino, R. Rodríguez, R. Olave

Abstract

Experimental crops of Miscanthus x giganteus were planted in three contrasting sites in Chile's south central to evaluate its growth and energy potential. In the second year of growth, the crop exhibited large differences among sites regarding height (52.1 to 158.2 cm), biomass yield (1.1 to 9.0 Mg ha-1 -1). The chemical composition of the biomass indicated cellulose 36%, hemicellulose 22.3% and lignin), ash 26.9%. content Elemental (3.8 to analysis9.6%) and indicated calorific C andvalue H (16.64content toof 18.1441.9% MJand kg 6.6% respectively. Therefore, Miscanthus x giganteus offers suitable attributes to be used for energy generation in Chile.

Keywords

biomass • wood energy • crops for wood energy • renewable energy Introducción

La generación de energía eléctrica en Chile desde fuentes renovables produce más etanol que el producido corresponde solo al 11,4% de la capacidad porde fertilizantes. cultivos de En maíz una mismay pasto superficie varilla eléctrica total (7). Una alternativa para (switchgrass) (Panicum virgatum L.) (15) incrementar la producción de energía y además, Miscanthus presenta una razón renovable es utilizar biomasa a partir energética (salida de energía/entrada de de cultivos dendroenergéticos, creando energía) mayor (47,3) que otros cultivos también, oportunidades para reducir el como maíz utilizado en la producción de abandono paulatino de cultivos tradicio- biocombustibles (5,5) (12). nales, mejorar el uso de terrenos subuti- El género Miscanthus pertenece a la familia Poaceae con alrededor de 14 abandonadas (33). especies (30), la mayoría originarias del lizadosEntre y las ocupar especies superficies posibles de forestales utilizar este de Asia. para producir biomasa se encuentra Miscanthus x giganteus es un híbrido Miscanthus x giganteus J. M. Greef & estéril (triploide) producto del cruza- miento entre M. sinensis (diploide) y ampliamente cultivada en Europa como M. sacchariflorus (tetraploide) (1, 16), que fuenteDeuter deex Hodk.bioenergía & Renvoize, por más la cualde 30 ha años sido se cree ocurrió en forma natural debido (30) en diferentes condiciones de sitio (1). a que en su hábitat ocurre con frecuencia Miscantus x giganteus es una gramínea hibridación entre especies de Miscanthus perenne que posee características (21). Esta planta es de interés para los adecuadas para producir biomasa para productores, ya que puede ser utilizada energía, ya que, entre otras, almacena como fuente de biocombustible o celulosa carbono en el suelo, no es invasiva debido a que es un híbrido que no produce (19) y para su uso en biorremediación (38). semillas viables (1, 5) y su propagación es (34),El tambiénrendimiento como de fijadora biomasa de nitrógenodepende de varios factores, incluyendo el genotipo en el uso del agua y bajo requerimiento y nutrición (20), edad de corta (2, 8) y solo vegetativa (23), tiene alta eficiencia

48 Revista de la Facultad de Ciencias Agrarias Evaluación de Miscanthus en Chile condiciones de sitio (24, 28). Un gran introducir y establecer cultivos experi- número de genotipos del género han sido mentales de Miscanthus x giganteus en tres estudiados y Miscanthus x giganteus tiene sitios del centro-sur de Chile, para evaluar gran potencial de producción de biomasa su crecimiento, rendimiento en biomasa, comparado con otros genotipos y además, características energéticas y composición no es invasivo (5). química durante sus dos primeros años de Miscanthus ha demostrado ser excep- desarrollo. cionalmente productivo en ensayos en el La necesidad de conocer la variación del centro-oeste de Estados Unidos, incluso crecimiento de la especie según diferente mejor que la especie perenne tolerante al frío C4 "pasto varilla" o "switchgrass" (Panicum virgatum) (15). Al ser una hipótesis:condición climática,la respuesta edáfica de crecimiento y material planta C4, se caracteriza por una alta ygenético, calidad llevade biomasa a definir para laenergía siguiente de absorción de CO2 y bajo consumo de agua clones de Miscanthus x giganteus presenta (26), crece rápidamente y produce altos interacción genotipo-ambiente. Para ello, rendimientos anuales de biomasa (23). el estudio comprende evaluar el comporta- En Irlanda, el rendimiento de la especie miento de la especie en sitios contrastantes al primer año de establecimiento es de (zonas agroclimáticas diferentes) ubicados 1-2 Mg ha-1, al segundo año entre 4-10 Mg ha-1 en el valle central y sector costero de la y al tercer año entre 10-13 Mg ha-1 o más (6). zona centro-sur de Chile. Miscanthus es un cultivo lignocelulósico que ha sido ampliamente investigado como posible materia prima para papel, energía, Metodología materiales de construcción, geotextiles y sustratos en viveros e invernaderos (23), Descripción del área de estudio e incluso en la producción de combustible El estudio se realizó en tres sitios del - centro-sur de Chile, i.e. El Vergel, La Isla y cación de la biomasa de Miscanthus ha sido Trehualemu. El sitio El Vergel (36°50'30" S reconocidalíquido (5). como Del mismo una fuente modo, de la azúcares sacarifi y 72°54'26" O) se ubica en la comuna de mixtos de bajo costo, con uso potencial Concepción, Región del Biobío. Pertenece para la fermentación a etanol, combustible a la zona agroclimática del secano costero o productos químicos (38). Sin embargo, su (10), de clima templado cálido con estación principal uso es la producción de energía, seca de 4 a 5 meses, entre noviembre y siendo considerado una excelente especie marzo. Posee una temperatura promedio anual de 12,2°C con máximas y mínimas en el período estival de 22,8°C y 8,9°C e depara Miscanthus estos fines (13). -1, invernal 12,9°C y 5,1°C (10). El poder calorífico superior-1 (5), anhidro con La precipitación media anual es de 2,7% de contenidoes alrededor de cenizas; de 17 haMJ sidokg 1196 mm y la evapotranspiración potencial utilizadopudiendo en alcanzar co-combustión 20 MJ kgcon carbón y de 660 mm (10). El suelo, con una pendiente en calderas de producción de vapor (38). general de 30%, corresponde a la serie En Chile no hay experiencia en la Treguaco (TG); son suelos profundos del producción de biomasa de Miscanthus tipo Inceptisol, formados a partir de rocas para uso en la generación de energía. La presente investigación tiene por objetivo metamórficas, de textura franco arcillo limosa en todo el perfil.

Tomo 50 • N° 1 • 2018 49 F. Muñoz, J. Cancino, R. Rodríguez, R. Olave

El sitio La Isla (36°44'12" S y importados desde la Universidad de 72°26'49" O) se ubica en la comuna de Catania, Italia y de la Universidad Quillón, Región del Biobío. Pertenece a de Santiago de Compostela, España la zona agroclimática del valle central, (clon "Hornum", Hornum, Dinamarca). de clima mediterráneo templado cálido El establecimiento de los ensayos con estación seca de 4 a 5 meses, consistió en la delimitación del área de entre noviembre y marzo. Posee una estudio, preparación del suelo y siembra temperatura promedio anual de 13,5°C de los rizomas de Miscanthus x giganteus, con máxima y mínima en el período estival en adelante Miscanthus. de 28,0°C y 10,9°C e invernal 12,3°C y La delimitación del área de estudio, 3,7°C, respectivamente (10). i.e. instalación de cerco perimetral con La precipitación media anual es de malla cuadrada galvanizada, se realizó con 1055 mm y evapotranspiración potencial de 846 mm (10). El suelo, de pendiente general domésticos que pudieran causar daños a entre 0% y 3%, corresponde a la serie lasel finplantas. de impedir el ingreso de animales Llahuecuy (LHY); son suelos profundos, La preparación del suelo, incluyó bien drenados del tipo Entisol (29). subsolado mecanizado hasta los 80 cm de El sitio Trehualemu (35°58'29" S y profundidad, con 2 m de distancia entre 72°45'8" O) está ubicado en la comuna líneas de subsolado, y control químico de de Pelluhue, Región del Maule. El sitio malezas con herbicida sin efecto residual. pertenece a la zona agroclimática del En cada sitio del ensayo, en octubre secano costero, de clima templado cálido de 2011, se sembraron los rizomas de con estación seca de 4 a 6 meses, entre Miscanthus en áreas de tamaño 20 x octubre y marzo. Posee una temperatura 20 cm y 10 cm de profundidad ubicadas promedio anual de 14,1°C con máximas y en la línea de subsolado. Al área rectan- mínimas en el período estival de 24,4°C y gular correspondiente a cada rizoma en 12,0°C e invernal 14,6°C y 6,0°C, respec- adelante se le menciona como "casilla". tivamente (10). Antes de depositar el rizoma en la casilla, La precipitación media anual es de se incorporó al suelo 2 g de hidrocaptu- 898 mm y la evapotranspiración potencial rador y 1 litro de agua. de 720 mm, con vientos predominantes en Luego de sembrar el rizoma se cubrió la época de otoño e invierno de dirección con una capa de suelo de 5 a 8 cm. Después de la plantación y hasta abril de 2012, se general entre 5% y 8%, corresponde a efectuó riego semanal de 1 litro de agua laNE seriedel Pacífico Cobquecura (10). El suelo,(CBC); de son pendiente suelos por planta. Un mes después de la siembra profundos, sedimentarios, de textura se realizó una aplicación de fertilizantes franco arcillo limosa, que pertenecen al (8) compuesta por una mezcla de fosfato tipo Inceptisol (29). diamónico (100 g), sulfato doble de potasio y magnesio (Sulpomag®, 50 g) y Material vegetal y establecimiento boronatrocalcita (25 g), la cual se aplicó El material vegetal utilizado fueron en una pequeña zanja de 10-15 cm de rizomas de Miscanthus x giganteus profundidad a una distancia de 30-40 cm (clon "Picoplant", Oldenburg, Alemania) de la planta.

50 Revista de la Facultad de Ciencias Agrarias Evaluación de Miscanthus en Chile

Diseño experimental y parcelas El registro de las variables se realizó en el de medición mes de abril de cada período: año 2011-2012 En cada sitio, el ensayo consistió (primera rotación) y año 2012-2013 en un diseño experimental de bloques (segunda rotación). Esta actividad, al igual completos al azar con arreglo factorial, que los resultados que se presentan, solo con cada factor, i.e. genotipo y densidad de corresponde al clon "Picoplant", debido a siembra, en dos niveles y tres repeticiones. que la siembra del clon "Hornum" no generó Se evaluó la densidad de siembra de prácticamente ninguna planta. 20.000 y 40.000 brotes ha-1 y el efecto de La determinación de la biomasa dos clones de Miscanthus, i.e. "Picoplant" y consistió en un muestreo destructivo de “Hornum”; en lo que sigue de este artículo, las plantas de Miscanthus esos niveles son denominados D1 y D2 rotación. En cada una de las unidades para el factor densidad, y M1 y M2 para el experimentales se seleccionó al final de cincocada factor genotipo, respectivamente. casillas como muestra de biomasa para la La unidad experimental consistió en determinación de peso verde y posterior una parcela cuadrada de 25 m2 (5 x 5 m). transporte al laboratorio para su secado Ambas densidades de siembra D1 y en estufa (105°C) hasta peso constante. D2 presentaron 24 rizomas (para igual El resto de las plantas fueron cortadas número de casillas) por parcela, con un y pesadas para obtener el peso verde en espaciamiento de 0,625 m sobre la línea terreno. La determinación de la biomasa de siembra y 1,667 m entre cada línea. total por unidad experimental se realizó utilizando la razón de peso seco/peso fresco visualmente los rizomas de acuerdo con la [1] y peso verde de la parcela [2] (14). cantidadPrevio de ayemas la siembra que poseían. se clasificaron Para lograr n la densidad D1 se utilizaron rizomas con [1] ∑  Wsi una cantidad de yemas por rizoma menor i 1 γsv  n a 4, en tanto que para la densidad D2 se ∑  Wvi utilizaron aquellos rizomas cuya cantidad i 1 de yemas era mayor o igual a 4. donde: Las parcelas de medición se ubicaron = la razón de peso seco/peso fresco por en el centro de cada parcela y fueron unidad experimental ϒ�� delimitadas por un área de borde equiva- W i= peso seco de la i-ésima muestra lente a una línea de siembra de rizomas a = peso fresco de la i-ésima muestra W �i cada lado de la parcela. Así, las parcelas de = el tamaño de la muestra seleccionada n � medición en ambas densidades D1 y D2 para la determinación de la razón peso fueron de 6,25 m2, i.e. conteniendo cada seco/peso fresco por unidad experimental. una 6 rizomas. Ws  γsv *∑ wv [2] Mediciones y determinaciones realizadas donde: = peso seco estimado en la unidad Para evaluar el crecimiento se midió Ws la altura total (con huincha de medir) y experimental en g = peso fresco de la unidad experi- se contabilizó la cantidad de brotes por wv rizoma en cada unidad experimental. mental obtenido en terreno en g γsv= Razón de peso seco/peso fresco de la muestra por unidad experimental.

Tomo 50 • N° 1 • 2018 51 F. Muñoz, J. Cancino, R. Rodríguez, R. Olave

Contenido de cenizas, calorimetría, Posteriormente se realizó análisis de análisis elemental y composición varianza para determinar el efecto del química sitio, del bloque jerarquizado al sitio, de la Se tomaron tres muestras de biomasa densidad de siembra y su interacción. de cada densidad de cultivo en cada sitio de ensayo de 100 g cada una, las cuales correspondía, se realizó mediante la se secaron en estufa (105°C) hasta peso La clasificación de medias, cuando constante y luego se trituraron en un molino estadístico de la composición química de hasta un tamaño al menos de 0,2 mm. laprueba biomasa de Tukey debido (35). al reducidoNo se realizó número análisis de Para la determinación del contenido muestras. En el proceso de datos se utilizó de cenizas tres submuestras de 1 g fueron el programa estadístico SPSS 15.0. seleccionadas, las cuales fueron sometidas a 550°C en horno hasta su calcinación. Resultados superior (PCS) se utilizó tres submuestras dePara 1 g la estabilizadas determinación al aire, del ypoder luego calorífico combus- Crecimiento tionadas con exceso de oxígeno en una La cantidad de brotes incrementa con bomba calorimétrica, modelo PARR 6400. el transcurso del tiempo. En ningún año Los análisis se efectuaron de acuerdo con de cultivo hubo interacción entre sitio las normas españolas de biocombustibles y densidad (tabla 1, pág. 53). Indepen- sólidos (36, 37). dientemente de la densidad, Trehualemu El análisis elemental y determinación es el sitio con menor cantidad de brotes de la composición química se realizó sobre (tabla 2, pág. 53). una mezcla homogénea de la biomasa El sitio El Vergel presentó la cantidad de las densidades por cada sitio. De esta más alta de brotes, seguido de La Isla y mezcla se obtuvo dos submuestras de luego Trehualemu. En el segundo año de 1 g, para determinar el contenido total de - carbono (C), hidrógeno (H) y azufre (S), en cativas entre la cantidad de brotes de los un analizador elemental FISONS, modelo diferentescultivo no sitios se detectó (tabla 2, diferencias pág. 53). signifi EA 1108, siguiendo la norma indicada en El incremento en altura varió con la el manual del equipo. edad del cultivo. En el primer año de cultivo, La composición química (celulosa, no hubo interacción entre sitio y densidad hemicelulosa, lignina, grupo acetilo) se realizó de acuerdo con la norma Tappi (p<0,0034) (tabla 1, pág. 53). y soloEl Vergel se detectó es el efecto sitio de significativo mayor incremento de sitio alta resolución (HPLC). Las muestras en altura; los otros dos sitios tienen incre- utilizadas222 om 98correspondieron y cromatografía a la líquida cosecha de (realizada en abril) de la segunda rotación En el segundo año de cultivo, se observó (año 2012-2013). mentos que no difieren significativamente. (p<0,0001); en El Vergel, el mayor incre- Análisis estadístico mentointeracción en altura significativa se observó entre sitioen la y densidad Todas las variables medidas durante más alta de cultivo (D2), al contrario de lo los dos primeros años fueron sometidas a que se observó en La Isla; en Trehualemu no pruebas para determinar su normalidad y homogeneidad de varianzas. densidades (tabla 2, pág. 53). se observaron diferencias significativas entre

52 Revista de la Facultad de Ciencias Agrarias Evaluación de Miscanthus en Chile , año 2 0,0250 0,5732 0,0398 0,3015 8,70 Ba 9,60 Aa 16,64 Aa 17,06 Aa 1,133 Ab 2,042 Ab 64,29 Ab 66,75 Ab Miscanthus x giganteus Miscanthus - - - - 189,259 Aa 268,765 Aa Trehualemu año 1 Poder calorífico superior calorífico Poder (1) La Isla 5,40 Bb 7,40 Ab Año 2 17,12 Aa 18,14 Aa 2,040 Ab 52,08 Bb 2,469 Ab 85,77 Aab 373,334 Aa 449,482 Aa año 2 0,1299 <0,0001 <0,0001 <0,0001 - - - - año 1 Contenido cenizas Contenido 3,80 Bc 4,64 Ac 6,560 Aa 17,65 Aa 9,014 Aa 17,83 Aa El Vergel 110,70 Ba 158,19 Aa 316,444 Aa 541,926 Aa -1 -1 año 2 0,6715 0,0403 0,2793 <0,0001 -1 - - - - 0,051 Bc 63,57 Aa 0,031 Bb 69,84 Ab Biomasa 24,615 Ab 37,995 Ab Trehualemu año 1 0,0321 0,0015 0,0035 <0,0001 Altura, cm Altura, Biomasa, Mg ha (1) - - - - Contenido de cenizas, % de cenizas, Contenido Cantidad de brotes, N° ha Cantidad de brotes, La Isla Año 1 0,122 Ba 58,75 Aa 0,136 Bb 60,29 Ab año 2 89,131 Aa 0,0001 0,0570 0,5350 0,0034 100,599 Aa Poder calorífico superior, MJ kg superior, calorífico Poder Altura letters indicate significant differences (α = 0.05). significant differences indicate letters - - - - año 1 0,0034 0,6089 0,1130 0,2797 al primer y segundo período de crecimiento (año 1: 2011-2012 y año 2: 2012-2013). al primer y segundo período de crecimiento

0,204 Ba 0,369 Aa 88,13 Aa El Vergel 115,74 Aa 110,310 Aa 130,134 Aa año 2 0,0397 0,2155 0,0540 0,4703 dentro de cada densidad; letras diferentes señalan diferencias significativas (α = 0,05). significativas señalan diferencias diferentes de cada densidad; letras dentro , clon Picoplant, al primer y segundo período de crecimiento (año 1: 2011-2012 y año 2: 2012-2013). , clon Picoplant, al primer y segundo período de crecimiento 20000 40000 40000 20000 20000 20000 40000 40000 20000 40000 , Picoplant clone, at first and second growth period (year 1: 2011-2012 and year 2: 2012-2013). period (year 1: 2011-2012 and year , Picoplant clone, at first and second growth , clon Picoplant, Sitio año 1 Cantidad de brotes Cantidad de brotes 0,5926 0,0299 0,8003 <0,0001 Valores medios del número de brotes, altura, biomasa, contenido de cenizas y poder calorífico biomasa, contenido altura, de brotes, medios del número Valores Período de crecimiento Período Picoplant clone, at first and second growth period (year 1: 2011-2012 and year 2: 2012-2013). period (year 1: 2011-2012 and year Picoplant clone, at first and second growth Densidad Densidad Densidad Densidad Densidad Significance of main factors in variables number of shoots, height, biomass, ash content and calorific value of and calorific value number of shoots, height, biomass, ash content in variables Significance of main factors Tabla 2. Tabla Average values for the number of shoots, height, biomass, ash content and calorific value of and calorific value the number of shoots, height, biomass, ash content for values Average Factores Significancia de factores principales en las variables número de brotes, altura, biomasa, contenido de cenizas y poder calorífico biomasa, contenido altura, de brotes, número principales en las variables Significancia de factores Miscanthus x giganteus Miscanthus Sitio Bloque (Sitio) Densidad Sitio x Densidad Table 1. Table de Miscanthus x giganteus Miscanthus (1) Letras mayúsculas para comparar verticalmente entre densidades dentro de cada sitio; letras minúsculas para comparar horizontalmente entre sitios entre horizontalmente comparar minúsculas para de cada sitio; letras densidades dentro entre verticalmente comparar para mayúsculas (1) Letras Table 2. Table (1) Capital letter to vertically compare between densities within each site; small letters to horizontall compare between sites within each density; different within each density; different sites between horizontall compare to small letters densities within each site; between compare vertically to (1) Capital letter x giganteus Miscanthus Tabla 1. Tabla

Tomo 50 • N° 1 • 2018 53 F. Muñoz, J. Cancino, R. Rodríguez, R. Olave

En la densidad D1, el incremento en altura en El Vergel es igual al de La Isla, - pero superior al de Trehualemu; en la tivasEn entre cuanto El Vergelal Poder y Trehualemu, Calorífico Superior siendo densidad D2, el incremento en altura en El este(PCS) último solo se sitio detectó el de diferencias menor PCS; significa no se Vergel es superior al de los otros dos sitios detectó efecto de la densidad ni interacción (tabla 2, pág. 53). de esta con el sitio (tabla 1, pág. 53).

Biomasa Composición química y análisis El rendimiento en biomasa varió con la elemental edad del cultivo (tabla 1, pág. 51). Para los tres sitios, la composición En el primer año de cultivo, se química de la biomasa indica que celulosa observó interacción entre sitio y densidad representa la mayor participación de la (p<0,0001); en la densidad D1 no se materia seca, seguido de lignina y hemicelulosa (tabla 3, pág. 55). biomasa entre sitios; en la densidad La biomasa producida en el sitio El D2,observó el rendimiento diferencias en biomasa significativas de todos en Vergel presenta la mayor proporción de celulosa y el sitio Trehualemu la mayor cantidad de biomasa se observó mayor proporción de lignina. El análisis enlos El sitios Vergel, difiere seguido significativamente; de La Isla y luego la elemental de la biomasa señala que la Trehualemu (tabla 2, pág. 53). mayor proporción corresponde a C (tabla En el segundo año de cultivo, no hubo 3, pág. 55). Los valores de C e H son interacción entre sitio y densidad y solo similares entre sitios.

(p<0,0001) (tabla 1, pág. 53). Independiente- mentese detectó de la densidad efecto significativode establecimiento, de sitio El Discusión Vergel es el sitio de mayor incremento en biomasa; los otros dos sitios tienen incre- Crecimiento Existe diferencia de crecimiento (tabla 2, pág. 53). (cantidad de brotes y altura) entre sitios. mentos que no difieren significativamente El sitio El Vergel alcanza el mejor creci- Cenizas y poder calorífico superior miento del cultivo y el menor en el sitio La cantidad de cenizas es afectada Trehualemu (tabla 2, pág. 53). Ambos por la interacción entre sitio y densidad sitios se localizan en la cordillera de la (tabla 1, pág. 53). costa y son del tipo Inceptisol (29), aunque En general, a mayor densidad del de diferente precipitación media anual, cultivo mayor es la cantidad de cenizas; 1196 mm y 898 mm, respectivamente. la magnitud de la diferencia varió entre Se conoce que las características sitios; la mayor diferencia entre densi- del sitio afectan la productividad del dades se detectó en La Isla. cultivo de Miscanthus, especialmente la - disponibilidad de agua en la obtención de vamente en la cantidad de cenizas; la rendimientos satisfactorios (28). biomasaTodos de los Trehualemu sitios difieren es la que significati genera la mayor cantidad de cenizas, seguido de la Isla y luego El Vergel (tabla 2, pág. 53).

54 Revista de la Facultad de Ciencias Agrarias Evaluación de Miscanthus en Chile

Tabla 3. Composición química y análisis elemental de la biomasa de Miscanthus x giganteus. Table 3. Chemical composition and elemental analysis of Miscanthus x giganteus biomass.

Celulosa HC Lignina Grupo acetilo Otros C H N S (2) Sitio (1) % peso seco % peso seco El Vergel 38,1 24,2 26,7 2,4 8,6 41,7 6,9 N.D. < 2 La Isla 33,8 22,8 26,9 2,0 14,5 42,9 6,6 N.D. < 2 Trehualemu 36,0 19,9 27,3 2,6 14,2 41,1 6,4 N.D < 2 Promedio 36,0 22,3 26,9 2,3 12,5 41,9 6,6 N.D.

(1) Mezcla de biomasa de las densidades 20.000 y 40.000 brotes ha-1, (2) resultado no detectable, se informa límite de la detección. HC: Hemicelulosa, C: Carbono, H: Hidrógeno, N: Nitrógeno, S: Azufre. N.D.: No disponible. (1) Biomass mix of densities 20,000 and 40,000 shoots ha-1, (2) not detectable result, it’s reported the detection limit. HC: Hemicellulose, C: Carbon, H: Hydrogen, N: Nitrogen, S: Sulfur. N.D.: Not available.

Similar tendencia se aprecia en esta ocurre una clara diferencia es en los sitios investigación, donde el sitio Trehualemu, de menor calidad, como La Isla, donde la de menor precipitación, presenta prácti- altura es de 85,77 cm para D1 y 52,08 cm camente la mitad del número de brotes y para D2 (tabla 2, pág. 53), es decir una altura que el sitio El Vergel; 189.259 brotes diferencia de 65%. Esto indica que en sitios y 66,75 cm, 316.444 brotes y 110,7 cm, de menor calidad no es posible establecer respectivamente (tabla 2, pág. 53). altas densidades iniciales sin afectar el La cantidad de brotes se encuentra en crecimiento en altura del cultivo, variable línea con lo reportado por la literatura. que es indicadora del rendimiento del Para la densidad de plantación 20.000 cultivo (18). brotes ha-1 el número de brotes que También hay que considerar la sobre- alcanza el cultivo en este estudio vivencia y desarrollo inicial de los brotes. (316.444 brotes ha-1, tabla 2, pág. 53) Al relacionar la cantidad de brotes luego es similar al reportado (9), en cambio, del primer año del cultivo y la densidad la altura del cultivo en este estudio es menor a lo señalado por los mismos entre 1,0 brote y 5,5 brotes por cada brote autores, aunque esto podría cambiar en establecidoinicial establecida, en el sitio se tieneTrehualemu que fluctúa y El los próximos años debido a que el creci- Vergel, respectivamente (tabla 2, pág. 53). miento anual del cultivo se incrementa Es decir, en sitios de buena calidad la hasta alcanzar su óptimo alrededor de 7 a sobrevivencia y su posterior desarrollo 10 años luego de establecido, para luego fue mejor. Estudios reportados (17, 27) declinar y permanecer relativamente indican que la sobrevivencia es variada constante (2, 9, 20). - También podría cambiar debido a que diendo de las condiciones del sitio. La las diferencias iniciales tienden a disminuir guíay fluctúa de mejores entre prácticas el 50 y para 95%, cultivo depen de con el desarrollo del cultivo. Cultivos de Miscanthus en Irlanda sugiere establecer Miscanthus establecidos en Austria de 16.000 rizomas ha-1 para esperar una densidades iniciales entre 10.000 y 30.000 emergencia de 10.000 plantas ha-1 (6), brotes ha-1 alcanzaron similar altura al cabo es decir, se asume una sobrevivencia de tres años de establecidos (9). Donde de 62,5%.

Tomo 50 • N° 1 • 2018 55 F. Muñoz, J. Cancino, R. Rodríguez, R. Olave

en el rendimiento en las primeras dos Rendimiento inicial en biomasa etapas del cultivo. Estudios con densi- La mayor producción ocurre en el sitio El dades iniciales de 10.000, 20.000 y Vergel, en sus dos densidades (D1 y D2), con 30.000 brotes ha-1 determinaron que el - producción alcanzada en los otros sitios. cante en el rendimiento luego de cuatro diferenciasEl mayor significativas rendimiento con para respecto el primer de la añosefecto de de crecimiento la densidad (9). inicial De acuerdo es insignifi con período de crecimiento es de 0,369 Mg ha-1 esto, es razonable sugerir una densidad y para el segundo de 9,014 Mg ha-1 (tabla inicial de 10.000 brotes ha-1 (1 planta m-2) 2, pág. 53) (biomasa cosechada al término evitando costos excesivos en el estableci- del primer mes de otoño). miento. Esta densidad también ha sido Los resultados indican que las carac- utilizada para estudiar rendimiento de terísticas del sitio afectaron el desarrollo Miscanthus en el medio oeste de EE.UU. del cultivo, situación también observada (2), y se sugiere para cultivos en Illinois en ensayos establecidos en la costa central (EE.UU.) (27) y en Irlanda (6). de Italia, donde se obtuvo rendimiento en biomasa entre 5 y 29 Mg ha-1 (28) y en Contenido de cenizas ensayos en Alemania con variación entre El contenido de cenizas varía entre 0,5 y 13,7 Mg ha-1 (32). También afecta sitios y densidades de establecimiento el rendimiento la edad del cultivo, tal (tabla 2, pág. 53). En este estudio, el como lo señalan estudios desarrollados contenido de cenizas es más alto a mayor en Dinamarca, donde se determinó que densidad de establecimiento y menor el rendimiento promedio para un período productividad del sitio. de 20 años fue de 13,1 Mg ha-1 con incre- El contenido de cenizas puede variar mento durante los primeros años hasta de acuerdo con la época de cosecha (3, alcanzar el óptimo entre los 7 a 8 años, 24), partición de la biomasa del cultivo para luego decrecer y permanecer relati- (25) y su genotipo (5). Según la partición vamente contante (20). de biomasa (hoja o caña del cultivo), Similar situación en EEUU donde el el contenido de cenizas en las hojas promedio de rendimiento de biomasa en (alrededor del 6%) puede ser hasta tres diferentes localidades durante 8 a 10 años veces más que lo obtenido en las cañas (3). fue de 23,4 Mg ha-1, variando entre los El contenido de cenizas obtenido con diferentes sitios entre 14,7 y 31,1 Mg ha-1 material cosechado en los sitios La Isla y (2). También la época de cosecha del Trehualemu, es mayor a los reportados por cultivo afecta el rendimiento en biomasa. varios autores (3, 25, 38). En cambio, el Las cosechas realizadas en otoño contenido de cenizas obtenido en El Vergel presentan mayor rendimiento que las se encuentra dentro de los rangos (3). realizadas en invierno (24), con disminución En los tres sitios ensayados se utilizó de hasta 40% al atrasar la cosecha de otoño material del segundo año de crecimiento, a invierno (28). De acuerdo con esto, es cosechado a mediados de abril (primer de esperar que el cultivo logre mayores mes de otoño) cuando la actividad foliar rendimientos cuando alcance su óptimo de aún no ha cesado, probablemente con una crecimiento alrededor de los 7 a 8 años (20). proporción mayor de hojas y por lo tanto, En general, la densidad inicial de de mayor contenido de cenizas. establecimiento del cultivo no influyó

56 Revista de la Facultad de Ciencias Agrarias Evaluación de Miscanthus en Chile

Calorimetría a mayores contenidos de celulosa, El PCS varió según sitio y densidad hemicelulosa y lignina, para la mayoría de de establecimiento. Diversos estudios especies de Miscanthus (5).

-1 -1 Análisis elemental indican que el PCS fluctúa -1 entre (38). 18 y La concentración de C e H en la biomasa 20 MJEn kgel presente(4, 31), entre estudio 18,2 yel 18,7 PCS MJ varió kg seca de Miscanthus indica que la mayor (19) y entre 16,7 y 17,3 MJ-1 kg, es decir, los proporción corresponde a C (41,9%) mayores valores obtenidos se ubican (tabla 3, pág. 55). El valor de concen- enentre el 16,6rango y inferior 18,1 MJ de kg los reportados tración de C se encuentra por debajo de (4, 25, 31). Tal como se mencionó, era de los valores reportados que indican valores esperar que en sitios de buena calidad de C entre 47,1 a 49,7% (5, 22). (caso de El Vergel) la biomasa obtenida La diferencia de valor puede deberse presentara mayor proporción de caña que a diferencias de época de cosecha y hojas y por lo tanto, mayores valores de partición de la biomasa aérea del cultivo. La estimación reportada se realizó con que las hojas, debido a la mayor cantidad dePCS. carbono La caña que tiene posee mayor su biomasa poder calorífico (4). (febrero en Hemisferio Norte), en cambio labiomasa cosecha cosechada de la biomasa a fines utilizada del invierno en el Composición química presente estudio fue realizada a inicios En el estudio actual y para los tres del otoño (abril en Hemisferio Sur). sitios, celulosa representa la mayor Diferencia de pocos meses en la época participación con promedio de 36% de de cosecha, entre diciembre y febrero en la materia seca, seguido de lignina con el Hemisferio Norte, cambió la partici- 26,9% y hemicelulosa con 22,3% (tabla 3, pación de las hojas desde 20,8% a 14,8%, pág. 55). Los valores de celulosa, hemice- respectivamente (22), llegando a pérdidas lulosa y lignina del presente estudio se de biomasa total que puede alcanzar el encuentran entre los rangos reportados 35,5% (23). Atrasar la cosecha genera (5, 11, 38). cambios en la partición de la biomasa, lo La biomasa producida en el sitio de que implica, aumento proporcional de la buena calidad (El Vergel) presenta la caña en el total cosechado, con ello, mayor mayor proporción de celulosa (38,1%) proporción de carbono (4). y la producida en el sitio de baja calidad (Trehualemu) mayor proporción de lignina (27,3%). Conclusiones La relación entre composición química de la biomasa y la calidad de sitio se El establecimiento de cultivos explica porque la composición varía según dendroenergéticos de Miscanthus x la partición de la biomasa, siendo celulosa giganteus en tres sitios contrastantes y lignina mayor en cañas y hemicelulosa del centro-sur de Chile indica que la mayor en hojas (39). - Aunque la composición también puede tivas de crecimiento. En sectores costeros, variar de acuerdo con la época de cosecha. deespecie suelos presenta de textura variaciones franco-arcillosa- significa Así, la cosecha en febrero (invierno en el limosa con buena capacidad de retención Hemisferio Norte) generalmente conduce de humedad, se obtienen los mejores

Tomo 50 • N° 1 • 2018 57 F. Muñoz, J. Cancino, R. Rodríguez, R. Olave crecimientos y estos se encuentran en y en energía) para su utilización en la línea con lo reportado por la literatura. generación energética. Sin embargo, la De igual manera, los parámetros calori- relación entre crecimiento del cultivo, métricos y características químicas de la calidad de biomasa y condiciones de biomasa son similares a otros estudios. sitio para el desarrollo de la especie Los resultados obtenidos sugieren en Chile deben ser evaluadas por un que Miscanthus x giganteus presenta período más extenso, hasta que alcance su condiciones (rendimiento en biomasa máximo crecimiento.

Bibliografía

1. Anderson E.; Arundale, R.; Maughan, M.; Oladeinde, A.; Wycislo, A.; Voigt, T. 2011. Growth and agronomy of Miscanthus x giganteus for biomass production. Biofuels. 2(1): 71-87. 2. Arundale R.; Dohleman, F.; Heaton, E.; McGrath, J.; Voigt, T.; Long, S. 2014. Yields of Miscanthus x giganteus and Panicum virgatum decline with stand age in the Midwestern USA. GCB Bioenergy. (6): 1-13. 3. Baxter X.; Darvell, L.; Jones, J.; Barraclough, T.; Yates, N.; Shield, I. 2012. Study of Miscanthus x giganteus ash composition-Variation with agronomy and assessment method. Fuel (95): 50-62. 4. Baxter X.; Darvell, L.; Jones, J.; Barraclough, T.; Yates, N.; Shield, I. 2014. Miscanthus combustion properties and variations with Miscanthus agronomy. Fuel. (117): 851-869. Miscanthus: a fast-growing crop for

5.6. BrosseCaslin N.;B.; Dufour,Finnan, A.; J.; Meng,Easson, X.; L.Sun, (Eds.). Q.; Ragauskas, 2010. Miscanthus A. 2012. best practice guidelines. Teagasc biofuels and chemicals production. Biofuels, Bioproducts and Biorefining. (6): 580-598. Northern Ireland (UK). 50 p. 7. CIFES 2015.(Ireland) Reportes and Cifes: Afbi Energías (Agri-Food renovables and Bioscience en el mercado Institute, eléctrico Northern chileno. Ireland), Centro IrelandNacional - para la Innovación y Fomento de las Energías Sustentables (CIFES), Ministerio de Energía, Gobierno de Chile. 7 p. 8. Christian D.; Riche, A. B.; Yates, N. E. 2008. Growth, yield and mineral content of Miscanthus × giganteus grown as a biofuel for 14 successive harvests. Industrial Crops and Products. (28): 320-327. 9. Clifton-Brown J.; Long, S.; Jorgensen, U. 2001. Miscanthus productivity. In: Jones M.B, Walsh M. (Eds.) Miscanthus 10. Del Pozo, A.; Del Canto, P. 1999. Áreas agroclimáticas y sistemas productivos en la VII y VIII regiones. Institutofor de energyInvestigaciones and fibre. Agropecuarias, Earthscan, London, Centro UK. Regional p: 46-67. de Investigación Quilamapu, Chillán. Ministerio de Agricultura, Chile. 115 p. 11. de Vrije T.; de Haas, G.; Tan, G.; Keijsers, E.; Claassen, P. 2002. Pretreatment of Miscanthus for

(27): 1381-1390. 12. Felten, hydrogenD.; Fröba, production N.; Fries, by J.; Thermotoga Emmerling, elfii. C. 2013.International Energy Journal balances of Hydrogenand greenhouse Energy. gas-mitigation potentials of bioenergy cropping systems (Miscanthus, rapeseed, and maize) based on farming conditions in Western Germany. Renewable Energy. (55): 160-174. 13. Feng X.; He, Y.; Fang, J.; Fang, Z.; Jiang, B.; Brancourt-Hulmel, M.; Zheng, B.; Jiang, D. 2015. Comparison of the growth and biomass production of Miscanthus sinensis, Miscanthus floridulus and Saccharum arundinaceum. Spanish Journal of Agricultural Research Vol. 13(3). 14. González, O. 2014. Evaluación de crecimiento y rendimiento en biomasa de Miscanthus x giganteus en sus primeros años de desarrollo. Memoria para optar al título de Ingeniero Forestal. Facultad de Ciencias Forestales, Universidad de Concepción, Chile. 44 p.

58 Revista de la Facultad de Ciencias Agrarias Evaluación de Miscanthus en Chile

15. Heaton, E.; Dohleman, F.; Long, S. 2008. Meeting US biofuel goals with less land: the potential of Miscanthus. Global Change Biology. (14): 1-15. Miscanthus x giganteus (Poaceae). Kew Bulletin. 56: 759-760. 16.17. Huisman, Hodkinson, S.; T.;Kortleve, Renvoize, W. 1994. S. 2001. Mechanization Nomenclature of crop of establishment, harvest and postharvest conservation of Miscanthus sinensis Giganteus. Industrial Crops and Products. (2): 289-297.

quality development comparison between miscanthus and switchgrass over a period 18. Iqbal, Y.;of Gauder,10 years. M.; Energy. Claupein, (89): W.;268-276. Graeff-Hönninger, S.; Lewandowski, I. 2015. Yield and Miscanthus x giganteus. GCB Bioenergy. (6): 577-586. 19. Keymer, D.; Kent, A. 2014. Contribution of nitrogen fixation to first year Miscanthus yields

20. Larsen, BioEnergyS. U.; Jørgensen, Research. U.; 7(2): Kjeldsen, 620-635. J. B.; Laerke, P. E. 2013. Long-term influenced by location, genotype, row distance, fertilization and harvest season. as energy crops in the US and Europe. Biomass and Bioenergy. (25): 335-361. 21. Lewandowski, I. 2003. The development and current status of perennial rhizomatous grasses experiments to modify the biomass quality of Miscanthus x giganteus. European 22. Lewandowski,Journal I.;of Kicherer,Agronomy. A. (6): 1997. 163-77. Combustion quality of biomass: practical relevance and Miscanthus: European experience with a novel energy crop. Biomass and Bioenergy. (19): 209-227. 23. Lewandowski, I.; Clifton-Brown, J.; Scurlock, J.; Huisman, W. 2000. M.; Riche, A.; Schwarz, K.; Tayebi, K.; Teixeira, F. 2003. Environment and harvest 24. Lewandowski,time affects I.; Clifton-Brown, the combustion J.; Andersson, qualities B.;of Basch,Miscanthus G.; Christian, genotypes. D.; Jorgensen,Agronomy U.; Journal. Jones, (95):1274-1280. 25. Meehan, P.; Finnan, J.; McDonnell, K. 2013. The effect of harvest date and harvest method on the combustion characteristics of Miscanthus x giganteus. GCB Bioenergy. (5): 487-496. Miscanthus x giganteus. Callus induction and plant regeneration. Acta Biologica Cracoviensia Series Botanica. 52 (1): 105-110. 26.27. Płażek,Pyter, R.;A.; Dubert,Heaton, F. E.; 2010. Dohleman, Improvement F.; Voigt, of medium T.; Long, for S. 2009. Agronomic experiences with Miscanthus x giganteus in Illinois, USA. In: Biofuels: Methods and protocols. Mielenz JR (Ed.). Human Press. NY. USA. p. 41-52.

crop management on the productivity of Miscanthus (Miscanthus x giganteus Greef et 28. Roncucci,Deu.) N.; Nassiin the oMediterranean. Di Nasso, N.; Bonari, GCB Bioenergy. E.; Ragaglini, (7): 998-1008.G. 2015. Influence of soil texture and 29. Santis, G. 2005. Mapa de reconocimiento de suelos de la región de Biobío (Sector Norte). Memoria de Título. Facultad de Ciencias Agronómicas, Universidad de Chile. Santiago, Chile. 178 p. Miscanthus. In: Jones M., Walsh M. (Eds.). Miscanthus 30.31. Scally,Schwarz, L.; Hodkinson,H. 1993. Miscanthus T.; Jones, M.sinensis 2007. ‘giganteus’ Origins and production taxonomy onof several sites in Austria. Biomass and Bioenergy. 5(6):for 413-419. energy and fibre. Earthscan. London. UK. p. 1-9. 32. Schwarz, K.; Murphy, D.; Schnug, E. 1994. Studies of the growth and yield of Miscanthus x giganteus in Germany. Aspects of Applied Biology. (40): 533-540. 33. Sixto, H.; Hernández, M.; Barrio, M.; Carrasco, J.; Cañellas, I. 2007. Plantaciones del género Populus Nacional de Investigación y Tecnología Agraria y Alimentación (INIA). Investigación Agraria: Sistemas para la produccióny Recursos Forestales. de biomasa 16(3): con 277-294. fines energéticos: revisión. Instituto 34. Smith, J. 2009. Antecedentes Miscanthus. Documento Técnico N° Doc IIR-BC-INF-12-09. Instituto Nacional de Tecnología Agropecuaria (INTA). Argentina. 6 p. 35. Steel, R.; Torrie, J. 1988. Bioestadística: Principios y procedimientos. México DF. México. McGraw-Hill/Interamericana. 622 p. 36. UNE-EN 14775. 2010. Norma Española Biocombustibles Sólidos. Método para la determinación

(AENOR). Madrid. España. 10 p. del contenido de cenizas. Asociación Española de Normalización y Certificación

Tomo 50 • N° 1 • 2018 59 F. Muñoz, J. Cancino, R. Rodríguez, R. Olave

37. UNE-EN 14918. 2011. Norma Española Biocombustibles Sólidos. Determinación del poder

España. 60 p. 38. Visser, P.;calorífico. Pignatelli, Asociación V. 2001. Utilisation Española of deMiscanthus Normalización. In: Jones y CertificaciónM.B. Walsh M. (AENOR). (Eds.) Miscanthus Madrid.

39. Wahid, R.; Frydendal Nielsen, S.; Moset Hernández, V.; James Ward, H.; Gislum, R.; Jorgensen, U.; forBjarne energy Moller, and H.fibre. 2015. Earthscan. Methane London. production UK. p. potential 109-154. from Miscanthus sp: Effect of harvesting time, genotypes and plant fractions. Biosystems Engineering. (133): 71-80.

Agradecimientos

(Proyecto FONDEF B09i 1008). El Lostrabajo autores de la agradecen Ingeniera elForestal apoyo delCynthia Fondo Labraña de Fomento y de los al Desarrolloestudiantes Científico de Ingeniería y Tecnológico Forestal de la Universidad de Concepción María Eugenia Hinojosa y Oscar González. La colaboración de los investigadores Dr. Salvatore Cosentino de la Universidad de Catania (Italia), Dr. Manuel Bao y Dr. Juan Luis Fernández de la Universidad de Santiago de Compostela (España), y del Laboratorio de Micropropagación de la Escuela Politécnica Superior de Lugo de la Universidad de Santiago de Compostela.

60 Revista de la Facultad de Ciencias Agrarias EfectosRev. FCA deUNCUYO. la cosecha 2018. y 50(1): conservación 61-71. ISSN sobre impreso la calidad 0370-4661. hortícola ISSN de (en topinambur línea) 1853-8665.

Efecto del momento de cosecha sobre la calidad hortícola de tubérculos de topinambur (Helianthus tuberosus L.) conservados a campo y en cámara frigorífica

Harvest time effect on horticultural quality of topinambur (Helianthus tuberosus L.) kept in the soil or in cold storage

Leandra Ibarguren, Cecilia Rebora, Marcelo Alberto

Originales: Recepción: 01/04/2016 - Aceptación: 12/12/2016

Resumen

Existen muy pocos antecedentes sobre la conservación de tubérculos de topinambur, así como de las variaciones de calidad que sufre el producto. A través de este trabajo se buscó generar información sobre: a) los efectos de la fecha de cosecha y la variedad de topinambur sobre las variables de calidad; b) la respuesta a la evolución en decámara los tubérculos. frigorífica deSe utilizarondistintos tratamientos dos variedades de conservación;de topinambur, y lac) dela incidenciatubérculos de rojos las ycondiciones la de tubérculos (cámara blancos. frigorífica-campo) Las variables y tiempo de calidad de almacenamiento medidas fueron: sobre materia la calidad seca; desarrollo de Penicillium sp. y evolución del peso fresco. Se detectó que para garantizar sólidos solubles; firmeza; índice de color de peridermis y de pulpa; presencia de brotes; todo el año, el período de cosecha no debería extenderse más allá de los 49 días desde la ocurrencia calidad de de los la tubérculos primera helada, y una adecuadapara la zona evolución de estudio en cámara(Luján de frigorífica Cuyo, Mendoza, durante entre variedades. Los datos sugieren que, para consumo en fresco, es posible efectuar laLatitud cosecha 33°00' hasta 30" 98 S; días Longitud posteriores 68°52'32" a la primera O). No se helada, observaron aunque diferencias sobre estos significativas tubérculos del método y tiempo de conservación sobre la calidad de los tubérculos, se observa que losno setubérculos observó unaque correctase conservaron conservación a campo en máscámara allá frigorífica. de la segunda Respecto fecha de de los medición efectos (30 de agosto), pierden rápidamente su calidad comercial.

Palabras clave

poscosecha • almacenamiento • firmeza • sólidos solubles

1 Universidad Nacional de Cuyo. Facultad de Ciencias Agrarias. Almirante Brown 500. M5528AHB. Chacras de Coria. Mendoza. Argentina. [email protected]

Tomo 50 • N° 1 • 2018 61 L. Ibarguren, C. Rebora, M. Alberto

Abstract

There are few papers on Jerusalem artichoke postharvest storage and quality changes. This research aimed to achieve information about: a) the influence of harvest wasdates studied. and varieties Two varieties on tuber ofˈs quality;Jerusalem b) theartichoke evolution were of eachused, treatment red's tubers in cold and storage; white's and c) the conservation periods and places (cold storage-field) effects on tubers quality Penicillium development and fresh weight evolution of tubers were measured. It was foundtubers. that Dry thematter; harvest soluble period, solids; to mantainfirmness; the peridermis tuber quality and pulp and colour;good performance sprouting and in the study area (Luján de Cuyo, Mendoza, Latitude 33°00'30" S; Longitude 68°52'32" W). Differencescold storage betweenduring the varieties year, should were not not extend observed. more thanThe information49 days since suggest the first that,frost for tubers are not kept properly refrigerated. Regarding method and time storage effects on fresh consumption, tubers must be harvested till 98 days after the first frost, but these measurement date (August 30), quickly lose their commercial quality. tubersˈ quality, it is observed again that tubers which are keep in field beyond the second Keywords

postharvest • storage • firmness • soluble solids Introducción

Los tubérculos de topinambur Atributos de calidad en topinambur (Helianthus tuberosus L.) poseen excelentes con destino hortícola aptitudes nutricionales. Entre las ventajas que ofrece su consumo se destaca la y características de un producto que presencia de inulina como hidrato de La calidad se define como los rasgos carbono de reserva, en una proporción requerimientos del consumidor (13). No que oscila entre el 16 y 20% del peso existeninfluyen estándares en su aptitudde valoración para de satisfacer calidad fresco (5, 7, 11). La digestión de la inulina este trabajo, se utilizaron los establecidos niveles de glucosa en la sangre, y por eso paraen topinambur, papa (Solanum por lotuberosum que, a los L.). fines Así, dese elno topinambur eleva de puede manera ser significativaconsumido por los evaluaron variables tales como: materia personas diabéticas. Adicionalmente, posee actividad prebiótica y disminuye los niveles de los tubérculos, color de la piel y la pulpa, de colesterol y triglicéridos en la sangre. La díasseca, a contenido brotación, de y evolución sólidos solubles, del peso firmeza fresco. harina producida a partir del topinambur no tiene gluten, aspecto que hace a este Alternativas de conservación posco- producto apto para celíacos (2, 6, 10). secha (conservación a campo y en Existen numerosas variedades de cámara frigorífica) topinambur difundidas en el mundo, pero Los tubérculos, una vez cosechados, en la Argentina se conocen solo dos, y las mismas se diferencian por el color rojo o continuos que producen la disminución blanco de su peridermis (12). deestán su calidad. sujetos a cambios fisiológicos

62 Revista de la Facultad de Ciencias Agrarias Efectos de la cosecha y conservación sobre la calidad hortícola de topinambur

El almacenamiento en condiciones seca (MS) y azúcares en topinambur óptimas permite prolongar dicho varían según la fecha de cosecha (30, 46 período (3). Las opciones típicas de alma- y 48 semanas desde la plantación) y la cenaje de topinambur son dos: en cámara variedad (ciclo corto, medio y largo). los tubérculos se cosechan luego de la 100 g de peso fresco, no presentando dife- primerafrigorífica helada y a campo. y se almacenan; En el primer mientras caso renciasLa MS entre fluctúa fechas entre de cosecha 19,4 y para 22,8 las g/cada varie- que con la conservación a campo, los dades de ciclo medio y largo, pero sí para la de tubérculos permanecen en el suelo y se ciclo corto que presentó un menor contenido recolectan cuando se los necesita. de MS en la cosecha 1 (30 semanas desde Los ambientes destinados a la posco- plantación) que en las 2 y 3 (46 y 48 semanas secha deben asegurar una reducción en la desde plantación). Esta última variedad es la tasa de respiración al mínimo requerido que presenta el mayor contenido de MS en para mantener los procesos vitales, de todas las fechas de cosecha. manera de extender lo máximo posible Con respecto al contenido de azúcares, la conservación del tubérculo, cuidando en la variedad de ciclo medio se mantienen a la vez que no se produzcan ataques de constante; pero, en las variedades de ciclo microorganismos patógenos. corto y de ciclo largo aumentó el contenido La temperatura y la humedad son los total de azúcares entre la primera y la segunda fecha de cosecha. La primera debe reducirse en forma rápida factores que más influyen en el proceso (3). Objetivos disminuir la respiración y la transpiración, mientrasdespués deque lala cosecha,humedad a es los importante fines de Con estos ensayos se busca: 1) deter- durante el almacenamiento, debido a que minar la calidad de los tubérculos de condiciona aspectos como la turgencia dos variedades de topinambur en cuatro o desecación del tubérculo. Al respecto, fechas de cosecha; 2) evaluar las posibles Kays y Nottingham (2008) publicaron variaciones de calidad de los tubér- topinambur pueden ser almacenados durante su período de conservación; y durantedatos que 6 a afirman 12 meses que a los 0-2°C tubérculos y 90-95% de 3)culos conocer almacenados el efecto en de cámara dos variables: frigorífica a) de humedad relativa ambiente (HRA). del lugar/condiciones y b) tiempo de conservación sobre la calidad de los tubér- López Camelo (2003), quien considera que culos de topinambur. Adicionalmente se elEstos topinambur valores difieren se puede de loalmacenar enunciado 4 pora 5 pretende contribuir con información para meses a una temperatura óptima de alma- la valoración de los estándares de calidad cenamiento entre -0,5 y 0°C y 90 a 95% de del topinambur. HRA. Por su parte, Danilcenko et al. (2008), enuncia que los tubérculos almacenados en Hipótesis

90-95% de HRA, durante un período de 4 Es posible conservar tubérculos de meses,cámara sufrenfrigorífica alteraciones a 2°C de entemperatura muchas de y topinambur durante todo el año, mante- sus características deseables, tales como la niendo su calidad hortícola, combinando distintos tiempos de conservación de los Según ensayos realizados por Bachfirmeza et al.y el (2012) contenido el contenido de inulina. de materia tubérculos a campo y en cámara frigorífica.

Tomo 50 • N° 1 • 2018 63 L. Ibarguren, C. Rebora, M. Alberto

Materiales y métodos Por diferencia de peso se determinó el contenido de materia seca de los tubér- Material experimental culos; b) contenido de sólidos solubles: se Se utilizaron tubérculos de topinambur utilizó un refractómetro de mano (ATAGO, de peridermis roja y de peridermis blanca, Brix 0-32%). Se cortó, con cuchillo, una pequeña porción y se la colocó en un prensa Ciencias Agrarias de la UNCuyo (Latitud ajos (envuelta en muselina) para obtener el 33°00'30"cultivados S en - Longitud la finca 68°52'32" de la Facultad O), sitio de líquido necesario para la determinación. El que también fue utilizado para la conser- jugo a analizar se depositó sobre el prisma, vación a campo. se cerró la tapa y el instrumento se dirigió La conservación se llevó a cabo en hacia la luz. A través de la lectura directa en dos modalidades: a campo y en cámara la escala del refractómetro, se determinó el porcentaje de sólidos solubles. que fueron conservados los tubérculos, El equipo se calibró de tal manera tomadafrigorífica. a 10 La cmtemperatura de profundidad, de suelo y comoa las que indicaba 0% cuando se realizaba promedio de las mediciones realizadas la medición con agua destilada y era a las 9:00, 15:00 y 21:00 h cada día, se perfectamente higienizado (con agua muestran en la tabla 1. destilada y secado con papel absorbente) durante el ensayo una temperatura de tubérculos: se utilizó un penetrómetro con 1°CEn ± 2°C la y cámara HRA de frigorífica 86% ± 6%. se Los mantuvo tubér- entre cada determinación; c) firmeza de hortalizas. Sobre una muestra de material fueron colocados dentro de bolsas de polie- seuna ejerció cuchilla presión de corte conpara el medir penetrómetro, firmeza en tilenoculos almacenadosde 30 micrones en conla cámara perforaciones. frigorífica y por lectura directa sobre el equipo se determinó la resistencia a la penetración Variables evaluadas (en kg o lbs) que presenta el tubérculo. Debido a que no se dispone de estándares La medición es destructiva por lo que el de valoración de calidad para esta especie, se material, luego de utilizado, se descartó; d) utilizaron algunos de los índices establecidos color de la peridermis y pulpa: se determinó para papa (Solanum tuberosum L.). Las con un colorímetro Kodak Minolta CR-400. variables evaluadas fueron; a) materia seca: Con el equipo en mano se disparó un haz de al momento de cada cosecha se llevaron tres luz, sobre el material cuyo color se deseaba muestras (3 repeticiones), de 1 kilogramo determinar, y se leyó en la pantalla digital de cada variedad de topinambur a estufa las coordenadas de color. (65°C), hasta peso constante.

Tabla 1. Temperaturas promedio máximas, medias y mínimas de suelo, a 10 cm de profundidad, tomadas a las 9:00, 15:00 y 21:00 h diarias. Table 1. Maximum, average and minimum soil temperature, 10 cm of depth, at 9:00, 15:00 and 21:00 daily. Período T° media (°C) T° máxima (°C) T° mínima (°C) Desde 24/05 hasta 12/07 7,46 12,3 1,9 Desde 12/07 hasta 30/08 7,97 17,3 2,5 Desde 30/08 hasta 18/10 14,5 22,8 6

64 Revista de la Facultad de Ciencias Agrarias Efectos de la cosecha y conservación sobre la calidad hortícola de topinambur

Estas, se combinaron en la fórmula permitiría recolectar nuevamente material del índice de color (IC) y dichos valores a campo. Cada tratamiento tuvo una fecha fueron sometidos a análisis estadístico; e) de cosecha diferente, cada 49 días, a los presencia de brotes y desarrollo de hongos (Penicillium): se determinó, en forma visual, la presencia de brotes en los tubérculos Unafines vezde comparar cosechados, los tiemposlos tubérculos y los métodos fueron al momento de cosecha y en las distintas lavadosde conservación con agua (foto corriente 1 y figura y1, pág.secados. 66). fechas de medición. Lo mismo se hizo con A continuación se realizó sobre el lote los tubérculos que desarrollaron hongos correspondiente la valoración de las (Penicillium) durante la conservación en variables de respuesta, mientras que otro lote se dispuso en la cámara para ser determinó el porcentaje de ocurrencia; utilizado posteriormente. Para materia f)cámara evolución frigorífica. del peso En fresco: ambos para casos cada se seca se trabajó con 3 repeticiones y para las restantes variables con 20 repeticiones. A tres kilos de cada una de las variedades, en partir de estos tratamientos se evaluó: bolsastratamiento de 1 kilo se colocó (3 repeticiones). en cámara Lasfrigorífica bolsas - Efecto de la fecha de cosecha y la se pesaron, en balanza de precisión, al variedad sobre las variables de calidad: se midieron las variables de calidad al La diferencia de peso indicó cuál fue la momento de la cosecha de cada uno de evolucióninicio y al final del peso del período fresco. de conservación. los tratamientos (24 de mayo, 12 de julio, 30 de agosto y 18 de octubre), para deter- Diseño experimental minar cuál es el tiempo máximo posible Se realizó un diseño factorial 2 x 2 con que se puede demorar la cosecha de los interacción en parcelas completamente al tubérculos, manteniendo estos su calidad azar. Combinó tiempos de conservación como alimento, para las dos variedades de los tubérculos a campo y en cámara de topinambur. - Evolución de los tubérculos conser- tratamientos; T1: los tubérculos fueron conservadosfrigorífica. Sedurante plantearon 341 días cuatro en tratamiento se determinó la variación devados los atributos en cámara de frigorífica:calidad de paralos tubér cada- conservaron 49 días a campo y 292 días cámara frigorífica; T2: los tubérculos se cada 49 días, hasta completar su período material 98 días en el campo y 243 en deculos conservación. almacenados en cámara frigorífica, en cámara frigorífica; T3: conservó el - Incidencia de las condiciones (cámara tubérculos durante 147 días a campo. Este - últimocámara tratamiento frigorífica; yactuó el T4: como conservó testigo, a los ya vación sobre la calidad de los tubérculos: que el brotado de los tubérculos, indicó sefrigorífica-campo) comparó la calidad y tiempo de los detubérculos conser que se había superado el tiempo de conservación de los mismos en el campo. aquellos que permanecieron en el suelo, Todos los tratamientos se iniciaron en paraalmacenados las fechas en de cámara medición frigorífica indicadas con forma simultánea, el 24 de mayo, luego de a continuación: registrarse la primera helada en la zona Fecha de medición 1-12 de julio: comparación de los tubérculos conser- lugar casi un año después, coincidiendo conde cultivo.la subsiguiente La fecha primera de finalización helada, lo tuvocual días y los que estuvieron a campo por igualvados período. en cámara frigorífica durante 49

Tomo 50 • N° 1 • 2018 65 L. Ibarguren, C. Rebora, M. Alberto

Foto 1. Tubérculos brotados durante la conservación a campo. Photo 1. Sprout tubers during tild conservation.

Fecha de medición 2011 2012 24 de mayo 12 de julio 30 de agosto 18 de octubre 6 de diciembre 24 de enero 13 de marzo 1 de mayo

Tratamiento 1

Tratamiento 2

Tratamiento 3

Tratamiento 4

Conservación a campo Conservación en cámara frigorí ica El cambio de coloración indica momento de cosecha

� Figura 1. Tratamientos y fechas de medición (cada 49 días). Figure 1. Treatments and measurement dates (every 49 days).

66 Revista de la Facultad de Ciencias Agrarias Efectos de la cosecha y conservación sobre la calidad hortícola de topinambur

Fecha de medición 2-30 de agosto: (19,1% blanca y 20,3% roja), en ambas varie- contraste de las variables de calidad de las dades. La cosecha del tratamiento 1 presentó siguientes muestras; una conservada 98 y respecto de la cosecha del tratamiento 2, campo, y la tercera 49 días en cada uno de diferencias significativas entre variedades losdías métodos en cámara de conservaciónfrigorífica, otra ensayados. 98 días a el contenido de sólidos solubles entre dichas Fecha de medición 3-18 de octubre: cosechas.observándose Esto coincide un aumento con lo significativo observado por en comparación de la calidad de los tubérculos Bach et al. (2012) en dos de las tres varie- de las siguientes muestras: una conservada dades de topinambur por él ensayadas. Esta 147 días a campo, otra con 96 días a campo respuesta podría atribuirse a que durante ese período continuaban movilizándose almacenada 49 días a campo y 96 en sólidos hacia los tubérculos. y 49 días en cámara frigorífica; la tercera La cosecha del tratamiento 4 fue la conservó los tubérculos durante 147 días que presentó menor porcentaje de sólidos cámara frigorífica, y la última, en la cual se solubles (12,8% blanca y 13,5% roja), resultado que se relaciona con el aumento en cámara frigorífica. de la temperatura del suelo de la parcela Resultados y discusión donde se conservaba el material y un consecuente aumento de la tasa respiratoria. Efectos de la fecha de cosecha y la variedad sobre las variables de calidad Firmeza de los tubérculos La cosecha del tratamiento 2 presentó Materia seca (MS) valores de resistencia a la penetración más Para ambas variedades estudiadas, la MS de los tubérculos disminuye a medida que estar relacionado con el estado en que los se atrasa el momento de la cosecha. El valor tubérculosbajos, es decir alcanzan mayor el firmeza. nivel completo Esto podría de registrado para el tratamiento 4 se dife- las reservas provenientes de la parte aérea de la planta. La cosecha del tratamiento para las cosechas de los otros tratamientos. 4 es la que presentó los valores de resis- rencióEsto significativamente podría deberse de alos que observados en los tencia a la penetración más altos (menor tubérculos conservados en el campo se activa el metabolismo y movilización blanca y 4,69 kg la rojas. Este resultado de las sustancias de reserva, a medida podríafirmeza), deberse siendo: 4,22a la kgmenor para la turgencia variedad que aumenta la temperatura del suelo, resultante de una deshidratación y movi- disminuyendo así la MS. lización de las reservas en los tubérculos. El contenido de MS de los tubérculos varió entre 24,50 y 19,98 g cada 100 g de Índice de color de peridermis peso fresco. En los ensayos realizados por (ICPeridermis) Bach et al. (2012) al igual que aquí, la MS - de los tubérculos disminuye a medida que tivas en el ICPeridermis para ninguna de se retrasa el momento de cosecha. las fechasNo se registraronde cosecha, perodiferencias sí se observaron significa

Sólidos solubles aspecto apreciable también a simple vista. El mayor contenido de sólidos solubles Losdiferencias valores significativas fueron: ICPeridermis entre variedades, Blanca: se obtuvo en la cosecha del tratamiento 2 4,72; ICPeridermis Roja: 15,61.

Tomo 50 • N° 1 • 2018 67 L. Ibarguren, C. Rebora, M. Alberto

Índice de color de pulpa (ICPulpa) diferencia para los días de conservación. - rente para las variedades blanca y roja, observándoseEl ICPulpa para es significativamente esta última un valor dife Desde el ingreso a la cámara frigorífica,- mayor (ICPulpa Blanca -1,27; ICPulpa Roja candohasta el la final deshidratación del tratamiento, de el los contenido tubér- -0,95). Por su parte, las cosechas de los culos.de MS El aumentó tratamiento significativamente, 1 presenta valores indi tratamientos 1 y 4 presentaron diferencias porcentuales de MS iniciales (24,5%) y sugerir cambios en la composición de la 2 (23,1% y 35,2%, respectivamente). pulpa;significativas. aunque Estoscabe resultadosmencionar podríanque no finales (38,5%) superiores al tratamiento eran percibidas visualmente. Sólidos solubles Las variedades presentaron dife- Presencia de brotes Las cosechas de los primeros tres trata- tratamientos. A medida que transcurrió mientos no presentaban brotes, mientras elrencias período significativas de conservación entre en sí enla cámara ambos que la cuarta los presentó en ambas varie- aumentó el contenido de sólidos solubles, dades. Esto indica que prolongar la cosecha probablemente debido a la deshidratación de los tubérculos hasta dicha fecha deteriora de los tubérculos y un aumento consiguiente el producto y lo vuelve no comercializable. de la concentración de sólidos solubles.

Evolución de los tubérculos conser- Firmeza de los tubérculos vados en cámara frigorífica Para el tratamiento 1 se obtuvieron dife- El tratamiento 4 no se llevó a cámara de la segunda fecha de medición (49 días), encontraban brotados, y el tratamiento mientrasrencias significativas que para el entretratamiento variedades, 2, las luego dife- 3frigorífica no tuvo debidouna conservación a que los tubérculos exitosa. Por se rencias se observaron luego de la cuarta tal motivo, solo se presentan y comparan fecha de medición (147 días). Esto indica las variables de respuesta evaluadas para que el tratamiento 2 permite mantener los tratamientos 1 y 2. Kays y Nottingham (2008), así como López Camelo (2009), tiempo. Esto coincide con lo enunciado porla firmeza Danilcenko de los (2008), tubérculos quien durante menciona más tubérculos de topinambur pueden ser que los tubérculos almacenados en cámara almacenadospublicaron datos en cámara que afirman durante que varios los meses manteniendo su calidad, pero no hacen mención a la condición de los tubér- frigorífica, a 2°C y 90-95% de HR, pierden culos al momento de ingresar a la misma. firmezaÍndice luego de color del transcurso de Peridermis de 4 meses. A partir de estos ensayos puede inferirse (ICPeridermis) que los tubérculos cosechados en forma El ICPeridermis es mayor en la variedad temprana, luego de ocurrida la primera roja que en la blanca. Este resultado se helada en la zona en estudio, son los que aprecia, además, a simple vista. En ambos tratamientos la variedad blanca presentó mejorMateria evolucionan seca en la cámara frigorífica. de medición, pero no ocurrió lo mismo Para ambos tratamientos las varie- condiferencias la variedad significativas roja. Esta entre última las fechas tuvo - un aspecto más homogéneo respecto de cativas en cuanto a la MS, pero sí se registró su coloración. dades no presentaron diferencias signifi

68 Revista de la Facultad de Ciencias Agrarias Efectos de la cosecha y conservación sobre la calidad hortícola de topinambur

Índice de color de Pulpa (ICPulpa) Cambios en el ICPulpa de los tubér- (5,22 kg vs 4,29 kg). El índice de color de firmeza en cámara frigorífica que a campo alteraciones del alimento. En los trata- para las variedades blanca (ICPeridermis mientosculos pueden 1 y 2 se indicar detectó modificacionesinteracción entre o 4,92)Peridermis y roja es(ICPeridermis significativamente 16,01). diferente la variedad y los días de conservación, Los métodos de conservación también aunque no con una tendencia clara. entre sí (ICPeridermis 9,05 a campo - Presencia de brotes y/o desarrollo presentaron diferencias significativas de hongos Respecto del índice de color de la pulpa, No se observó presencia de brotes ni lasICPeridermis variedades 11,88 presentaron en cámara frigorífica).diferencias hongos (Penicillium) en el tratamiento 1 hasta los 294 días de almacenaje, mientras de conservación utilizado (ICPulpa que en el tratamiento 2 se constató la blancos:significativas, -1,59; indistintamente ICPulpa Rojos: del -1,04). método En aparición de hongos a partir de los 194 esta fecha de medición, no se observó días; aspecto que se acentuó con el avance presencia de brotes ni desarrollo de del período de conservación. hongos en los tubérculos, para ninguna de las variedades y métodos de conservación. Evolución del peso fresco En ambos tratamientos, las variedades Fecha de medición 2 - 30 de agosto El contenido de sólidos solubles para Sí se observaron diferencias en cuanto a cada variedad no presentó diferencias losno días presentaron de conservación. diferencias significativas. para la blanca, aumentando su contenido Incidencia de las condiciones (cámara consignificativas el transcurso para del la variedadperíodo en roja, la cámara pero sí frigorífica - campo) y tiempo de conser- vación sobre la calidad de los tubérculos métodos de conservación, no se hallaron La fecha de medición 3, realizada el 18 frigorífica. Analizado en función de los de octubre, en la que se que conservó los tubérculos a campo hasta dicho momento, diferencias significativas entre variedades. debió ser descartada debido a que los peroRespecto sí los demétodos la firmeza, de lasconservación. variedades mismos se encontraban brotados. Por este Enno presentaroneste caso, los diferencias tubérculos significativas, con mayor motivo, solo se presentan aquí las fechas de medición 1 y 2. tiempo en el campo. firmezaEl índice son de los color que permanecieronde peridermis varió más Fecha de medición 1 - 12 de julio entre variedades, pero no entre métodos El contenido de sólidos solubles no de conservación. Mientras que el índice de color de pulpa presentó diferencias variedades ni entre métodos de conser- vaciónpresentó (valor diferencias medio significativas 19,76°Brix). entre La de conservación, no observándose ninguna tendencia.significativas En entreesta fecha variedades de medición y métodos no se blanca no presentó diferencias entre observó presencia de brotes ni desarrollo métodosfirmeza dede los conservación; tubérculos en pero la variedad sí la de Penicillium en los tubérculos para roja, en la cual se observó una mayor ninguna de las dos variedades y métodos de conservación.

Tomo 50 • N° 1 • 2018 69 L. Ibarguren, C. Rebora, M. Alberto

Conclusiones

Es posible prolongar la vida posco- El estudio de la evolución de los tubér- secha de tubérculos de topinambur durante todo el año, manteniendo su muestra que aquellos que permanecen calidad hortícola, y combinando distintos aculos campo conservados más allá ende cámarala segunda frigorífica fecha tiempos de conservación de los tubérculos de cosecha (12 de julio) no presentan la calidad adecuada luego de trascurrido el En función de las fechas ensayadas, en período de conservación. La variedad roja laen zonael campo en estudio y en cámara el período frigorífica. de cosecha es más susceptible al brotado y desarrollo se extiende desde la primera helada de hongos (Penicillium) durante la conser- (mediados de mayo) hasta la segunda fecha de cosecha (49 días después). Respecto de los efectos del método y La disminución de calidad se hace más tiempovación en de la conservación cámara frigorífica. sobre la calidad notoria a medida que transcurre el tiempo de los tubérculos, se aprecia nuevamente de permanencia en el campo. Esto se debe que los tubérculos que se conservaron al aumento de la temperatura ambiental a campo, luego de la segunda fecha de y del suelo, y al aumento de la tasa medición (30 de agosto), pierden rápida- respiratoria. Los datos sugieren que, para mente su calidad comercial. Cabe destacar consumo en fresco, es posible efectuar que el período adecuado de conservación la cosecha hasta 98 días posteriores a a campo posiblemente pueda extenderse la primera helada, aunque sobre estos más allá del 30 de agosto, pero siempre tubérculos no se observó una correcta antes del 18 de octubre. Ensayos con una periodicidad de medición menor a 49 días podrían contribuir a ajustar dicha fecha. conservación en cámara frigorífica.

Bibliografía

1. Bach, V.; Kidmose, U.; Kjeldsen Bjorn, G.; Edelenbos, M. 2012. Effects of harvest time and variety on sensory quality and chemical composition of Jerusalem artichoke (Helianthus tuberosus) tubers. Food Chemistry 133: 82-89. 2. Carvalho, S.; Toledo, I.; Araújo, F.; Pereira G. 2004. Fructanos en raíces tuberosas de yacón (Smallanthus Sonchifolius-Poep. & Endl.) expuestas al sol y almacenadas bajo condiciones ambientales. Agro-Ciencia. 20(1): 17-23. 3. Chiesa, A. 2010. Factores precosecha y postcosecha que inciden en la calidad de la lechuga. Horticultura Argentina. 29(68): 28-32. 4. Danilcenko, H.; Jariene, E.; Aleknaviciene, P.; Gajewski, M. 2008. Quality of Jerusalem artichoke (Helianthus tuberosus L.) tubers in relation to storage conditions. Not. Bot. Hort. Agrobot. Cluj. 36(2): 23-27. Disponible en www.notulaebotanicae.ro (octubre 2013). 5. Duke, J. 1983. Helianthus tuberosus L. Handbook of energy crops. En: http://www.hort.purdue. edu/newcrop/duke.energy/Helianthus_tuberosus.html (consultado junio 2012). 6. Eguia, E. 2014. Topinambur, una especie con grandes cualidades como alimento funcional. Universidad Fasta. Argentina. Disponible en: http://redi.ufasta.edu.ar:8080/xmlui/bitstream/ handle/123456789/678/2014_N_009.pdf?sequence=1 (consultado enero 2015).

manejo. Horticultura Argentina. 32(77): 35-41. 7.8. Ibarguren,Kays, S.; Nottingham, L.; Rebora, C. S.2013. 2008. El cultivoBiology de and Topinambur: Chemistry generalidades of Jerusalem sobre Artichoke su ecofisiología Helianthus y tuberosus L. Ed. CRC Press. p. 269-344 / 383-400.

70 Revista de la Facultad de Ciencias Agrarias Efectos de la cosecha y conservación sobre la calidad hortícola de topinambur

9. López Camelo, A. 2003. Manual para la preparación y venta de frutas y hortalizas. Boletín de servicios agrícolas de la FAO N° 151. 49-80 / 95-115. 10. Moshfegh, A.; Friday, J.; Goldman, J.; Chug Ahuja, K. 1999. Presence of inulin and oligofructosa in the diets of americans. The Journal of Nutrition, American Society for Nutrition. 129: 1407-1411. 11. Ragab, M.; Okasha, A.; Eloksh, I.; Ibrahim, M. 2003. Effect of cultivar and location on yield, tuber quality, and storability of Jerusalem artichoke (Helianthus tuberosus L.) I. Growth, yield, and tuber characteristics. Acta Horticulturae. 620: 103-111. 12. Rebora, C. 2008. Topinambur (Helianthus tuberosus L.): usos, cultivos y potencialidad en la región de Cuyo. Horticultura Argentina. 27(63): 30-37. 13. Vignoni, L. 2004. Evaluación sensorial. Material didáctico para alumnos de posgrado. Diaeta Buenos Aires. 29(137): 7-13.

Tomo 50 • N° 1 • 2018 71 Physiological and production responses of olive under RDI Rev. FCA UNCUYO. 2018. 50(1): 73-83. ISSN impreso 0370-4661. ISSN (en línea) 1853-8665. Physiological and production responses of olive (Olea europaea L.) cv. Frantoio under regulated deficit irrigation on a semiarid mediterranean weather condition (Cholqui, Maipo Valley, Chile)

Respuestas fisiológicas y productivas en olivo (Olea europaea L.) cv. Frantoio bajo riego deficitario controlado en condiciones de un clima mediterráneo semiárido (Cholqui, Valle del Maipo, Chile)

Cristián Kremer, Luis Reyes, Thomas Fichet, Víctor García de Cortázar, Julio Haberland

Originales: Recepción: 03/05/2016 - Aceptación: 11/04/2017 Nota científica

Abstract

The objective of the present study was to determine the Regulated Deficit Irrigation (RDI) effect on the cv. Frantoio olive tree, under semiarid mediterranean weather condtions (8 months dry period). The trial was established in the “El Oliveto” farm c c (33°48' S, 71°05' W) Cholqui, Melipilla, Metropolitan Region, Chile, and considered c c c five irrigation treatments: 100% of crop evapotranspiration (ET ) (T1), 85% ET conducted,(T2), 75% ETwhich (T3), included 70% ETphysiological (T4), and parameters 65% ET (T5) (midday applied stem between water potential, February (endocarp lignification) to May (harvest) of 2011. Periodic plant measurements were irrigationphotosynthesis water, and the stomatalwater potential, conductance) the stomatal and production conductance indices and (meanthe photosynthesis fruit weight, maturity index and total production). The results obtained indicate that to a less c are decreased when compared to the 100% ET . As others have quoted, it was also noticedKeywords that the less irrigation water had no effect on yield and fruit oil content.

olive oil • water stress • stem water potential

Universidad de Chile. Facultad de Ciencias Agronómicas. Casilla 1004. Santiago. Chile. [email protected] Tomo 50 • N° 1 • 2018 73 Cristián Kremer et al.

Resumen

El objetivo del presente estudio fue determinar el efecto del riego deficitario controlado (RDC) en el olivo cv. Frantoio, bajo condiciones de un clima mediterráneo semiárido (8 meses secos). El ensayo se estableció en el fundo "El Oliveto" (33°48' S 71°05' O) localidad de Cholqui, comuna de Melipilla, Región Metropolitana, Chile y consistió en 5 c c c c c tratamientos de reposición hídrica equivalentes a: 100% evapotranspiración de cultivo- (ET ) (T1), 85% ET (T2), 75% ET (T3), 70% ET (T4), y 65% ET (T5) aplicados entre febrero (lignificacion del endocarpo) y mayo (cosecha) de 2011. Se realizaron medi ciones periódicas a la planta, las que abarcaron variables fisiológicas (potencial hídrico xilemático, fotosíntesis y conductancia estomática) y de producción (peso promedio- de fruto, índice de madurez y producción total). Los resultados obtenidos indican que c a menor restitución hídrica, el potencial hídrico, la conductancia estomática y la foto síntesis se ven disminuidos comparados con el 100% de ET . Tal como señalaron otros autores, se observó que la menor reposición hídrica no afectó ni la producción, ni el contenidoPalabras de claveaceite en el fruto.

aceite de oliva • estrés hídrico • potencial xilemático

Introduction

The greater demand for olive oil at a world level has led to an increase in planted in oil yield has been described in studies Instead, more reduction in fruit than competitionareas (13) and has has headed generated to the a development competition where different deficit irrigation strategies offor different the available irrigation water strategies resources. based This on were used (3, 9, 10, 13). In these studies, nonthe oil reduction yield of deficitin fruit irrigated load, fresh trees and ranged dry is usually compatible with commercial from 75 to 86%. Other studies described deficit irrigation, where reduction in yield strategies with a seasonal water reduction - fruit weight and fruit value under RDI tivesgoals; exists, while particularlywater saving regarding is substantial whether (3). A wide array of deficit irrigation alterna causingof 16 to 25stomata % during to partially June and close July and, (5). Oneas a - of the possible harmful effects from RDI is the application is constant (CDI), partial considerable(partial root-zone amount drying, of information PRI) or reguvali- consequence, reducing theet photosynthetical lated to specific periods (RDI). There is a Sellesrate due et toal a lower water availability. In this example, Gucci et al regard, studies by Alegre . (1999) and dating the use of these strategies (14). For . (2006) in olives trees subject . (2007) demostred that theto RDI, control shown group, significantly which was lower irrigated stomatal in fruit and oil yield from olives cv. Leccino conductances (gs) when compared to irrigated with a 50% of their water needs during the irrigation period (2.5 months) function of water demand. were 19% lower than those fully irrigated.

74 Revista de la Facultad de Ciencias Agrarias Physiological and production responses of olive under RDI

Regarding the water status of with the aim of determining preliminary olive trees under stress conditions, Grattan et al effects of RDI on physiological variables, c, did not have .any (2006) major found difference out that on water their production and oil content. replenishment treatment over a 71% ET - Materials and Methods xylematicLower replenishment water potential, percentages which fluc led The experiment was carried out totuated reductions from -0.2 of xylematic MPa to -1 water MPa. potential, - between February and May 2011 season c reaching values of et -4 al MPa for replenish in a commercial “Frantoio” olive orchard ments between 15 and 25% ET . On the at the “El Oliveto” farm (33º48’ latitude- other hand, Alegre . (1999) found no south, 71º05’ longitude west, altitude significant differences in xylematic water 205 m a. s. l.), Cholqui, Melipilla, Metro c to the temperate mesothermal steno- carriedpotential out between by Grattan the control, et al 75 and 50% politan Region, Chile. The climate belongs alsoET treatments. noticed that According for water toreplenishment the research Temperatures range between an . (2006), it was thermic semiarid mediterranean type. c, the weight of fresh values below 70% ET average maximum of 28.7ºC in January higherfruits was oil negatively percentage affected. in fruits, which averageand an average rainfall minimumis 330 mm, of with3.4ºC a inwater July Nevertheless, this also brought a characterize the thermal regime. Annual Regarding the effects on the ripeness of fruits,was favorable olives under in terms water of stress oil production. conditions deficit of 1,030 mm and an 8 month dry showed higher values on the ripeness period. During 2010 the annual rainfall index, which was related to a faster fruit was 290 mm concentrated between May- and November, being the last precipitation eventDrip on Novemberirrigated 2. Notwelve effective year precipi old ripening (2). tation events occurred until June 2011. Despite this significant amount of information about the benefits of deficit oriented“Frantoio” and olive the trees spacing of similar was 6x4 vigor m with and regardingirrigation strategiesthe impact and of suchin particular handling RDI on afruit total load area were of selected.1080 m2 The rows were N-S for olive trees, several questions arise considered 4 L h-1 droppers with one line factors as soil, weather, and age of plants of droppers per row, each. Irrigation being 1 m design apart canproductive be dramatically farms in South different America, from where the -1 soil was a deep well drained alluvial soil, The latter is a major concern, specially (discharge equivalent to 0.66 mm h ). The-3 inoriginal Chile, conditionsan emerging of thesecountry research. in olive oil production, because research validating with a sandy clay loam texture (1.5 Mg m external results is scarce or not focused on rootsaverage up bulk to density).100 cm depth, with the the effects of these practices in oil production highestThe profilepercentage showed being thin concentrated and middle for irrigation is not limited in the area of cm3 cm-3, (15) or focused in periods where water between 20 and 70 cm. Soil water holding proposed for different levels of regulated capacity (SWHC) was 0.13 study (1). For these reasons, a field test was allowing an equivalent depth of water of 6.5 cm, considering the active root zone water replenishment in “Frantoio” olives, (20 to 70 cm). Tomo 50 • N° 1 • 2018 75 Cristián Kremer et al.

Treatments were selected per plant in an average position on each tree, always maintaining established as a percentage restitution Five irrigation treatments (T) were c - the light exposure angles.2 of the crop evapotranspiration (ET ), Each leaf was inserted into the assimi with a CO2 (T1)100%, (T2)85%, (T3)75%, (T4)70%, Thelation duration chamber of (2.5 the cm measurement area) fed with varied air and (T5)65%, which were monitored concentration of 282 ± 20 ppm.- from the endocarp lignification stage c was estimated using the ments were carried out between 12:30 and (February 2, 2011) until the harvest (May 14:30between local 40 time, and in 60 days seconds. with clear Measure skies: 6, 2011). ET baseline evapotranspiration (ETo) based Xylematic water potential was measured on the Penman-Monteith method and a February 17, February 22 and March 3. fromcrop coefficienta previously (kc) calibrated of 0.7 (4). agrometeo- Meteorological data was obtained hourly branchesat midday exposed with a pressureto the sun chamber (one facing (PMS which was located at 300 m from the study instrument, Oregon, U.S.A) using two rological station (Campbell Scientific Inc.) 5 days at the same moment with different branchesEast and were the other covered facing with West) an aluminum on three site. All treatments were irrigated every 3 to andplants plastic for each sealed treatment. bag for Before at least measuring, one hour

c fraction to be replenished and the to permit xylem water potential and leaf irrigation times, estimated as the-1 quotient- of the ET equipmentTo achieve discharge the later, (0.66 each mm treatment h ), consid had water potential to equalize. Measurements anering independent a 90% irrigation irrigation efficiency. layout which wereProduction carried out variablesevery two weeks. was controlled with a programmable valve, set just before an irrigation event fruits per tree were counted, the average The trees were harvest on May 6. The c estimated fruit weight was determined and the total began. The accumulated ET productivity and the crop load per tree were duringTo theoffset research the effect period of was soil 21.16 water cm expressedkilograms (kg)by dividing per tree werethe kg weighed. and fruits, The availability(from January to 28 delayto May the6, 2011). measurable respectively, by the trunk cross-sectional area (cm-2 was fully irrigated until January 28 and the before the harvest, to take account of the differentialimpacts of theirrigation RDI in started olives, onthe February orchard possible TCSA) differences measured in 40 the cm size up fromof the the trees soil made on February 8, before an irrigation index were determined on a subsample 1, 2011. The first measurement was selected. Average fruit weight and ripeness c of 100 fruits with olives being separated between January 28 and February 8, and by color into different categories and the anevent, estimated with an fractionaccumulated of SWHC ET of available 3.94 cm ripeness index calculated with the formula proposed by Ferreira (Hermoso et al. Oil content in fruits was determined rangingPhysiological from 0.62 variables for T1 and 0.51 for T5. by the Soxhlet extraction method in 2004). previ- - ously dried olive pulp and using petroleum tance were determined with an infrared Photosynthesis and stomatal conduc completely expanded and mature leaves ether as solvent. Results were expressed gas analyzer (CIRAS-2, PP Systems). Two in oil percentage based on dry matter.

76 Revista de la Facultad de Ciencias Agrarias Physiological and production responses of olive under RDI

Experimental design Corresponded to a completely rando- also showed the lowest values, with mized block design with 5 irrigation the lowest water replenishment (65%), treatments distributed among 3 blocks, The values of Ψx varied also with the each block corresponding to a different variations ranging from -1.9 to -3.8 MPa. was composed of 3 trees being the one in corresponding VPD (figure 1b, page 78), with orchard row. Each treatment per block lower values when VPD was high and higher values when VPDΨx was low. Specifically, on crossingthe center the the experimentalarea between unit. rows Three were pit the fourth date of measurement, when VPD hole (2 m depth, 6 m long, and 1.5 m wide) was 1.5 kPa, the ranged betweenΨx -2.3 ranged and -3.5 MPa. Conversely, with a VPD of 0.6 kPa described. (sixth date of measurement) the No roots were found between rows betweenRelationships -1.4 to -2.3 between MPa. physiological latterover 0.8 description m from the guarantee center of theno row, border and variables effectsthe wet among bulb neighboring had a similar rows radius. since Thethe Observations carried out at midday found out that for all the treatments when were subjected to an analysis of variance distance between rows was 6 m. Results photosynthesis (A Tukey´s multiple range comparison test was (stomatalE conductance increased (gs), (ANOVA) with a 95% confidence level. parameters was made), andusing transpirationa hypothesis test) increased.in order An to evaluation verify ifof therethe model are carried out at a 5% significance level, when the ANOVA showed significant differences. Results therefore,differences the among results the treatmentswere evaluated slopes. throughNo significant a differerencessimple lineal were regression observed, Xylematic water potential (Ψx) Ψx differences between treatments for (R(figure2 2a and 2b, page 79), showing did not show any significant betweensignificant A vs determinationE vs coefficients =0.77The regressionand 0.86) between for the regressionxylematic conditionthe first on date plants of measurement,a few days after which the potential and. gs andstomatal . gs respectively.conductance would reflect a homogeneous soil water datestart ofof the measurement, RDI (figure 1a, treatments page 78). with xylematic(figure 3a, potentials page 80) ordecreased, photosynthesis both Nevertheless, starting from the third (figure 3b, page 80) showed that as c replenishment tended to stomatal conductance and photosynthesis have lower Ψx values, which remained as 75% or less ET wereProduction also diminished. variables such until harvest (figure 1a, page 78). This trend was significant for the last between treatments, which would indicate measurements,The treatment which with showed the highest significant water There were no significant differences differences between 100% and 65%. established restrictions, would not affect Ψx values, with variations ranging from the RDI applied for this date and the replenishment (100%), kept the highest the productive performance for “Frantoio” -1.6 to -2.9 MPa, while the treatment with olive trees (table 1, page 81).

Tomo 50 • N° 1 • 2018 77 Cristián Kremer et al.

1,8

1,6

) 1,4 a P k (

i 1,2 c i � e d

e 1 r s u e

r 0,8 p

r o p

a 0,6 v

y l i a

D 0,4

0,2

0 6/ Feb 23/ Feb 12/ Mar 29/ Mar 15/ Apr

Bars indicate the standard error, the squares indicate the dates of xylematic potential measurement FigureBarras 1. indican( el error estándar, cuadrados indican los días de medición de potencial xilemático. A) Xylematic water potential measured at midday, (B) Average daily vapor Figura 1. ( pressure deficit (VPD). A) Potencial hídrico xilemático medido a mediodía, (B) Déficit de vapor promedio diario (VPD).

78 Revista de la Facultad de Ciencias Agrarias Physiological and production responses of olive under RDI

Figure 2. ( observation, including the 5 treatments; the lineal regression which included the whole data is also shown,A) Relation ( between photosynthesis and stomatal conductance for each each observation, including the 5 treatments, the lineal regression which included the B) Relation between transpiration and stomatal conductance for Figura 2. ( whole data is also shown. ( A) Relación entre fotosíntesis y conductancia estomática para cada observación incluyendo los 5 tratamientos, una regresión lineal incluye todos los datos, B) Relación entre transpiración y conductancia estomática para cada observación incluyendo los 5 tratamientos, una regresión lineal incluye todos los datos. Tomo 50 • N° 1 • 2018 79 Cristián Kremer et al.

FigureThe figures 3. (include data from the 5 treatments. / Las figuras incluyen datos de los 5 tratamientos.

shown, ( A) Relation between stomatal conductance (gs) and xylematic water potential, (bars indicate the standard error), the lineal regression for the data is also B) Relation between photosynthesis and xylematic water potential (bars indicate the standard error), the lineal regression for the data is also shown. Each dot Figura 3. ( represents the average of 3 replications for both parameters measured at midday. A) Relación entre conductancia estomática (gs) y potencial xilemático, (barras indican el error estándar), se presenta una regresión lineal para los datos, (B) Relación entre fotosíntesis y potencial xilemático (barras indican el error estándar), se presenta una regresión lineal para los datos. Cada punto representa el promedio de 3 mediciones para ambos parámetros medidos a mediodía. 80 Revista de la Facultad de Ciencias Agrarias Physiological and production responses of olive under RDI

Table 1. its standard deviation per treatment are presented RDI effects on productive variables in “Frantoio” olive trees. Average value and Tabla 1.

Efectos del RDC sobre variables productivas en olivos “Frantoio”. Se presentan Oil porFerreira tratamiento el valor promedio y su Fruitdesviación yield estándarCrop load Fresh fruit concentration Fruit yield Treatment ripeness efficiency (fruits cm-2 weight dry weight (kg tree-1) index (g cm-2 TCSA) TCSA) (g) basis (%)

100% 1.09 ± 0.12 45.91 ± 4.45 27.67 ± 15.41 54.41 ± 28.08 27.67 ± 17.38 2.17 ± 0.48 85% 1.54 ± 0.38 49.45 ± 2.42 28.30 ± 10.89 68.69 ± 15.25 34.55 ± 11.08 2.04 ± 0.33 75% 1.84 ± 0.16 50.87 ± 10.83 22.28 ± 4.86 49.41 ± 9.42 29.04 ± 9.93 1.77 ± 0.36 70% 1.41 ± 0.45 52.67 ± 5.35 17.73 ± 5.44 48.16 ± 12.31 23.75 ± 7.21 2.05 ± 0.10 65% 1.57 ± 0.34 53.17 ± 1.70 23.33 ± 9.62 58.11 ± 31.41 32.61 ± 19.40 1.84 ± 0.22 ANOVA p-value N.S. N.S. N.S. N.S. N.S. N.S.

N.S.: not significant; ANOVA: analysis of variance. N.S.: no significativo, ANOVA: análisis de varianza. of harvest, achieving xylematic water

Either, Ferreira ripeness index (color fruit), oil content based on dry Sellespotential et al values over -3.5 MPa, showing matter, fruit yield efficiency, crop load, and no significal differences (16), similarly c fresh fruit weight, presented no significant phase of the. fruit (2006) growth found Sevillana, out with values RDI differences, suggesting that a moderate RDI treatments of 40% of ET applied on the III (over 65% water replenishment) between endocarp lignification and harvest in betweenRelation -2 to -3.4ships MPa. between physio- “Frantoio” olive trees does not impact the logical variables variables analyzed for this study. The results for the relationship between Discussion A and gs were similar to the ones obtained et al Xylematic potential olive trees were subject to treatments of Values obtained in this study which by Moriana . (2002), in which “Picual”

c (upy to 75% waterx; R2 replenishment regarding were highersimilar thanto the -3.8 ones Mpa forobtained xylematic for ET . These authors found a regression water potential (figure 1a, page 78), for= plants 0.074 with =midday 0.92), similarxylematic to the values one obtained in this study (figure 2a, page 79), other RDI tests on olive trees. There is relationship between the decrease in the case of “Picual” olive trees, in which higher than -4 MPa. There is a linear RDIs with contributions between 60 to 80% managed to induce xylematic water measuredpotential and xylematic stomatal conductance.potentials, water potential values over -3.8 MPa (12). stressApparently, protection within includes the rangestomatal of subjectedAn analogous to irrigation behavior between was observed 66 and closure and a decrease in potential as to on “Frantoio” olive trees, which were c in the period between the

100% of ET preserve transpiration gradients. start of endocarp lignification and start Tomo 50 • N° 1 • 2018 81 Cristián Kremer et al.

The interesting part is that it is a linear indicator for the water stress condi- - On the other hand, the correct interpre- variablesreaction equallywere not reflected statistically in photosyn altered tationtions moreof xylematic at the endpotential of this data research. as a thesis. Therefore, even though productive characterization of water restrictions were, a situation which should have an cannot be isolated or made independent (table 1, page 81), physiological ones impact particularly on floral induction for decreasefrom the VPD.in xylematic potential and its the Productionnext season variables (11). impactA linear on physiological relationship variables between such the The results obtained in this research as stomatal conductance and photosyn-

c replenishment amounts applied on olive trees in this study from endocarp that a decrease in irrigation water causes suggest ET athesis proportional was found. decrease This trend in would assimilated reveal level in fruits or other production variables production, a situation which must be kept lignification until harvest do not affect oil as stated by other authors (5, 6, 16). Onin mind the other when hand, the RDI there practices were no overlaps effects Conclusions onwith the a most process, relevant such productive as floral induction. variables

preliminary results are in concordance withsuch asresults fruit growth than andothers oil buildup.authors Thesehave at midday,RDI practices showed do a trend have differentiating an impact on theolive various trees. Xylematicwater amounts potential applied, measured even an initial promissory result validating quoted, with similar RDI practices, being though this was a stastically significant deficit irrigation from foreign research.

References

1. Agüero, A.; Rousseaux, M.; Searles, P. 2010. Respuestas fisiológicas y reproductivas al riego deficitario controlado de post-cosecha en olivo en una zona árida de Argentina. CRILAR CONICET. En: http://www.inta.gov.ar/mendoza/V_Jornadas/Ponencias/Aguero.pdf 2. Alegre, S.; Girona, J.; Marsal, J.; Arbonés, A.; Mata, M.; Montagut, D.; Teixidó, F.; Motilva, M. J.; Romero, M. P. 1999. Regulated deficit irrigation in olive trees. Acta Horticulturae (ISHS). 474: 373-376. 3. Caruso, G.; Rapoport, H. F.; Gucci, R. 2013. Long-term evaluation of yield components of young olive trees during the onset of fruit production under different irrigation regimes. Irrigationresponses Sciences.(Olea europea 31: 37-47. 4. Girona, J.; Luna, M.; Arbonés, A.; Mata, M.; Rufat, J.; Marsal, J. 2002. Young olive trees , cv. “Arbequina”) to different water supplies. Water function determination. Acta Horticulturae. 586: 277-280. 5. Goldhamer, D. A. 1999. Regulated deficit irrigation for Californian canning olives. Acta Horticulturae. 474(1): 369-372. 6. Grattan, S. R.; Berenguer, M. J.; Connell, J. H.; Polito, V. S.; Vossen, P. M. 2006. Olive oil production as influenced by different quantities of applied water. Agricultural Water Management. 85: 133-140. 7. Gucci, R.; Lodoloni, E.; Rapoport, H. F. 2007. Productivity of olive tree with different water status and crop load. Journal of Horticultural Science and Biotechnology. 82: 648-656.

82 Revista de la Facultad de Ciencias Agrarias Physiological and production responses of olive under RDI

Fernández- ta 8. Hermoso, M.; Beltrán, G.; Uceda, M. 2004 Maduración. Pp. 159-183. In: Barranco, D.; Escobar, R.; Rallo, L. (Eds.). El cultivo del olivo, 5 edición, ediciones Mundi- Prensa. España. 800 p. 9. Iniesta, F.; Testi, L.; Orgaz, F.; Villalobos, F. J. 2009. The effects of regulated and continuos deficit irrigation on the water use, growth and yield of olive trees. European Journal of Agronomy. 30: 258-265. O. europea 10. Lavee, S.; Hanoch, E.; Wodner, M.; Abromowitch, E. 2007. The effect of predetermined deficit irrigation on the performance of cv. Muhasan olives ( L.) in the eastern coastal plain of Israel . Science Horticulturae.Olea europaea 99: 267-277. 11. Martín-Vertedor A. I.; Pérez, J. M.; Prieto, H.; Fereres, E. 2011. Interactive responses to water deficits and crop load in olive ( L., cv. Morisca) I. Growth and water relations.(Olea europaea Agricultural Water Management. 98: 941-949. 12. Moriana A.; Villalobos, F. L.; Fereres, E. 2002. Stomatal and photosynthetic responses of olive L.) leaves to water deficits. Plant, Cell and Environment. 25: 395-405. 13. Moriana, A.; Orgaz, F.; Pastor, M.; Fereres, E. 2003. Yield responses of a mature olive orchard to water deficits. Journal of the American Society for Horticultural Science.Prunus 128: 425-431.avium 14. Podestá, L.; Vallone, R.; Sánchez, E.; Morábito, J. A. 2010. Efecto del riego deficitario controlado sobre el crecimiento vegetativo en plantaciones jóvenes de cerezo ( L.). Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 42(1): 73-91. cv. 15. Sellés, G.; Ferreira, R.; Sellés, I.; Lemus, G. 2006. Efecto de diferentes regímenes de riego sobre la carga frutal, tamaño de fruta, y rendimiento del olivo Sevillana. Agricultura Técnica. 66(1): 48-56. Olea europaea 16. Tognetti,(cvs. R.; d’Andria, R.; Sacchi, R.; Lavini, A.; Morelli, G.; Alvino, A. 2007. Deficit irrigation affects seasonal changes in leaf physiology and oil quality of Frantoio and Leccino). Ann. Appl. Biol. 150: 169-186.

Tomo 50 • N° 1 • 2018 83 SoilRev. compactionFCA UNCUYO. in 2018.the corn 50(1): crop 85-100. (Zea Mays ISSN L.) impreso 0370-4661. ISSN (en línea) 1853-8665.

Guido Fernando Botta 1, 2, Alfredo Tolón-Becerra 3, Fernando Bienvenido 3, Ezequiel Ricardo David Rivero 4, Daniel Andrés Laureda 2, Enrique Ernesto Contessotto 4, Roberto Andrés Fonterosa 2, Diego Wilfredo Agnes 2

Originales: Recepción: 04/10/2017 - Aceptación: 03/11/2017

Abstract pressures and axle loads on soil properties and maize (Zea Mays L.) - In this work, we quantified the effects of harvest traffic having different tyre ground yields. The treat ments consisted of a control plot with no traffic (T1), a combine harvester with low tyre ground pressure (T2) and the same harvest traffic with high tyre ground pressure (T3). centreCone index of the (CI), tracks soil (0), water and content at 70, 140 (SWC), and 210rut depth cm on (RD), either root side dry of them.matter For per three plant growing (RDM) and maize yields (MY) were measured at seven places in relation to the tracks, namely: seasons, the results showed that in the topsoil (0 to 20 cm), CI values produced by treatment topsoilT3 were and > 2.7 subsoil, MPa and but between differences 3.4 into rut4.25 depth MPa in(RD) the at subsoil the surface (20 to did60 cm).not extend Also, when into the soil was trafficked by tyres with infaltion pressures of 120 to 240 kPa, the CI increased in the -1 was observed in 2016 (third growing season) in the centre subsoil in terms of CI. The greatest differences in RDM were found in the third growing season. The minimum MY of 4.7 Mg ha -1 at 210 cm on eitherline of sidethe tyreof them. tracks The after main one conclusions pass of combine were that harvester one pass with of the high combine tyre ground harvesters pressure. with Yield increased with distance from the track centres reaching 5.10 Mg ha thetotal combine weight loadharvesters between tracks, 16.67 as and well 21.10 as all Mgpositions was sufficient alongside to them. increase the CI in both the topsoil and subsoil layers while maize yields were significantly reduced by all compaction in Keywords

soil bearing capacity • cone index • crop yield • root growth

1 National University of Luján. Technology Department. P. C. 6700 Luján. Buenos Aires Province. Argentina. [email protected] 2 University of Buenos Aires. Scholl of Agriculture. Agricultural Engineering and Land Almería,use Department. Spain. Agricultural Machinery Area. P. C. 1427. Buenos Aires City. Argentina. 3 University of Almería. Ctra. Sacramento s/n. La Cañada de San Urbano. 04120.

4 University of La Pampa. School of Agriculture. Agricultural Machinery Area. P. C. 6300. Santa Rosa. La Pampa Province. Argentina. Tomo 50 • N° 1 • 2018 85 G. F. Botta et al.

Resumen

En este trabajo se cuantificaron losZea efectos Mays delL.). tráficoLos tratamientos de cosechadoras consistieron con diferentes en una presiones en el área de contacto rueda/suelo y cargas por eje sobre las propiedades del suelo y los rendimientos del maíz ( (T3).parcela Se testigomidieron sin el tráfico índice (T1), de cono una (IC), cosechadora el contenido con debaja agua presión en el sueloen el área(CAS), de la contacto profun- rueda/suelo (T2) y una cosechadora con alta presión en el área de contacto rueda/suelo didad de huella (PFH), la materia seca de raíz por planta (MSR) y los rendimientos de maíz (RM) en siete distancias a un lado y otro de las huellas: (0), 70, 140 y 210 cm. Durante las tres temporadas de cultivo, los resultados mostraron que en la capa superficial del suelo (0 a 20 cm), los valores de IC producidos por el tratamiento T3 fueron > 2,7 MPa y entre 3,4 y 4,25 MPa en el subsuelo (20 a 60 cm). Además, cuando el suelo fue transitado por neumático con presiones de inflado entre 120 y 240 kPa, el IC aumentó en la capa superficial y el subsuelo, sin embargo la PFH-1 en la superficie no se extendió al subsuelo en términos de IC. Las mayores diferencias en MSR se encontraron en la tercera temporada de contactocrecimiento. rueda/suelo. El mínimo El RM rendimiento fue de 4,7 Mgaumentó ha y se con observó la distancia en 2016 desde en el centro de la huella de los neumáticos después-1 a 210 de cmun enpaso cada de ladola cosechadora de la misma. con Las alta principales presión enconclusiones el área de alcanzando 5,10 Mg ha fueron que una pasada del equipo de cosecha con un peso total entre 16,67 y 21,10 Mg defue recolección, suficiente para así como incrementar todas las la posiciones IC en las capasa su lado. de suelo y subsuelo, mientras que los rendimientos de maíz fueron significativamente reducidos por compactación en las vías Palabras clave

crecimiento de la raíz capacidad portante del suelo • índice de cono • rendimiento del cultivo •

Introduction

Zea mays L.) is South America's second most important crop with 19.3 Maize ( (4.2 Mha under direct sowing (DS)) (33), are Brazil and Argentina, which in the which are very susceptible to compaction 2015/2016Mha devoted season to it. produced The main 98 producers million (50-110by high kN), traffic tractors intensity (50-100 with heavykN), metric tonnes (33). combinemachinery harvesters such as (90 seeding to 150 machineskN) and Argentina is the second largest grain chasers (100-200 kN)). In harvest exporter of maize after the United States, operations, Botta et al. (2007), found that 70% of its production being exported and Brazil is the third largest (13). In Argentina, maize is produced when the traffic intensity increases on clay andsoils soil with compaction a high bearing problems capacity increase. (soils Accordingunder long toterm (ASAE DS) cropStandarts yields decrease(1992)), in the Rolling Pampa region, mainly on clayey and loamy soils

86 Revista de la Facultad de Ciencias Agrarias Soil compaction in the corn crop (Zea Mays L.)

These statements argue that a single compaction is caused by high wheel loads and tyre ground pressures from determination of bulk density made at the machinery used in DS crop operations, highestcenter of value the attyre each track horizontal at a single or vertical depth particularly when these operations are locationis probably (32). not representative of the carried out on wet clay soil or with high et al. (2014), in inflation pressure tyres (between 140 to species218 kPa). are unable to penetrate deeper withStudies special by treads Hidalgo for these condi- The roots of the majority of plants tions,rice cultivationreported workingthat in a in packed (Planosoil) soil with no structure, the passage of the reportedin the profile problem. when there is compaction in theNunes topsoil, et al. and(2015) this also is a observed frequently a compaction due to soil displacement. higher concentration of maize (Zea mays) Thesespecial data tyres are caused of relevant more importance horizontal to compaction (8, 21). In this respect, Cambie et al. (2015), concluded (on a anroots Oxisol (63.8%) (27) inunder the 0no-tillage to 7cm layer . due to physicalAccording deterioration to Lapiec in (2012), the subsurface the mean of DystricThe Cambisol),largest negative that deep impact ruts occurred on soil occurredin moist soil when with using just a asingle wheeled pass. tractor crop yield reduction was 2.5%, but varied on moist soil. A general rule of thumb is dueconsiderably to persistent among subsoil sites, years compaction and crops. as aFor consequence example, the of high maize axle yield load reduction was 6% accountto prohibit for conditions traffic when in the soils subsoil are wetter (12). than field capacity, although this may not in Minnesota and 12% in Quebec. The developed and tested around the world, negative impact of agricultural tyres, with Although DS systems have been high ground pressure, heavy equipment knownand traffic (8, 11, on 15). soil The physical equipment properties, weight athe new results management vary depending regime. on Also, the thereclimate is root elongation and crop yields are well and the time required by soils to adapt to related to the machine and affect subsoil differences in maize (Zea mays L.) compactionand the resulting (1, 8). wheel load are directly very little information in the literature on of compaction from the centre of tracks. yields the distribution of pressure throughout under DS caused by the horizontal transfer However, the tyre ground pressure and- Objectives toolsthe topsoil that can are linkedbe used to theto control tyre's attri soil compactionbutes (21, 25) (23). and are major engineering maize crop development in different et al. (2015) positionsQuantify relative soil to parameters equipment thattracks. affect small values of stress in the transverse Compare the effect of two different Acording to Schjønning pressures of harvest equipment (combine harvester, tractor and grain chaser) on direction of the tyre at high inflation observedpressures in reflect other astudies stress (16, peak 18, at 19). the center of the tyre, which was also compaction of a Hapludol entic soil and maize yields cultivated under DS.

Tomo 50 • N° 1 • 2018 87 G. F. Botta et al.

Hypothesis was 70 cm and the average emergence was

season),90% in all April treatments. 25, 2016 Maize (end was of the harvested second That maize yields are negatively growingon: April season)26, 2015 and (end April of the 26, first 2017 growing (end displacementaffected by one as passwell asof subsoilharvest compaction. equipment of the third growing season) for all treat- and that this traffic causes horizontal soil ments. Yields on the control plot (T1) -1. Materials and methods Fertilizer (60 kg ha-1 of diammonium phosphateaveraged 8.2 andMg ha45 kg ha-1 of liquid The site and crop operations The work was carried out at the La Ines the seed line while weeds were controlled usingnitrogen) post-emergence was applied herbicides. nominally along located in west of the Buenos Aires province farm (36°04'33.18" S y 62°29'14.57" W), Treatments Two main treatments and a control plot on a soil classified as Loamy Entic Haplustol (29). Typical profile characteristics are consecutive growing seasons using the shown in table 1. Soil management history equipmentwithout traffic outlined (T1) inwere table applied 2 (page in 89). three includes 8 yearsTriticum of crop aestivum rotation L.)/( followingGlicine Treatment 2 (T2) consisted of combine maxa very common regional pattern,Zea mays winter L.) in wheat/soya ( "DekalbL.) followedvt 670 3p", by maizeand was ( direct drilled Treatmentharvester, all3 with(T3) tyresused applyingthe combine a low the summer. The hybrid maize used was axle load and low tyre ground pressure. 2014, in the second growing season on 8 Octoberin the first 2015, growing and seasonin the onthird 10 grawingOctober harvester but with applying high axle season on 7 October 2016. withloads oneand highpass tyreof the ground harvest pressures. machines, The sowing rate was 71500 pl ha-1, and eachEach with experimental its own centre plot line. was trafficked the sowing depth was 3 cm. The row spacing

Table 1. Tabla 1. Soil profile characteristics of the Entic Haplustoll. Horizons Ap A AC C Perfil tipico del suelo Haplustol12 Entico. Depth range (mm) 0-120 150-300 350-650 710-1120 Organic carbon g kg-1 10.2 6.1 5.2 - C/N ratio 8 8 7 - -1 161 284 184 63 -1 98 63 76 99 Clay (<2 µ) g kg -1 176 144 131 206 Silt (2-20 µ) g kg -1 402 302 398 367 Silt (2-50µ) g kg -1 159 201 207 261 Very fine sand (74 - 100 ) g kg -1 4 6 4 4 Fine sand (100 - 250 µ) g kg 6.1 6.1 6.3 6.7 Medium sand (250 - 500 ) g kg 0 (1: 2.5) 6.4 6.6 6.9 6.9 pH 2 pH in H

88 Revista de la Facultad de Ciencias Agrarias Soil compaction in the corn crop (Zea Mays L.)

Table 2. Description and harvest characteristics. Tabla 2.

Descripción y característicasCombine Harvester de las (T2) cosechadoras.Combine Harvester (T3) Engine power (CV/kW) 325/238.3 480/352 Rotors One one 900/60 R 32 900/60 R32 200 240 Front tyres 28 L - 26 750/65 R 26 Front tyres inflation pressure (kPa) 120 120 Rear tyres 16.67 21.10 Rear tyres inflation pressure (kPa) 11.66 13.72 Total weight loaded (Mg) 5.10 7.38 Front axle weight (Mg) 5.83 6.86 Rear axle weight (Mg) 2.55 3.69 Static load per front wheel (Mg) Front wheel track width (mm) 3300 3450 Static load per rear wheel (Mg) Rear wheel track width (mm) 3300 3450 2) 0.845 0.924 2) 0.800 0.862 Front tyre - soil contact area (m 67.61 77.99 Rear tyre - soil contact area (m 31.23 83.90 Tyre ground pressure per front tyre (kPa) Tyre ground pressure per rear tyre (kPa) Fifteen 200 m x 80 m plots were Parameters monitored Cone index (CI), soil water content

20randomly m wide assignedbuffer zones to traffic between treatments plots to with five replicates for each treatment andmeasured.(SWC), rut Soildepth sampling (RD), root was dry done matter at seven per cation of each treatment, all the combine plant (RDM) and maize yields (MY) were harvestersprevent interactions. was weighed Prior (with to theelectronic appli scale) to obtain its total, individual axle andpoints 210 across cm cm the to tyreeither track, side describedof it, denoted as: centre line of the tyre track (0) and at 70, 140 loads and wheel load (figure 1). "inside" and "outside" (figure 3, page 90). Harvest operations were the same place for botheach growing the traffic season treatments because (figure 2, page 90) but were not in the local commercial practice employs random traffic. duringThe the same three machinery growing seasons was used of the for trial,sowing but and the spraying harvest theequipment maize cropwas changed according to treatment. Figure 1. to the test. Weight of the machinery prior the Theratio tyre-soil between contacttotal axle area load (TSC) and total and Figura 1. tyre ground pressure was estimated as Peso de la maquinaria previo tyre-soil contact area (5). al ensayo. Tomo 50 • N° 1 • 2018 89 G. F. Botta et al.

Each of the points was selected at

the passage of each of the treatments random within the sectors described by measured after harvest at three depth ranges,(figure 2,0-20-20-40 page 90). and Cone 40-60 index cm (CI) using was a

harvesterRimick CP20 passes recording on the S313 CI, penetrometerSWC and TD, were(3). Datataken at for the studying beginning the (before impact sowing of

and averaged for the three growing seasons date) and end (harvest day) of each season,

forof study. each On of eachthe measuringplots per occasion,treatment, each as datum was the mean of thirty soil samples measured with a gamma probe at depths ofproposed 0-20 cm, by20-40 Botta cm, and (2000). 40-60 SWC cm. Each was Figure 2. Schematic for the harvest et al. (2007). measurements. Rut depths (RD) were Figura 2. quoted value of SWC is the average of thirty cosecha.traffic. Source: Fuente: Botta Botta et al. (2007). of a set of vertical metals rods (length 50 cm Esquema para el tráfico de andmeasured diameter using 0.5 a cm), profile spaced meter 2.5 consisting cm apart

1-m long iron bar. horizontallyThe bar wasand slidinglevelled through across theholes wheel in a tracks perpendicular to the direction of travel and the rods pushed down to conform to the shape of the depression. The track depth was calculated from the average depth of 60 reads on the 1 metre bar.

8 weeks after seedling emergence (duringRoot tasseling).dry matter Roots (RDM) were was sampled measured in the 0 to 30 cm depth range because most

25 cm. of theA total roots of were 70 samplesconcentrated were intaken the firstper Soil and crop sampling points Figure 3. treatment and after washing to remove all soil particles, the roots were dried at Figura 3. 104°C in a conventional oven to constant across the tyre track. weight, which was recorded. To determine Puntos de muestreo del suelo y cultivo a través de la pisada into 160 m2 isolated quadrants in accor- del neumático. maize yield (MY), each plot was divided Tolón Becerra et al. (2011). dance with the method proposed by

90 Revista de la Facultad de Ciencias Agrarias Soil compaction in the corn crop (Zea Mays L.)

Statistical analysis the combine harvester (T2) caused the least increase in soil impedance, with minimal horizontal transfer of compaction Data for yield and maize parameters in the 0 to 20 cm depth range, showing blockfor each design. growing For seasonall parameters, were analyzed mean valuesby ANOVA were separated considering using a the randomized Duncan's (T3)significant caused differences the greatest from increase the in control CI at only in the centre of the track. In contrast, carriedmultiple out range using tests Statgraph with 7.1. a significance level of 5%. Statistical analyses were T1all points(control). analyzed, and was differentiated significantly from treatments T2 and Results and discussion pressure treatment (T3) caused greater changesCompaction to the by topsoil the high and tyre groundsubsoil Weather conditions properties than the low pressure treatment (T2). These results are in maximum temperatures from September accord with those of Botta et al. (2016) The ten-day total rainfall and average- and who tered. The average maximum air indicated that compaction effects at high temperature25 to April 30was for within each normal year were ranges regis for Håkansson and Reeder (1994), the proper implantation and growth and development of maize. Rainfall during the axle load are related to soil type, number critical period of maize growth (1st - 25th of passes,The CI tyrevalues ground resulting pressure from andthe theT2 (lownumber pressure) of years andsince T3 compaction. (high pressure)

January) was below average in the three growing seasons. Rainfall was significant attreatments different weresoil depths significantly (as expected), different Becausebefore harvest seasonal operations weather conditions(last 10 days were of i.e.(P <40 0.01) cm for from T2 theand control60 cm for plot T3. (T1), but ratherApril) insimilar the third in all year the causing growing high seasons, SWC. In addition, the CI values were higher for could be due to soil compaction produced variations in maize yields between seasons T3 than for T2. It is likely that this higher CI, which caused densification of the subsoil, by theSoil different water content combine and harvester. Cone index ratherwas due than to passage to the ofqualities the heavier of the machinery ground during harvest operations (T2Arvidsson = 21.10 Mg)and (October 2014-April 2017), there was et al. (2007) and Over the whole period of the study itself. This mirrors studies by between depths (0 to 60 cm) seasons or Håkansson (2014), Botta treatments,no significant although difference there inwas the a small SWC Håkansson and Reeder (1994). increase in absolute values with sampling thereFor were the strong tyre low differences pressure in treatment the data depth. Topsoil compaction (0-20 cm) from(T2), the in thesampling first depth points, range with (0-20maximum cm) CI in the centre of the tracks and greaterby treatment changes 3 in (combine the topsoil harvest properties with higher than the control plot, and up to high tyre ground pressure) caused 70diminishing cm either toward side of the sides,centre but line always of the

(CI > 2.7 Mpa) than treatment 2 (harvest with low tyre ground pressure). With tyre track (figure 4, page 92). respect to the CI values (figure 4, page 92), Tomo 50 • N° 1 • 2018 91 G. F. Botta et al. 0 0 2 1 2 1 0 0 3 3 T T 1 4 1 4 e m ) m ) d e i ( c ( c d s i k k s n 2 7 0 2 7 0 I c c n T T a a I t r t r

e e

2 0 1 5 r r r 0 0 I t y t y

2 0 1 7 t f I f t e b e

o o o o d e

i t e e d P l P l c i l l t s O April u t s l i n l i n r o r o u O r r 7 0 7 0 n t n t e e O t t o o n n C C e e C C 0 0 1 4 1 4 0 0 2 1

2 1

5 4 3 2 1 0 5 4 3 2 1 0

) a P M ( x e d n I e n o C ) a P M ( x e d n I e n o C

0 2 1 0 3 T 0 2 1 3 1 4 T e d 0 i e s m ) m ) 1 4 d n 2 i I ( c T ( c s 7 0 k n k 2 I c

T a a 7 0 t r

t r

I e

e r t 2 0 1 6 e r 0 2 0 1 5 o I r d t y

i t y f e t P l f 0 r i l b e l t s o o d

o p i

o u e t r o e A P l O t s c l n t u l i n O l i n o r o 7 0 O r C r e n t 7 0 e t o t n C n e e C C 0 0 1 4 1 4 0 0 2 1

2 1

5 4 3 2 1 0 5 4 3 2 1 0

) a P M ( x e d n I e n o C ) a P M ( x e d n I e n o C seasons at the start and end of testing. 0 0 2 1 2 1 3 0 0 tres estaciones de crecimiento, al inicio y final de la prueba. estaciones de crecimiento, tres 3 T T 1 4 1 4 e m ) m ) d e i ( c d ( c i n s 2 k s k I 7 0 2 7 0

c T n c

T I a

t r

e r 2 0 1 4 r 2 0 1 6 r 0 t y 0 t y e t I f

f t d r i l b e o i o e o o

o p d e t t s P l e i A l P l c u l t s O l i n O r o l i n u r o r r 7 0 n t O e 7 0 n t e t o t o C n n C e e C C Valores del índice de cono (MPa) medidos, entre 0 a 20 cm de profundidad para las dos cosechadoras durante las durante las dos cosechadoras para 0 a 20 cm de profundidad medidos, entre del índice de cono (MPa) Valores Cone index values (MPa) measured, between 0 to 20 cm depth range for two combine harvest in the three growing growing in the three combine harvest two for 20 cm depth range 0 to between measured, (MPa) values Cone index 0 0 1 4 1 4 0 0 2 1 2 1 5 4 3 2 1 0

5 4 3 2 1 0

Figura 4. Figura ) a P M ( x e d n I e n o C ) a P M ( x e d n I e n o C 4. Figure

92 Revista de la Facultad de Ciencias Agrarias Soil compaction in the corn crop (Zea Mays L.)

treatment (T3) CI values measured at 0, 70, For140 theand 210 high cm, tyre to groundeither side pressure of the the For tyre tretamnet centre line 2, andin the decreased 40 to 60 as thecm depthposition range moved CI towards values theat 210edge cmof the to tyre. the to T1 (control) and T2 (low pressure) and track centre, were significantly different- outside and inside of the tyre track did not higher than 2.5 MPa. For the three experi thisdiffer treatment significantly (T2) from compared the control with plot.the mental growing seasons, the tyre ground controlThere were in the no 40 significant to 60 cm depth differences range. for pressureIn the reflected 20 to 40 in CIcm was depth always range, higher T2 In this level depth range, average CI (lowfor treatment pressure) T3 caused (figure an 4, increasepage 92). in soil values for the three growing seasons impedance compared with the control, were higher for (T3) than for (T2). Of particular note is the fact that T3 (in last season) caused CI values between 3.4 and but this difference was only significant (P< 0.01) at 70 cm, both on the inside and indexoutside values of the for center the T3 line treatment of the tyre CI trackwere 4.25Rut Mpa depth in the (RD) subsoil. (figure 5, page 94; figure 6, page 95). Cone The RD for the two treatments were between depths of 0 to 20 and 20 to 60 cm of different magnitudes. During all three higher than 3 MPa at the centre of the track growing seasons, RD at constant wheel CI values indicate that over-compaction occurred(figure 5, pagein the 94; subsoil figure 6,and page were 95). greater These the topsoil (0 to 20 cm) and upper subsoil load significantly increased the stress in Botta et al. (2004) and Botta et al. (2009), than the limit of 2.0 MPa suggested by (figure 7, page 96). For treatments 2 and 3, the CI values pressureThis figuretreatment also shows(T3) than that those RD was of measuredto avoid yield at 70, decreases. 140 and 210 cm, to either thealways equivalent greater forlow the pressure. high tyre Also, ground the high axle load machines caused a higher lower than at the centre. pressure on the topsoil than (T2). sideThe of theresults the tyrefor trackT3 in centre particular were subsoil compaction is not clear. Also, However, the influence of RD on those(tyre inflationof Jun et pressuresal. (1998) ofwho up indicated to 220 thatkPa inthe front maximum tyres) are normal in accord stress with it can be seen (figure 7) that when the soil was trafficked with tyre ground increasedpressures ofin 77.99the topsoil to 83.90 and kPa subsoil, and high but occurred near the centreet al. (2016), line of Keller tyres thereload (Eg.: was T3no =effect 21.10 of Mg), the theRD coneon subsoil index andat high Arvidsson inflation (2004), pressure. Keller This was(2005), also compaction (20 to 60 cm). observed by Hidalgo Root dry matter (RDM) and maize Lamandé and Schjønning (2011) and- yields (MY) Schjønning (2015), who additionally In each of the three growing seasons, thenoted topsoil, that tyrebut alsoinflation in the pressure subsoil. signifi cantlyJun affects et al. (1998) the vertical also observedstress not that only the in maximum tangential stress occurred near asthere the werecontrol significant (table 3, differencespage 97). in RDM between all the traffic treatments as well

Tomo 50 • N° 1 • 2018 93 G. F. Botta et al. 0 0 2 1 2 1 0 3 0 3 T 1 4 T 1 4 e m ) d e m ) i ( c d s i ( c n s k 2 7 0 c k 2 n 7 0 T I c a T a I t r

t r I

r e 2 0 1 5 r 0 t y r e 0 2 0 1 6 I t y f t

d t f o o i e b e

o o d

o e t s i P l t e l P l u c l April t s l i n O r o O u l i n r o r 7 0 O n t e r 7 0 n t t o e o t n C C e n e C C 0 0 1 4 1 4 0 0 2 1

2 1

5 4 3 2 1 0 5 4 3 2 1 0

) a P M ( x e d n I e n o C ) a P M ( x e d n I e n o C 0 2 1 0 3 0 3 2 1 T T 1 4 0 e m ) e d d m ) ( c i 1 4 i s s k ( c n 2 2 n 7 0 c I I k T T a c t r a

7 0

e t r

r e 2 0 1 5 2 0 1 6 0 r t y I I

r f t t t y e e r i l o o o

f 0 d d p b e i i e o

o A P l P l t l l t s t s e c l i n u u r o r o O r O l i n O 7 0 e n t n t r t o o e 7 0 n C t C e n C e 0 C 0 1 4 1 4 0 0 2 1

2 1 5 4 3 2 1 0

5 4 3 2 1 0

) a P M ( x e d n I e n o C ) a P M ( x e d n I e n o C seasons at the start and end of testing. 0 2 1 0 2 1 0 3 3 tres estaciones de crecimiento, al inicio y final de la prueba. estaciones de crecimiento, tres 0 T 1 4 T 1 4 m ) e e m ) d d ( c i i ( c s s k 7 0 2 k 2 n n c 7 0 I c T I T a a t r

t r

e e 2 0 1 4 r r r 0 2 0 1 6 t y I 0 I

t t b e f t y e e o o o r i l

o d o d t

e i p i c P l P l e l A l t s t s O l i n u u r o r o l i n r O O 7 0 r 7 0 n t e n t t e o o t n C C n e e C C 0 0 Valores del índice de cono (MPa) medidos, entre 20 a 40 cm de profundidad para las dos cosechadoras durante las durante las dos cosechadoras para 20 a 40 cm de profundidad medidos, entre del índice de cono (MPa) Valores Cone index values (MPa) measured, between 20 to 40 cm depth range for two combine harvest in the three growing growing in the three combine harvest two for 40 cm depth range 20 to between measured, (MPa) values Cone index 1 4 1 4 0 0 2 1

2 1 5 4 3 2 1 0

5 4 3 2 1 0

) a P M ( x e d n I e n o C ) a P M ( x e d n I e n o C 5. Figura Figure 5. Figure

94 Revista de la Facultad de Ciencias Agrarias Soil compaction in the corn crop (Zea Mays L.) 0 2 1 3 0 T 1 4 m ) e d ( c i s k 2 7 0 n c T I a t r

e 2 0 1 5 r 2 0 1 6 r t y 0 I

t f b e e o o

o d t i e P l April c l t s O l i n r o u r O n t 7 0 e t o C n e C 0 1 4 0

2 1

5 4 3 2 1 0

) a P M ( x e d n I e n o C 0 2 1 3 0 T 1 4 e m ) d i ( c s 2 k n T 7 0 c I a t r

e r 2 0 1 6 2 0 1 5 t y r 0 I t

f o e r i l o b e

d p P l i o e l A t t s c r o l i n u O r n t O 7 0 e o t C n e C 0 1 4 0

2 1

5 4 3 2 1 0

) a P M ( x e d n I e n o C seasons at the start and end of testing. 0 0 2 1 2 1 3 3 T T 0 tres estaciones de crecimiento, al inicio y final de la prueba. estaciones de crecimiento, tres 0 1 4 1 4 e e m ) m ) d d i s i s ( c ( c 2 2 n T k k T I 7 0 c c 7 0 I n a a

t r t r

I e e 2 0 1 4 r r I r 2 0 1 6 t t

0 t y 0 o o e f f t y e b e d r i l o i d o

o P l P l

i p l l t e e t s c A t s r o r o u O u l i n l i n O n t n t O r r o o 7 0 7 0 e e C C t t n n e e C C 0 Valores del índice de cono (MPa) medidos, entre 40 a 60 cm de profundidad para las dos cosechadoras durante las durante las dos cosechadoras para 40 a 60 cm de profundidad medidos, entre del índice de cono (MPa) Valores 0 Cone index values (MPa) measured, between 40 to 60 cm depth range for two combine harvest in the three growing growing in the three combine harvest two for 60 cm depth range 40 to between measured, (MPa) values Cone index 1 4 1 4 0 0 2 1

2 1

5 4 3 2 1 0 5 4 3 2 1 0

) a P M ( x e d n I e n o C ) a P M ( x e d n I e n o C 6. Figura Figure 6. Figure

Tomo 50 • N° 1 • 2018 95 G. F. Botta et al.

cd d c c cd b bc bc a ab b a

Duncan’s multiple range test). Error bars indicate standard errors. (Values with different letters are significantly different (P < 0.01)

Las barras de error indican errores estándar. (Los valores con letras diferentes son significativamente Figure 7. diferentes (P < 0,01) prueba de rango múltiple de Duncan). three growing seasons. Rut depth (cm) measured for two combine harvesters after traffic in the Figura 7.

Profundidad de huella (cm) medida para los dos tratamientos después del tráfico en las tres estaciones de crecimiento del cultivo.

As the axle load increased, the RDM biologically responsive indicators and values decreased. Root dry matter (RDM) tend to grow more vigorously in zones inwas the affected 1rst Growing negatively season by soil for compaction. T2 (46.6 g that show least physical resistance. plantThe-1) highestat the 210 RDM cm values position were outside found whichIn allwere treatments, greater RDMin treatment values were 2 the track centre line, whereas the highest thandirectly treatment proportional 3. Lower to values maize of yields soil value in T3 was 41.9 g plant-1 in the 1st compaction were associated with greater Growing season (again at 210 cm outside the track centre line). and table 4, page 98). These results mirror those of maizeFor yieldsthe three and growing RDM (table seasons, 3, pagein treat 97- Nunes et al. (2015) and Botta et al. (2009) who indicated that a decrease in root development of all species below ments T2 and T3, traffic caused variable- decreases in maize yields. After one pass of the equipment,-1 MY decreased signifi the presence 0-10 cm layerof aggregates reflected formed a restrictive origi- cantly with respect to the control plot soil physical condition. This was due to (T1 = 8.2 Mg ha ). The MY over the three (tablegrowing 4, page seasons 98). was significantly lower accordingnally by compression, to Botta et al. with (2016), high rootssoil bulk are in the (T3) treatment, followed by (T2) density and low soil macroporosity. Also,

96 Revista de la Facultad de Ciencias Agrarias Soil compaction in the corn crop (Zea Mays L.)

Table 3. -1) for three growing seasons. Tabla 3. -1) en tres temporadas de crecimiento. Root dry matter per plant (g plant Materia seca de raíz por planta1st Growing (g planta season 210 cm 140 cm 70 cm Center line 70 cm 140 cm 210 cm Treatments Outside Outside Outside Inside Inside Inside (T3) 41.8 Cc 41.5 Cc 41.1 Cc 40.5 Cc 41.6 Cc 41.4 Cc 41.9 Cc of tyre track (T2) 46.6 Bb 46.1 Bb 46.2 Bb 45.2 Bb 46.1 Bb 46.1 Bb 46.3 Bb Control plot (T1) 50.1 Aa 50.3.1 Aa 49.7 Aa 50.2 Aa 50.0 Aa 49.4 Aa 50.1 Aa 2nd Growing season 210 cm 140 cm 70 cm Center line 70 cm 140 cm 210 cm Treatments Outside Outside Outside Inside Inside Inside (T3) 41.5 Cc 41.1 Cc 41.0 Cc 40.0 Cc 41.3 Cc 41.5 Cc 41.7 Cc of tyre track (T2) 45.8 Bb 45.7 Bb 45.5 Bb 44.7 Bb 45.1 Bb 45.6 Bb 45.5 Bb Control plot (T1) 50.1 Aa 50.3.1 Aa 49.7 Aa 50.2 Aa 50.0 Aa 49.4 Aa 50.1 Aa 3rd Growing season 210 cm 140 cm 70 cm Center line 70 cm 140 cm 210 cm Treatments Outside Outside Outside Inside Inside Inside (T3) 40.8 Cc 40.2 Cc 40.0 Cc 39.7 Cc 40.4 Cc 40.6 Cc 40.7 Cc of tyre track (T2) 45.0 Bb 45.2 Bb 45.1 Bb 43.9 Bb 45.0 Bb 45.2 Bb 45.2 Bb Control plot (T1) 50.1 Aa 50.3.1 Aa 49.7 Aa 50.2 Aa 50.0 Aa 49.4 Aa 50.1 Aa

Means with different capital letters show significant differences between treatment (vertically) and lowercase letters show significant difference between sampling site (horizontally) (P < 0.01). Medias con letras mayúsculas diferentes muestran diferencias significativas entre los tratamientos (verticalmente) y letras minúsculas muestran una diferencia significativa entre los sitios de muestreo (horizontalmente) (P < 0,01).

control (T1). The effect of harvester traffic (T2 lower maize yield than from T2 and the and T3) on maize yield was found to 42.69% (at the track centre line for T3 groundbe important, pressure. with yields decreasing in thePercentage 3rd Growing decreases season) to ranged 16.82% from (at with increased axle load and-1 tyrewas 210 cm from the inside of the track centre observed in the 3rd Growing season in line for T2 in the 1rst Growing season). The minimum of 4.7 Mg ha treatment, but increased with distance the centre line of the tyre track in-1 T3at withMaize (T3), yields being decreased the treatment with increasing with the 210 cm on either side (table 4, page 98). tyre ground pressure and vehicle weight, Also,from inthe the centre, 3rd growing reaching season, 5.10 a Mgminimum ha -1 was found in the centre line damagelowest yield. to the It topsoil is probable structure that resulting most of of the T2, increasing toward the sides, and the yield reduction for T3 was caused by of 6.25 Mg ha -1 at 210 cm on the inside and the outside of the track from the higher tyre ground pressure reaching 6.70 and 6.71 Mg ha produced by the combine harvester (> 80 kPa) and the high total load of T3 centre line respectively (table 4, page 98). researchers(21.10 Mg). (2, This 6, 14, result 30, 31). is in agreement Treatment 3 resulted in a significantly with those obtained by numerous

Tomo 50 • N° 1 • 2018 97 G. F. Botta et al.

Table 4. (t ha-1) Tabla 4. Rendimientos del maíz (t ha-1 Maize yields en lasmeasured tres estaciones after harvesters de crecimiento. traffic in three growing seasons. ) medido después del tráfico de las cosechadoras 1 rst Growing season

Control plot (T1) Treatment 2 Treatment 3 Sampling site 210 Outside 8.20 Aa 6.81 Ab 5.56 Ac 140 Outside 8.20 Aa 6.73 Ab 5.45 Ac 70 Outside 8.20 Aa 6.59 Ab 5.38 Ab 8.20 Aa 6.50 Ab 5.10 Ac 70 Inside 8.20 Aa 6.63 Ab 5.40 Ab Center line of tyre track 140 Inside 8.20 Aa 6.74 Ab 5.52 Ac 210 Inside 8.20 Aa 6.82 Ab 5.58 Ac 2 nd Growing season

Control plot (T1) Treatment 2 Treatment 3 Sampling site 210 Outside 8.20 Aa 6.73 Ab 5.33 Ac 140 Outside 8.20 Aa 6.40 Ab 5.25 Ac 70 Outside 8.20 Aa 6.32 Ab 5.11 Ab 8.20 Aa 6.35 Ab 5.03 Ac 70 Inside 8.20 Aa 6.42 Ab 5.15 Ab Center line of tyre track 140 Inside 8.20 Aa 6.51 Ab 5.26 Ac 210 Inside 8.20 Aa 6.75 Ab 5.38 Ac 3rd Growing season

Control plot (T1) Treatment 2 Treatment 3 Sampling site 210 Outside 8.20 Aa 6.70 Ab 5.10 Ac 140 Outside 8.20 Aa 6.30 Ab 5.05 Ac 70 Outside 8.20 Aa 6.20 Ab 5.01 Ab 8.20 Aa 6.25 Ab 4.70 Ac 70 Inside 8.20 Aa 6.17 Ab 5.03 Ab Center line of tyre track 140 Inside 8.20 Aa 6.43 Ab 5.08 Ac 210 Inside 8.20 Aa 6.71 Ab 5.10 Ac

Means with different lowercase letters show significant differences between treatment (horizontally) and capital letters show significant difference between sampling site (vertically) (P < 0.01). Medias con diferentes letras minúsculas muestran diferencias significativas entre tratamientos (horizontalmente) y mayúsculas muestran una diferencia significativa entre los sitios de muestreo (verticalmente) (P < 0,01).

98 Revista de la Facultad de Ciencias Agrarias Soil compaction in the corn crop (Zea Mays L.)

Conclusions

In general, the degree of soil compaction is dependent upon the axle soil under the wheel centre and have impact on the subsoil and only influence ground pressure. load,Combine tyre inflation harvesters pressure andweighing the tyre limited or no influence on either side of it. pressuresThis study and ground also demonstratedpressure increases, that if the wheel load and tyre inflation depth21.10 both Mg withbelow high their inflation track centres pressure and (soil in long term direct sowing), maize totyres 210 (240 cm either kPa) compact side. Combine the soil harvesters to 60 cm even in soils with a high bearing capacity and 210 cm to either side of it) and subsoil compactionyields decrease increases. (in the machinery track weighing 16.67 Mg and with low tyre ground pressure (31.23 - 67.61 kPa) have References

Till. Res. 96: 284-291. 1. Arvidsson, J.; Keller, T. 2007. Soil stress as affected by wheel load and tyre inﬂation pressure. Soil

2.3. ASAEArvidsson, Standards. J.; Håkansson, 1992. Soil I. cone2014. penetrometer Response of Sdifferent 313.2. Am. crops Soc. to Agric. soil compaction Eng. 611. - Short-term effects in Swedish field experiments. Soil Till. Res. 138: 56-63.

4. Botta, G. F. 2000. Subsoil compaction distribution induced by agricultural traffic. Thesis Doctor, Luján University. Argentina. p. 230. 5. Botta, G. F.; Jorajuria, D.; Draghi, L. 2002. Influence of the axle load, tyre size and configuration, on the compaction of a freshly tilled clayey soil. J. of Terr. 39(1): 47-54. Glycine max L.) 6. Botta, G. F.; Jorajuria, D.; Balbuena, R.; Rosatto, H. 2004. Mechanical and cropping behaviour of direct drilled soil under different traffic intensities: Effect on soybean ( yields. Soil Till. Res. 78: 53-58. Glycine max L.): effect on 7. Botta, G. F.; Pozzolo, O.; Bomben, M.; Rosatto, H.; Rivero, D.; Ressia, M.; Tourn, M.; Soza, E.; Vázquez, J. 2007. Traffic alternatives in harvest of soybean ( yields and soil under direct sowing system. Soil Till. Res. 96: 145-154. 8. Botta, G. F.; Rivero, D.; Pozzolo, O.; Tourn, M.; Bellora-Melcon, F.; Nardon, G.; Balbuena, R.; Tolón-Becerra,sowing. Soil Till. A.; Res. Rosatto, 101: 44-51. H.; Stadler, S. 2008. Soil compaction produced by tractor with radial and bias-ply tyres in two soil conditions: conventionalSeedbed tillage compaction and direct

9. Botta, G. F.;Res. Tolón-Becerra, 105: 128-134. A.; Tourn, M.; Lastra-Bravo, X.; Rivero, D. 2009. produced by traffic on four tillage regimes in the rolling Pampas of Argentina. Soil Till.

10. Botta, G. F.; Tolón–Becerra, A.; Rivero, D.; Laureda, D.; Ramírez-Roman,Glycine max M.; Lastra-Bravo, X.; Agnes, D.; Flores-Parra, I. M.; Pelizzari, F.; Martiren, V. 2016. Compaction produced by combine harvest traffic: Effect on soil and soybean2015. ( Impact of L.) wheeled yields underand tracked direct sowing in Argentinean Pampas. Europ. J. Agronomy. 74: 155-163. 11. Cambi, M.; Certini, F. F.; Foderi, C.; Laschi, A.; Picchio, R. tractors on soil physical properties in a mixed conifer stand. iForest. 9: 89-94. 12. Chamen, W. C. T.; Moxey, A. P.; Towers, W.; Balana, B.; Hallet, P. D. 2015. Mitigating arable soil compaction: A review and analysis of available cost and benefit data. Soil Till. Res. 24: 359-380. 13. Fischer R. A.; Byerlee, D.; Edmeades G. O. 2014. Crop yields and global food security: will yield increase continue to feed the world? ACIAR Monograph No. 158. Australian Centre for International Agricultural Research: Canberra. XXII + 634 p. 14. Håkansson, I. 2005. Machinery-induced compaction of arable soils incidence, consequences and counter-measures. Swedish University of Agricultural Sciences, Division of Soil Management. Report no. 109. p. 153. Tomo 50 • N° 1 • 2018 99 G. F. Botta et al.

persistence and crop response. Soil Tillage Res. 29: 277-304. 15. Håkansson, I.; Reeder, R. C. 1994. Subsoil compaction by vehicles with high axle load extent, de arroz (Oryza sativa L.) 16. Hidalgo, R.; Botta, G. F.; Tolón-Becerra, A.; Pozzolo, O.; Dominguez, F.; Serafini, E. 2014. Rastrojo Aregentina. 46(2): 163-175.en sistemas de siembra directa: alternativas de manejo. Revista de la Facultad de Ciencias Agrarias Universidad Nacional de Cuyo.Estudio Mendoza. de las prestaciones de cabezales arroceros con sistema draper. Revista de la Facultad de 17. Hidalgo, R.; Pozzolo, O.; Serafini, E.; Dominguez, F.; Beltramino, J.; Botta,Argentina. G. F. 2016. 48(1): 65-78.

Cienciasdistributions Agrarias for a Universidad pneumatic tractor Nacional tire de in Cuyo. soft soil. Mendoza. Trans. ASAE 41. 1237-1242. 18.19. Keller, Jun, H.; T. 2005. Kishimoto, A model T. for R.; the Way, prediction T. R.; Taniguchi,of the contact T. area 1998. and Three-directional the distribution of contact vertical stress

below agricultural tyres from readily available tyre parameters. Biosyst. Eng. 92: 85-96. 20. Keller, T.;in soil.Arvidsson, Soil Till. J. Res. 2004. 79: Technical 191-205. solutions to reduce the risk of subsoil compaction: effects of dual wheels, tandem wheels and tyre inflation pressure on stress propagation compaction. Trans. Am. Soc. Agric. Eng. 28: 11-16. 21. Koger, J. L.; Burt, E. C.; Trouse, A. C. 1985. Multiple pass effects of skidder tires on soil

22. Lamandé, M.; Schjønning, P. 2011. Transmission of vertical stress in a real soil profile. Part II: Efectinducida of tyre por size, la maquinaria inflation pressure en campos and de wheel polo load.en Argentina. Soil Till. Res.Revista 114: de 71-77. la Facultad de 23. Laureda, D. A.; Botta, G. F.; Tolón Becerra, A.; Rosatto, H. G. 2016. Compactación del suelo 24. Lipiec, J. 2012. Crop responses to soil compaction. In NJF Seminar. Soil compaction effects on Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 48(1): 79-99.

soil functions and strategies for prevention. Helsinki, Finland. 8(1): 27-36. 25. Naderi-Boldaji, M.; Keller, T. 2016. Degree of soil compactness is highly correlated with the soil physical quality index S. Soil Till. Res. 159: 41-46. 26. Nunes, R. N.; Denardin J. E.; Pauletto, E. A.; Faganello, A.; Spinelli Pinto, F. 2015. Mitigation of clayey soil compaction managed under no-tillage Soil Till. Res. 148: 119-126. 27. Ruiz, H. A.; Oliverio Sarli, G.; Gonçalves Reynaud Schaefer, C. E.; Filgueira, R. R.; Silva de Souza, F. 2016.48(2): La 95-105. superficie específica de oxisoles y su relación con la retención hídrica. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. and vertical stress distribution based on loading characteristics. Soil Till. Res. 152: 52-66. 28. Schjønning, P.; Stettler, M.; Keller, T., Lassen, P.; Lamandé, M. 2015. Predicted tyre-soil interface area Service, Washington, DC. 29. Soil Survey Staff. 2014. Keys to Soil Taxonomy, 12th ed. USDA-Natural Resources Conservation regimes on soil compaction, maize (Zea mays 30. Tolón-Becerra, A.; Tourn, M.; Botta, G. F.; Lastra-Bravo, A. 2011. Effects of different tillage L.) seedling emergenceSubsoil and yieldscompaction in the eastern Argentinean Pampas region.Olea europeaSoil Till. L.)Res. grove 117: in184-190. Almería, Spain. Soil Use and 31. Tolón-Becerra, A.; Botta, G. F.; Lastra-Bravo, A.; Tourn, M.; Rivero, D. 2012. from tractor traffic in an olive ( Management.Agricultural Engineering. 28: 606-613. 678-681. 32. Trabbic, G. W.; Lask, K. V.; Buchelle, W. 1959. Measurement of soil-tire interface pressures. . 33. USDA (United States Department of Agriculture). 2016. World Agricultural Production. Circular Series. Circular Series WAPAcknowledgements 7-16

This work was supported by grants to Technology Department National University of Luján and Faculty of Agronomy, University of Buenos Aires (Project UBACyT 2014 - 2017). The Ministerio de Economia y Competividad (MINECO) and European Regional Development Fund (ERDF) (Project CTM2013-41750-P, "Territorial and sector target distribution model for evaluating sustainability progress using indicators") are also gratefully acknowledged.

100 Revista de la Facultad de Ciencias Agrarias Rev. FCA UNCUYO. 2018. 50(1): 101-122. ISSN impresoAsparagus 0370-4661. officinalis ISSN (en línea) 1853-8665.

Eficiencia del agua de riego en espárrago ( L.) en el DR037 Análisis de la eficiencia física, económica y social del agua en espárrago (Asparagus officinalis L.) y uva (Vitis vinífera) de mesa del DR-037 Altar-Pitiquito- Caborca, Sonora, Mexico 2014 Analysis of physical, economic and social water efficiency in asparagus (Asparagus officinalis L.) and grape (Vitis vinifera) fruit from DR-037 of Altar-Pitiquito-Caborca, Sonora, Mexico 2014

José Luis Ríos Flores 1*, Becky Elizabeth Rios Arredondo 2, Jesús Enrique Cantú Brito 3, Hebrián Efraín Rios Arredondo 4, Sigifredo Armendáriz Erives 1, José Antonio Chávez Rivero 5, Cayetano Navarrete Molina 6, Rafael Castro Franco 1

Originales: Recepción: 8/10/2015 - Aceptación: 21/12/2017

Resumen

económicaEste trabajo y social estimó del aguala eficiencia en el cultivo del agua de enespárrago los cultivos versus de uvaespárrago de mesa. y vid Los en indicadores el Distrito de Riego 037 mediante el uso de indicadores que permitieron determinar la-1 , eficienciaUS$ 540.924 física, y US$ 945.190 de utilidad hm-3 y 48,6 y 10,7 empleos hm-3 respectivamente para espárrago y de la eficiencia física, económica y social del agua fueron 2.075 y 625 L kg vid. En conclusión, el espárrago en comparación con la uva de mesa es ineficiente en el uso del deagua utilidad en términos y 245,63 físicos hm3 dey económicos, agua usada pormas ambos no sociales, cultivos, el usoel espárrago del agua contribuyóen espárrago con genera 91%, 56,3%4,54 veces y 69,2% más respectivamente.empleo por unidad En de Caborca agua usada. el agua De es los un 8.281 recurso empleos, escaso, US$sin embargo, 163,63 millones a pesar de que la proporción utilidad m-3/costo m-3 fue de 29,7, ubica al agua regional dentro de lo que la economía llama la tragedia de los bienes de uso común, lo que ha provocado un serio problemaPalabras de sobreexplotación clave del acuífero, pues el productor hace un uso ineficiente del agua.

1 Uespárragoniv. Autónoma • uva de Chapingo. mesa • eficiencia Unidad Regional• productividad Universitaria del agua de • Zonasindicadores Áridas. económicos

C.P. 35230. *[email protected] 2 Univ.Domicilio Autónoma Conocido. de Coahuila. Bermejillo. Fac. Mapimí. de Cs. Biológicas-Ingeniería Durango. México. Apartado Bioquímica postal No.8, Ambiental. Coahuila. México.

Coahuila. México. 43 Inst.Univ. TecnológicoAutónoma Agraria de Estudios Antonio Sup. Narro de Monterrey Unidad Laguna. Campus Dpto. Torreón. de Producción Maestría en Animal. Administración y Control de Energía. Coahuila. México.

5 Univ. Autónoma Chapingo. Grupo Interdisciplinario de Vinculación. Durango. México. 6 Univ. Autónoma Chapingo. Departamento de Posgrado. Durango. México. Tomo 50 • N° 1 • 2018 101 Ríos Flores J. E. et al.

Abstract

This work estimated the efficiency of water in asparagusversus and vine table crops grape. in IndicatorsIrrigation District 037 through the use of indicators that allowed determining the physical,1 US$ economic 540,924 and social$ 945,190 efficiency useful of hmwater-3 and in the 48.6 cultivation and 10.7empleos of asparagus hm -3 respectively for asparagus of physical, economic and social efficiency of water were 2075 kg and 625 L- in physical and economic but not social terms, water use in asparagus generates 4.54 timesand vine. more In jobsconclusion, per unit asparagus of water used.compared Of the with 8,281 table jobs, grapes US$ 163.63is inefficient million water of utility use and 245.63 hm3 of water used by both crops, asparagus contributed with 91%, 56.3% and 69.2% respectively. In Caborca water is a scarce resource, however, even though the proportion utility m-3/cost m-3 was 29.7, it places the regional water within what the economy called the tragedy of the common goods. Which has caused a serious problem of overexploitationKeywords of the aquifer, as the producer makes an inefficient use of water.

asparagus • table grape • efficiency • water productivity • economic indicators Introducción

El agua dulce es indispensable para la Conforme la demanda de agua para vida, pero la cantidad disponible es escasa abastecer al sector agrícola crece, se y su distribución desigual. Solamente el incrementa la competencia por el recurso 0,26%, se encuentra realmente disponible por los demás usuarios, tales como el sector para todos los seres humanos (33), visto doméstico y el industrial (59), por lo que el reto principal que encara la humanidad es la agricultura es en extremo relevante. producir más alimentos con menos agua. de otra forma, el uso eficiente del agua en- Lo anterior es el encuadre de este trabajo, mente el 0,26% es agua dulce disponible, 2,24%Del es total agua de dulce agua no en disponible el mundo, al estar sola económica y social del agua usada por en los casquetes polares y en el permafrost laya agricultura que la eficiencia es clave y productividada largo plazo física,en la y aguas en extremo profundas y el 97,5% sostenibilidad en la cual debe circunscribirse es agua salada de los mares. Además, la la producción de alimentos. agricultura de riego en las zonas áridas y Esta meta puede lograrse solamente si semiáridas, emplea más del 80% del total se determinan estrategias apropiadas para del agua dulce disponible (56). Recientes estudios realizados por el en la agricultura. Una de las estrategias Instituto Internacional del Manejo del Agua, essalvar la de al incrementaragua y hacer lamás productividad eficiente su usodel indican que una tercera parte de la población agua (34). El concepto de la productividad que habita en los países desarrollados del agua fue establecido ya en 1966 por padecerá la escasez del agua, es decir; en 2003 Kijne et al., lo aplican como una para mantener sus necesidades agrícolas, medidaViets restringiéndole para determinar al ámbito la capacidad fisiológico, de domésticas,no tendrán industriales suficientes y recursos ambientales hídricos que los sistemas agrícolas de convertir el agua requerirán para el año 2025 (56). en alimento, pero no es sino hasta 2010

102 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 que Molden et al. explícita como: “La productividad del agua sería el inverso del índice de produc- le definen de manera tividad,que un índicees decir, de que eficiencia en el numerador en el uso delva netos de los sistemas agrícolas, forestales, la cantidad de agua usada y en el denomi- pesqueros,agua es la ganaderos proporción y agrícolas de los beneficios mixtos a la cantidad de agua utilizada para producir económico o social obtenido, el primero se expresanador laen cantidadkg m-3 y el desegundo producto en m 3 físico, kg-1. En la práctica se utiliza como una alimentos,esos beneficios. ingresos, En su sentidomedios másde amplio,subsis- herramienta de diagnóstico para deter- refleja los objetivos de producir más costo social y ambiental por unidad de como punto de partida para determinar aguatencia consumida. y beneficios ecológicos a un menor oportunidadesminar la eficiencia de redistribución del uso del de agua, agua y hacia cultivos más redituables. Seckler et al. (1998), indica que la producciónLa productividad agrícola y la físicacantidad del de agua productividad económica del agua se consumidase define -"más como cultivo la relación por gota"- entre y la productividad económica del agua se entre la cantidad de agua aplicada o asignada,refiere al valorel cual total puede o valor ser neto empleado dividido de agua utilizada y esto también se ha utilizadodefine como para el relacionar valor derivado el agua por uso unidad en la usos alternativos del agua, en este sentido agricultura para la nutrición, el empleo, el Riospara definiret al. (46, los costos47, 48, de 50) oportunidad generaron o bienestar y el medio ambiente”.

Revisión del estado actual de la enindicadores la producción de eficiencia de diversos y productividad cultivos. eficiencia del agua física,En económicael caso de ylos social forrajes del agua(46) usadaen el Con base en lo anterior, Ríos et al. - diferenciaron y aplicaron los índices de delDR017 agua en determinaron el norte de México,diversos y selecesce- ámbito de los forrajes (44), nogal (48), narios,cionando resaltando los más eficientesque era en posible el uso duraznoproductividad (45) y y trigo eficiencia (46) y del frijol agua (49), al crear patrones agrícolas que podrían diferenciando así los índices de “produc- disminuir el volumen de agua usada en - la producción hasta en 47%, equivalente rente connotación: a 492 millones de m3 (volumen casi igual tividad” y “eficiencia” (48) que tienen dife al volumen de sobreexplotación actual) y solo disminuir 2,5% (US$ 3,4 millones) el valor de la producción agrícola y 9% (469 empleos) el empleo. O bien, elevar 30,6% (US$ 42,1 millones) el valor de la Así, la productividad del agua es un producción agrícola, incrementar 90.4% cociente, en el que en el numerador va la (US$ 38,7 millones) las ganancias y 13% (656 empleos) el empleo, pero con un o social, mismo que se divide entre el costo de oportunidad ecológico elevado: volumencantidad de agua producto que físico,le dio económicoorigen tal incrementar 26% (273 millones de m3) el como Molden (2010) lo sugiere, mientras volumen de agua usado en la producción.

Tomo 50 • N° 1 • 2018 103 Ríos Flores J. E. et al.

El estado actual acerca del cono- obra "El secreto del boom del espárrago: es la sobreexplotación del agua", ya que y social del agua, mediante la generación "en 2009 la explotación del acuífero en decimiento indicadores, de la eficiencia permite optimizarfísica, económica el agua Ica alcanzaba 543,15 millones de metros a la vez que se maximizan el valor de la cúbicos (MMC) anuales, mientras el producción, las ganancias y el empleo. volumen de explotación sustentable -el El concepto de huella hídrica fue intro- que permite la recarga del acuífero-, ducido por primera vez por Hoekstra y según la ANA, es de solo 252,99 MMC; Chapagaine (2004) en el Instituto para - Educación en Agua de la UNESCO en 2004, tación de 290,16 MMC de agua", añade y fue luego desarrollado por la Univer- que:esto "Se significa recomienda que hay producir una sobreexplo donde el sidad de Twente en los Países Bajos y agua es abundante y vender donde el agua por la Red de Huella Hídrica (WFN por es escasa. Ya se están desarrollando inicia- sus siglas en inglés). La huella hídrica fue tivas para etiquetar los bienes ofrecidos a propuesta como un indicador alternativo a los consumidores en países como España y el Reino Unido, indicando cuánta agua ha sido utilizada en su producción. No sería aguala medición hacia dentro de la eficiencia y fuera de del los uso países de agua, con extraño que, en unos años, los espárragos así como para ilustrar los flujos virtuales de o uvas peruanos estén obligados a llevar y de suministro de agua necesarios para esta etiqueta, pues existe una mayor preo- mantenerel fin de comprender el consumo los de requisitos un país (66). directos cupación de los consumidores de los países China, con 735 mil Toneladas Métricas, de destino de las exportaciones acerca del equivalente al 88,8% de la producción impacto medioambiental de sus decisiones mundial es el principal productor de de compra, y sobre el futuro de los recursos espárrago en el mundo, Perú el segundo hídricos en países como el Perú". productor concentra el 4,6% de la En otros cultivos, como el maíz producción mundial con 376,7 miles de (Zea mays) del centro y noreste argentino TM (58). En relación con el espárrago Álvarez et al. (2016) señalan que el riego de Perú, Salazar (2012) señala que "el y la fertilización reducen la huella hídrica, promedio anual del volumen de agua que determinando índices promedio de 803, usan las empresas agroexportadoras para 602 y 488 hasta 803 L kg-1, dependiendo su riego es de 15 mil metros cúbicos (m3) de si el maíz es producido bajo secano, por hectárea, y en otros casos el consumo aumenta a 22 mil m3 de agua. "En la óptima respectivamente, lo cual es criti- última década Perú ha tenido una notoria cableriego yen riego tanto óptimo son promedios con fertilidad aritméticos edáfica expansión en este cultivo, pero su elevada para las huellas hídricas de diez loca- huella hídrica de 5031,86 m3 t-1 (15), ha ciones, y debió estimarse esa huella hídrica originado, de acuerdo con Salazar (2012), mediante promedio ponderado, ya que al que entre 1990 y 2008 la producción pasase de 5 a 125 millones de kg año-1, en cada una de las diez locaciones, así pero el costo de oportunidad ha sido que comotener tener diferentes diferentes superficies rendimientos cosechadas por el manto freático descendiera de 28 a de conducción de la red hidráulica, la Ica y Villacurí, principales zonas produc- huellahectárea hídrica y diferentes promedio índices aritmético de eficiencia es toras,37 m bajopor deello la es superficie que el autor en los titula Valles a desu diferente a la promedio ponderado.

104 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 México es el tercer país productor de Lo anterior fue el motivo del presente espárrago (10), de acuerdo con el SIAP trabajo: indagar sobre la productividad (2015) con 22.231 ha cosechadas y 198 mil 75 TM producidas, ocupó el 2,4% de la en el cultivo de espárrago, contrastándole producción mundial. Sonora es el principal confísica, la económica vid, y así y social generar del aguaindicadores de riego estado productor de México, al contribuir numéricos que en principio señalen la con 56,2% y 62,2% respectivamente para todo, indicadores que aporten datos sobre nacional respectivamente. En Sonora, el laeficiencia posible sobrecon que explotación usa el agua, del pero agua. sobre espárragola superficie usa cosechada 20 mil m y3 ha la -1 producción, (tabla 1), et al. (2011), no hay estudios sobre la productividad el manejo del agua basado en parámetros de productividadDe acuerdo con puede González mejorar su uso y espárrago, mucho menos sobre su efecto contribuir a su ahorro en aquellos sistemas depredadorfísica, económica en el escaso y social recurso del aguahídrico, en donde se consume cantidades excesivas tal como ha señalado Salazar (2012) para el Perú, productividad agrícola del agua y el valor mismo estado de Sonora, de acuerdo con consideradode agua. No existeen el numerador solo una definición depende delde Olmedo et al. en(2017 el DR041 a), el establecimientoRío Yaqui, en el enfoque y del tipo de trabajo que se realice, de una agricultura intensiva aunado a así como de la disponibilidad de datos. una prolongada sequía colapsó las presas Sin embargo, la productividad del agua y la actividad agrícola en 2002-2003, lo -3), vista como que puso de relieve una agricultura no la cantidad de producto generada por sustentable, por lo que la optimización unidaden términos de agua físicos es un (kgconcepto m útil cuando del agua de riego se convirtió en un tema se compara la productividad del agua en central para ese distrito.

Tabla 1. Productividad del agua de algunos cultivos en el mundo. Table 1. Water productivity from someone crops in the world. Productividad Cultivo kg m-3 País Fuente económica Alfalfa verde 3,79 0,05 US$ m-3 México Ríos et al. (2015) Algodón 1,04 0,23 € m-3 España Montesinos et al. (2011) Arroz 0,39-0,52 Sd Mundial Kijne et al. (2003) Arroz 0,17-0,38 Sd Pakistán Ahmad, Masih y Turral (2004) Arroz 0,81 0,42 € m-3 España Montesinos et al. (2011) Avena forrajera 2,42 0,07 US$ m-3 México Ríos et al. (2015) Comino 0,27-0,31 Sd India Rao et al. (2010) Fresa 0,05 21,4 € m-3 España Montesinos et al. (2011) Frijol 0,93 Sd Cuba López et al. (2011) Girasol 1,23 0,25 € m-3 España Montesinos et al. (2011) Maíz criollo 0,68-1,4 Sd México Rojas et al. (2013) Maíz forrajero 5,28 0,07 US$ m-3 México Ríos et al. (2015) Maíz grano 0,38 0,42 € m-3 España Montesinos et al. (2011) Olivo 0,39 0,97 € m-3 España Montesinos et al. (2011) Trigo 0,78-2,03 Pakistán Ahmad, Masih y Turral (2004) Trigo 1,49-3,11 México Ríos et al. (2016) Fuente: Elaboración propia. / Source: Own elaboration.

Tomo 50 • N° 1 • 2018 105 Ríos Flores J. E. et al. diferentes partes del mismo sistema o directo sobre el rendimiento del cultivo así cuenca y también cuando se compara la como sobre el consumo de agua, por lo que productividad del agua en la agricultura la productividad del agua es variable de una con otros usos posibles del agua (12), con región a otra, incluso de una parcela a otra la ganadería por ejemplo. aun cuando se produzca el mismo cultivo, Carrasco, Pistón y Berbel (2010) como se observa en la tabla 1 (pág. 105). indican que para entender el desarrollo El incremento de la productividad del de la agricultura de riego en una agua es particularmente importante en determinada región es necesario estudiar regiones donde el recurso es escaso (29). la evolución de la productividad del agua En este sentido en la Región noroeste de en los cultivos de regadío, ya que estos México el 83,9% del agua dulce disponible resultados mostrarán si existe o no una se emplea para la agricultura (41), aunado disminución en el consumo de agua por a que, de acuerdo con Reyes y Quintero hectárea y si los cambios en el patrón (2009), el uso irracional de los recursos de cultivos y otras tecnologías (semillas hidrológicos ha provocado fuertes mejoradas y/o sistemas de riego) podrían problemas ambientales, particularmente incrementar la productividad del agua y en el estado de Sonora, donde se encuentra

Asimismo de acuerdo con González- Entre 2002 y 2012 el inventario Robainahacer más et eficiente al. (2015), el uso para del el recurso. mejor uso el Distrito de Riego analizado. económico y social del agua se requieren varió de 816 a 926 hm3/año, pero de métodos para evaluar su productividad, lade demanda aguas superficiales de agua creció y subterráneas de 1.053 a 1.372 hm3/año, lo que elevó el a políticas y estrategias de utilización de 3/año, maneraa fin de tomar sostenible. mejores Los decisiones administradores en cuanto incrementando así el agotamiento de los del agua para el riego necesitan identi- acuíferos,déficit hídrico su contaminación de 237 a 446 y salinización hm del agua. Por ello se han observado cambios importantes en el patrón de cultivos de yficar mejorar tendencias la productividad en los patrones por unidad de uso de y Caborca, principalmente orientado hacia volumenniveles de utilizado eficiencia y/o con consumido. vistas a fijar metas cultivos con mayor margen de utilidad (7), En este sentido existen muchos trabajos lo cual no soluciona la sobreexplotación realizados para distintas regiones del del acuífero, de hecho, cultivos como mundo o a escala global, indicando la el espárrago que demandan de 2.000 a 2.400 m3 por ha exacerban la extracción (kg m-3) y económicos ($ m-3), para una de aguas subterráneas, agravando el variedadproductividad de cultivos agrícola dentro en términos de las quefísicos se principal problema socioeconómico de incluyen; cereales, frutales, aromáticas, Cabora-Altar-Pitiquito: la escasez de agua. industriales y forrajeras (tabla 1, pág. 105). La variabilidad en la productividad del y trigo eran anteriormente, los más agua según Zwart y Bastiaanssen (2004), importantesDe esta forma, para cultivosla región. como Si bien algodón se los son atribuibles al clima, manejo del agua de riego, así como el aporte de nutrientes reducida, ocupando su lugar cultivos más al suelo. Asimismo, Molden et al. (2010), rentables:sigue cosechando, el espárrago, su superficie la vid y hael olivo sido menciona que los diferentes ambientes y (8), pero ante este cambio en el patrón de las condiciones de manejo tienen un efecto

cultivos, el déficit de agua se ha elevado.

106 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 a lo determinado por Insunza (2008) para hidráulica "EC" del agua de riego, es un índiceEl índicemayor dea cero eficiencia y menor de a conducción la unidad, Actualmente el 61,26% de la super- el DR075 de Río Fuerte. cantidad de agua extraída de una fuente encuentra establecido con espárrago, vid "A"SIAP (una le definepresa por implícitamente ejemplo) para como irrigar la yficie olivo agrícola (50). Sin de embargo, ese Distrito el problema de riego de se una parcela "B" distante a varios km de la escasez del agua en Sonora de acuerdo "A", de manera tal que el índice se obtiene con Wilder (2002) son el resultado de al dividir el volumen extraído entre el una compleja combinación de factores, volumen que llegó a la parcela. incluyendo los naturales como la sequía y la variabilidad del clima, además de SIAP (2014) señala que entre 1970 y 2013, los factores estructurales tales como el en LaEn Comarca el DR017 Lagunera, en La Comarca México, Lagunera, la EC fue fomento de la producción de cultivos en promedio igual a 0,6805 (con variaciones rentables con láminas de riego altas, dado desde 0,51 hasta 0,81), es decir, que por que estos cultivos tienen como destino el cada m3 de agua soltado, corriente arriba mercado estadounidense. en la Presa Lázaro Cárdenas, llegaron a la parte baja de la cuenca, 220 km corriente lámina de riego para el cultivo de vid con abajo, solamente 680,5 litros. riegoDe por acuerdo cintilla con es de el 1,0 INIFAP m, mientras (2010), que la Cuando es un riego altamente tecni- en el espárrago la lámina neta es de 2,0 m. - Por ello el objetivo de este trabajo fue compuertas y la fuente de agua es un determinar indicadores numéricos de la pozoficado que como extrae aspersión, agua subterránea, cintilla, microEC se acerca a la unidad, si es riego poco tecni- agua de riego en el cultivo de espárrago y eficiencia física, económica y social del zona agrícola es muy distante, EC es más de Riego 037. La primera hipótesis fue que pequeñoficado con y aguatendiente de ríos, a cero. presas o lagos y la contrastarle el cultivo3 dekg -1vid) del en aguael Distrito en el Estudios previos demuestran que el cultivo de vid es superior al espárrago, cultivo de trigo en Ensenada, Baja Cali- la eficiencia física (m fornia, al Oeste de Sonora, muestran económica (US$ de ganancia hm-3) del que un m3 de agua produjo 0,321 kg en aguala segunda en el hipótesis cultivo fuede queespárrago la eficiencia fue superior al de vid, la tercera hipótesis fue mexicanos"términos físicos, en el una contexto pérdida del de MX$comercio 1,51 (empleos hm-3) es superior en espárrago mundial)(MX$ es lay denominacióngeneró solamente para "pesos0,025 que enla eficienciavid. social del agua de riego empleos hm-3 de acuerdo con Ríos et al. (2016), Insunza (2008) determinó que Materiales y métodos de Sonora, el mismo m3 de agua produjo 0,17en el kg DR075 si se irrigaba Río Fuerte, en algodón Sinaloa, y 0,40 al sur kg si se usaba en trigo. Asimismo, ese mismo de Riego 037, Altar-Pitiquito-Caborca, m3 Sonora,El área México. de estudioSe localiza fue elentre Distrito los meridianos 111°29' y 113°08' longitud Montesinos produjo MX$et al. 0,147 (2011) de gananciadeterminó en oeste, y paralelos 29°54' y 31°22' latitud 0,23€algodón m y-3 MX$de 0,139productividad en trigo; eneconómica España, norte, a una altura que varía entre 10 a para el cultivo de algodón, muy superior

400 m s. n. m. (figura 1, pág. 108). Tomo 50 • N° 1 • 2018 107 Ríos Flores J. E. et al.

Figura 1. Figure 1. Localización del área del DR037, Altar-Pitiquito-Caborca, Sonora, México. Location área DR037, Altar-Pitiquito-Caborca, Sonora, México. la fuente registra que se recomienda riego por goteo y que las principales plagas son el tipoDe de acuerdo clima es con seco la estepario clasificación BS, KW de el pulgón europeo, la chicharra cantadora, (x')Köppen, (8e'). modificadaLa temperatura por media García anual (1981) es el gusano soldado, chinche apestosa, araña de 21,2°, con precipitación media anual roja y trips, la cosecha es diaria, iniciando de 269 mm, con evaporación media de la última semana de diciembre y hasta la 2.346 mm (7). La extracción anual para segunda semana de abril. uso agrícola es de 500 Millones de metros En relación con la vid, en Caborca, Sonora cúbicos (Mm3), para el riego de 35.000 los cultivares de uva de mesa son la Perlette, hectáreas ha provocado un serio problema Flame, Superior y la Red globe, iniciando la de sobreexplotación de los acuíferos. cosecha desde la primera semana de mayo La Agenda Técnica Agrícola de Sonora (Perlette) y hasta la primera semana de (2015), señala que el espárrago es uno de los junio (Red globe). Para la poda, del 15 de pilares económicos de la región de Caborca, diciembre al 15 de marzo, se usa cianamida Sonora, con más de siete mil hectáreas. de hidrógeno, el aclareo puede ser manual o químico con ácido giberélico, la fertilización

Destaca su importancia económica-3, y socialmente y social, produceseñala que 185 la eficiencia jornales económicaha-1, pero usadel aguamucha de cosecha-caídase hace en las etapas de hojas, de brotación- con 120-150 floración, kg de agua:riego sede estima2 a 2,4 enm de MX$ lámina 1,2 m anual de riego, lo N,floración- 110 kg de envero, P, 140 kg envero de K, 25 cosecha kg de Ca y cual pude reducirse con riegos presurizados, 25 kg de Mg. En riego por goteo con goteros siendo las variedades más usuales la Brock, autocompensados separados entre 0,50 a UC-157, UC-115, Atlas, Early California y la 1 m, la lámina de riego es de 90 a 100 cm. Jaleo. Con densidades desde 1,5 a 5 kg ha-1 si Las principales plagas son la Chicharrita se siembra como semilla y de 3 a 4 coronas de la vid, gusano presidiario, trips y piojo por metro a doble hilera cuando se trasplanta, harinoso Planococcus ficus; las principales requiriéndose de 200 a 400 kg de Nitrógeno, enfermedades son la cenicilla polvorienta, de 100 a 150 kg de Fósforo y de 100 a 150 kg la pudrición negra, mildiu velloso y la de Potasio por hectárea. En cuanto al riego, pudrición texana (1).

108 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 La disponibilidad del agua para riego ha disminuido, en 1999 a través de 887 pozos, el volumen de extracción anual era de 660,10 Mm3, del cual 648,70 Mm3, donde: se empleaban para uso agrícola (98,27%), 9,8 Mm3 para uso público, 1,50 Mm3 para de la red de distribución (0 ‹ EC › 1) uso doméstico, y 0,10 Mm3 para uso La"EC"= utilidad eficiencia "U" por de conducción hectárea (expresada hidráulica industrial (44). Se calcula que los niveles en US$ ha-1) si bien es una variable estáticos variaron de 43 m en 1970 a 67 m independiente de la que dependen en el 2001, sin embargo en ese mismo año las variables Y3, Y4, y Y5, a su vez ella se determinaron profundidades estáticas depende de tres variables que actúan mayores a los 120 m y dinámicas mayores independientemente: RF, p, y el costo por a los 140 m (25), además, se tiene una hectárea "C", ya que: 3 descarga de 3,5 Mm de aguas negras a U = RF (p) - C tierras agrícolas (62). donde: Variables dependientes e indepen- "C" = variable independiente de las que dientes dependen algunas de las variables evaluadas en este trabajo, es a su vez dependiente de dos variables independientes: los costos BrutoCon de las la cifras Producción de superficie "VBP" cosechada y costos variables (dependientes a su vez de los de"SC", producción producción "C" por física ha, "PF",número Valor de costos de: fertilización, labores culturales, jornales “J” por ha y lámina de riego "LR" costo del riego o costo de extracción del de FIRA 2014 y la paridad cambiaria agua del subsuelo, control de plagas, "PC" del Banco de México, se obtuvieron malezas y enfermedades, cosecha- las variables independientes: "RF" selección y empaque, comercialización,

(volumen de agua empleado por el cultivo por(rendimiento hectárea), físico"p" (precio por hectárea), por t), "U" "V" amortizacióndiversos, y costos de bienes financieros) de capital y los y costos renta (Utilidad o ganancia bruta por hectárea) delfijos suelo); (dependientes la variable a su vezindependiente de los costos del de y "E" (empleo generado por el cultivo) empleo "E" generado por el cultivo aparece de las que dependieron las seis variables en la variable dependiente Y6 (empleo por dependientes evaluadas en este trabajo hectómetro cúbico) donde "E" proviene (los indicadores de productividad y de multiplicar la cantidad de jornales "J"

1 a Y6). SC dividido todo ello entre 288 (el cual es eficiencia del agua Y elpor producto hectárea de por multiplicar la superficie 6 jornadas cosechada por cosechadaEl rendimiento (SC): físico "RF" relaciona a la semana por 48 semanas al año), es decir: producción física (PF) entre la superficie

RF, y se expresa en tonelada o kg por hectárea, el volumen "V" de agua por Si se alude a una hectárea solamente, hectárea (en m3) demandado por el cultivo entonces SC es igual a la unidad. a escala comercial, "V" depende de LR y EC, dado que:

Tomo 50 • N° 1 • 2018 109 Ríos Flores J. E. et al.

Indicadores de eficiencia y produc- (1) tividad La naturaleza de este trabajo es cuantitativo-descriptiva, no experimental, ya que se emplearon datos cuantitativos La variable Y2, es una variable depen- provenientes de la producción a escala diente que a pesar de depender de las

mismas variables independientes que Y1, por hectárea, el volumen de agua empleado al ser su inversa, tiene connotación dife- realmentecomercial, por tal hectárea como rendimientos y láminas de físicosriego rente, es de índole de productividad del empleadas por los productores agrícolas, de kilogramos producidos de uva o uso del agua, a diferencia de los datos espárragoagua, no de por eficiencia, m3 de agua expresa irrigada. la cantidad experimentalesrefleja la eficiencia que serían y productividad solamente delde (2) carácter indicativo. Por ejemplo, en La Comarca Lagunera, al norte de México, el INIFAP (Instituto Nacional de Investigaciones

Forestales Agrícolas y Pecuarias) recomienda La variable dependiente Y3, representa para el cultivo de alfalfa (Medicago sativa) una la relación entre la utilidad monetaria lámina de riego de 1,2 m, pero usualmente en o ganancia "U" bruta por hectárea y el esa región, los productores riegan de acuerdo volumen "V" de agua empleado en su con su experiencia aplicando láminas que generación. Y3 depende de las variables sobrepasan los 2 m, con lo que el volumen U y V. El numerador es la utilidad bruta de agua empleado por hectárea se dispara de "U" generada por el cultivo, igual al 12.000 m3 recomendados por INIFAP hasta rendimiento monetario "RM" por ha los 20 a 24 miles de m3 realmente empleados menos el costo "c" por ha. RM es el por ha por el productor. Aplicando las ecuaciones Y1 a Y6 deter- ha por el precio "p" por t. El denominador minadas por Rios et al. (2015), se tiene que deproducto esta ecuación del rendimiento es el mismo físico numerador "RF" por la primera variable evaluada, la Y1 , mide la que se señala en la ecuación Y1. Esta variable es expresada en US$ generados que se expresa en litros de agua empleados de ganancia por m3 de agua irrigada. eneficiencia el riego conpor kilogramo que se usa de el uva agua o espárrago de riego, (3) producidos, y depende de las variables independientes "V", RF, LR y EC, donde "V" es el volumen de agua que representa la demanda hídrica del cultivo en una hectárea La variable Y4 es la inversa de la variable 2 (en litros), V es el producto de 10.000 m por Y3 la lámina de riego "LR" (LR es la columna de agua, en metros, que demanda el cultivo en agua,, tiene se unexpresa significado en m diferente,3 de agua ya irrigada que es una producción a escala comercial, conver- porun indicador cada US$ de utilidad.eficiencia económica del tidos los m3 - (4)

"EC" (en porcentaje, a litros) endividida base 1) entre , y "RF" el coefi es el ciente de eficiencia hidráulica de conducción (en kg). rendimiento físico por hectárea del cultivo

110 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 La variable dependiente Y5 es la división por algunos autores como la relación que de Y4, entre el costo en el cual incurre el existe entre el empleo y el agua consumida, productor por la extracción del subsuelo de cada m3 de agua (C m-3), es señalado como precio del m3 de agua. Expresada como elutilizados numerador en la es evaluación el empleo de generado la eficiencia por y un índice positivo mayor, menor o igual a cultivoproductividad asociados del al agua uso (11, de un 12, hm 17).3 de Donde agua usada en el riego, el cual va en el denomi- utilidad generada por m3, es superior a lo nador. El número 288 bajo "J" en la ecuación quela unidad. el productor Donde pagó mayor por a cada 1 indica m3 de que agua la 6, presupone que un empleo permanente extraída del subsuelo, y menor a 1 señala equivale a 288 jornadas de trabajo al año, que la utilidad generada es inferior al costo es decir, seis jornadas por semana por del metro cúbico de agua. cuarenta y ocho semanas al año. (5) (6)

La variable Y5, en tanto trata de un recurso común o comunal, el agua subterránea. El consumo de agua subterránea puede generar externalidades de jornales por hectárea del cultivo, tiene agua, mediante el costo de su extracción del históricamenteDebe observarse tendencia que J, es decreciente el número subsuelo,ambientales, pero en la tantoapropiación se fija un precio al debido a la mecanización de la agricultura. logrado con ese bien eminentemente social Para fomentar el empleo que se asocia al es de carácter privado. Paradójicamente, del beneficio al uso del agua de riego, debe contrarrestarse llegar a formularse una medida de política el efecto negativo en el empleo por parte al agua extraída del subsuelo, donde ese hidráulica EC de conducción del agua de precioeconómica no solamente encaminada cubra a fijar el uncosto precio de riegode J, mediante a la par de la laelevación reducción de dela eficienciala lámina extracción sino que además contempla de riego LR. Esto se lograría con acciones una tasa impositiva para el productor que que van desde buenas labores culturales, use ese bien común, con aras a elevar la manejo del suelo, uso de abonos naturales, etc., hasta el extremo de la mejora genética productores agrícolas pobres pudieran del cultivo, que demande menos agua. usareficiencia el agua. del usoLa usarían imposibilitaría principalmente que los los productores ricos, ya que tendrían acceso a mejoras tecnológicas que les Resultados y discusión permitieran cubrir ese precio del agua Contexto de la producción de Como indicador de la importancia social espárrago y uva de mesa del DR037 delahora agua, artificialmente se generó la variablealto. dependiente

Y6, que mide el número de empleos agrí- colas asociados al uso de un hm3 (un millón 037De durante acuerdo el ciclo con agrícola el SIAP 2014 (2014), fue de la de m3) de agua empleada en el riego. Esta 28.747,55superficie cosechadahectáreas delde Distritolas cuales de 8.518Riego productividad social del agua, es propuesta (29,63%) fueron cosechadas de espárrago y 7.563 hectáreas (26,30%) de uva de mesa.

Tomo 50 • N° 1 • 2018 111 Ríos Flores J. E. et al.

Asimismo, según CONAGUA (2015), determinada para el cultivo de espárrago fue para el riego del distrito se emplearon un de US$ 10.818, lo cual indica que el espárrago total de 298,90 hm3 para la producción obtuvo una ganancia 14,5% superior a la de un patrón de cultivos compuesto por ganancia que generó el cultivo de uva de mesa. 24 cultivos. Se determinó que el cultivo del - espárrago empleó un total de 170,36 hm3 (56,99%), mientras que la uva de mesa elDe indicador acuerdo confue la1,92 tabla y 2,98 2, la enRelación el cultivo Bene de utilizó 75,63 hm3 (25,30%), lo que indica uvaficio de Costo mesa, (R lo B/C) que muestra indica que que ambos en espárrago cultivos que ambos cultivos emplean el 82,29% del resultan rentables en esa región. agua disponible (tabla 2). Asimismo, la tabla 2, muestra la cantidad En la tabla 2 se observa que el ingreso de jornales invertidos por hectárea en por hectárea en espárrago fue de US$ 22.585 ambos cultivos, mientras en uva de mesa y US$ 14.233 en uva de mesa, mientras que se requirieron un total de 30,89 jornales el costo por hectárea en espárrago fue de ha-1, en espárrago se emplearon un total US$ 11.766, y en uva de mesa el costo fue de 280 jornales, de los cuales el 75,71% US$ 4.781 ha-1. La ganancia por hectárea se emplean en actividades de cosecha,

Tabla 2. generado y volumen de agua empleado en el riego de espárrago y uva de mesa. Relación Beneficio-Costo (R B/C), horas de trabajo por tonelada, empleo Table 2. and volume of water used in irrigation of asparagus and grape fruit. Relationship Benefit-Cost (B/C R), hours of work per t, generated employment Espárrago/ Variables Vid mesa Espárrago Vid mesa 7.563 8.518.0 1,13 Producción anual (t) 67.946 82.093,0 1,21 RendimientoSuperficie cosechada (t ha-1) (ha) 16,00 9,64 0,60 Precio medio (US$ t-1) $ 890 $ 2.343 2,63 Ingreso ha-1 (US$) $ 14.233 $ 22.585 1,59 Costo ha-1 (US$) $ 4,781 $ 11.766 2,46 Ganancia ha-1 (US$) $ 9,452 $ 10.818 1,14 2,98 1,92 0,64 Numero de jornales ha-1 30,89 280 9,06 ProductividadRelación Beneficio/Costo (t jornada-1) 0,518 0,034 0,07 Costo t-1 (US$) $ 299 $ 1.221 4,09 Ganancia jornada-1 (US$) $ 306 $ 39 0,13 Lámina de riego neta (m) 1,00 2,00 2,00 Volumen de agua empleado (hm³) 75,63 170,36 2,25 Ganancia monetaria total (Millones de US$) $ 71,48 $ 92,15 1,29 Total, de jornales al año 233.621 2.385.040 10,21 Número de empleos permanentes 811 8.281 10,21 Capital invertido en la producción (Millones de US$) $ 36,16 $ 100,22 2,77 Fuente: Elaboración propia con base en cifras de costos de producción por ha y lámina de riego a nivel comercial

(de 1.0 m para vid y 2.0 m para espárrago) de FIRA (2014), y cifras de superficie cosechada, producción, rendimientos físicos por ha, precios por t, número de jornales por ha de SIAP (2014), y paridad cambiaria MX$ 16,1745 por dólar norteamericano del Banco de México al día 8 de agosto de 2015 a 17:20 horas. Source: Own elaboration, based on cost production per hectare figures and commercial irrigation sheet (1.0 m for grapevine and 2.0 m for asparagus)determined from by Bank FIRA of (2014), Mexico and on figuresaugust of8, 2015harvested at 5:20 area, p.m. production, physical yields per ha, prices per t, number of work journal per ha of SIAP (2014), and parity exchange MX$ 16,1745 per US dollar

112 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 selección y empaque. Esta disparidad Los costos de cosecha-selección- entre los jornales que requiere cada cultivo empaque y fertilización fueron los más produjo una diferencia en cuanto a la importantes en espárrago (44,6%), en vid productividad, mientras en uva de mesa lo fue la fertilización (22,1%). El rubro de se generaban 0,518 t jornada-1 y US$ 306 riego, que contempla el agua usada en la de ganancia jornada-1, en espárrago se producción, fue relativamente de los más obtuvieron 0,034 t jornada-1 y US$ 39 de bajos: 15,5% en vid y 10,6% en espárrago. ganancia jornada-1. En el espárrago, por sí solo, el rubro de cosecha-selección-empaque representó Costos de producción de los cultivos 33%, la causa es que emplea mucha mano de espárrago y uva de mesa en el DR037 de obra: en esta etapa se emplearon 202 de La tabla 3 muestra el resumen del los 280 jornales que se requieren en total. costo total por ha desagregado en sus En este sentido Rodríguez et al. (2014), dos componentes: los costos variables mencionan que la variable más relevante en el costo total correspondiente a la de los costos variables (fertilización, producción de espárragos orgánicos en laboresy los costos culturales, fijos. El riego, análisis control porcentual de Chile, es la mano de obra, la cual representa plagas-malezas-enfermedades, cosecha- un 71,5 % del costo total anual, mientras selección-empaque, comercialización, que en uva encontraron que el costo de la mano de obra representó 43,6% del total. (depreciación de maquinaria y equipo Asimismo, en la tabla 3, se indica que ydiversos renta ydel costo suelo). financiero) Muestra y costos que fijoslos en términos relativos, el costo del riego costos variables fueron de 67,5 y 86,2% en el espárrago fue bajo: 10,6%, en uva de mesa representó el 15,5% del total. A espárrago respectivamente. pesar de la importancia que tiene el agua y los costos fijos 32,5 y 13,8% en uva y para esta región árida en el análisis de los costos de producción se observa, ahora en Tabla 3. Costos por hectárea de términos absolutos, que el precio del m3 espárrago y uva de mesa (pérgola sin en ambos cultivos, US$ 0,06 en espárrago empaque) irrigados por cintilla en el y US$ 0,07 en uva de mesa (tabla 3). Al comparar con otros cultivos en americanos US$. México estos precios/m3 fueron superiores DR037, Caborca, Sonora. Cifras en dólares Table 3. Cost per hectare of asparagus a los determinados por Ríos et al. (2015) and grape fruit (pergola unpackaged) en la Comarca Lagunera para un grupo de cultivos forrajeros en los cuales, el precio promedio por m3 fue de US$ 0,02 m-3, osci- irrigated by strap on the DR037, Caborca, lando de US$ 0,02 m-3 en avena forrajera Concepto Uva de mesa Espárrago Sonora. Amounts in Dollars US$. -3 Costos variables $ 3.229,00 $ 10.148,00 hasta US$ 0,03 m en rye grass. Asimismo, $ 1.552,00 $ 1.618,00 Ríos et al. (2015) en el cultivo de durazno Costo total por criollo determinaron un índice igual a $ 4.781,00 $11.766,00 hectáreaCostos fijos MN $ 0,40 m-3 (equivalente a US$ 0,024), Precio del m3 de $ 0,07 $0,06 en Zacatecas, México, mientras que para agua al productor el cultivo de trigo grano en el Valle de Fuente: Elaboración propia, con base en cifras de FIRA (2014). Mexicali, Baja California Ríos et al. (2016) Source: Own elaboration, based on dates from determinaron un precio por metro igual a FIRA (2014). US$ 0,012 m-3.

Tomo 50 • N° 1 • 2018 113 Ríos Flores J. E. et al.

Al comparar el precio/m3 del agua en se origina de un cambio de uso de suelo espárrago de Caborca con el precio/m3 del en la cuenca”. Así es permisible contrastar agua usada en espárrago en otras partes el precio pagado por el m3 de agua usado del mundo, fueron inferiores. Los producen el riego al producir espárrago o vid en tores de espárrago estadounidenses contra del precio que, en promedio está pagan US$ 0,78 m-3 empleado en el riego dispuesto a pagar el consumidor urbano (24), en la región del Ica, Perú el costo es por el agua potable. Para el norte de México de US$ 0,25 m-3, en la Libertad en Perú, el en 2008, donde un consumidor promedio costo es de apenas $ 0,018 m-3 (31). pagaba US$ 0,02745 m-3 (equivalente a Por otro lado, usuarios de tipo doméstico -3) (2008), implicando ello que pagan entre US$ 0,30-US$ 0,80 m-3 (2004), el precio pagado por el agricultor por el mientras los agricultores de Israel pagan aguaMX$ 4,44que usam en el riego, es de solamente US$ 0,57 m-3, lo que evidencia que el precio entre 21,85% y 25,50% el precio al del m3 que está dispuesto a pagar por el agua potable el consumidor urbano. Lo cual Takele yde Kallenbch agua en el(2001), DR0-037 los precioses bajo delen permite entender que el precio del agua aguarelación son con importantes los señalados. para De la acuerdo mejora con de es solamente uno de entre las múltiples la demanda y de la conservación de este causas de los enfrentamientos, armados recurso. En este sentido Ramírez-Vallejo incluso, que han existido en Sonora, entre y Rogers (2010), indican que el Tratado los indios Yaqui, usuarios agrícolas del agua y la población urbana que quiere entre México y Estados Unidos propició la que el agua de las presas se destine al exportaciónde Libre Comercio de agua virtual (NAFTA) de las firmado zonas consumo urbano y no al consumo agrícola áridas y semiáridas de México hacia USA. (4, 40, 63). En el mismo sentido, usando Al establecer líneas atrás, que el precio el método de valoración de contingencia, del agua en espárrago (US$ 0,06 m-3) y Ríos et al. (51), determinaron que vid (US$ 0,07 m-3, tabla 3, pág. 113) es mientras el agricultor productor de frijol muy bajo, no es un juicio de valor, es el (Phaseolus vulgaris) en Zacatecas, México, resultado de una valoración por el método contingente, el cual pretende estimar la (US$ 0,03) m-3, el consumidor urbano de máxima disposición a pagar de un indi- aguapaga potable (en moneda paga (en de moneda 2015) MX$de 2015) 0,48 viduo por la provisión o mejora de un bien por ese mismo volumen de agua hasta de no mercado o, alternativamente, la -3. mínima disposición a ser compensado por la pérdida o disminución del mismo bien, MX$Indicadores 50,33 (US$ 3,11)de productividad m física, pues con base en Oyarzún et al. (2005). económica y social en espárrago y uva “La medida de valor económico de mesa obtenida a través de esta función El análisis de la productividad y corresponde al cambio en productividad marginal del agua del estero valorado al (pág. 115), la cual muestra los indicadores precio de mercado del agua potable. Esto productivos,eficiencia del económicosagua se observa y sociales. en la tabla Los 4 indicadores que evalúan la productividad aguasignifica potable que el medida valor económico en metros está cúbicos dado más ampliamente empleados en una gran anuales,por el cambio resultante físico de enun produccióncambio en dela variedady eficiencia de cultivos del agua en sonEspaña de los(3, 18, índices 54). producción de agua del estero, que a su vez

114 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 Tabla 4. Cifras monetarias en US$. Indicadores de la productividad y eficiencia del agua en espárrago y uva de mesa Table 4. producida en el DR-037 Altar-Pitiquito-Caborca, Sonora. Indicators of productivity and efficiency of water in asparagus and grape fruit Uva de Espárrago/ produced in theVariable DR-037 económica Altar-Pitiquito-Caborca, Sonora.Espárrago Amounts in Dollars US$. mesa Uva -1 Y1 = L kg 625,00 2.075,00 3,32 -3 Y2 = kg m 1,60 0,48 0,30 -3 Y3 = Utilidad bruta hm (US$) $ 945.190 $ 540.924 0,57 3 Y4 = m por dólar de utilidad bruta 1,058 1,849 1,75 -3 3 Y5 = Utilidad bruta m /Precio del m 14,3 29,7 2,09 -3 Y6 = Empleos generados hm 10,7 48,6 4,53 Fuente: Elaboración propia. / Source: Own elaboration.

En México existe escasa información región de Altar, aún deben aplicarse mejoras en la gestión del agua de riego con las cuales del agua en la agricultura no es un tema se incremente la productividad del agua en queal respecto, haya permeado, el uso eficiente el agua, y productivoal parecer, el cultivo de vid. es un recurso poco valorado, no obstante En el caso de espárrago Frimbres et al. existen trabajos con indicadores de la (2011) determinaron un indicador para el cultivo de 0,22 kg m-3 para la misma región agua de riego en cultivos como durazno agrícola, lo cual indica que este indicador (47),eficiencia trigo física,(48), forrajes económica (46), y nogal social (50), del fue 45,83 % inferior al determinado en este frijol (51), cebolla (49) y chile (45). trabajo, la razón de tal diferencia es atribuible En el presente estudio el indicador de a que mientras en este trabajo se consideró una lámina neta de 2,0 m, en el caso de estos -3 fue 0,48 kg m (Y1 y Y2 de la tabla 3, pág. autores, se determinó una lámina de riego 113),productividad encontrándose física del un cultivo índice de mayor espárrago en el de 64 cm, lo que estaría indicando que el cultivo de uva de mesa con 1,60 kg m-3, lo rendimiento de cultivo resultó seriamente afectado por la reducción de agua. cultivo para convertir el agua en producto El análisis de la variable Y3, muestra que muestra una mayor eficiencia de-1 este, en que cada hm3 de agua empleado en el comparación con el cultivo de espárrago que cultivo de espárrago generó una ganancia físico, ya que solo -1 empleó 625 L kg empleó 2.075 L kg (Y1 y Y2 de la tabla 4). de US$ 540.924 dólares, mientras que el Estos índices indican que la primera hipó- cultivo de uva de mesa produjo con ese tesis de este trabajo se acepta, dado que en mismo volumen de agua una ganancia efecto el cultivo de vid mostró un indicador de US$ 945.190, es decir, el mismo hm3 superior al del espárrago en términos de agua generó en espárrago 57,22% de -3). Sin embargo, los valores lo que se generó en uva de mesa, por lo que la segunda hipótesis de este trabajo porfísicos debajo (kg de m los indicadores determinados se rechaza, dado que la productividad del pordel índiceTeixeira de yproductividad Bassoi (2009) física quienes se ubican para agua en términos económicos fue superior la región de Petrolina, Pernambuco, Brasil, en el cultivo uva de mesa en relación con determinaron un índice igual a 2,44 kg m-3 el espárrago. Visto de otra forma, para en uva de mesa. Lo que indica que, en la producir un dólar de ganancia en el cultivo

Tomo 50 • N° 1 • 2018 115 Ríos Flores J. E. et al. de espárrago se invirtieron 1,849 m3, (equivalentes a US$ 0,54 m-3) mientras que es la cantidad de empleos generados 3 En cuanto3 a la eficiencia social del agua, en uva de mesa se utilizaron 1,06 m por hm de agua (Y6), el indicador en (equivalente a US$ 0,94 m-3), lo que indica espárrago fue 48,6 y en uva de mesa fue que el cultivo de espárrago emplea 74,7% 10,7 empleos hm-3. Este indicador es alto, más agua que uva de mesa para producir dado que la producción de hortalizas la misma cantidad de ganancia (tabla 4, y frutales normalmente requieren de pág. 115). Sin embargo al comparar con el mayor mano de obra en actividades mismo índice para uva de mesa en Brasil como la cosecha, selección y empaque al se observa que fue improductivo económi- compararse con cultivos como los forrajes camente el uso del agua en Caborca, ya o los cereales. En ese sentido, Ríos et al. que en uva de mesa el indicador fue US$ (2015), para el cultivo de durazno en 6,51 m-3 y US$ 0,93 m-3 en uva industrial Zacatecas, México determinaron un índice (2009). Olmedo et al. (2017 b) determi- igual a 0,20 empleos hm-3, mientras para el naron que en el ciclo agrícola 2012-2013 indicador promedio para el grupo forrajero Sonora, un índice de 4,89 pesos de ingreso fueDistrito de de0,48 Riego empleos 017, Comarca hm-3 (2015). Lagunera Por el en promedio para el DR041 Río Yaqui, otro lado, en la producción de trigo en el 301.709 hm3), productividad económica Valle de Mexicali, México se determinó un muypor metroinferior cúbico a la determinada (equivalente para a USD el índice igual a 0,025 empleos hm-3 (2016), lo que indica la importancia social que

El indicador de la variable Y5, muestra tiene el cultivo de uva y espárrago para elespárrago cociente del de DR037.dividir la utilidad bruta por la generación de empleo en la región m3 entre el precio del m3 pagado por el de Caborca. agricultor. Así el índice para el cultivo de En efecto, aun cuando los indicadores de espárrago fue 29,7; lo que indica que por productividad indiquen que la uva mostró cada dólar que el productor de espárrago mejores indicadores de productividad pagó por concepto de agua de riego, le retornó ese dólar y US$ 28,7 adicionales. importante mencionar que la importancia Mientras que en uva mesa el indicador socialtanto enque términos tiene el espárragofísicos y económicos, es superior esal fue 14,3, lo que muestra que el productor cultivo de uva, dado que este cultivo emplea de uva fruta recobró el dólar invertido en promedio 280 jornales por hectárea en riego y US$ 13,3 adicionales. En este mientras que la uva emplea solamente sentido García (2015), determinó un 30,89 jornales por hectárea. En efecto, el indicador de € 11,43 m-3 (lo que equivale cultivo de espárrago por si solo generó a US$ 12,79 m-3 valorado a moneda de 8.281 empleos permanentes en la región. 2015), en el sistema de producción de fresa de Huelva en España. Asimismo, del agua del espárrago (US$ 540.924 menciona que a escala global, la agri- hm-3Al contrastar la-3 ) eficiencia y vid (US$ económica 940.190 cultura de regadío es reconocida como el hm-3 -3 - sector que demanda un mayor volumen nados ≅ en US$ este 0,54 estudio m (tabla 4, pág. 115) de agua, por lo que los agricultores tienen con literatura≅ US$ 0,94 especializada, m ) del DR037 se determiobserva una gran responsabilidad en la conser- vación del recurso y es crítico que hagan económica superior al usar el agua en comparaciónque ambos cultivos con otros tuvieron cultivos una en eficiencia México, un uso eficiente del mismo. como es el caso de los forrajes en el DR017. 116 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 Con US$ 0,04 m-3 (46), el frijol de Zacatecas con US$ 0,12 m-3 (51), el trigo de Baja cosechada de espárrago en Caborca se California con pérdida de US$ 0,02 m-3 multiplicóAsí, entre por 2000 1,41, y de 2015 5.886 la a superficie8.588 ha, (48), el cultivo de durazno en Zacatecas pero la producción se cuadruplicó al ir de con US$ 0,088 m-3 (47), el nogal pecanero 23,86 a 87,25 miles de t, al multiplicar la

US$ 0,098 m-3 (50), y el cultivo de chile 2.075 L kg-1 (tabla 4, pág. 115) se obtiene el del DR005 en Delicias, Chihuahua, con volumenproducción de poragua la usado huella en hídricaesa producción, física de US$ 0,39 m-3 (45) (valores monetarios de el cual aumentó 131,52 hm3, al ir de 49,52 2014).en el Otra DR-017 hortaliza, Comarca la cebolla Lagunera de otoño- con a 181,04 hm3. CONAGUA (2017) señala para abril de 2015, que el VCAS (volumen concesionado de aguas subterráneas) del usarinvierno el agua: producida US$ 0,689en Delicias, m-3 (49) Chihuahua, siendo acuífero de Caborca es de 302,835012 hm3, mostró una alta eficiencia económica al que la recarga natural “R” es de 212,9 hm3, del agua más cercana a vid y superior al espárragoesta hortaliza de este la deestudio. eficiencia económica es de 89,935012 hm3, pero si la producción por lo que el déficit actual (igual a VCAS-R) social del agua en el cultivo de agua en el acuífero de Caborca, y de todo espárragoEn relación (48,6 empleos con lahm -3 eficiencia) y vid elde estado,espárragos seguiría sigue aumentando, creciendo, el déficitelevando de (10,7 empleos hm-3 - el VCAS, y como la recarga suele ser más nados en este estudio (tabla 4, pág. 115), con literatura especializada,) del DR037 al igual determi que subterránea en Caborca y en todo el estado deo menos Sonora, fija, seguiría implica aumentado, que el déficit tornando de agua observa que ambos cultivos tuvieron una insustentable la producción de espárrago con la eficiencia económica del agua, se en el largo plazo. en México. Es el caso de los forrajes en el eficiencia social por arriba de otros cultivos-3, del trigo de Baja California con 0,025 empleos Conclusiones hmDR017-3 (48), (46) del con durazno 0,48 empleos de Zacatecas hm con 0,020 empleos hm-3 (47), del nogal Este trabajo forma parte de una línea - con 0,39 empleos hm3 (50), y del cultivo de tividad del agua en el Norte de México. Es pecanero del DR005 en Delicias, Chihuahua,-3 de investigación de la eficiencia y produc (45). La cebolla de otoño-invierno de de importancia para los órganos decisores chile en el DR-017 con 6.254 empleos hm yade queinterés aporta para un la diagnósticocomunidad regionalcientífica de y la producción de espárrago y uva, lo cual usarDelicias, el agua Chihuahua de riego, pues (49) se manifestó le determinó ser contribuirá a la toma de decisiones en unaltamente indicador eficiente de 52,05 en términos empleos sociales hm-3, al relación con la sostenibilidad integral de usar el agua. Esta hortaliza resultó ser la agricultura de riego a través del otorga- miento de nuevas concesiones de derechos espárrago y la vid de este estudio. de agua, ampliación de la frontera agrícola, másUna eficiente importante en términos implicación sociales del que uso el reconversión de cultivos, reasignación del agua, así como la implementación de económica y social del agua en la agricultura,de indicadores es la generación de la eficiencia de escenarios. física, las áreas de regadío. programas que apoyen la tecnificación de

Tomo 50 • N° 1 • 2018 117 Ríos Flores J. E. et al.

Indudablemente, el sector agrícola exactos, sino, una aproximación acerca de la requiere de agua para producir los alimentos necesarios para subsistir, sin el agua de riego en el cultivo de espárrago embargo el reto que la humanidad encara es yeficiencia vid en la y productividadregión, y que conal igual que seque emplea otras el de producir más alimento con menos agua áreas del mundo los indicadores de produc- para una población creciente, considerando tividad descritos en este estudio tienen una que la frontera agrícola no puede crecer variabilidad debido a las condiciones de más debido al incremento de las ciudades. manejo, sistemas de riego, tipo de cultivo, Sin embargo, esta producción debe buscar manejo del suelo, así como al empleo de la sustentabilidad a largo plazo, lo que nuevas tecnologías, por lo que los datos aquí garantizará la alimentación humana en la mostrados deberán utilizarse por la comu- actualidad y las generaciones futuras. Se concluye que el cultivo de espárrago multidisciplinario de la aplicación de nuevas - tecnologíasnidad científica en el para campo el análisis que contribuyan detallado ya ciente e improductivo en el uso del agua en en comparación con la uva de mesa es inefi agua en los cultivos. emplea 3,32 veces más agua para producir unaLa mayor determinación productividad de y las eficiencia medidas del untérminos kg de físicosproducto y económicos, y 1,75 veces en mástanto agua que a aplicar más apropiadas por lo tanto, para producir un dólar de ganancia, pero dependerá en última instancia de las no así en términos sociales, ya que produce políticas agrarias, hídricas y sociales que 4,53 veces más empleo por hm3 que la vid. - misma que deberá priorizar la generación diato implica un alto costo de oportunidad, dese optenempleo, para el usobeneficio racional de de la loscomunidad, recursos yaNo que obstante, en términos ese beneficio absolutos social presupone inme el uso en el tiempo presente, de grandes lo tanto, la información discutida será volúmenes de agua del subsuelo así como dey elutilidad beneficio para económico los órganos regional. encargados Por de la toma de decisiones cuyo objetivo el uso del agua para futuras generaciones, primordial deberá ser; mantener la ademásde aguas de superficiales, potenciar posibles comprometiendo enfrenta- sostenibilidad integral de la agricultura. mientos sociales entre los usuarios urbanos Una medida de política económica de y los usuarios agrícolas del agua, enfrenta- sustentabilidad en el largo plazo, debiera mientos que se han suscitado en el pasado. ordenar ya no incrementar la super- Asimismo, debe remarcarse, que los indicadores generados por las variables dada su elevada demanda hídrica de dependientes, al provenir de la producción 2.075ficie cosechada L kg-1 del cultivo de espárrago, a escala comercial y no experimental, no son agua del acuífero sonorense. , que ha elevado el déficit de Bibliografía

1. Agenda Técnica Agrícola. Sonora. 2015. 2ª edición. SAGARPA. México. D.F. 2. Ahmad, M.Punjab. U. D.; Masih, Journal I.; of Turral, Applied H. 2004.Irrigation Diagnostic Science. analysis 39 (1):43-63. of spatial and temporal variations 3. Aldaya, M.in M.; crop Martínez-Santos, water productivity: P.; Llamas, A field M. scale R. 2010. analysis Incorporating of rice-wheat the water cropping footprint system and of

Resources Management. 24(5): 941-958. virtual water into policy: Reflections from the Mancha Occidental Region, Spain. Water

118 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 4. Alvarez, A.; Morábito, J. A.; Schilardi, C. 2016. Huellas hídricas verde y azul del cultivo de maíz (Zea mayz) en provincias del centro y noreste argentino. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 48(1): 161-177.

y sociedad. 17(34):73-125. 5.6. CaireCarrasco, Martínez, J. M.; Pistón, G. 2005. J. M.;Conflictos Berbel, porJ. 2010. el agua Evolución en la Cuenca de la productividad Lerma-Chapala, del 1996-2002. agua en la CuencaRegión del Guadalquivir 1989-2005. Economía Agraria y Recursos Naturales. 10 (1): 59-69.

http:// 7. CONAGUA.www.conagua.gob.mx/OCNO07/Noticias/2605%20Caborca.pdf 2007. Determinación de la Disponibilidad de Agua en el Acuífero /(last 2605acceded Caborca. July Comisión19, 2015). Nacional del Agua. Estado de Sonora. México. 31p. Disponible en:

8. CONAGUA.en: 2015. http://www.conagua.gob.mx/CONAGUA07/Publicaciones/Publicaciones/SGIH-6- Estadísticas Agrícolas de los Distritos de Riego. Comisión Nacional del Agua Insurgentes15.pdf / (last Sur, acceded Colonia September Copilco, Delegación5, 2015). Coyoacán, México, D.F. 408p. Disponible https://www.gob.mx/conagua/acciones- y-programas/sonora-74834https://www.gob.mx/cms/uploads/attachment/ 9. CONAGUA. 2017. Disponibilidad por acuíferos. 10. Conveagro. 2016. Convención Nacional del Agro Peruano. www.conveagro.org.pe/node/11010. 11. Espinoza-Ojeda,file/104297/DR_2605.pdf E. 2003. Evaluación del riesgo a la salud por exposición a arsénico en agua potable en poblados de la costa de H. Caborca, Sonora: Hermosillo, México. Tesis de

Food and Agriculture Maestría. Universidad de Sonora. División de Ingeniería.http://www.fao.org/docrep/006/ 79p. 12. FAO, 2003.Y4525S/y4525s00.htm Descubrir el potencial del agua para la agricultura. Organization Roma, Italia: FAO. 72 p. Disponible en: potásica en el cultivo de / espárrago (last acceded (Asparagus December officinalis 26, 2016). L.) en la región de Caborca, 13. Fimbres,Sonora. F. A.; Rivas,Revista D. Bio A.; Ciencias. Navarro, 13(2): A. J. A. 35-40. 2011. Efecto de la fertirrigación nitrogenada y 14. FIRA, 2014. Sistema de elaboración de Costos Agropecuarios en su Módulo Agrícola de FIRA.

mx / (last acceded September 11, 2015). 15. Fonseca,Fideicomisos S. S. E.; Verano, Instituidos Z. C.; Mariluz, en Relación S. J. conP. 2012. la Agricultura. Huella hídrica Disponible del espárrago en: www.fira.gob. en Perú.

http://es.calameo.com/read/001271945d27b8c12518b Autoridad Nacional del Agua. Oficina Nacional de Información de Recursos Hídricos.

16. García, E. 1981. Modificaciones al sistema de clasificaciónEconomic climática assessment de Köppen and socio-economic para adaptarlo a las condiciones de la república mexicana. UNAM. México. DF. 246 p. 17. García, G.2(2): J.; Contreras, 45-52. L. F; Usai, D.; Visani, C. 2013. 18. García, J.evaluation G.; Brunton, of waterJ. G. 2013. use efficiencyEconomic in evaluation artichoke of cultivation. early peach Open (Prunus Journal Persica of Accounting. L. batsch) Commercial orchard under different irrigation strategies. Open Journal of Accounting. 2(04): 99-106.

19. García, M. J. 2015. Hacia el riego de precisión en el cultivo de fresahttp://helvia.uco.es/xmlui/ en el entorno de Doñana. Tesisbitstream/handle/10396/12639/2015000001120.pdf?sequence=1 Doctoral. Universidad de Córdoba. Escuela Internacional de /(last Doctorado acceded en Agroalimentación.October 1, 2015). Campus Rabanales. Disponible en: 20. Garcia-Salazar, J. A.; Mora-Flores, J. S. 2008. Tarifas y consumo de agua en el sector residencial de la

Comarca Lagunera. Región y sociedad [online]. 20(42):119-132. Disponible en: .Science. 302: 1524-1528. [citado 2017-09-20].

Tomo 50 • N° 1 • 2018 119 Ríos Flores J. E. et al.

22. González-Robaina, F.; Herrera, P. J.; López, S. T.; Cid, G. L. 2011. Productividad agronómica del agua. Ingeniería Agrícola. 1 (2): 76-81. 23. González-Robaina, F.; Herrera, P. J.; López, S. T.; Cid, G. L. 2015. Productividad del agua en algunos cultivos agrícolas en Cuba. Revista Ciencias Técnicas Agropecuarias. 23 (4): 21-27.

the impacts of the uk’s water footprint through a case study of peruvian asparagus. 24. Hepworth,Progressio. N. D.; Postigo, CEPES and J. C.; Water Güemes, Witness D. B.; International Kjell, P. 2010. London. Drop 99p. by drop, understanding

reconversión productiva del distrito de riego 037 Altar-Pitiquito-Caborca, Sonora. 25. Herrera, J. C.; Unland, H.; Pulido. L.; Zavala, M.; Ojeda. W.; De León, B. 2002. Tecnificación y Zac., México. 26. HoekstraConferencia A. Y.; Chapagain presentada A. K. en 2004. el XII WaterCongreso Footprints Nacional of de Nations. Irrigación UNESCO-IHE. de la ANEI. Zacatecas, Institute of Water Education. Value of Water. Research Report Series. Serie 16. Volume 1. Appendices. Netherlands.

Hermosillo. Hermosillo, Sonora, México. 220p. 27.28. Inzunza INIFAP. López, 2010. J. Guía O. 2008 Técnica Optimización para el áreade patrones de influencia de cultivo del de campo distritos experimental de riego del Costanoroeste de

29. IWMI. 2000.de México. World Revista water Chapingo supply andSerie demand Zonas Áridas 1995 [ento 2025linea]. (draft). Disponible International en:. [Fecha de consulta: 4 http://www.cgiar.org/de septiembre de 2017] . /(last acceded October 1, 2015). Management Institute. Colombo. Sri Lanka. Disponible en iwmi/pubs/WWVisn/WWSDOpen.htmopportunities for improvement. CABI Publication, Wallingford UK. 332p. 30.31. Lewis, Kijne, A. J. G. W.; 2013. Barker, Automated R.; Molden, Asparagus D. J. Harvester 2003. Water Feasibility productivity Study. Thesis in agriculture: Master of Engineering limits and Management. University of Canterbury. Engineering Management. Available en: http:// ir.canterbury.ac.nz/handle/10092/7442/(last acceded July 18, 2015).

maíz y frijol en diferentes condiciones de suelo y disponibilidad hídrica. Ingeniería 32. López, T.;Agricola Herrera, 1 (1):J.; González, 24-29. F.; Cid, G. 2011. Modelación de la eficiencia del uso del agua en 33. Masari, H., M. (2003). El agua como recurso. http://www.comoves.unam.mx/ numeros/articulo/54/el-agua-como-recurso. Disponible en:

34. Molden,Water D.; Murray-Rust, productivity H.; inSakthivadivel, agriculture: R;limits Makin, and I.; opportunities2003. A water productivityfor improvement. framework CABI forPublication, understanding Wallingford and action, UK. 332p. pp.1-18. In: Kijne, J. W.; Barker, R.; Molden, D. J. 2003.

water productivity: Between optimism and caution. Agricultural Water Management, 35. Molden,94 D.; (4): Oweis, 528-535. T.; Steduto, P.; Bindraban, P.; Hanja, M.; Kjine, J. 2010. Improving agricultural

Water. Application to Water Resources Management in a Mediterranean River Basin. 36. Montesinos,Water P.; Resources Camacho, Management.E.; Campos, B.; 25 Rodriguez-Díaz, (6): 1635-1651. J. 2011. Analysis of Virtual Irrigation

37. Olmedo Vázquez, V. M.; Camacho Poyato, E.; Rodríguez Díaz, J. A.; Minjares Lugo, J. L.; Hernández Hernández,Ciencias Agrarias. M. L. Universidad 2017. Determinación Nacional de de Cuyo. indicadores Mendoza. de Argentina. gestión en49(2): los 149-168. módulos 38. Olmedo delVázquez, Distrito V. M.;de RiegoMinjares No. Lugo, 041, RíoJ. L.; Yaqui Camacho (Sonora, Poyato, México). E.; Hernández Revista deHernández, la Facultad M. deL.;

RodríguezMéxico). Revista Díaz, J.de A. la2017. Facultad Uso delde CienciasAnálisis EnvolventeAgrarias. Universidad de Datos (DEA) Nacional para de evaluar Cuyo. laMendoza. eficiencia Argentina. de riego 49(2):en los Módulos127-148. del Distrito de Riego No. 041, Río Yaqui (Sonora,

39. Oyarzún,20(3): C.; Nahuelhual, 88-95. L.; Núñez, D. (2005). Los servicios ecosistémicos del bosque templado lluvioso: producción de agua y su valoración económica. Ambiente y Desarrollo.

120 Revista de la Facultad de Ciencias Agrarias Asparagus officinalis

Eficiencia del agua de riego en espárrago ( L.) en el DR037 40. Padilla Calderón, E. 2012. La construcción social de la escasez de agua: Una perspectiva teórica anclada en la construcción territorial. Región y sociedad, 24(SPE. 3), 91-116. 41. Pineda-Pablos, N.; Salazar-Adams. A. 2010. Managing Water Amid Rapid Urbanization: Mexico’s North Borderlands. Water and Sustainability in Arid Regions. 2010: 245-260. 42. Ramírez-Vallejo, J.; Rogers, P. 2010. Failure of the virtual water argument: Possible explanations using the case study of Mexico and NAFTA. In Global Change: Impacts on Water and food Security. Springer Berlin Heidelberg. pp 113-126. 43. Rao, S. S.; Singh, Y. V.; Regar, P. L.; Chand, K. 2010. Effect of micro-irrigation on productivity and water use of cumin (Cuminum cyminum) at varying fertility levels. Indian Journal of Agricultural Science. 80(6): 507-5011. 44. Reyes, M. A.; Quintero, S. M. A. 2009. Problemática del agua en los distritos de riego por bombeo

del estado de Sonora. Revista Digital Universitaria. 10(4): 2-19. 45. Ríos, F. J. J.; Torres, M. M.; Ruiz, T. J. 2014. Eficiencia física, económica y social del agua subterránea paraAportaciones riego en enChile Ciencias en el DR-017. Agronómicas Comarca y Ambientales. Lagunera. En: Chapingo, Godínez, México. M. L.; Figueroa, H. E.; Pérez, S. F.; Sepúlveda, J. D.; García, N. R. M.; Márquez, B. S. R.; y Mamani, O. C. I. (editores).

46. Ríos, F. J.la L.; Facultad Torres, M.de M.; Ciencias Castro, Agrarias. F. R.; Torres, Universidad M. M. A.; NacionalRuiz, T. J. de2015. Cuyo. Determinación 47(1): 93-107. de la huella 47. Ríos, F. J.hídrica L.; Torres, azul M. en M.; los Ruiz, cultivos T. J.; forrajeros Torres, M. del M. DR-017, A.; Cantú, Comarca B. J. E. 2015. Lagunera, Evaluación México. productiva, Revista de económica y social del agua de riego de durazno (Prunus persica L. Batsch) en Zacatecas (México). Avances en Investigación Agropecuaria. 19(2): 97-109.

de riego en trigo (Triticum vulgare) de Ensenada y Valle de Mexicali, Baja California, 48. Ríos, F. J.México. L.; Torres, Acta M. Universitaria. M.; Ruiz, T. J.; 26(1):20-29. Torres, M. M. A. 2016. Eficiencia y productividad del agua 49. Ríos, F. J. J.; Jacinto, S. R.; Torres, M. M. A.; Torres, M. M. 2017. Huella hídrica del cultivo de cebolla

producidaProducción en Agrícola el DR005 en Delicias, México. Chihuahua.Handbook T-I.En: Pérez,Ciencias S. Francisco,de la Economía Figueroa; y Agronomía, H. Esther; Godínez,Vol.1. Chapingo, M. Lucila; México. Salazar, M. Raquel. 2017 (Directores-editores ). Rentabilidad de la 50. Ríos, F. J. L.; Torres, M. M.; Torres, M. M. A. 2017. Productividad agrícola del agua en nogal

Editorial Académica Española. Saarbrucken, Alemania. pecanero del norte de México. Casos: Comarca Lagunera y Delicias, Chihuahua. del cultivo de frijol en un sistema de riego por bombeo en Zacatecas, México. Revista 51. Ríos, F. CienciaJ. L.; Torres, ergo sum M. . M.; Universidad Torres, M. Autónoma M. A; Cantú, del Estado B. J. E. de 2017. México. Eficiencia Universidad y productividad Autónoma del Estado de México, México. 2(2):152-163.

production: implications on competitiveness. Quarterly Journal of Business Studies. 52. Rodríguez,1(4): J.; 141-148. Kern, W.; May, D. E. 2014. Analyzing the incidence of labour cost on organic

53. Rojas, E. B.; Delgado, G. B.; Manzano, L. A. V.; Ramírez, M. V.; Hernández, M. A. J. 2013. El uso 54. Romero,eficiente A. P.; García, del aguaG. J.; Botía, en la O.producción P. 2006. de maíces nativos de color en Xalostoc, Morelos, México.almond Ambienteorchard under y Desarrollo. subsurface 17 (3):drip 99-110. irrigation conditions in south-eastern Spain. Irrigation Science. 24(3): 175-184.Cost-benefit analysis of a regulated deficit-irrigated 55. Salazar, B. 2012 El secreto del boom del espárrago: La sobreexplotación del agua, http://

boom%20del%20esparrago.pdf larevistaagraria.org/sites/default/files/revista/LRA139/El%20secreto%20del%20 supply, 1990 to 2025: Scenarios and Issues. Research Report 19. International Water 56. Seckler, D., Upali, M.; Molden, D.; De Silva, R.; Barker, R. 1998. Worldhttp://protosh2o.act. water demand and

Management Institute: Colombo, Sri, Lanka. 40p. Disponible en: be/VIRTUELE_BIB/Water_in_de_Wereld/ALG-Algemeen/W_ALG_E22_World_Water. PDF / (last acceded December 25, 2015).

Tomo 50 • N° 1 • 2018 121 Ríos Flores J. E. et al.

57. SIAP. 2014. Anuarios estadísticos de la producción agropecuaria. Servicio de Información http://www.siap.gob.mx/ / (last acceded August 25, 2015). Agroalimentaria y Pesquera. SAGARPA-SIAP. Disponible en 59. Steduto, P.; Hsiao, T. S.; Fereres E. 2007. On the conservative behavior of biomass water 58. SIAP. 2015.productivity. Infosiap.siap.gob.mx/aagricola_siap_gb/icultivo/index-jsp Water productivity: Science and Practice. Irrigation Science. 25:189-207. 60. Takele, E.; Kallenbach, R. 2001. Analysis of the impact of alfalfa forage production under summer water‐limiting circumstances on productivity, agricultural and growers returns and plant stand. Journal of Agronomy and Crop Science. 187(1): 41-46.

large scales. Ann. Arid Zone. 48: 1-13. 61.62. Vega-GranilloTeixeira, A. D., C.; Bassoi, L. H. 2009. Crop water productivity in semi-arid regions: 2011. from Hidrología field to de Sonora, México, In: Calmus, Thierry ed., Panorama de Geología de Sonora, México. UniversidadE. L.; Cirret-Galán, Nacional Autónoma S.; De la Parra-Velazco, de México, M. Instituto L.; Zavala-Juárez, de Geología, R. Boletín 118: http://www.geologia.unam.mx:8080/igl/publs/boletin/ bol118/(8)Vega.pdf /(last acceded November 12, 2016). 63. Velázquez,267- G. G.298. 2014. Disponible Los pueblos en indígenas en México contra las nuevas formas de despojo. El caso de los yaquis en Sonora. Territorios en disputa. 269 p.

64. Viets, F. G.Science 1966. SocietyIncreasing of America. water use 295 efficiency p. by soil management. In plant environment and 65. Wilder, efficientR. 2002. waterIn name use. only: Guilford water RD., policy, Madison, the state, USA: and American ejidatario Society producers of Agronomy, in northern Soil Mexico. http://arizona.openrepository.com/arizona/handle/10150/280078/(last acceded October 2, 2015). 66. World Wildlife Fund. 2013. Estado del arte de la medición de la huella hídrica a nivel nacional e internacional. WWF. Perú. p. 113. 67. Zwart, S. J.; Bastiaanssen W. G. M. 2004. Review of measured crop water productivity values for irrigated wheat, rice, cotton and maize. Agricultural Water Management. 69. 115-133.

122 Revista de la Facultad de Ciencias Agrarias HeavyRev. FCA metals UNCUYO. and 2018. vegetative 50(1): 123-139.species ISSN impreso 0370-4661. ISSN (en línea) 1853-8665.

Capacity of two vegetative species of heavy metal accumulation

Capacidad de dos especies vegetativas en la acumulación de metales pesados

Jorge Alcalá Jáuregui 1, Juan C. Rodríguez Ortíz 1, Alejandra Hernández Montoya 1, Maria Flavia Filippini 2, Eduardo Martínez Carretero 3, Paola Elizabeth Diaz Flores 1

Originales: Recepción: 01/05/2017 - Aceptación: 10/04/2018

Abstract

Habitat fragmentation allows for vegetative species to be used as indicators of environmental pollution by heavy metals. Considering the distribution of Prosopis laevigata (mesquite) and Schinus molle (pepper tree) heavy metal concentrations were determined as potential indicators of environmental impact assessment for agricultural and livestock, rural settlement, commercial and service, urban settlement and mining land uses. A total of 30 sampling points were established during summer, autumn, winter and spring, based on the presence of the two species. Applying the technique of ICP-MS, concentrations of Al, As, Co, Cu, Cd, Pb, Ti, V and Zn were determined. With a statistic model the interactions between species, type of land use and season with respect to the concentration of these minerals in the leaf material were determined. Results indicated that the presence of heavy metals is determined by the effect of the species, land use and season, and the possible -

Ti.association On one hand, between trees these. located The in specie the mining of mesquite land use was showed the most the efficient highest forconcentrations bioaccumu oflation Cu, ofZn, Pb, Cd, Co Pb, and Co Al. and In theAs. Onsame the way, other the hand, pepper the tree spring was seasonmore efficient presented with the respect highest to concentration of Cu, Zn, Co, Ti and V. With that, it could be demonstrated that As, Co, Cd, Pb, Ti and Zn concentrations were above the normal limit. Therefore, the dynamics and functionality, environmental factors and physiological differences to develop physical- chemical processes in the absorption and transport of these elements towards the leaves are a determining factor of vegetative species placed under conditions of fragmentation, are good elements for surveying on pollution and environmental impact.

Keywords

pollution • foliar matter • land use • season • heavy metal 1 Facultad de Agronomía y Veterinaria. Universidad Autónoma de San Luis Potosí. Km 14.5 Carretera San Luis-Matehuala Apartado Postal 32. C.P.78321 Soledad de Graciano Sánchez. San Luis Potosí. [email protected] 2 Universidad Nacional de Cuyo. Facultad de Ciencias Agrarias. Química Agrícola. Almirante Brown 500. M5528AHB. Chacras de Coria. Mendoza. Argentina.

3 Geobotánica y Fitogeografía. IADIZA (CONICET). Tomo 50 • N° 1 • 2018 123 Alcalá Jáuregui, Jorge et al.

Resumen

La fragmentación del hábitat permite aprovechar especies vegetativas como indica- doras de contaminación ambiental por metales pesados. Considerando la distribución de Prosopis laevigata (mezquite) y Schinus molle (pirul) se determinaron las concentraciones de metales pesados en material foliar para evaluar el impacto ambiental de los usos de suelo agropecuario, residencial rural, comercial y servicio, residencial urbano y minero. Fueron establecidos 30 puntos de muestro durante las estaciones de verano, otoño, invierno y primavera, basados en la presencia de las dos especies. Aplicando la Técnica ICP-MS fueron determinadas las concentraciones de Al, As, Co, Cu, Cd, Pb, Ti, V y Zn. Con un ANOVA se probaron las interacciones entre especie, tipo de uso de suelo y estación con respecto a la concentración de estos minerales en material foliar. Los resultados indicaron que la presencia de metales pesados está condicionada por el efecto de la especie, uso de suelo y la estación, así como la posible asociación entre estos. El mineromezquite obtuvieron resultó ser las más mayores eficiente concentraciones en la bioacumulación de Cu, Zn, deCd, Pb, Pb, Co y As.Al. PorEn elotra caso parte, del lapirul estación solo fue de másprimavera eficiente incidió con respectoen la mayor al Ti. concentración Los árboles deubicados Cu, Co, enTi yel V. uso Con de esto suelo se pudo demostrar que As, Co, Cd, Pb Ti y Zn presentaron concentraciones arriba del límite normal en material foliar. Por lo tanto, la dinámica y funcionalidad, factores ambientales transporte de estos elementos hacia las hojas son un factor determinante de las especies vegetativasy diferencias situadas fisiológicas bajo paracondición desarrollar de fragmentación, procesos físico-químicos lo que contribuye en la ser absorción un buen y elemento de estudio de la contaminación y evaluación del impacto ambiental.

Palabras clave

contaminación • material foliar • usos de suelo • temporada • metales pesados Introduction

Pollution by heavy metals (HM) can be assessed by making use of plant species that are considered in this study, locate that grow in fragmented habitats, serving Cu Someand Zn classifications within the group of elementsof trace as environmental indicators (21, 24). HM elements and micronutrients, being are severe pollutants in the environment these necessary for essential functions due to their toxicity, persistence and bioac- of the plants. The micronutrients are cumulation problems (9). Furthermore, it is presence in the earth crust is lower to 0.1 % for plant growth found in small amounts, and generally lower than 0.01 % (28). These usuallydefined < a chemical100 mg elementkg-1 in the necessary plant.; and the As is considered ultratrace or micronutrients (As, B, Co, Cr, Cu, Mo, Mn, non-metallic elements and the metallic Ni,are Seclassified and Zn) into necessary two groups in small trace quantities elements elements are located some as Cd, Cr, Co, for organisms, but toxic once past a certain Pb, Ni, and V (34). In the dynamics of the threshold and without known biological entrance of heavy metals in the plants function (Ba, Cd, Hg, Pb, Sb, Bi) (29). are associated the soil contamination,

124 Revista de la Facultad de Ciencias Agrarias Heavy metals and vegetative species the dynamics of heavy metals in the or toxicity. It can also provide information soil, transport and toxicity of metals (31). like the concentration of metals (27). It Pollution in soil, air and water is possible to may be used as preventive practice and originate an accumulation of toxic elements quality control as well as being used as in plant tissue. Hence, it is necessary to environmental pollution index (18). In carry out leaf analysis to assess their the state of San Luis Potosi, the munici- concentration, where the selection of palities of Soledad de Graciano Sanchez samples may include the entire plant or and San Luis Potosi, considered to be the most populated of the region (29, 35, 36), roots and leaves (8, 19, 28). exhibit a rural-urban connectivity, high- specificThe HMsections are built of it, upsuch in asstreet the dustleafstalk, and lighting the infrastructure and motion on the plant leaves through atmospheric of agricultural areas, livestock farming, deposition related to sediments, impact mining, resource banks, roads, vehicular - enced by the aerodynamic effect of the business and service expansion and rural woodsand interception or wooded (38). area This primarily could bebecause influ andtraffic, urban as wellhousing as industrial(35, 36). influence,This has of the surface roughness of the woodland caused fragmentation in the distribution and turbulence generated in the wind (18). of some species and has developed studies In general, the pollutant measurement to assess the environmental impact of the central is located in urban areas, and there human activities, above all the presence of are few permanent registers from the heavy metals due to the usual extraction outskirts such as those in the rural sector of metallic and non-metallic minerals in and natural areas. This situation worsens these zones (37). when it´s the case of rural and industrial The presence of lead, zinc, arsenic, and mining zones where the background, cadmium in the environment and in urine historical and indicator levels are unknown and hair was found in children of San Luis concerning the degree of pollution. Under Potosi (11, 20). The objective of this work these conditions the leaves of plants play was to determine the presence of heavy an important role as a receptor of the atmo- metals in Prosopis laevigata (mesquite) spheric dust and as a baseline for the differ- and Schinus molle (pepper tree), prevalent ential degree of pollution (18, 22). species with fragmented distribution from Plants are used as direct or indirect different land uses, in San Luis Potosi.

- cationelements of ofthe decontaminating. pollutant quantity In thethrough first Materials and methods absorption,case, plants sequestration participate in or the accumu modifi- lation. Trees are also candidates in the The study area was located in the practice of recovery, but the environ- state of San Luis Potosi, within the rural- mental consequences of their usage differ urban sector between the municipalities to those of herbaceous plants; this is due of Soledad de Graciano Sanchez and San to their growth form, chemical compo- Luis Potosí. The municipality of Soledad de sition, and longevity (25). The foliage Graciano Sanchez lies between 22°10'59" N analysis is a procedure to determine the and 100°56'27" W, and the San Luis Potosi elemental concentration in the leaves that at 22°08'59" N, 100°58'30" W with an altitude between 1.849 and 1.864 m (29). reflect trees nutritional status, deficiency,

Tomo 50 • N° 1 • 2018 125 Alcalá Jáuregui, Jorge et al.

The climate is dry template with warm summers, BSOKw11 e.g. according the use, type of land, species and season inα≤0.05, reference testing to the the concentration interactions betweenof heavy rainfall is 400 mm, mostly concentrated metals. A correlation analysis was carried into summer Koeppen´s and classification.fall (from May Theto October). annual Dominant soil types are litosol, and in addition to principal component analysisout (Pearson’s (PCA) was correlation performed. coefficients), (35). Propospis laevigata (mesquite) and Shinusxerosol, molle feozem, (pepper castañozem tree) are ylocated fluvisol in Results and discussion dominant land uses: agricultural and livestock,fragmented rural groundsettlement, paths commercial of five types and The general averages found in the service, urban settlement, and mining. This analyzed elements of the leaves were ground path formed an ecological corridor, on the basis of Al (266.0 mg kg-1) > Zn (21.75 mg kg-1) > Cu (5.2 mg kg-1) > Ti pag 127) and where previous studies have (4.21 mg kg-1) > V (2.62 mg kg-1) > Pb (2.05 mg shownallowed the to locatepresence 30 sampleof heavy areas metals (figure in soil 1, kg-1) > As (0.45 mg kg-1) > Cr (0.42 mg kg-1) and sediments riparian area (4, 6). > Cd (0.11 mg kg-1) > Co (0.06 mg kg-1). On The main criterion was the presence the other hand, there were considerable of the two species in each land use and associations between the concentrations of sampling point due to habitat fragmen- heavy metals in the leaves, species, land use, tation conditions. In each land use, 30 to season, and the double interaction between 40 g of foliar matter was taken of each species-land use and land use-season. species from single branches longer than 1.60 m. All sampled trees were located Species effect alongside a highway, alternating on the left The species factor had a signif- and right sides, as well as their exposure icant effect in the concentrations of Al (p=0.000), Co (p=0.035), Pb (p=0.077) and The samples were taken from the Ti (p=0.004). The relation of results can sameto sources exemplars of pollution during and the airflow. summer and be seen in table 1 (page 128). The species fall seasons of 2009, in addition in winter of mesquite concentrated the highest and spring of 2010, gathering 120 samples amount of Al (406.7±23 mg kg-1), being during the studied period. In order to highlighted the difference of 137.5 mg kg-1 determine the concentration of metals, a in the concentrations of Al in mesquite 0.5 g of foliar matter was incinerated in a to those found in the pepper tree. The concentrations of Al in plants are found on an average of 200 mg kg-1 ranging between addition of HNO3 muffle furnace at 450°C (dry digestion), 10 a 1000 mg kg-1 (34). Regarding Co, the the analysis of de Al, to As, 1%, Co, filtering Cu, Cd, it,Pb, and Ti, mesquite resulted with a concentration of Vcomplete y Zn by usingat 25 mlof thein a ICP-MS volumetric technique flask for in 0.11±0.009 mg kg-1, obtaining 0.03 mg kg-1 Laboratory of the Institute of Geology of the more than the pepper tree, being above Autonomous University of San Luis Potosi. the average which is of 0.2 mg kg-1 (34). The concentrations of metal were In mature leaf tissue of various plants, reported in mg kg-1. For the data analysis the normal range is 0.02-1 ppm; it can be (ANOVA) a was designed by Minitab, set to toxic to plants (23).

126 Revista de la Facultad de Ciencias Agrarias Heavy metals and vegetative species Location of the study area. Location of the study Localización del área de estudio. Localización del área Figure 1. Figure Figura 1. Figura

Tomo 50 • N° 1 • 2018 127 Alcalá Jáuregui, Jorge et al.

Table 1. Ratio of the concentrations of heavy metals in foliar matter according to the species effect. Tabla 1. Relación de las concentraciones de metales pesados en material foliar de acuerdo con el efecto de la especie. Pb (mg kg-1) Co (mg kg-1) Al (mg kg-1) Ti (mg kg-1) Species Mean ±E.E. Mean ±E.E. Mean ±E.E. Mean ±E.E. P. laevigata 7.08 1.02 0.11 0.009 406.7 23 4.14 0.18 S. molle 4.52 1.02 0.08 0.009 269.2 23 4.92 0.18

In respect to Pb, the concentration Regarding Ti, the highest concentration was of 7.08±1.02 mg kg-1, obtaining a was present in the pepper tree during the difference of de 2.56 mg kg-1 between season of spring with 7.47±0.376 mg kg-1, the mesquite and the pepper tree, over- being above average range from 0.1 to 4.6, passing the limit of normal content which its presence is considered as an indicator of is of 1.0 mg kg-1 (34). In reference to the pollution in land and atmospheric dust (34). concentrations of Ti, the highest amount In respect to V, the highest concentration was present in the pepper tree with was obtained from the pepper tree in spring 4.92±0.18 mg kg-1, being above the normal with 3.66±0.143 mg kg-1. In reference to V range of 0.1 to 4.6 (34). The ratio species- (p=0.019), its highest concentration was in season showed substantial incidence in the pepper tree and in the commercial and the concentrations of Ti (p=0.006) and service land use with 3.09±0.160 mg kg-1, V (p=0.000). These results are shown in the V concentrations in plants varied from . 0.27 to 4.2 mg kg-1 (34). figures 2 (page 128) and 3 (page 129)

Figure 2. Ratio of the Titanium concentrations according to the species-season effect. Figura 2. Relación de las concentraciones de Titanio de acuerdo con el efecto especie-temporada.

128 Revista de la Facultad de Ciencias Agrarias Heavy metals and vegetative species

Figure 3. Ratio of the Vanadium concentrations according to the species-season effect. Figura 3. Relación de las concentraciones de Vanadio de acuerdo con el efecto especie- temporada.

Regarding Ti, the pepper tree concentrated the highest amount in the urban Al (p=0.000), Cd (p=0.000), Co (p=0.030), settlement area with 6.11 mg kg-1 Cutially (p=0.002), significant Pb for (p=0.000), the concentrations Ti (p=0.000), of and Zn (p=0.000), mainly because of its were found in Platanus occidentalis (3). high concentration in trees found in the This(figures element 4 and is5, linkedpage 130), to the similar removal values of mining and the urban residential land the earth´s crust, especially to particles of use. These results are shown in table 2 dust (26). On the whole, the presence of the (page 131). The mining and metal indus- assessed elements can be attributed to the tries are associated to soil, air and water atmospheric disposition caused by indus- pollution with different potentially toxic trialization and by emissions of automo- elements such as lead and zinc (33). This tives (41). These elements have been found may be having an effect in the concentration in similar studies with tree species (3, 10, of these elements in both studied plant 38). The bioaccumulation patterns in plant species. On the other hand, the content of species vary as well as the same elements, elements in plants differs according to therefore the results cannot be extrapo- the level of pollution in the soil, but the lated (30). Also, the natural sensibility or differences between soils may be moder- tolerance of plants in accumulating metals ately or highly polluted (39). In reference is substantially different according to the to the use of mining land, most concentra- species and the genotypes (39). tions of Cd were 1.29±0.150 mg kg-1. The content of this element varies from 0.1 a Land use effect 1.0 mg kg-1, and could have various effects In the case of the land use and considered over the plants such as on photosynthesis all samples of two species, this was substan- elements (34). and the interruption the flow of mineral Tomo 50 • N° 1 • 2018 129 Alcalá Jáuregui, Jorge et al.

Figure 4. Ratio of the Vanadium concentrations according to the species-land use effect. Figura 4. Relación de las concentraciones de Vanadio de acuerdo con el efecto especie-uso de suelo.

Figura 5. Ratio of the Titanium concentrations according to the species-land use effect. Figura 5. Relación de las concentraciones de Titanio de acuerdo con el efecto especie-usos de suelo.

130 Revista de la Facultad de Ciencias Agrarias Heavy metals and vegetative species ) -1 0.22 0.22 0.22 0.22 0.22 ±E.E. As (mg kg 0.5 0.49 0.56 0.75 2.21 Mean ) 36.4 36.4 36.4 36.4 36.4 ±E.E. -1 Al (mg kg Mean 243.7 286.68 282.95 487.48 289.78 ) -1 0.29 0.29 0.29 0.29 0.29 ±E.E. Ti (mg kg 4.2 4.1 4.38 4.66 5.33 Mean ) -1 ±E.E. 0.015 0.015 0.015 0.015 0.015 Co (mg kg 0.1 0.1 0.08 0.07 0.13 Mean ) 1.6 1.6 1.6 1.6 1.6 -1 ±E.E. Pb (mg kg 2.56 2.81 4.65 4.71 Mean 14.28 ) -1 0.15 0.15 0.15 0.15 0.15 ±E.E. Cd (mg kg 0.12 0.15 0.44 0.27 1.29 Mean ) -1 20.6 20.6 20.6 20.6 20.6 ±E.E. Zn (mg kg 155 Mean 35.05 27.94 64.14 48.12 ) 1.5 1.5 1.5 1.5 1.5 -1 ±E.E. Cu (mg kg Ratio of the concentrations of heavy metals in foliar matter (two species) according to the land use effect. to species) according (two matter metals in foliar of heavy of the concentrations Ratio 5.53 5.11 7.77 6.31 15.2 Mean Relación de las concentraciones de metales pesados en material foliar (dos especies) de acuerdo con el uso de suelo. (dos especies) de acuerdo foliar de metales pesados en material de las concentraciones Relación Table 2. Table Land uses Agricultural Agricultural and livestock Rural Rural settlement Trade and Trade services Urban Urban settlement Mining Tabla 2. Tabla

Tomo 50 • N° 1 • 2018 131 Alcalá Jáuregui, Jorge et al.

In mature leaf tissue of various plants, repair and caused by vehicle pneumatic the normal range Cd is 0.05-0.02 ppm; motor wear. The automobile tire abrasion excessive or toxic levels range from increases especially in semi-arid environ- 5-30 ppm (23). In regard to Co, the highest ments (32, 38). The concentrations of Cu concentration was of 0.13±0.015 mg kg-1. showed a difference of 10.09 mg kg-1, the It's a natural element found in rocks, land, Pb was of 11.72 mg kg-1 and the Zn was of water, plants and animals. It´s associated to 127.06 mg kg-1. In reference to the concen- alloys used in the manufacture of engines, trations obtained in the urban settlement, cutting and grinding tools, and is used the plant species showed higher Al to color glass, ceramics, paints, and as a concentrations of 487.48±36.4 mg kg-1 y drier for porcelain enamels and porcelain Ti 5.33±0.29 mg kg-1, being above normal paints (14). The Cu had its highest concen- range of 0.1 to 4.6, associating their tration with 15.2±1.5 mg kg-1. Copper is presence as a pollutant indicator in land usually found near mines, foundries, indus- and atmospheric dust (34). The highest concentration of Al was sites. At extremely high levels toxic effects in trees leaves localized in urban land mighttrial plants, occur. landfillsIt's associated and waste with disposalcopper use with 487.8 mg kg-1, twice the concen- compounds that can be found in the envi- tration obtained in the commercial and ronment, dust, air and land, vegetation in service land use. The levels of Al in the air generally vary between 0.005 y 0.18 3 The concentrations of this element can ) of bedecomposition, due to the presence and forest of particles fires (13). emanated air, depending on the location, the weather by the copper foundries of the industrial conditions,micrograms and per the cubic type meter and level (μg/m of the zone (11). In regard to the Pb, the highest industrial activity in the area. Most of the concentration was of 14.28±1.6 mg kg-1. Al in the air is found hovering in small dust This indicates that it is above the limit of particles. The levels of Al in urban and normal content in plants of 1.0 mg kg-1 industrial areas may be higher and could 3 (34). The Zn was of 155±20.6 mg kg-1, the (17). highest concentration found in this land use. The content of Zn in plants varies from varySeason between effect 0.4 y 8.0 μg/m 10 to 100 mg kg-1 (34). Most of the Zn in the environment is the result of mining, effect in the concentrations of Al (p=0.086),The season Co (p=0.000), factor had Cu (p=0.002), a significant Ti and coal and waste incineration (15). (p=0.000), V (p=0.011) and Zn (p=0.099) mineralThe level refining, of zinc manufacturing in the land increases of steel, (table 3, page 133) considered all samples mainly because of to the disposal of of two species. The highest concentra- residues by industries that manufacture tions of Al were registered in winter metal and by coal ash brought about from (391.2±32.56 mg kg-1) and the lowest in power plants. The Zn is an essential element fall with 277.6±0.009 mg kg-1, showing a for plant growth and has an important difference of 113.6 mg kg-1. In regard to Zn, role in the biosynthesis of enzymes. While the highest concentration was in winter comparing the trends of the concentrations with 98.1±18.4 mg kg-1 and the lowest in of these elements, it is highlighted that the summer with 40.1±18.4 mg kg-1, having a rural settlement land use mostly had the difference of 58 mg kg-1. The amount of Zn least concentrations (2). Its presence may in plants vary from 10 a 100 mg kg-1 (34). be due to being used as an agent for tire

132 Revista de la Facultad de Ciencias Agrarias Heavy metals and vegetative species

Table 3. Ratio of the concentrations of heavy metals in foliar matter (two species) according to the season effect. Tabla 3. Relación de las concentraciones de metales pesados en material foliar (dos especies) de acuerdo con el efecto de la temporada.

Cu (mg kg-1) Zn (mg kg-1) Co (mg kg-1) Ti (mg kg-1) Al (mg kg-1) V (mg kg-1) Season Mean ±E.E. Mean ±E.E. Mean ±E.E. Mean ±E.E. Mean ±E.E. Mean ±E.E. Summer 5.13 1.35 40.1 18.4 0.08 0.013 4.09 0.26 324.1 32.56 2.72 0.1 Fall 6.27 1.35 48.3 18.4 0.06 0.013 3.2 0.26 277.6 32.56 2.83 0.1 Winter 8.58 1.35 98.1 18.4 0.12 0.013 4.49 0.26 391.2 32.56 2.64 0.1 Spring 11.97 1.35 77.7 18.4 0.14 0.013 6.35 0.26 358.8 32.56 3.09 0.1

For copper, the highest concentration arsenic on land varies broadly, in general was in spring with 11.97±1.35 mg kg-1 and the between 1 and 40 parts of arsenic per lowest in summer with 5.13 ±1.35 mg kg-1. million of parts of land (ppm) with an The contents of this element in plants average of 3 to 4 ppm. However, the land vary from 10 a 100 mg kg-1 (34). Ti was near the geological deposits rich in arsenic higher in spring with 6.35±0.26 mg kg-1 near some mines and foundries, or in and lower in fall with 3.2±0.26 mg kg-1. agricultural areas where pesticides were Also Vanadium had its highest concen- used with arsenic in the past may have tration in spring with 3.09±0.1 mg kg-1 and higher levels of arsenic (16). Vanadium had the lowest in winter with 2.64±0.1. The the highest amount in the use commercial concentration of this element in plants and service-winter 3.53±0.22 mg kg-1 varies from de 0.27 a 4.6 mg kg-1. and the least concentration in the use of residential land rural-spring (2.38 mg kg-1). Use of land season-effect Vanadium is usually mixed with other Considered all samples of the two metals creating alloys. Vanadium in the species, the relation between land use form of vanadium rust is a component of a special kind of steel used in automobile concentrations of As (p=0.009), V (p=0.080) parts, springs, and ball bearings. Vanadium yand Pb season(p=0.014) had (table a significant 4, page 134). effect The in theAs is also blended with iron to manufacture exhibited the highest concentration on the parts for airplane engines. Small amounts land use mining-autumn with 3.81±0.44 of Vanadium are used to manufacture mg kg-1 and the lowest in the residential rubber, plastic, ceramic, and other chemical use rural-autumn with 0.22±0.44 mg kg-1, products (12). The concentrations of having a difference of 3.59 mg kg-1. The this element in plants varies from 0.27 normal concentration of this element in to 4.2 mg kg-1 (34). In regard to Pb, its plants varies from 0.009 a 1.7 mg kg-1, highest concentration was in the land use which indicates being above this range mining-fall with 27.67±3.21 mg kg-1 and (34). Arsenic origins in natural form in the least in rural residential land use with land and minerals and therefore may go 1.08 mg kg-1±3.21 having a difference of into the air, water and to the soil as dust 26.59 mg kg-1. This indicates that it is above carried in the wind. The concentration of the limit of normal content in plants of 1.0 mg kg-1 (34).

Tomo 50 • N° 1 • 2018 133 Alcalá Jáuregui, Jorge et al.

Table 4. Ratio of the concentrations of heavy metals in foliar matter (two species) according to the land use-season effect. Tabla 4. Relación de las concentraciones de metales pesados en material foliar (dos especies) de acuerdo con el efecto uso de suelo-temporada.

V (mg kg-1) As (mg kg-1) Pb (mg kg-1) Land uses Season Mean ±E.E. Mean ±E.E. Mean ±E.E. Summer 2.71 0.22 0.31 0.44 1.41 3.21 Fall 3.12 0.22 0.33 0.44 1.8 3.21 Agricultural and livestock Winter 2.9 0.22 0.72 0.44 3.81 3.21 Spring 2.95 0.22 0.58 0.44 3.21 3.21 Summer 2.96 0.22 1.01 0.44 5.72 3.21 Fall 3.09 0.22 0.22 0.44 1.08 3.21 Rural settlement Winter 2.38 0.22 0.28 0.44 2.05 3.21 Spring 2.66 0.22 0.51 0.44 2.37 3.21 Summer 2.43 0.22 0.48 0.44 4.4 3.21 Fall 2.39 0.22 0.25 0.44 2.18 3.21 Trade and services Winter 2.64 0.22 0.7 0.44 8.27 3.21 Spring 3.53 0.22 0.81 0.44 3.76 3.21 Summer 2.69 0.22 0.61 0.44 4.21 3.21 Fall 2.76 0.22 0.43 0.44 3.08 3.21 Urban settlement Winter 2.74 0.22 0.6 0.44 4.95 3.21 Spring 3.3 0.22 1.34 0.44 6.61 3.21 Summer 2.79 0.22 1.15 0.44 7.92 3.21 Fall 2.81 0.22 3.81 0.44 27.67 3.21 Mining Winter 2.53 0.22 1.12 0.44 10.45 3.21 Spring 3 0.22 2.78 0.44 11.09 3.21

Lead is generally added to the envi- and the turbulence caused by the wind, ronment by deposition of dust and from present in different seasons (18). roads and highways in proportion to the Analysis of the coefficient of corre- edge of the highway (1, 2). The levels of lation and PCA somedensity pollutants of traffic mayand dependthe distance on the from region, the - the weather conditions, and the type and level of the industrial activity in the area whichThe Cu-Co Pearson´s (0.817), coefficient Zn-Cu (0.855), of correZn-Co (17). On the other hand, these results may (0.785),lation test Ti-Al provided (0.656), significant Pb-As ratios (0.903), from Cd-Cu (0.884) y Cd-Zn (0.953) ratios stand the forest or arboreal area, mainly due to out. For such reason, the studied species thebe influenced surface roughness by the aerodynamic of the forest effect mass of comply with some of the criteria in order to be considered as bio monitors (2).

134 Revista de la Facultad de Ciencias Agrarias Heavy metals and vegetative species

observed throughout the PC1 away from 71% of the variability in the original data the interception axis between PC1 and PC2 (42,The 19, first 10%) three obtained components from explainedthe nine (89, 177, 117, 137, 140, 147, 202, 207, 208, heavy metals that were analyzed. The 223, 234, 237, 5, 158, 110, 191, 30 y 142). dispersion diagram was built with the PC1 and PC2, which explained as a whole and 147 distant from the central axis. The 61% of the variability of the original data. In figure 6, it distinguishsP. laevigata the and samples the use 140 of PC1 resulted positive correlations of which urban settlement land. In the original data higher values were of the Co (0.38), Cu presentedfirst belonging the highest to values of heavy metal (0.37), Cd (0.37), Zn (0.35) and Pb (0.32). concentrations, reaching 2346 mg kg-1 El PC2 presented positive correlations Al, 0.90 mg kg-1 of As, 0.28 mg kg-1 Co, with high values highlighting Al (0.46) y 6.37 mg kg-1 of Cu, 0.843 6.37 mg kg-1 of V, 10.9 mg kg-1 Pb, 6.97 mg kg-1 of Ti, 3.08 mg kg-1 of V and 168.4 Mg kg-1 of Zn. In miningTi (0.42) settlement (figure 6), as to well a large as that extent of the regard to sample 147 which belongs to the speciesinfluence of ofmesquite the land and use the of thewinter urban season and S. molle and mining land use, showed high show data that have an effect upon this values of original data the Al (662.5 mg kg-1), variability. Twelve samples are primarily As (1.50 mg kg-1), 0.698 mg kg-1 of Co,

Figure 6. Point distributions derived of principal component analysis considering the factors of land use, species and season. Figura 6. Distribución de puntos derivado del ánalisis de componentes principales considerando los factores usos de suelo, especie y temporada.

Tomo 50 • N° 1 • 2018 135 Alcalá Jáuregui, Jorge et al.

88.02 mg kg-1 of Cu, 9.33 mg kg-1 of Cd, Figure 7 shows a cluster derived from 56.10 mg kg-1 of Pb, 9.24 mg kg-1 of Ti, 3.19 mg kg-1 of V y 1304.5 mg kg-1 of Zn. between the heavy metals studied, Similar results were found, attributing the distances of correlation coefficient the presence of these elements in the As and Pb with a level of 96.8 %; on the contrary,indicating V the presents degree ofa affinitylowest betweendegree and mining activity in the area (5, 7). environment to the influence of the urban of affinity.

Figure 7. Dendogram of similarity of Euclidean distance between the studied metals foliar matter. Figura 7. Dendrograma de similitud de la distancia euclidiana entre los metales estudiados en material foliar.

Conclusions

Results indicated that the presence of assessed elements. On the other hand, heavy metals is determined by the indi- the spring season presented the most vidual effect of the species, land use, and amount concentrations of Cu, Co, Ti and V. season as well as the possible association In winter season Zn was the most repre- between them. P. laevigata turned out to sented concentrations. In this way, As, Co, Cd, Pb Ti and Zn showed concentrations Pb, Co and Al than the S. molle, that was above normal values for the vegetative be more efficient in the bio-indication of species. It is evident that in addition to of mining land resulted in higher concen- trationsmore efficient of Cu, Zn, with Cd, respect Pb, Co and to Ti. As, The having use environmental factors and physiological differencesthe influence to ofdevelop anthropogenic physical-chemical activities, significatively impacted in six of the eight 136 Revista de la Facultad de Ciencias Agrarias Heavy metals and vegetative species processes in the absorption and transport of fragmentation are good elements for of these elements towards the leaves assessment on pollution and environ- are a determining factor. Therefore, the mental impact of antropogenic activities dynamics and functionality of vegetative such as the different the land uses. plant species studied under conditions

References

1. Abdel-Latif, N. M.; Saleh, I. A. 2012. Heavy metals contamination in roadside dust along major roads and correlation with urbanization activities in Cairo, Egypt. Journal of American Science. 8(6): 379-389. 2. Aksoy, A.; Demirezen, D. 2006. Fraxinus excelsior as a biomonitor of heavy metal pollution. Polish Journal of Environmental Studies. 15(1): 27-33. 3. Alcalá Jáuregui, J.; Sosa, M.; Moreno, M.; Quintana, C.; Quintana, G.; Miranda, S.; Rubio, A. 2008. Metales pesados en vegetación arbórea como indicador de calidad ambiental urbana: ciudad de Chihuahua, México. Multequina. 17: 39-54. 4. Alcalá Jáuregui, J.; Ávila Castorena, C.; Rodríguez Ortíz, J.; Hernández Montoya, A.; Beltrán Morales, F.; Rodríguez Fuentes, H.; Loya Ramírez, J. G. 2012. Metales pesados como indicador de impacto de un sistema ecológico fragmentado por usos de suelo, San Luis Potosí, México. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. 44(2): 15-29 [en linea] Available in:

10. André, O.; Vollenweider, P.; Günthardt-Goerg, M. S. 2006. Foliage response to heavy metal contamination indicators.in Sycamore Scientific Maple (ResearchAcer pseudoplatanus and Essays. 6(4):L.). For. 966-976. Snow Landsc. Res. 80(3): 275-288. 11. Aragón-Piña, A.; Campos-Ramos, A. A.; Leyva-Ramos, R.; Hernández-Orta, M.; Miranda- ncia de emisiones industriales en el polvo atmosférico de la Ciudad de San Luis Potosí, México. Revista Internacional de Ortiz,Contaminación N.; Luszczewski-Kudra, Ambiental. 22(1): A. 5-19. 2006. Influe 12. ATSDR (Agencia para Sustancias Tóxicas y el Registro de Enfermedades). 1995. Vanadio (Vanadium) CAS # 7440-62-2. División de Toxicología ToxFAQs. 13. ATSDR (Agencia para Sustancias Tóxicas y el Registro de Enfermedades). 2004. Resumen de Salud Pública. Cobre. CAS#: 7440-50-8.

Tomo 50 • N° 1 • 2018 137 Alcalá Jáuregui, Jorge et al.

14. ATSDR (Agencia para Sustancias Tóxicas y el Registro de Enfermedades). 2004 b. Resumen de Salud Pública. Cobalto. CAS # 7440-48-4. 15. ATSDR (Agencia para Sustancias Tóxicas y el Registro de Enfermedades). 2005. División de Toxicología Resumen de Salud Pública. Cinc. CAS#: 7440-66-6. 16. ATSDR (Agencia para Sustancias Tóxicas y el Registro de Enfermedades). 2007. Agencia para Sustancias Tóxicas y el Registro de Enfermedades. División de Toxicología y Medicina Ambiental. Resumen de Salud Pública. Arsénico. CAS#: 7440-38-2. 17. ATSDR (Agencia para Sustancias Tóxicas y el Registro de Enfermedades). 2008. Agencia para Sustancias Tóxicas y el Registro de Enfermedades. División de Toxicología y Medicina Ambiental. Resumen de Salud Pública. Aluminio. CAS#: 7429-90-5. 18. Dalmasso, A.; Candia, R.; Llera, J. 1997. La vegetación como indicadora de la contaminación por polvo atmosférico. Multequina. 6: 91-97. 19. Delgado, M. del M.; Lobo, C.; Plaza, A.; Capuano, A.; Hernando, G.; Prieto, J.; Miralles de Imperial, R.; Valero Martín, J. 2016. Efecto residual provocado por dos lodos de depuradora

(Camelina sativa (l.) Crantz) en Madrid. Revista de la Facultad de Ciencias Agrarias. procedentesUniversidad Nacionalde un ensayo de Cuyo. de fitorremediaciónMendoza. Argentina. con 48(2):cardo 13-30.en un cultivo de camelina 20. Díaz-Barriga, F.; Santos, M. A.; Mejia, J. J.; Batres, L.; Yanez, L.; Carrizales, L.; Vera, E.; del Razo, L. M.; Cebrian, M. E. 1993. Arsenic and cadmium exposure in children living near a smelter complex in San Luis Potosi, Mexico. Energy Technology. Data Exchange (ETDEWEB). 21. Duffus, J. H. 2002. Heavy metals. A meaningless Term? Pure and Applied Chemistry. 74(5): 738-807. 22. Durán, A.; Paris, M.; Maitre, M. I. Marino, F. 2016. Diagnóstico ambiental en la zona del cinturón hortícola de la ciudad de Santa Fe. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 48(1): 129-143. 23. EPA. 1992. Guide to site and soil description for hazardous waste site characterization.

Research and Development. U.S. Environmental Protection Agency. 24. Gmelin,Volume L. 1849. 1. Hand.BookMetals. Environmental of Chemistry. monitoring V. III. Metals. systems. Translated Laboratory-Las from the Vegas. German Office by H.of Watts. London. 25. González-Chávez, M. C. A. 2005. Recuperación de suelos contaminados con metales pesados utilizando plantas y microorganismos rizosféricos. TERRA Latinoamericana. 23(1): 29-36. 26. Goudot, A.; Bertrand, D. 1973. Los oligoelementos. Que sais-je. Nº 88. Oikos-tau Ediciones. España. 27. Heckman, J. 2004. Leaf analysis for fruit trees. Fact sheet FS627. Rutgers Cooperative Research & Extension. NJAES. Rutgers. The State University of New Jersey. 2 p. 28. Hernández-Vera, D.; Pompa-García, M.; Wehenkel, C.; Pérez-Verdín, G.; Carrillo-Parra, A. 2017. Are there any differences in carbon concentration among species of high conservation value forests in Northern Mexico?. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 49(2): 183-192. 29. INEGI. 2014. Anuario estadístico de San Luis Potosí. Instituto Nacional de Estadística y

30. Madejón-Rodríguez, P. 2004. Elementos traza y nutrientes en plantas y suelos afectados por Geografía (México). 573 p. Ecología y Medio Ambiente. XII: 002. 31. Navarro-Aviñó,el vertido J. P.; minero Aguilar de Alonso, Aznalcóllar. I.; López-Moya, Revista Ecosistemas. J. R. 2007. Aspectos Revista bioquímicos Científica y yTécnica genéticos de de la tolerancia y acumulación de metales pesados en plantas. Ecosistemas. 16(2): 10-25.

Platanus orientalis L. leaves as bioindicator. Eurasian J Soil Sci. 4(3): 144-152. 32.33. Ortiz-Cano,Norouzi, S.; H.Khademi, G.; Trejo-Calzada, H. 2015. Source R.; Valdez-Cepeda, identification R. of D.; heavy Arreola-Ávila, metals in atmosphericJ. G.; Flores-Hernández, dust using A.; López-Ariza, B. 2009. Fitoextracción de plomo y cadmio en suelos contaminados usando Quelite (Amaranthus hybridus L.) y Micorrizas. Revista Chapingo. Serie Horticultura [en línea] 15 (Mayo-Agosto). 34. Pais, I.; Benton, J. J. 1997. The Handbook of Trace Elements. St. Lucie Press. 223 p.

138 Revista de la Facultad de Ciencias Agrarias Heavy metals and vegetative species

35. Plan del Centro de Población Estratégico San Luis Potosí-Soledad de Graciano Sánchez. 201. H. Ayuntamiento de San Luis Potosí. H. Ayuntamiento de Soledad de Graciano Sánchez. 36. Plan Municipal de Desarrollo (2009-2012). 2012. San Luis Potosí. H. Ayuntamiento de San Luis Potosí. 101p. 37. SGM (Servicio Geológico Mexicano). 2008. Panorama minero de San Luis Potosí. Secretaría de Economía. Gobierno Federal. 38. Tanushree, B.; Chakraborty, S.; Bhumika, F.; Piyal, B. 2011. Heavy metal concentrations in street and leaf deposited dust in Anand City. India Research Journal of Chemical Sciences. 1(5): 61-66.

2006. Removal of As, Cd, Pb, and Zn from contaminated soilby high biomass producing 39. Tlustoš, plants.P.; Száková, Plant J.; soilHrubý, environment. J.; Hartman, 52(9): I.; Najmanová, 413-423. J.; Nedělník, J.; Pavlíková, D.; Batysta, M. 40. Velázquez, G. 2008. Diseño de una red de monitoreo atmosférico para la ciudad de San Luis Potosí: ubicación de nodos. Tesis de doctorado en ciencias ambientales Universidad Autónoma de San Luis Potosí. Facultades de Ciencias Químicas, Ingeniería y Medicina. San Luis Potosí. México. 41. Yilmaz, R.; Sakcali, S.; Yarci, C.; Aksoy, A.; Ozturk, M. 2006. Use of Aesculus hippocastanum L. As a bioindicator of heavy metal pollution. Pak. J. Bot. 38(5): 1519-1527.

Acknowledgment To all the students of the Agroecology Educational Engineer Program who participated as support in the samplings and Idrissa Diédhiou (Posgrade student) for the translation to English.

Tomo 50 • N° 1 • 2018 139 DevelopmentRev. FCA UNCUYO. programs 2018. 50(1): for female 141-155. farmers ISSN impreso 0370-4661. ISSN (en línea) 1853-8665.

Development programs for female farmers: identifying clusters for the case of Chile's "Education and training program for rural women"

Programas de desarrollo dirigidos a agricultoras: identificando clústeres para el caso del programa "Formación y capacitación para mujeres campesinas" de Chile

1 1, Maruja Cortés 1, Margarita Rico 2 1

Originales:Sofía Boza Recepción:, Tomás Muñoz 22/09/2016 - Aceptación: 24/10/2017, Jazmín Muñoz

Abstract

This article aims to contribute to the evaluation of development policies for female the Metropolitan Region of Santiago, Chile, to a representative sample of participants in farmers based on their beneficiaries' attitudes. For this, it was conducted a survey in the "Education and training program for rural women" of the Chilean National Institute for Agricultural Development. The questionnaire applied was divided into the following sections: i) personal characteristics of the farmers and their family unit; ii) technical, descriptiveproductive andand commercialmultivariate features; techniques iii) farmsuch andas principal household components income; and and iv) cluster vision of themselves and program-related attitudes. The data collected was processed by analysis. The results show a positive assessment of the program on an aggregate level, although there are significant dissimilarities within the sample, allowing three clusters to be identified: "reticent participants" (42.3%), "associative participants" (20.5%) and "empowered participants" (37.2%). The farmers on those clusters present differences not only in their attitudes towards the program but also in their education level, income, farm profitability and balance between productive and domestic roles. It's concluded that individual characteristics and circumstances impact beneficiaries’ perception of the programs,Keywords which should be considered in their design and implementation.

female farmers • public policies • rural development • attitudes • clusters • Chile

1 University of Chile. Faculty of Agricultural Sciences. Department of Agricultural Economics. Av. Santa Rosa 11315. La Pintana. Santiago. Chile. [email protected]. 2 UniversityPalencia. Spain. of Valladolid. Higher Technical School of Agricultural Engineering Department of Agricultural and Forestry Engineering. Av. Madrid 57.

Tomo 50 • N° 1 • 2018 141 S. Boza et al.

Resumen

Este artículo tiene como propósito contribuir a la evaluación de las políticas de desarrollo dirigidas a mujeres campesinas, considerando en este sentido las actitudes de Santiago, Chile, a una muestra representativa de participantes del programa de sus propias beneficiarias. Para ello, se aplicó una encuesta en la Región Metropolitana

"Formación y Capacitación para mujeres campesinas" del Instituto Nacional de Desarrollo Agropecuario. El cuestionario utilizado se dividió en las siguientes secciones: i) características personales de las productoras y de sus unidades familiares; ii) rasgos técnicos, productivos y comerciales; iii) ingreso predial y familiar; y iv) visión respecto- de ellas mismas; así como actitudes frente al programa. La información levantada se procesó mediante técnicas descriptivas y multivariantes, como componentes princi pales y análisis de conglomerados. Los resultados obtenidos muestran una valoración positiva del programa a nivel agregado, sin embargo con diferencias significativas entre agricultoraslas encuestadas, en cada permitiendo grupo divergen identificar no solo tres en grupos: sus actitudes "participantes respecto reticentes" del programa, (42,3%), sino "participantes asociativas" (20,5%) y "participantes empoderadas" (37,2%). Las también en su nivel educacional, ingreso, rentabilidad de sus negocios y relación entre los roles productivo y doméstico. Se concluye que las características y circunstancias individuales impactan en la percepción que las beneficiarias tienen sobre los programas, lo quePalabras debe ser clave considerado en su diseño y ejecución.

mujeres campesinas • políticas públicas • desarrollo rural • actitudes • clústeres • Chile Introduction

An increase in the presence of females Despite these important boundaries for female farmers, for a long time rural managerial positions is a phenomenon in the farming workforce and in land address them (5). In fact, up until the 70s small-scale farming (14, 36, 51). development policies did not seek to that has gained strength, particularly in restricted to reproductive/domestic rolesdevelopment (40). Since programs, the United women Nations were However, there are limitations in declared 1975-1985 the "Decade for femaleaccess tofarmers resources (2, that12, frequently20, 27, 39, result 42) Women", important progress has been in production gaps between male and made in terms of the incorporation of attractive in terms of expansion (53). gender issues into development planning, thereby making women’s activities less - - points: "Women in Development" (WID) Meanwhile, a "traditional" labor division andwhich "Gender has producedand Development" two main (GAD). stand still prevails, in so far as women's partici pation in production tasks is frequently unpaid and invisible (11) and additionally, The first approach proposes the they spend many more hours than men in need to improve the situation of women housework and childcare. by integrating them into development

142 Revista de la Facultad de Ciencias Agrarias Development programs for female farmers

This proposed approach, of course, the need to transform social structures does not rule out the importance of an thatinitiatives, foster inequalities whereas the (46). second defends outcome evaluation, but rather comple- One of the main criticisms to the ments it for a greater understanding of

attitudes is more common in consumer theGAD approachWID approach is the difficultyhas had of puttinggreater the programs. Although the analysis of it into practice, which has meant that diversestudies, issues it has (8, been 28, 29, previously 32, 33, 44, applied 45). incomesignificance countries, regarding but also in developmentcases such as in the context of farmers' perceptions on theinitiatives European (40); Union not only (43). in lowSaid and initiatives middle Some of these researches have shown (1989) "practical" gender needs, over that farmers' attitudes diverge depending thosehave prioritized of "strategic" the nature.satisfaction This of is Moser'sdespite on their objective characteristics; which the fact that the structural circumstances mayConsidering imply a relationship this context, between the objective those of thistwo paperdimensions. is to evaluate rural development that restrict women's empowerment- constitute an essential factor in lowering policy directed towards female farmers by developmenttheir entrepreneurial (9). capacity and, conse aboutidentifying development the attitudes programs of its beneficiaries. of female quently, their positive impact on rural The hypothesis is that the perception

Since rural women face particular infarmers relation differs to the in relative accordance importance with their of limitations associated with the social productivecharacteristics role. and situation, especially structures into which they are placed, not only is the quantitative impact of programs berelevant, related but to also subjective the dynamics processes by which such For this, we will examine the case of those effects are generated, which might Chile's "Education and training program for rural women". as their progressive empowerment. the InNational Chile, family Institute farming for isAgricultural supported From this point of view, a public policy mainly by the governmental agency, aand complete its beneficiaries assessment are inof constanta program and shouldbidirectional also include interaction. consideration Consequently, of the Development (Indap, due to its acronym individual responses to it. being Spanish), which has a long history of work with small-scale producers (35). Of the twenty plus different programs offered The beneficiaries' attitudes can be by Indap, the "Education and Training assimilated to such specific responses, Program for Rural Women" is the only one since they are defined as evaluative fromspecifically the Foundation focused on for female the Promotion farmers. thereactions recent with literature the potential that to conditionevaluates andIt is Development carried out with of Women additional (Prodemu, support the individual's behavior (38). However, The program aims to help small-scale female farmers' support programs uses femaledue to itsfarmers acronym in operative being Spanish). units made up landto narrow use (19, its 26).focus to women’s impact on variables such as productivity, income or on different subject areas: production of ten women through training sessions

Tomo 50 • N° 1 • 2018 143 S. Boza et al. development, business management, rural. In contrast to this urban character, agricultural production in the Metro- and personal development. In fact, the insti- organizational and sociability development, politan Region is extremely important for tutions in charge of the program explicitly the nation's supply. state the importance of achieving significant The Region encompasses 26.5% of the progress not only in terms of the female Chilean total area for horticulture, 17.3% farmers' economic situation, but also in for fruit and 9.4% for vineyards (37). their psycho-social development, implicitly compromisedHowever, thethroughout relative positionthe last of initiatedrecognizing in 1992, that bothit has are attended closely to related. more farming in the region has been seriously Over the course of the program which was In addition to a deeper understanding decadesIn fact, (mainly Santiago since and the its 80s) metropolitan due to the than 20,000 women. areaexpansion is the ofmain the economiccity of Santiago center (22). of Chile. literatureof the specific on casegender study, issues this paperin agricul aims- to significantly contribute to the existing triggersIn 2015 thepressure region generatedfrom non-agricultural 45.6% of the national GDP (6). This economic power methodologicaltural and rural approach development unexplored policy, in of land use, but also on account of human thiswhile area. addressing So, besides the contributing subject from to the a activities on agriculture not only because observed in the regional farms: aging and resources. Two related situations are furthercurrent research. literature, this paper will also Therefore, the choice of the Metro- constitute an innovative framework for feminization of management (7). facilitatingAdditionally, the itconception will represent of asupport highly continuouspolitan Region tensions as an areathat impact,of study inter is due alia, to constructive background for policymakers an interest in a context in which there are segment that faces particular restrictions, addition, the Metropolitan Region has not andstrategies therefore for is female of special family interest farming, to the a the changing role of women in farming. In- public sector. tural development research in Chile, been an area of frequent study for agricul

Materials and methods which has instead been focused on the carriedcentral andout viasouthern a simple parts random of the sampling country. The survey sample selection was total number of Metropolitan Region the Themonths data of analyzed June and in September this article 2013, was "Educationof finite populations and training program -considering for rural the amongobtained participants from a survey of theconducted Indap-Prodemu between "Education and training program for rural women" participants in 2013- of 394 women. The result was 78 individuals women" in Chile's Metropolitan Region. This (CI = 95%; e = 10%). inRegion the urban concentrates nucleus of 40% the Gran of the Santiago. Chilean characteristicsThe questionnaire of the farmers was divided and their into population,The region of which is divided the majority into 52 isdistricts, settled the following main sections: i) personal

family unit; ii) technical, productive and of them, only 18 are considered and commercial features; iii) farm

144 Revista de la Facultad de Ciencias Agrarias Development programs for female farmers

of themselves and program-related and household income; and iv) vision The groups identified underwent a discriminant analysis in order to check attitudes. The answers to the last category whether there were significant differences disagree",were given 2: in "disagree", accordance 3: with "indifferent", a 5-level observed between clusters. In order to Likert scale (in this case, 1: "completely evaluate the results two statistics were used: The information obtained from the the canonical correlation and Wilks' lambda. 4: "agree" and 5: "completely agree"). Finally, the segments obtained were characterized using descriptive statistics. survey was analyzed firstly by using Results and discussion applieddescriptive to the statistics. results obtained This was regarding followed by multivariate analysis techniques Descriptive analysis of the sample In this sense, a principal compo- farmers' attitudes. facilitates a reduction in information Firstly, the women who participated derivednents analysisfrom inter-related was employed, variables which (24). in the survey were between 19 and 81 couldyears old,be due, with among an average other age causes, of 48 toyears. the As already mentioned, the relative aging Previously Bartlett's sphericity test and the Kaiser-Meyer-Olkin (KMO) index incessant migration of young people from wereThe estimated criteria usedin order to select to determine the number the the country to the city. This proposition is sample adequacy (30). - Rebolledosupported (2015).by the case of central Chile as mination based on the percentage of the discussed in Castro (2012) and Valdés and of factors were Kaiser's method, the deter 2015 data, the Chilean rural population hasIn experienced addition, according an average to World annual Bank variance, and lastly, the coherence of the variables within the chosen factors. - compared to an increase in the urban The internal consistency of said factors- decrease of 0.8% in the last two decades, was measured using Cronbach's coeffi same period. componentcient alpha. matrix The factors obtained were through then inter the population of 1.5% per year during the preted in accordance with the rotated Furthermore, the relatively high level Varimax process, from which the variance of education of the women consulted percentage explained by the variables of stands out, given that 35.9% of them each factor was established. stated that they had finished high school. Once the factors were established, a alsoThis studied number higher reaches education, 61.6% when even the if givenhierarchical that both cluster can be analysis used complemen was carried- participants who declared that they had out, followed by a k-means cluster analysis, and then to group the consequent obser- they have not finished, are counted. These vationstarily, first (30). to define the number of clusters results contrast with data from the Chilean The procedure used for the hierarchical National Socio-Economic Survey (CASEN) for 2013, which show that in Chile only 32% of rural inhabitants declare that they structurecluster analysis per agglomeration was Ward's (24). technique have completed secondary education or which aims to form a hierarchy or tree-like higher, and 37.8% of the population have not even completed primary school.

Tomo 50 • N° 1 • 2018 145 S. Boza et al.

in the aforementioned process, even individuals aged 60 or more and for the The national situation is worse for "head of house". These authors highlight when they are not recognized as the two lowest quintiles of income. haveRegarding access to access preschools to services, in their 79.5% area, co-ownership of land as an essential factor of the women consulted claimed to in that sense, which is also supported by Wiig (2013) in the case of Perú. 87.2% to elementary schools and 38.5% When the women consulted were to secondary schools. Regarding health asked to declare the work status that best services, 52.6% of the women consulted represents them, the majority (46.2%) said that they had access to the rural answered "housewife", followed by 14.1%- accident and emergency service, 41% to a choosing "working", 6.4% "working and doctor’s surgery and 20.5% to the primary studying" and 15.4% "working sporadi emergency service (SAPU). cally". In this same sense, in order to find Furthermore, 61.5% of the women out how the women consulted organized consulted used community transport to andtheir second time, theyplace. were asked what activity travel locally and 32.1% did so by car. Only they dedicated most of their day to, in first 6.4% of the women declared that they used non-motorized modes of transport Fifty-nine percent of the women thatsuch a as priori bicycles or walking. This is of great dedicatingconsulted declaredtheir time that to houseworkthe production was relevance if we consider the possibility their primary activity, followed by 17.9% access to more efficient modes of transport leads to greater autonomy. unit. As a second option, 52.6% of the Meanwhile, 55.1% of the women women indicated the production unit, consulted lived in their own house and providedfollowed byevidence 22.4% indeclaring the case housework. of central up37.2% on average obtained of it4 throughpeople, ranging family links.from In this sense, Fawaz & Soto (2012) The women's family units were made productive and domestic roles for rural Chile for the constant tension between 12 members to women that live alone. There was a notable presence of elderly women despite advances in terms of their people within the family unit, considering incorporation into the labor market. that they represented 17% overall. Actually, Ferrada & Zarzosa (2010) and On the other hand, 25% of the Fawaz & Rodríguez (2013) point out the link members were under the age of 18, and between marital status and women's labor 9% of them were under 6 years old. In market participation in Chile, with married terms of relationship status, 72.4% of the women being significantly less active. women consulted were either married The high priority that the women (48.7%) or in a relationship (23.7%). consulted gave to unremunerated work Regarding decision making, 53.8% is probably related to (in addition to of the women declared that they carried CLPother $74,787 factors) per the month low income(112.3 US$). that theyIt is out this process together with their generated, which on average added up to partner, whereas 28.2% did so alone. This is reflected in the positive relationship partimportant of the to program mention and that corresponded this income was to andevidenced age and by their Damisa level & Yohannaof participation (2007) mainly the product of work carried out as between rural women's level of education 22.5% of the overall household budget,

146 Revista de la Facultad de Ciencias Agrarias Development programs for female farmers

- (498.1 US$) per month. These results which reached an average of CLP $331,729 respectively, followed by 11.5% in flori - lastculture. agriculture The high census presence conducted in the first in twothe fall in line with Anthopoulou's (2010) subsectors coincides with data from the findings, which identified that expecta thantions in for men, benefits given and that expansion females inprotect their Metropolitan Region (48); however, this is business is more modest in rural women not the case for floriculture. The difference may be due to the fact the balance between production tasks and particular,that in Chile to females. floriculture is an activity taking care of the family. with special ties to family farming and, in inhibitingComplementarily, the Chilean Rodríguez rural & Muñozfemale Assessment of statements referring (2015) show that one of the factors to attitudes and factorial analysis representmovement to into the household the labor income. market is the series of statements relating to attitudes relatively small contribution that they The survey employed contained a

Therefore, it is likely that female farmers towards the initiative "Education and- discouragefall into a vicious greater circle, dedication where low to income their training program for rural women" that business,prospects thus and preventing family responsibilities them from were scored by respondents in accor improving their performance and dance with a 5-level Likert scale, with 1 being "totally disagree" and 5 being "totally agree". In this context, the most contribution to the household economy. (averagehighly supported 4.68). This statement represents was: a great "The unitsIn declared fact, in their the caseactivities of the to womenthe tax program has helped me to value my work" consulted, only 18.2% of the production achievement, considering that a lack of services. This rate is even lower than that self-confidence has the potential to limit which is observed for rural entrepreneurs rural women’s entrepreneurship (3). in the country, which was 26.2% in 2014. Likewise, the following statements were The informality is also reflected in also highly rated: "In general terms I am terms of market access. In this sense, satisfied with the service provided by the 57.7% of the women consulted declared- programprogram" are (4.59), useful" and (4.56). "I think This the illustrates training, that the products elaborated by the courses and workshops provided by the program group in which they partici the participants evaluated the general pated were sold directly from the place contentan overall that positive the program view inoffered terms them. of how "doorof production, to door". Even whereas their participation for 12.8% the in method of distribution employed was to association and participation arose: important these are to Chilean small-scale Subsequently, statements relating farminglocal markets (47), isand very thus low, this considering is expected how to have an additional detrimental effect on "Thanks to the program I have learned the importance of associating with others" (4.49), "Thanks to the program I the potential growth of their sales. have learned to work as a team" (4.47), Finally, the main areas that the groups and "The program takes into account the work in are horticulture and poultry participants' opinions" (4.48). farming, standing at 46.2% and 30.8%

Tomo 50 • N° 1 • 2018 147 S. Boza et al.

Cluster analysis of female farmers these statements is of particular relevance in terms of their attitudes The beneficiaries' agreement with Three homogenous groups of female been found regarding the relationship if we consider that positive links have farmers were identified in terms of researchesbetween rural (15, women's50). collective action their attitudes towards the program and their empowerment in a number of (and specified in the principal components pillars of this program since it is aimed at previously described). These groups Additionally, associativity is one of the were named the following: "reticent achieve common goals (54). participants" (42.3%), "associative promotingFurthermore, collaboration among and reliabilitythe most to participants" (20.5%) and "empowered participants" (37.2%). a number related to overall improvements The first segment was defined, thatpositively the program evaluated facilitates statements for the there current are generally speaking, by its relatively impactnegative that attitude this towardssegment the of program.partici- This is particularly so in terms of the situation and for the business outlook tofor thethe women:program" "My (4.41), production "The programunit will pants felt they had achieved regarding continue working in the future thanks in"associativity" relation to the and "training "commercialization and personal development"and organizational factor. management", but also has helped me learn to introduce new ideas into my production unit" (4.32), et al. (2016) for Indap the"Thanks future" to (4.21),the program and "The I feel program capable has of The results mentioned agree with carrying out new business ventures in those of Boza production unit" (4.19). beneficiaries of the local development helped improve the organization of my program (Prodesal), where an important - group of farmers that were skeptical about The principal components analysis toits usefulnessthe "associative were identified.participants" cluster, based on answers to the proposed state In the case of the women belonging ments showed that the farmers' attitudes towards the training program could there were contrasting positive and be explained as 57.6% of the variance negative attitudes towards the program. for the following six factors: "training factorsAs for the"future other prospects profiles, and the business greatest prospectsand personal and development" business (20.39%),ventures" differences were identified in the "service and feedback" (9.29%), "future- - expressed.ventures" andIn "dedicationcontrast, the to work","associa for- (8.31%), "commercialization and organi both of which negative attitudes were (5.83zational management" (7.06%), "associa - tivity" (6.71%) and "dedication to work" tivity" factor produced extremely positive %) (table 1, page 149). attitudes. Lastly, the "empowered partici pants" segment was characterized by its all-round positive attitude towards (tablethe program, 2, page 150) and . was the only group to commend the "dedication to work" factor

148 Revista de la Facultad de Ciencias Agrarias Development programs for female farmers

Table 1. Tabla 1. Composición de los factores que explican las actitudes de las agricultoras Composition of factors whichfrente explain al programa. farmers attitudes towards the program. % of Factor Loading Factor variable variance 0.770

0.684 My efficiency when working has improved thanks to the program. the program. The quality of my business’ products has improved thanks to 0.658 production unit. Training and personal The program has helped me learn to introduce new ideas into my development 0.624 20.39% 0.550 The program has helped me improve my technical skills. program are useful. I think that the training, courses and workshops provided by the 0.530

0.507 The program has helped me increase my self-esteem.

0.787 The program has helped improve the organization of my production unit. the program. In general terms I am satisfied with the service provided by 0.731 legal aspects. The program has helped my production unit in its formal and 0.703 Service and feedback 9.29% 0.446 The program takes into account the participants’ opinions. the program. My production unit will continue working in the future thanks to 0.728 ventures in the future. Thanks to the program I feel capable of carrying out new business The program provides information on other support services 0.698 Future prospects and and programs. business ventures 0.698 8.31% 0.482 The program has taught me how to run a business. 0.437 The program promotes taking care of the environment.

0.763 My household income has risen as a result of this program. Thanks to the program my production unit has improved its 0.681 commercialization. Commercialization management There is a fair distribution of tasks among the participants in and organizational 7.06% I consider there to be an adequate number of participants in 0.616 my group.

0.841 my group. Thanks to the program I have learned the importance of associating 0.764 Associativity 6.71% with others. 0.624 Thanks to the program I have learned to work as a team. to be excessive. I consider the amount of time I spend working on my production unit 0.559 0.527 Dedication to work 5.83% The program provides sufficient financial support. 0.426 The program activities are carried out opportunely. The program has helped me learn to value my work.

* Bartlett's sphericity test p = 0.000. / * Prueba de esfericidad de Bartlett p = 0,000. ** Kaiser-Meyer-Olkin index (KMO) = 0.642. / ** Índice Kaiser-Meyer-Olkin (KMO) = 0,642. *** Total explained variance = 57.6%. / *** Varianza total explicada = 57,6%. Tomo 50 • N° 1 • 2018 149 S. Boza et al.

Table 2. Tabla 2. Beneficiaries' clusters in terms of attitudes towards the program. Grupos de beneficiarios conforme a sus actitudesCluster frente al programa. Components “Reticent “Associative “Empowered participants” participants” participants” Training and personal development -0.57 0.37 0.45 -0.16 -0.04 0.20

FutureService prospects and feedback and business ventures 0.12 -1.07 0.45 -0.55 0.15 0.55

Commercialization and organizational management -0.61 0.69 0.31 Associativity -0.12 -0.79 0.57 Dedication to work

appreciate the effect the program had in terms of their personal development and To summarize, on the one hand, there is a segment of participants whose aspectsattitudes despite reflect believing a distinct that skepticismit has the aspectscapacity of to production make contact and with management. other female regarding the program's impact in all producers, instead of specifically different participants grouped as "reticent" and capacity to generate a positive effect on “associative”Finally, theregarding disconformity the program of thein the overall evolution of their activity. relation to the time dedicated to it and This group differs from the "empowered particularparticipants", components who present and its positiveoverall constitute additional evidence that their attitudes both in terms of the program's- to their own production activities would These res impact. Lastly, the "associative partici businesses are not priority. - pants" demonstrate significantly positive ults are linked to those butattitudes not intowards respect the to program the technical in relation and obtained by Rico & Gómez (2009), Anthord productiveto their aspects. psycho-social This contrast development, could be poulou (2010) and Galié, Jiggins & Struik attributed to the individual circumstances subject(2013) whoto household show that circumstances, rural women rega more thantheir as activities a true business as a subsidiaryventure the supportsuccess their businesses- on a small scale, in an under which the women consulted run In fact, Abramo (2004) states that,of which in is ageneral priority onterms, a personal in level.Latin thatinformal a large context percentage and, in of many the cases,program in addition to home-keeping. This suggests America female workers are seen as a participants, who do not see their activities "secondary labor force", subordinated to as a business to expand upon, lack the thefamily presence needs. Specifically,of a partner in and Chile's children case, motivation to analyze in depth and put Fawaz & Rodríguez (2013) illustrate that into practice the specific training provided by the program. This is also linked to the limits the women's positive attitude fact that many of the women consulted towards assuming a productive role, given

150 Revista de la Facultad de Ciencias Agrarias Development programs for female farmers that a large percentage of them feel that it differences can be found among the Regarding the family unit, several has a negative effect on the care they can give to their family. groups, the first being the number of thisHowever, does not despite mean allthat the the restrictions current participants"members. There cluster, was 4 up members to an average in the situationaffecting theirof their opportunities businesses forcannot growth, has "associativeof 3.4 family participants" members in and the 4.5 "reticent in the

age distribution, it is possible to observe an impact on the empowerment of rural "empowered participants". In terms of women (31). - To continue, it was relevant to carry that the profile with the largest number of out an overview of the program's partici children between the ages of 0 and 6 years pants' main characteristics for each of the was the first one, reaching 11.5%, followed "reticentsegments participants" identified. This had revealed the highest some by the third and lastly the second cluster, significant differences. For instance, the reaching 9.9% and 6.2% respectively. This order is repeated when considering concentration of older producers, with an elderly people (65 years and over), with average age of 50.7 years, compared with 19.5%; 16.8% and 12.3%, respectively. the profiles of "associative participants" and Likewise, the segment of "empowered "empoweredIn terms participants"of level of that education, averaged partnerparticipants" compared presented to the a slightlyothers, higheralong 45.3 and 46.4 years of age, respectively. percentage of women living without a the participants in the first and third thewith most a consequent favorable declaration evaluations that of theythe segments differentiated themselves by programmake decisions came atfrom home participants unilaterally. that So a greater relative presence of secondary school education (39.4% and 37.9% respectively), whereas in the second belonged to the largest families, and who segment there was a strong et presence al. (2015), of needwere to often generate in charge. income via their production, technical training (37.5%). This agrees Their responsibility implies a greater with both the results of Boza who indicate that in the Metropolitan which can be linked to a higher motivation Region, older people haveet fewer al. (2010) years for of to assimilate the training provided by the Indapschool, participants especially in in rural the central-southern areas, and with concerningprogram. This the introduction agrees with of results Chilean already rural those obtained by Jaime mentioned in Rodríguez & Muñoz (2015) Concerning the occupations of participationregion of Chile, in associations. who found that a higher thewomen participants, into the labor itmarket. is possible to level of education was directly linked to of services, the "associative participants" Furthermore, regarding the availability observe strong contrasts within groups. The most noteworthy of these segment also showed better access, thehas to"associative do with participants" self-identification cluster, as particularespecially insegment terms ofdeclared educational using facilities. public "housewives", which reached 62.5% in transportLikewise, as 100% a means of the of transport, participants compared in this observed for the "reticent participants" whereas 42.4% and 41.4% were with 39.4% of the "reticent participants" and "empowered participants" clusters and 65.5% of the "empowered participants". Tomo 50 • N° 1 • 2018 151 S. Boza et al. farmers from the "associative participants"respectively. segment In thisindicated sense, that 81.3% their of there were significant differences among participants. Consequently, three specific segments were identified. most important activity was household expectedOn the impact one hand, of thea majority different group compo was- tasks, compared with 48.5% and 58.6% nentsnotorious of forthe holding program. a reticent This viewcontrasts of the demonstratedin the other twospecial segments. appraisal This of helps the programto explain in terms both of why it providing said participants a meeting with another segment of producers who demonstrated notably positive attitudes. technicalpoint and and support productive network, aspects and itof beingtheir Lastly, the third segment identified valued more than a way of improving different the program's facility to generate social evaluation of the time dedicated to the regardlinks. In for this the sense,aspects it of was the revealedprogram that programown businesses, and their as productive well as their activities. negative there is a concurrence between this high - of farmers and their dissimilarities in promote relationships and psycho-social Lastly, regarding the different groups well-being and the participants identi fying themselves as "housewives". andattitudes their towards businesses, the program it is to be as wellexpected as in demonstratedAdditionally, asa previouslypessimistic mentioned, attitude their opinions on how they see themselves a significant number of women differences in the income generated. that there would also be apparent specific program.in terms ofThat utilizing position the seemed technical to andbe managerial training provided by the Effectively, the higher personal income expanding their businesses. At the same averagingwas obtained CLP$ by the91,750 women per belonging month, linked to low motivation in terms of comparedto the "empowered to CLP$ 66,156 participants" for the "reticent profile, participants" and CLP$ 61,533 for the thetime, program another appears interesting to be resultrelated was to their that "associative participants". the degree to which the women valued In contrast, in the case of total opinionhousehold about economic the program vulnerability. had a greaterIn fact, registered for the participants belonging economicthe female contribution farmers with to their a more household, positive household income, the highest amount was - to profile "reticent" (CLP$ 375,793), as they often lacked additional support. "associative"followed by profile households "empowered" (CLP$ 261,000). partici This suggests that the necessity that these pants (CLP$ 318,928) and lastly, profile women have for their production activity developto help alleviatetheir businesses. their financial situation, Conclusions encourages them to seize opportunities to action, the results obtained suggest, on From the point of view of public sector stands out that despite the "Education From the results presented, first it termsthe one of hand, variations that thisin economic kind of program's situation, butimpact also should in terms be contemplated of social development not only in and training program for rural women" being positively evaluated on an aggregate level by the female farmers consulted, and psycho-social well-being.

152 Revista de la Facultad de Ciencias Agrarias Development programs for female farmers

On the other hand, another circumstance Therefore, given that it is a long term aim to reverse an installed social structure (traditional role distribution), the most that should be taken into consideration suitable option could be to adapt the crucialwhen designingfor the participants and implementing to be able this to programs to such circumstances but type of program is that it seems to be run both their household tasks and their gradually work (directly or even indirectly) production activities simultaneously. towards bringing about their mitigation. References

secundaria? Estudos Feministas. 12(2): 224-235. 1. Abramo, L. 2004. ¿Inserción laboral de las mujeres en América Latina: una fuerza de trabajo

2. Aguilar, A.; Carranza, E.; Goldstein, M.; Kilic, T; Oseni, G. 2015. Decomposition of gender differentials in agricultural productivity in Ethiopia. Agricultural Economics. 46(3): 311-334. 3. Amghani,Management M.; Gholami, andH.; Shiri, Development. N.; Shabanali, 3(3): H. 153-158. 2013. Obstacles of women presence in Iranian rural management: A case from Osku County. International Journal of Agricultural

4. Anthopoulou, T. 2010. Rural women in local agrofood production: Between entrepreneurial initiatives andRevista family de strategies.Ciencias Sociales. A case study 48: 223-253.in Greece. Journal of Rural Studies. 26: 394-403. 5. Baca, N.; Herrera, F. 2008. Emergencia de la relación desarrollo rural-género. Convergencia Central. 14 p. 6. Banco Central. 2016. Cuentas nacionales de Chile. PIB regional 2015. Santiago, Chile. Banco

7. Boza, S.; Idesia Cortés, (Arica). M.; Guzmán, 33(1): 135-142. F. 2015. Caracterización de pequeños empresarios agrícolas beneficiarios de programas de desarrollo local en la Región Metropolitana, Chile.

8. Boza, S.; Marcos, G.; Cortés, M.; Mora, M. 2016. Perfiles basados en actitudes hacia los programas de48(2): apoyo 161-175. público de microempresarios rurales de la zona central de Chile. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina.

9. Buendía, I.; Carrasco, I. 2013. Mujer, actividad emprendedora y desarrollo rural en América Latinaescenario y el de Caribe. ruralidad Cuadernos en tensión. de desarrollo Psicoperspectivas. rural. 10(72): 11(1): 21-45. 180-203. 10. Castro, A. 2012. Familias rurales y sus procesos de transformación: Estudio de casos en un

11. Contzen, S.; Fortney, J. 2016. Family farming and gendered division of labour on the move: a typology of farming-family configurations. Agriculture and Human Values. In press. 12. Croppenstedt, A.; Goldstein, M.; Rosas, N. 2013. Gender and Agriculture: Inefficiencies, segregation, and low productivity Traps. The World Bank Research Observer. 28(1): 79-109. 13.14. FAO.Damisa, 2010. M. The A.; useYohanna, of monitoring M. 2007. and Role evaluation of rural women in agriculture in farm and management rural development decision projects. making process: Ordered probit analysis. World Journal of Agricultural Sciences. 3(4): 543-546.

Rome.families. FAO/World Journal of Bank. Rural 60Studies. p. 26: 141-151. 15. Farmar-Bowers, Q. 2010. Understanding the strategic decisions women make in farming

16. Fawaz, 4(35): M. J.; Soto,218-254. P. 2012. Mujer, trabajo y familia. Tensiones, rupturas y continuidades en sectores rurales de Chile central. Revista de Estudios de Género: La Ventana.

17. Fawaz, M. J.; Rodríguez, C. 2013. Mujeres rurales y trabajo en Chile central. Actitudes, factores yUniversum significaciones. (Talca). Cuadernos 25(2): 79-99. de Desarrollo Rural. 10(72): 47-68. 18. Ferrada, L.; Zarzosa, P. 2010. Participación laboral de las mujeres en las regiones de Chile.

Tomo 50 • N° 1 • 2018 153 S. Boza et al.

19. Fisher, M.; Kandiwa, V. 2014. Can agricultural input subsidies reduce the gender gap in modern maize adoption? Evidence from Malawi. Food Policy. 45: 101-111. 20. Fletschner, D.; Kenney, L. 2011. Rural women's access to financial services. Credit, savings and insurance.households FAO-ESA in Siria. WageningenWorking Paper. Journal 11-07. of Life Sciences. 64-65: 25-33. 21.22. INE. Galié, 2007. A.; Jiggins, Cambios J.; Struik,estructurales P. C. 2013. en la Women'sagricultura identity chilena. as Análisis farmers: Intercensal A case study 1976-1997- from ten 2007. Santiago. Chile. 69 p.

23. Jaime, M.;Economía Salazar, Agraria. C.; Araya, 14: 9-21. S.; Vergara, J. 2010. Niveles de participación en la pequeña agricultura ¿De qué depende que los productores se involucren en sus organizaciones?

24. Jolliffe, I. T. 2002. Principal Component analysis. New York. Springer. 487 p. 25. Johnson, R. A.; Wichern, D. W. 2007. Applied multivariate statistical analysis. New Jersey. Pearson Prentice Hall. 773 p. 26. Karamba, R. W.; Winters, P. C. 2015. Gender and agricultural productivity: implications of the farmin land input rights subsidy indicators program in Asia. in Malawi. Agricultural Agricultural Economics. Economics. 46(1): 119-138.46(3): 357-374. 27. Kieran, C.; Sproule, K.; Doss, C.; Quisumbing, A.; Mi Kim, S. 2014. Examining gender inequalities

28. Kotevska, A.; Martinovska-Stojcheska, A.; Öhlmér, B.; Dimitrievski, D. 2013. Attitude of Macedoniande los trabajadores farmers del towards campo EU acerca accession. del sistema Agroeconomia de formación Croatica. continua 3(1): en 9-17. la Región 29. López Lluch, D. B.; Zapata, J. L.; del Campo Gomis, F. J. 2016. Análisis preliminar de la percepción

de Murcia. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 48(2): 177-193. 30. Malhostra, N. K. 2008. Investigación de Mercados. Mexico DF. Prentice Hall Mexico. 864 p. 31. Markantoni,Studies. M.; 28:Van 507-516. Hoven, B. 2012. Bringing 'invisible' side activities to light. A case study of rural female entrepreneurs in the Veenkoloniën, the Netherlands. Journal of Rural desarrollo de la micro región Tierra de Palmares desde la perspectiva del turismo rural 32. Marzo-Navarro, M.; Pedraja-Iglesias, M.; Vinzón, L. Percepción de los residentes sobre el

integrado. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. En prensa. 33. Mora M.; Cortes M.; Sanhueza C.; Sáenz C. 2013. Innovation requirements for the development 34. Moser, C.of 1989. cactus Gender pear for planning export: in A the new Third item World: to be incorporatedmeeting practical to the and Chilean strategical fruit genderexport sector.needs. WorldActa Hortulturae. Development. 995: 17(11): 229-236. 1799-1825.

agriculteurs. Cahiers Agricultures. 20: 352-358. 35. Namdar-Irani, M.; Sotomayor, O. 2011. Le conseil agricole au Chili face à la diversité des 37. ODEPA. 2013. Región Metropolitana. Información regional 2013. Santiago. Chile. 17 p. 36. NEPAD. 2013. Agriculture in Africa, transformation and outlook. Johannesburg. NEPAD. 72 p. Psicología Social: Procesos Interpersonales. Madrid. Editorial Pirámide. 131-159. 38. Quiles, M. N.; Marichal, F.; Betancort, V. 1998. Las actitudes sociales. In: Quiles, M. N. (Ed.).

39. Ragasa, C.; Berhane, G.; Tadesse, F.; Tafesse, A. S. 2012. Gender differences in access to extension services and agricultural productivity. ESSP Working Paper. 49. 40. Rico, M.; Gómez, J. M. 2009. Análisis de los enfoques sobre género y desarrollo: algunas reflexiones acerca de la mujer y su incorporación al proceso de desarrollo rural. In:Diputación Orejas, J.de A.; Palencia. Retortillo, 239-274. O.; Piñeyroa, A. J. (Coord.). Mujer, empresa y medio rural: V Congreso Internacional Mercado de Trabajo y Relaciones Laborales. Palencia.

41. Rodríguez, C.; Muñoz, J. 2015. Participación laboral de las mujeres rurales chilenas: tendencias, perfiles y factores predictores. Cuadernos de Desarrollo Rural. 12(75): 77-98.

154 Revista de la Facultad de Ciencias Agrarias Development programs for female farmers

42. Ruíz, L. E. 2012. Relaciones de género y mercados de derechos de agua y tierra en Chiapas. Regiónrural. In: y Sociedad.Unión de Pequeños24(53): 55-89. Agricultores (UPA) (Ed.). Agricultura familiar en España. 43. Sabaté, Madrid:A. 2009. UPA.La dimensión 103-108. de género en las políticas españolas y europeas de desarrollo

44. Sánchez-Toledano,Chiapas, México. B. I.; Revista Kallas, de Z.; la Gil, Facultad J. M. 2017.de Ciencias Importancia Agrarias. de Universidad los objetivos Nacional sociales, de ambientales y económicos de los agricultores en la adopción de maíz mejorado en

Cuyo.lamb meatMendoza. production Argentina. under 49(2): a Protected 269-287. Geographical Indication. Small Ruminant 45. Sepúlveda,Research. W.; Maza, 94: M.; 90-97. Pardos, L.; Fantova, E.; Mantecón, Á. 2010. Farmers’ attitudes towards

46. Taylor, V. 1999. A quick guide to gender mainstreaming in development planning. London, UK. Commonwealth Secretariat. 40 p. 47. Tejada, H. 2014. Venta directa en ferias locales: el proceso de modernización de las ferias libres enSantiago. Chile. In:Chile. Sotomayor, CEPAL. 93-96. O.; Rodrigues, M.; Rodríguez, A. (Coord.). Agricultura familiar y circuitos cortos: Nuevos esquemas de producción, comercialización y nutrición. Santiago. Chile. ODEPA. 14 p. 48. Traub, A.; Gajardo, S. 2012. El sector silvoagropecuario en la Región Metropolitana de Santiago. Chile Central. Polis (Santiago). 14(42): 491-513. 49. Valdés, X.; Rebolledo, L. 2015. Géneros, generaciones y lugares: cambios en el medio rural de sobre a construção territorial do assentamento Nova Lagoa Rica. Revista de Economia 50. Viana-Silva,e Sociologia C.; Valente, Rural. A. 51(2):2013. Agricultura387-400. familiar, gênero e dinâmicas sociais: um estudo

investments. Agriculture. 5: 188-220. 51. Wichelns, D. 2015. Achieving water and food security in 2050: outlook, policies, and

52. Wiig, H. 2013. Joint titling in rural peru: impact on women's participation in household decision-making. World Development. 52: 104–119. 53. World Bank, 2012. World development report 2012: gender equality and development. Washington DC. World Bank. 426 p. 54. Zambrano, A.; Bustamante, G.; García, M. 2009. Trayectorias organizacionales y empoderamiento comunitario: Un análisis de interfaz en dos localidades de la región de la Araucanía. Psykhe. 18(2): 66-78.

Tomo 50 • N° 1 • 2018 155 Rev. FCA UNCUYO. 2018. 50(1): 157-170. ISSN impreso 0370-4661. ISSN (en línea) 1853-8665.

A comparison between tourists' profiles in two Italian wine routes A comparison between tourists' profiles in two Italian wine routes

Una comparación entre los perfiles de los turistas de dos rutas del vino italiano

Luigi Galletto

Originales: Recepción: 18/05/2015 - Aceptación: 05/07/2016

Abstract

The study presents a comparative analysis of the wine tourism demand characteristics contradistinguish the wine tourists who frequent the Piave Wine Road and the Soave on two Italian wine routes. The research focuses on the more significant aspects that variables may increase the relative propensity for a wine tourist to choose one or other Wine Road, relying on 576 tourists' interviews. Through logistic regression, the identified propensityitinerary. The to travel results along confirm the Piave a rather Wine significant Road rather diversity than the between Soave one the correspond two profiles to an(84% elderly of cases foreign, are correctlyuniversity classified). graduate touristThey show who thathave the travelled aspects for that more imply than a greater3 days. This tourist pursues cultural activities, visits friends or acquaintances and tours with them. On the contrary, the latter one is more often preferred by someone aged less than thirty, who has learned of the route on a tourist board. He is less inclined to buy local wines and he spends less than 20 euro per meal. In this road is much more common the tendency to consider the wine tourism experience complete. Understanding the aspects that distinguish own wine tourists from other routes tourists allows Road Associations to position themselves better in an increasingly competitive market, in order to prepare appropriate territorial marketing strategies in relation to the wine tourism target that they intend to reach.

Keywords

wine route • wine tourist profile • logistic regression

Professor of Wine Economics. Centro Interdipartimentale Ricerche Viticole ed Enologiche (CIRVE). Universitá degli Studi di Padova. Agripolis. Viale dell'Università 16. 35020. Lengaro (PD) Italia. [email protected]

Tomo 50 • N° 1 • 2018 157 L. Galletto

Resumen

El estudio presenta un análisis comparativo de las características de la demanda de turismo del vino en dos rutas del vino italiano. En particular, la investigación se centra en los aspectos más importantes que distinguen a los turistas del vino que frecuentan la Ruta del Vino del Piave y la Ruta del Vino Soave basándose en 576 entrevistas. A propensión relativa para un turista del vino a elegir uno u otro itinerario. Los resultados través de regresión logística, se pueden identificar las variables que más aumentan la unaconfirman mayor unapropensión diversidad a viajar bastante a lo largosignificativa de la ruta entre del los vino dos Piave perfiles en lugar (84% de de la los ruta casos del Soaveson clasificados son: turistas correctamente). ancianos, graduados, Los resultados extranjeros, muestran viajando que los por aspectos más de que 3 días,implican que realicen actividades culturales, visitas a amigos o conocidos y viajar con ellos. Por el treinta años que han conocido el camino a través de organizaciones de turismo, están menoscontrario, dispuestos la preferencia a comprar por la vinos segunda locales ruta y segastan refleja menos mejor de en 20 los euros jóvenes por menores comida. Ende esta ruta, es mucho más común la tendencia a considerar la experiencia del turismo del vino completa. El conocimiento de los aspectos que distinguen a los turistas del vino permite posicionarse adecuadamente en un mercado cada vez más competitivo y preparar estrategias de marketing apropiadas en relación con el target del turismo del vino que desean lograr.

Palabras clave

ruta del vino • perfil del turista del vino • regresión logística Introduction

Wine or enological tourism is a type Wine routes are organizations of of tourism based on the promotion of a wine growers and others take holders local product: wine. Wine tourism has connected to the world of wine or the been the subject of economics studies territory where one or more types of wine since the 1990s (33). These studies have are produced. regarded both the supply of and demand They compete to provide a mix of of economics experiences that, according products, services and experiences that to some authors (30), aren't much wider can satisfy the expectations of the wine than simple services focused on the tourism demand, generating added value two characteristic organizations: wine not only for their members, but also for festivals and wine routes. other stakeholders in the area. And the The former are frequent mainly in closer these itineraries are each other the New World Countries, the latter have the higher is the level of competition. well-established roots in some Countries If the incentive of price is undoubtedly of the Old World (e.g. Rhein Weinstrasse), important for the success of a wine route but they have found more and more favor in many settings, its ability to attract one with the public in some wine-growing or more sectors of wine tourists in order areas of the New World. to choose it instead of another one is

158 Revista de la Facultad de Ciencias Agrarias A comparison between tourists' profiles in two Italian wine routes equally important. Therefore, complete information on the tourists who visit the behaviors of wine tourists have been wineries on a route is really important in studiedThe factorsin North defining America: the Brown choices (2005) and order to identify an appropriate strategy of and Getz (2006) analyzed the demand for wine tourism destinations in an important participants. This strategy must consider Canadian town (Calgary). Sparks (2007) territorial marketing that benefits all the applied the theory of planned behavior nearby routes because they are competing to identify the factors that determine the eachtourists’ other. profiles Therefore, visiting the wineries actions in can the intentions of wine tourists; Geide et al. differ whether the tourists travelling along (2008) high lighted the role of preferences two or more nearby routes constitute a and motivations in the segmentation of fundamentally homogeneous group or wine tourists in Virginia. present rather marked differentiating Segmentation can be a complex elements for each route. operation, combining demographic, The awareness that marketing is psychological and experiential variables essential for the success of wine tourism with the purchasing behavior in a winery, has led to many studies on the subject of the involvement of wine tourists and the segmentation of wine tourists. It has their information on wine (29). If Marzo- emerged that there are no wine tourist Navarro and Pedraja-Iglesias (2010) stereotypes; therefore, it is fundamental showed the existence of two segments in to identify the differences in order to reach the suitable target of the offer (8, 28). are several and various categories of wine Many approaches and applica- tourists.Spain in otherIn general, researches a prominent on profiles, variety there tions have been applied in different prevails in terms of socio-demographical geographical areas (3). characteristics, attitudes and life styles. According to the standard socio- Only a few studies considered the demographical characteristics (6, 13, 16, wine route. Hashimoto and Telfer (2003) has been based on the interest in visiting wine tourists' profiles linked to a specific wineries31), the classificationand on information of wine touristson the route and Hojman and Hunter-Jones offered wine (11), on the different percep- (2012)defined differentconsidered profiles the forheterogeneity the same tions of the visitors of the winery charac- of demand among the different routes teristics (12), on the level of involvement in the world of wine (4), on the type of sensations sought during the visit to within Chile. a wine In Italy,route thewas identificationthe subject of ofthe a wineries (15). Gallettospecific and wine Galletto's tourist outresearch line associated(2010). Barth and Salazar (2011) investi- However, we do not know any paper gated the link between wine purchases comparing the wine tourist outlines at wineries and those made in day-to-day in different routes, and this is the aim life, while Chang et al. (2002) combined of research. wine purchases with the trip charac- From this point of view, we have teristics. However, the principal wine tourist reasons to make the excursion are each other can be associated with two of interest to the researchers in several verified if two routes relatively close geographical areas (1, 2). variables commonly used in studies on winetypical tourists. wine tourist profiles referring to

Tomo 50 • N° 1 • 2018 159 L. Galletto

The both routes we have selected wines territory is between the provinces are sited in the Venetian region, in Italy, of Venice and Treviso, in eastern Veneto, where wine tourism has presented a rapid on a vast plain delimited by the Adriatic growing in recent years. Sea at the south and crossed by the Piave Researches on wine tourism demand River. Piave DOC Wines include both have used different techniques of multi- white (Chardonnay, Pinot bianco, Pinot grigio, Verduzzo and Tai) and red wines factorial analysis, principal compo- (Cabernet Franc, Cabernet Sauvignon nentsvariate analysis, analysis, cluster such as analysis confirmatory and Merlot, Pinot nero and Raboso Piave). logistic regression. The PWR is an itinerary of approxi- The last one seems to be the most mately 170 kilometers that starts and ends in Conegliano. It winds both on the applications on wine tourism have right and left of the Piave River, therefore consideredqualified to achievevarious ouraspects: aims. Itsa) previousdifferen- it is possible to visit places of cultural tiating the level of involvement of wine interest (Roman Time archeological sites, consumers, i.e. between supporters and several Venetian Villas, as well as the sites beginners (24, 35); b) discriminating of the Great War). between high and low spending potential The PWR Association has about 80 wine tourists (22); c) specifying the members, mainly wineries. At the time of factors of the approval deriving from wine this research, it was reorganized, thanks tourism activities (23, 27); d) identifying the factors that make a trip along a wine The Soave wine producing area is route more probable (26); e) specifying situatedto the most in recentwestern redefining Venetian of region, the route. not the reasons that lead to the purchase of far from Verona. It is a beautiful land wine at festivals (9); f) delineating some where tourists can admire hills, volcanic consumers’ features concerning both soils, gentle slopes and green areas of the participants in wine-tasting events vineyards. It is a popular tourist desti- at agritourists (18) and the visitors to nation for Italians and foreigners, thanks wineries in the Northern Appalachian to the easy motorway and railway links. States (34). Wines totally depend on the local variety In this study, we used logistic regression named Garganega. to identify the differences characterizing The SWR, a much shorter itinerary, the two studied wine roads customers. extends as far as 50 Km, with various the two routes differ not only in terms of villas and castles and it covers the main landscapeThe hypothesis and in terms to of be enological verified supply, is that crusramifications for the production among vineyards, of Soave. churches, The SWR Association was founded in 1999. There are presently (2014) but also because of the specific wine tourist 130 members, including wineries profile, that distinguishes one another. (privates and cooperatives), agritourists, Materials and method restaurants, hotels and companies offering typical local products. It is The routes we investigated are the active in coordinating the members with Piave Wine Road (PWR) and Soave the ambition of creating the Soave area Wine Road (SWR), which are located at as one of the principal circuits for the a distance of about 100 km. The Piave enological tourism.

160 Revista de la Facultad de Ciencias Agrarias A comparison between tourists' profiles in two Italian wine routes The data utilized were obtained using where: interview based on a questionnaire. 0 = constant, i.e. = the value of Y when the The analysis was conducted during the value of all the independent variables are weekends in 2012 spring, a busy period for equalβ to 0 the wineries working along the two roads. 1 n = the estimates of the parameters

Besides the usual socio-demographical X1 - Xn = characteristics of the wine tourists questions, the questionaire included β - β other information about the wine tourists The model is estimated by logit trans- in terms of a) motivations, b) type and formation, which results as a linear duration of the trip, c) acquisition of infor- function in the explanatory variables. More mation on the road, d) previous wine tourism experiences, e) accommodation transformation of the propensity (odds): preferences, f) willingness to pay for a Logexactly, (p/(1-p), Logit iswhere defined p is as the the probability logarithmic of meal, g) purchase of wines and h) the favorable cases. Logit transfers the proba- opportunity of repeating the same route. bility from the interval (0,1) to the whole Having considered the sample size in axis. So logit values equal to zero are associated to the probabilities of success (22, 26, 35), we planned 350 interviews in equal to ½, negative values are associated eachsimilar wine research road. Becauseon the consumer's of uncomplete profile or to the probabilities of success less than uncoherent answers led us to rely on 576 ½ and positive values are linked to the cases, a good number for performing statis- probabilities of success greater than ½. tical valid analyses. Interviewees were i casually selected among people available to have been estimated the marginal effects answer the questionnaire. In case of people In addition to the β coefficients, we travelling in group, we tried to individuate a p level < 0.1. They indicate the variation a sort of inside "guide" or "chief". onfor thethose probability variables that that a arewine significant tourist will at belong to the PWR due to a given feature. the differences between the two wine there is only The logistic regression model verifies binary explanatory variables, this change After having specified that is given by: p(Xij= 1) – p(Xij= 0). fortourist classifying profiles a wine as well tourist as as provides acustomer the Table 1 (page 162) lists the charac- ofcontribution one route ofrather the significantthan the other variables one. teristics used for the logistic regression Therefore, it offers a prognosis (or in terms of frequency distribution. Some propensity) relative to deciding on the important variables are not included former or the latter route. in the table 1 (pág. 162). They are the Concisely, in the logistic regression level of income, the residence and the model, the dependent variable belongs kind of profession. In fact, they were not to one of the two roads, and it assumes a considered because there were too many value 1 for the PWR and 0 for the SWR. Its missing data (from around a third to two probability is equal to 1/1(1+eY), with Y thirds of interviewees). For this reason, it was preferred to use only the variables surveyed for all the interviewees and to defined by the linear combination: 0 1X1 2X2 nXn, (1) maintain a good sample size, thinking that these variables would be adequate to Y = β + β + β + … β pursue the objectives of the research.

Tomo 50 • N° 1 • 2018 161 L. Galletto

Table 1. Frequency distribution of the variables used in the logistic regression models. Tabla 1. Distribución de frecuencias de las variables usadas en los modelos de regresión logística.

% Piave Wine Road 53.70 Soave Wine Road 46.30 Age: under 30 years 27.95 Age: between 30 and 60 years§ 45.14 Age: over 60 years 26.91 Nationality: Italian § 64.58 Nationality: foreign 35.42 Male§ 62.80 Female 37.20 Education: primary school 3.04 Education: secondary school 9.01 Education: high school§ 52.95 Education: university 35.00 Motivation: visiting friends or acquaintances 20.42 Motivation: cultural trip 27.58 Motivation: holiday trip or other§ 52.00 Day trip 31.30 Tripin 2 or 3 days§ 37.50 Tripin more than 3 days 31.20 Trip with relatives or alone§ 50.97 Trip with friends or acquaintances 32.81 Organized trip 16.32 The knowledge of the route: from friends or acquaintances 25.80 The knowledge of the route: from traditional advertising 10.33 The knowledge of the route: travel agents or tourist boards 25.87 The knowledge of the route: internet 10.10 The knowledge of the route: other§ 27.90 Previous experience of wine routes§ 50.17 49.83 Overnight staying in hotel or guest house§ 58.33 The first experience of wine routes Overnight staying in agritourist 15.10 Other kinds of overnight staying 13.54 Overnight staying with relatives or friends 13.03 The purchase of local wines: Yes§ 66.68 The purchase of local wines: No 20.57 The purchase of local wines: Perhaps 12.75 The intention to repeat the route: Yes § 76.48 The intention to repeat the route: No 3.83 The intention to repeat the route: Perhaps 19.69 Willingness to payless than 20 € for a full meal 11.11 Willingness to payfrom 20 to 30 € for a full meal § 64.76 Willingness to paymore than 30 € for afull meal 24.13

§ Reference variable in the logistic regression (=0). § Variable de la referencia en la regresión logística (=0).

162 Revista de la Facultad de Ciencias Agrarias A comparison between tourists' profiles in two Italian wine routes Results

Sample features The distribution of interviewees between Finally, the willingness to pay for a the two routes seems adequate. Regarding meal is at an intermediate level for almost socio-demographical aspects, both the young two thirds of the samples. and the elder people seem well represented, the number of graduates at university is Logistic regression models reliable, moreover the foreigners are more Variables in table 1 (page 162) can than a third and the percentage of women be divided into three groups: a) socio- appears to be in line with many investiga- demographic (they cover from age to levels tions on wine tourists and, in general, on of education), b) related to the character- wine drinkers both in Italy and in Europe. istics of the trip as a wine tourist (they People visit the wineries mainly for a short cover from the trip duration to the wine holiday for cultural interests or for study. route experience), and c) related to choices The prevailing period of the trip is about of a wine tourist. These groups were 2-3 days; a day trip and longer ones are also well represented. About 50% of these are regression model and then all together. family or unaccompanied trips, followed firstlyIf weintroduced consider separately the indicators in the logisticon the by trips among friends or acquaintances, validity of the logistic regressions and on while it is limited the percentage of the the level of adaptability to the observed data travelers in trips organized by travel agents with provided transport. It is nearly equal where the three groups of variables were the division between those who experience considered(table 2, page separately, 164), the show first threean absolutely models, higher contribution of the aspects related already experienced them at least once. to the trip and the socio-demographic and a wineHow route they forget theto know first timethe routes and who is quite has choice aspects follow in the list. These different. Travel agents and tourist boards models are partial even if they demonstrate are used by more than a quarter of the interviewees, while to get to know about second model. Moreover, the full model the trip from friends and acquaintances appearsa great ability to be inequally classification suitable chieflyaccording in the to is the most used way of deciding a wine the explained variability. route. Only a tenth of the samples obtained The analysis of the odds ratio (eB) the information by internet and another shows extremely high values for two tenth by traditional forms of advertising characteristics: The former is the (television, radio, the printed press). organized trips and the latter is the The prevalent type of night accommo- learning about the route via internet. dation is a hotel or a guest house, followed The odds ratio in favor of the PWR by an agritourist. A quarter of the sample compared to the SWR is less than 86% does not buy wines at the wineries, but for those who obtained information they only taste them during their visits. via internet in comparison with other A few of them do not want to repeat methods and it is 72% for those who the itinerary not for dissatisfaction but belong to an organized group, comparing because the want to experience new wine them to those who travel alone or routes: it could be the consequence of the with relatives. presence of "route hunter" tourists.

Tomo 50 • N° 1 • 2018 163 L. Galletto

Table 2. Results of logistic regression models. Main statistical indicators. Tabla 2. Resultados de los modelos de regresión logística. Principales indicadores estadísticos.

Log Hosmer- Correctly Cox and Nagelkerke Model likelihood Lemeshow χ2 classified cases Snell R2 R2 -2 (8 g.l.) (%) 1 – Socio-demographic variables 613.081 0.271 0.362 13.110 72.7 2 – Trip variables 468.864 0.433 0.578 8.362 82.6 3 – Choice variables 673.140 0.186 0.249 3.630 68.4 4 – All variables 314.398 0.565 0.755 10.832 89.7 5 – All variables* 400.658 0.494 0.660 5.925 83.8 6 – Step selection* 417.897 0.479 0.640 9.102 83.8 * Excluding the variables: organized trip and learning about the route via internet. * Excluyendo las variables: viaje organizado y aprendizaje sobre la ruta vía internet.

While corresponding to the actual sample, these latter pieces of evidence all the models. A subsequent estimation appear to be rather incidental, i.e. linked withroute. theOnly stepwisethe gender method is not significantselects the in to the fact that at the time of the survey, unlike the SWR, the PWR had a scarcely According to table 2, this regression functioning internet site and the organi- (Model15 variables 6) shows that area level fully of significant. adaptation only zation of the trips in collaboration with slightly lower than that of the previous other tourism stakeholders was still at an embryonic stage. Therefore, it capacity. In addition, the values of the was decided to re-estimate the models model and it has an equal classification omitting these two variables in model 5 those in Model 5. (table 3, page 165), which the following coefficients are not very different from analysis refers to. In this model, it is Main discriminating variables immediately obvious that some character- Age and nationality discriminate more istics have little implication in explaining than the level of education. Infact, a young the probability of belonging to the route. person is the 50% less expected to drive These are 10 variables out of 25: three the PWR than a wine tourist of interme- of them are socio-demographic, three diate age (from 30 to 60 years), while of them are linked to the trip and four the 29% of people over 60 years of age variables are connected to the choices. decided to do so. Likewise, the probability However, this does not imply that these for a foreigner is the 28% higher than for an Italian tourist for the same route. As the level of education rises there is Theyvariables are haveassociated no influence to a consistent in defining level the an increasing odds ratio, even if only the ofprofile collinearity of the winewith the tourist other on independent each route. variables and, in such a way, they provide redundant information for determining the coefficient related to the graduate wine propensity to the trip along one or another tourist is significant.

164 Revista de la Facultad de Ciencias Agrarias A comparison between tourists' profiles in two Italian wine routes Table 3. Logistic regression. Independent variables used in Model 5. Tabla 3. Regresión logística. Variables independientes usadas en el Modelo 5.

Marginal Variable B St. Err. Wald Sign. Exp(B) effect

Age: under 30 years -2.308 0.36 41.166 0.000 0.099 -0.5009

Age: over 60 years 1.289 0.348 13.72 0.000 3.629 0.2871

Female -0.185 0.271 0.464 0.496 0.831

Nationality: foreign 1.236 0.322 14.699 0.000 3.442 0.2835

Education: primary school -1.664 0.946 3.092 0.079 0.189 -0.3698

Education: secondary school -0.215 0.51 0.177 0.674 0.807

Education: university 0.666 0.291 5.235 0.022 1.946 0.1622

Motivation: visiting friends or 1.105 0.354 9.750 0.002 3.020 0.2717 acquaintances

Motivation: cultural trip 1.284 0.339 14.317 0.000 3.609 0.2999

Day trip 0.294 0.378 0.604 0.437 1.342

Trip in more than 3 days 1.020 0.36 8.044 0.005 2.773 0.2127

Trip with friends or 0.899 0.309 8.460 0.004 2.457 0.2204 acquaintances The knowledge of the route: 0.678 0.352 3.712 0.054 1.970 0.1532 from friends or acquaintances The knowledge of the route: 0.049 0.468 0.011 0.917 1.050 from traditional advertising The knowledge of the route: -0.839 0.358 5.509 0.019 0.432 -0.2249 travel agents or tourist boards

2.023 0.29 48.664 0.000 7.560 0.4653 routes The first experience of wine Overnight staying in agritourist 1.209 0.47 6.628 0.010 3.350 0.2475

Overnight staying with relatives 1.200 0.458 6.857 0.009 3.319 0.2407 or friends

Other kinds of overnight staying 0.386 0.423 0.832 0.362 1.471

The purchase of local wines: No -1.191 0.353 11.357 0.001 0.304 -0.2800

The purchase of local wines: 0.745 0.435 2.935 0.087 2.107 0.1604 Perhaps The intention to repeat the -1.477 0.863 2.933 0.087 0.228 -0.3510 route: No The intention to repeat the 0.720 0.348 4.295 0.038 2.055 0.1813 route: Perhaps Willingness to pay for a full meal -2.126 0.458 21.563 0.000 0.119 -0.4405 < 20 € Willingness to pay for a full meal -0.372 0.308 1.462 0.227 0.689 > 30 €

Constant -2.235 0.534 17.518 0.000 0.107

Tomo 50 • N° 1 • 2018 165 L. Galletto

less for people who follow the former route is the variable that most differen- route in comparison with someone willing Being the first experience of a wine to pay an intermediate sum. Moreover, a two routes. The "beginner wine tourists" tourist, who does not intend to purchase marginaltiate the effect profiles shows of the that tourists they are on 47% the wine in comparison with one who is more expected to prefer the PWR in instead certain of doing so, is 28% less comparison with expert wine tourists. probable in this route. Finally, people, who A person with cultural objectives is have frequented the PWR, show a greater more disposed to follow the PWR rather hesitancy about repeating the itinerary in than the SWR. Moreover, the wine tourist, the future. who travels for visiting friends or relatives, usually prefers the PWR in comparison with someone who travels mainly for a Discussion holiday, and it corresponds well to the choice of this route performed by those Previous results shows that it is who travel with friends or acquaintances. neither possible to identify a wine tourist A person, who has obtained information by friends or acquaintances or who stays over night with friends or relatives, Chartersstereotype and nor Ali-Knight give a unilateral (2002) stated,definition i.e. presents a higher propensity for the PWR. of his behavior. They confirm what Therefore, it could really be known as the a single homogeneous group and it is more "wine road of friendship or company", as realisticit is difficult to todescribe define winethe differenttourists withintraits human relations play an important role. in relation to the investigated areas. In Those who follow the SWR more often addition to the above-mentioned studies obtain information from travel agents and on the wine tourist’s demand, they have tourist boards in comparison with the demonstrated the key role of wine roads wine tourists on the PWR, and there is a greater participation in organized trips. In fact, each of the two routes is distin- Indeed, a tourist who obtained infor- in defining the wine tourist local market. mation from these sources has a 22.5% lower probability in favor of the PWR byguished a set byof avariables specific winecommonly tourist used profile in than a person who used other methods. A segmentationthat is highly processes. differentiated Some and comments defined long trip is the 21% more probable along seem useful for a better understanding the PWR than a trip of average duration. of the reasons underlying the main Similarly, a greater propensity for this route is shown by those who spend the The particularly higher age of the wine night either staying with friends or in an touristdifferences on the between PWR canthe twobe related profiles. to the agritourist (odds ratio higher than three presence of many elderly residents in the for both variables). area of the route who return periodically to If a propensity for cheap accommo- stock up with their preferred wines (14). dation distinguishes the wine tourist of The higher number of foreign wine the PWR, travelers of the SWR want a less tourists on the PWR may be due both to expensive meal and they are less incline to the vicinity of this itinerary to the cities buy wine. Indeed, the probability to pay of Venice and Treviso and the capacity of no more than 20 euro for a meal is 44% the stakeholders to arouse the interest

166 Revista de la Facultad de Ciencias Agrarias A comparison between tourists' profiles in two Italian wine routes of the many foreigners who are in the The PWR tourists can choice cheaper Adriatic beach resorts, while the nearest accommodations than the usual hotels and competitor is the short Lison Pramaggiore guest houses for their overnight stayings. Wine Road. This choice happens much less A high frequency of young and on the SWR, because the foreign tourists limited income travelers on the SWR may are on holiday near Lake Garda or they contribute to the willingness of to pay less want to visit Verona and therefore they for a meal for those touring this road. That have many opportunities of wine tourism is why these tourists purchase less local itineraries (e.g. Valpolicella, Custoza and wine along the itinerary; therefore, there Bardolino Wine Roads). Graduate people is a larger proportion of "pure tasters" in prefer the PWR because few young people comparison with those on the PWR. have reached that level of education and a The doubt on repeating the experience cultural motivation. is higher among those who travelled the In order to understand the high PWR because the involved area is very large, the production of wine is rather favor of the PWR, it should be considered various and there are several historical sites thatmarginal the visit effect to of the the wineries first experience may be ina and monuments. Tourists need to consider stopgap, i.e. a spontaneous resolution all these elements when they decide to plan when weather is bad for many beach another trip in the same area. vacationers or an unplanned digression Even though there is a marked for a large section of tourists who did not differentiation between the wine tourists know the wine tourism before. Because of on the two examined wine routes, its the great resources of wine routes in the generalization is not possible on other province of Verona, a lot of people who wine tourism contexts because it must just experienced wine routes spend time at the SWR and therefore they are more Some peculiarities of this research appear acquainted with wine tourism excursions. be confirmed by further investigations.- About trip motivations, the possibility cantly widened the gap between the of combining the itinerary with a visit to to be relevant and they may have signifi Venice also undoubtedly increases the such as: a) even if both routes can be cultural reasons for the PWR tourists. reachedwine tourists' by car profiles in an hour, on the they two are routes not Moreover, the high rate of visitors of the adjacent; b) the SWR is mainly located in SWR, who knew the route by travel agents a hilly area, while the PWR is an itinerary and tourist boards, clearly depends on entirely on the plain; c) the surrounding the SWR Association's strategy of closely areas have characteristics that can involving these entities. The length of the itinerary, the greater tourist who approaches these routes; foreign participation, more varied motiva- strongly influence the profile of the wine tions encourage longer trips for the PWR organizational level of the two routes, wine tourists, compared to the SWR ones, especiallyd) there is in a termssignificant of creativity gap between of the twothe because it has a much shorter itinerary Associations. Indeed, if these peculiarities with wineries very close each other, and if diminish or disappear, the differences a tourist is in a hurry he can taste wine or organize other activities. routes might become less marked even if nobetween less interesting. the wine tourist profiles of two

Tomo 50 • N° 1 • 2018 167 L. Galletto

Conclusions

The logistic models adequately part of an overall strategy of territorial marketing that the wine routes must put into practice to compete in an increasingly twoconfirm wine the routes hypothesis located in on the the same existence region. globalized arena. Mostof different of the wine employed tourist variables profiles betweenact as a If this competition concerns even distinction between the wine tourists of distant wine tourist destinations, it is the two routes even if variable sub-groups mostly true for wine routes in competition in the same geographical area, sampled cases. Especially features related both in providing services that satisfy determine a good classification of the the demands of their main tourists, and identifying new factors to attract tourists playsto trips the differentiate main role theand twohis profiles.motivation In with different characteristics. It is a case isfact, the the second first experience important as consideration.a wine tourist of modelling the supply on the basis of Among the socio-demographic variables, the real requirements of the tourists, the most relevant ones are age, foreign promoting every resource of the local participation and education. The choice variables have a less use of the public funding that is often availableterritorial for system wine andtourism making activities. an efficient to pay for food and buying wine at the For example, it emerged from the defining influence, although willingness analysis that either SWR stakeholders The obtained results interest the could try to attract more wine tourists stakeholderswineries are quitebelonging significant. to the wine through the organization of events and a routes. For this purpose, if wine producers better promotion of the territorial cultural need to differentiate themselves from aspects or they could study initiatives as a the competitors on the other routes by passport for the road in order to encourage emphasizing the characteristics that people to come back. Instead, the PWR make them exclusive (e.g. the grape type, stakeholders could attract younger the soils and climate that contribute to tourists improving their marketing by differentiate wine qualities, the cultural internet, travel agents and tourist boards, tradition, etc.), they must also concen- in such a way they can reduce the portion trate their competitive offers towards of people who have not yet decided their one or more segments of wine tourists. coming back. In fact, positioning and targeting are both

References

1. Alant, K.; Bruwer, J. 2004. Wine tourism behavior in the context of a motivational framework for wine regions and cellar doors. Journal of Wine Research. 15(1): 27-38. 2. Alebaki, M.; Iakovidou, O. 2010. Segmenting the Greek wine tourism market using a motivational approach. New Medit. 9(4): 31-40. 3. Alebaki, M.; Iakovidou, O. 2011. Market Segmentation in Wine Tourism: A Comparison of Approaches. Tourismos. An International Multidisciplinary Journal of Tourism. 6(1): 123-140.

168 Revista de la Facultad de Ciencias Agrarias A comparison between tourists' profiles in two Italian wine routes 4. Alonso, A. D. 2008. An investigation of wine involvement among travelers in New Zealand. e-Review of Tourism Research. 6(1): 1-9. 5. Barth, S.; Salazar, J. 2011. Wine tourism and consumer behaviors related to wine purchases. Journal of Tourism Insights. 1(1): 1-6. 6. Boatto, V.; Barisan, L.; Montedoro, M. 2006. Domanda enoturistica: l’esempio del Trevigiano. VQ. 1(6): 16-20. 7. Brown, G.; Getz, D. 2005. Linking wine preferences to the choice of wine tourism destinations. Journal of Travel Research. 43(3): 266-276. 8. Brunori, G.; Rossi, A. 2000. Synergy and coherence through collective action: some insights from wine routes in Tuscany. Sociologia Ruralis. 40(4): 409-423. 9. Bruwer, J. 2002. South African wine routes: some perspectives on the wine tourism industry's structural dimensions and wine tourism product. Tourism Management. 24(4): 423-435.

on behavioral segmentation. In Proceedings of the 2002 Northwestern Recreation 10. Chang, T.Research C.; Kim, Symposium.M. K.; Kim, S. Bolton H. 2002. Landing, Profile New of winery York. 133-139.visitors of Michigan wineries based 11. Charters, S.; Ali-Knight, J. 2002. Who is the wine tourist? Tourism Management. 23(3): 311-319. 12. Dodd, T.; Bigotte, V. 1997. Perceptual differences among visitor groups to wineries. Journal of Travel research. 35(3): 46-51. 13. Evans, M. R.; Carol, P.; Grant, H. 2008. Discover North Carolina wines: A wine tourism visitor

profileAgricole study. et Viticole. John A. 127(19): Walker College 408-413. of Business, Appalachian State University. 14.15. Galloway,Galletto, G.; G.; Galletto, Mitchell, L. R.; 2010. Getz, AD.; profile Crouch, of G.;the Ong, wine B. tourist2008. Sensation of the Vini seeking del Piave and Route. the prediction Progrès of attitudes and behaviours of wine tourists. Tourism Management. 29(5): 950-966.

16. Gatti S.;Society Maroni, (vdqs) F. 2004. Colloque, A profile Oenometrics of wine XI, tourists Dijon, inFrance. some Italian region vineyards: an 17. Geide, C.;application Harmon, ofL.; theBaker, multiple R. 2008. correspondence Northern Virginia analysis. Wineries: Vineyard understanding Data Quantification visitor motivations for market segmentation. In Proceedings of the 2008 Northwestern Recreation Research Symposium. Bolton Landing, New York. 350-356. 18. Gennari, A. J.; Winter, P.; Martin, D.; Eiseclhlas, P.; Ciardullo, V.; Smud, H. 2011. Analisi dell’enoturismo in Argentina, 149-210. In Boatto, V.; Gennari, A. (eds). La roadmap del turismo enologico. Franco Angeli, Milano, Italy. 19. Getz, D.; Brown, G. 2006. Critical success factors for wine tourism regions: a demand analysis. Tourism Management. 27(1): 146-158. 20. Hashimoto, A.; Telfer, D. J. 2003. Positioning an emerging wine route in the Niagara Region: Understanding the wine tourism market and its implications for marketing. Journal of Travel and Tourism Marketing. 14(3-4): 61-76. 21. Hojman, D. E.; Hunter-Jones, P. 2012. Wine tourism: Chilean wine regions and routes. Journal of Business Research. 65(1): 13-21. 22. Lankford, S.; Oksana Grybovych, O.; Lankford, J. K. 2006. Development of a Regional Wine Culture in Iowa. Final Report Prepared for the Leopold Center for Sustainable Agriculture. University of Northern Iowa STEP. 1-35. 23. Lopez-Guzman, T. J.; Millán, G.; Caridad y Ocerin, J. M. 2008. Análisis econométrico del enoturismo en España: un estudio de caso. Estudios y Perspectivas en Turismo. 17(2): 98-114. 24. Magalhães Serra, E.; Carvalho Vieira, M.; Spawton, T. 2010. Determinants of Portuguese wine & enotourism consumer behavior. COGITUR: Journal of Tourism Studies. 10(3): 9-20.

An initial approach. International Journal of Wine Business Research. 22(4): 349-361. 25.26. Marzo-Navarro,Mauracher, C.; M.;Procidano, Pedraja-Iglesias, I.; Sacchi, M. G.2010. 2014. Are Customerthere different satisfaction profiles per of winel’innovazione tourists? dell’enoturismo in Veneto. Effetti delle nuove forme di integrazione turistica. Economia Agro-Alimentare. 16(1): 157-178.

Tomo 50 • N° 1 • 2018 169 L. Galletto

27. Millàn, G.; Meliàn Navarro, A. 2010. Turismo enológico y desarrollo rural: una applicacion empirica. Revista Lider. 17: 159-175. 28. Mitchell, R.; Hall, C. M. 2001. Life style behaviours of New Zealand winery visitors: wine club activities, wine cellars and place of purchase. International Journal of Wine Marketing. 13(3): 82-93. 29. O' Mahony, B.; Hall, J.; Lockshin, L.; Jago, L.; Brown, G. 2008. Wine tourism and subsequent wine purchase behaviour. CRC for Sustainable Tourism. Gold Coast, Australia. 30. Quadri-Felitti, D.; Fiore, A. 2012. Experience economy constructs as a framework for understanding wine tourism. Journal of Vacation Marketing. 18(1): 3-15.

ways of touring. Tourism. 52(4): 463-475. 31.32. Romano,Sparks, B. M. 2007. F.; Natilli. Planning M. 2009. a wine Wine tourism tourism vacation? in Italy: NewFactors profiles, that helpstyles to of predict consumption, tourist behavioral intentions. Tourist Management. 28(5): 1180-1192. 33. Varchiano Pol, M.; Ramon Cardona, J. 2013. Turismo y vino en la literatura academica: Breve REDMARKA UIMA. 2(6): 55-82. 34. Woods, T. A.; Nogueira, L.; Yang, S. 2013. Linking wine consumers to the consumptions of local revisionwines and bibliográfica. winery visit in the northern Appalachian States. International Food and Agribusiness Review. 16(4): 181-205.

a successful list. Journal of Nutrition in Recipe & Menu Development. 3(3-4): 63-79. 35. Yuan, J. J.; So, S.; Chakravarty, S. 2005. To wine or not to wine: profiling a wine enthusiast for

170 Revista de la Facultad de Ciencias Agrarias Rev. FCA UNCUYO. 2018. 50(1): 171-184. ISSN impreso 0370-4661. ISSN (en línea) 1853-8665.

Conocimiento científico y políticas de conservación en las razas autóctonas españolas Conocimiento científico y políticas de conservación: interrelaciones en las razas ganaderas autóctonas españolas en peligro de extinción

Scientific knowledge and conservation policies: interrelationships in the Spanish livestock autochthonous endangered breeds

José Perea 1, Cecilio Barba 1, Manuel Luque 2, Ana González 1, Elena Angón 1, Antón García 1

Originales: Recepción: 04/12/2016 - Aceptación: 14/02/2017

Resumen y los principales factores que determinan el grado de amenaza de las razas autóc- El objetivo del estudio fue analizar las relaciones entre el conocimiento científico de razas españolas en peligro de extinción durante el período 2009-2013, y la tonas españolas en peligro de extinción. Se utilizaron los datos oficiales del conjunto producción científica y divulgativa de cada raza, recopilada a partir de Web of Science resultadosy Google para han elmostrado período que 1950-2012. el riesgo Lasde extinción razas fueron es elevado clasificadas en más según de la sumitad riesgo de lasde extinciónrazas, moderado con base en enel 12,4% criterios y crítico demográficos en el 36,1%. durante Los el mayores período niveles 2009-2013. de riesgo Los correspondieron a razas concentradas en pequeñas áreas, con poblaciones y rebaños extinción,de menor tamaño,mientras y que reconocimiento los aspectos oficialproductivos más reciente. y productos La producción han sido más científica estudiados en el enárea las de razas genética con menorha sido riesgo significativamente de extinción. superior La divulgación en las razasde aspectos con mayor zootécnicos riesgo de y en las situaciones de menor riesgo de extinción. Por todo ello, se recomienda que las políticassistemas de de conservación producción, produccionesconcentren sus y productosapoyos en una ha sido fase significativamenteinicial relativa al estudio mayor y caracterización racial basada en aspectos genéticos y una segunda fase centrada en el incremento del conocimiento y divulgación de las características productivas y de los sistemas de producción.

Palabras clave

análisis bibliométrico • razas locales • recursos zoogenéticos

1 Departamento de Producción Animal, Universidad de Córdoba. Campus Rabanales. Código Postal 14071. Córdoba. España. [email protected] 2 Federación Española de Asociaciones de Ganado Selecto. C/ Castelló, 45-2° Izda. Código Posta 28001. Madrid, España. [email protected]

Tomo 50 • N° 1 • 2018 171 J. Perea et al.

Abstract

The aim of this study was to analyse the progress and current status of endangered autochthonous Spanish breeds exploring relationships between the main factors that determine the degree of endangered and the scientific and technical production related to the breed. The status of each breed was determined from official data published by Ministry of Agriculture during 2009-2013. The scientific and disclosure production andrelated the to annual each breed growth was rate collected of the frompopulation Web of duringScience 2009-2013. and Google forResults 1950-2012. showed Each the breed was classified according to its risk of extinction, based on demographic criteria risk of extinction was high in approximately the half of breeds, intermediate in 12.4% and very high in 36.1%. The highest levels of extinction risk corresponded to breed with recent official recognition and spread in small areas, with reduced population and herds of small size. Scientific literature on genetics has been significantly higher in breeds at greatest risk of extinction, while productive issues and products have been significantly studied most intensively in breeds with less risk of extinction. The disclosure literature on zootechnical issues and production systems has been significantly higher in breeds andat lower production risk of extinction.systems. Therefore, it is recommended conservation policies focus, in a first stage, on genetic aspects and breed features, and secondly on productive issues Keywords

bibliometric analysis • local breeds • animal genetic resources Introducción

Las razas ganaderas locales han y de los sistemas tradicionales ligados a la tierra por modelos intensivos industriales una progresiva disminución del censo, altamente especializados y que utilizan un loexperimentado que ha provocado en las un últimasrápido descenso décadas de variabilidad genética, extinciones y la La erosión genética limita la adaptación expansión de otros genotipos (29). dereducido la sociedad número al defuturo, genotipos. especialmente a De acuerdo con FAO (12), el 22% de las nuevas demandas comerciales y a cambios razas ganaderas a nivel mundial corren irreversibles en los entornos productivos, como el cambio climático (22). Otras justi- más grave en la UE. peligroLa pérdida de extinción de diversidad y la situación racial es yaún el de conservación son el valor ecológico de riesgo de extinción se explican por tres lasficaciones razas localespara el desarrolloen los agroecosistemas de programas factores clave: la industrialización del singulares, su valor socioeconómico para sector agroalimentario, el desarrollo las comunidades rurales y la protección tecnológico y los cruzamientos indiscrimi- del patrimonio histórico y cultura rural nados, especialmente en los países en vías (13, 18, 29). de desarrollo (13). Todo ello ha contri- buido a la sustitución de las razas locales

172 Revista de la Facultad de Ciencias Agrarias Conocimiento científico y políticas de conservación en las razas autóctonas españolas Hoy en día existe consenso en que el objetivo de cualquier programa de conser- disponibles. La estructura adminis- vación debe ser minimizar la pérdida de trativaoficiales de deEspaña 2009 se basa en adelanteen 17 regiones están razas; por tanto, las decisiones deben o comunidades autónomas con compe- tener en cuenta el grado de amenaza, cuya estimación requiere de datos sistemáticos ganadería, mientras que el gobierno de la sobre aspectos como la situación nacióntencias se específicascentra básicamente en agricultura en labores de y coordinación. En ese sentido, la Comisión la pérdida de variabilidad genética (2, 23). nacional de coordinación de conservación, demográfica,La mayoría la tendenciade países de dela población Occidente o mejora y fomento de razas ganaderas es un órgano interadministrativo de coordi- recopilan periódicamente información nación entre los gobiernos central y regio- relevantedisponen para de programasdeterminar oficialesel grado quede nales, siendo cada comunidad autónoma amenaza. Sin embargo, poca atención se ha la autoridad competente en la gestión prestado a evaluar el nivel de éxito de los de las razas ganaderas y las políticas que le afectan. Esto conlleva la ausencia de los factores que lo determinan. Entre estos indicadores homogéneos respecto de las factoresprogramas se deencuentran conservación el conocimiento e identificar esto hace de la realidad española un marco los aspectos de interés vinculados con la depolíticas trabajo públicas muy relevante en este paraámbito las (8). políticas Todo razacientífico (23). y la posterior divulgación de de conservación. Por tanto, se plantea En la actualidad existen numerosas como objetivo analizar la evolución bases de datos que recopilan sistemática- zootécnica y del conocimiento en las mente información bibliométrica de todos razas autóctonas españolas en peligro de los campos académicos, lo que permite extinción, explorando las relaciones entre el desarrollo de estudios orientados al los principales factores que determinan el grado de amenaza y la documentación bibliométrico se puede caracterizar la output científico. A través del análisis factor racial. (individuo, grupo de investigación, etc.) a científica y divulgativa relacionada con el producción científica desde un nivel micro Materiales y métodos asociaciones;un nivel macro (país,todo áreaello geográfica, orientado etc.), a conseguiridentificar puntosuna mejor críticos asignación y establecer de La población objeto de estudio abarca recursos y priorizar proyectos o líneas un total de 128 razas (bovinas: 31; ovinas: de investigación (15, 19). A pesar de la 33; caprinas: 15; porcinas: 9; equinas: 20; asnales: 6; aviares: 19 -17 gallinas y 2 ocas-, y 1 camélido), lo que corresponde al laimportancia conservación del deanálisis recursos bibliométrico zoogenéticos. aún conjunto de razas incluidas en la categoría no seEspaña ha desarrollado cuenta con 137 suficientemente razas ganaderas en de razas autóctonas españolas en peligro autóctonas, de las cuales el 78% se de extinción, contenidas en el Catálogo encuentra en peligro de extinción (3). Desde los años 90 se llevan Las variables zootécnicas y administrativasoficial de razas de ganadoutilizadas de España fueron: (8). de conservación, aunque solo los datos desarrollando actuaciones con fines número de ganaderías inscritas en el libro

Tomo 50 • N° 1 • 2018 173 J. Perea et al.

- ductores de raza pura inscritos en el libro o multirracial perteneciente a alguna de las genealógico (NR), número total de repro germoplasma, ya sea este de tipo específico reproductores de raza pura inscritos en España o bien se trate un banco de germo- genealógico (NP), número de machos plasmaAdministraciones privado bajo Públicas la gestión existentes Asociación en hembras reproductoras de raza pura de Criadores de la raza. La variable DG se inscritasel libro genealógicoen el libro (NM),genealógico número (NH), de

codificó en 3 niveles, según la distribución delvariación libro genealógico anual del número (NRD), detamaño hembras medio de geográfica del 75% de la población en un raza pura inscritas en el registro definitivo DCradio indica de menossi la raza de 12,5está km,integrada entre o 12,5 no del libro genealógico de la raza (AOL), y 50 km o en más de 50 km. La variable añodel rebaño de inclusión (TR), año de dela laraza aprobación en el catálogo oficial en figuras de calidad diferenciada como a denominación de calidad (DC), distri- DenominaciónComo indicador de Origen, de heterocigosidad Identificación oficial (AOC), producción de la raza acogida- esperadaGeográfica en Protegida una población u otras (17).se utilizó el índice de Panmixia (IPX), que estima la delbución programa geográfica de mejora (DG), (AOM). banco de germo diversidad genética teórica existente en plasmaLa información (BG) y año de de la estas aprobación variables oficial se una población sobre la base de su tamaño relevó del Sistema Nacional de Infor- efectivo (25). mación de Razas Ganaderas (ARCA), El Índice de Panmixia (P) se calculó como: de Agricultura, Alimentación y Medio P=1–(1/(2Ne)) Ambiente,como base quede datos se nutre pública de la del información Ministerio aportada por las asociaciones de criadores donde: Ne = el tamaño efectivo de la población, validada por las Comunidades Autónomas a partir de: yde el razapropio pura Ministerio oficialmente (3). reconocidas y Ne=4MH/(M+H) El marco normativo español (8) establece que la gestión del libro donde: genealógico de cualquier raza está condi- M - tores de raza pura asociación de criadores; por tanto, la H = el número de machos reproduc- referenciacionada al reconocimientoal libro genealógico oficial implica de una toras de raza pura necesariamente la existencia de una = el número de hembras reproduc reconocida por la autoridad competente. Laasociación información de de criadores las variables oficialmente DC, AOC, ThomsonLa producción Reuters científica(ISI), para de el cada período raza AOL y AOM se complementó con la recopi- 1950-2012fue recopilada (15). a partir de Web of Science,

con los nombres de cada raza y con las criterioslación de otrosFAO datosen "completo", oficiales (5, 6,"medio" 7, 17). palabrasSe realizaron clave: Spain, búsquedas local breed, temáticas native y "carente"La variable (11), BG y se está codificó referida según a losla breed, autochthonous breed, Spanish breed, existencia/ausencia de material genético endangered breed, España, razas locales, de una determinada raza en un banco de razas autóctonas, razas en peligro de

174 Revista de la Facultad de Ciencias Agrarias Conocimiento científico y políticas de conservación en las razas autóctonas españolas extinción, razas españolas. Solo los artículos que tiene en cuenta el promedio anual de y las revisiones fueron considerados. hembras de raza pura inscritas en el libro Los documentos divulgativos de cada genealógico que pasan a reproductoras. raza fueron recopilados a partir de Google, muestra en la tabla 1. cada raza, y solicitándolos directamente La puntuación codificación global de las de variables cada raza se arealizando las Asociaciones búsquedas de concriadores el nombre de raza de puede oscilar entre un mínimo de 0 y un pura a través de la Federación Española máximo de 9. Las razas con una puntuación de Criadores de Ganado Selecto (FEAGAS). Tanto los documentos indexados (IT) "en riesgo crítico", las razas con una como los documentos divulgativos (DT) global mayor a 5 fueron clasificadas como como "en riesgo elevado", y las razas con puntuación entre 1 y 5 fueron clasificadas- genéticafueron (IGE, posteriormente DGE), aspectos clasificados zootéc- cadas como "en riesgo moderado". nicossegún y sistemas su área de deproducción conocimiento (IZP, DZP), en unaLa puntuación evolución globalde la depoblación 0 fueron de clasifi cada producción y productos (IPP, DPP), y raza fue analizada mediante la tasa de aspectos reproductivos (IRP, DRP). Cada crecimiento anual (TCA), estimada a partir documento puede corresponder a diferentes áreas de conocimiento. pura durante el período 2009-2013. del Senúmero utilizó total 2009 de reproductorescomo primer deaño raza de riesgo de extinción con base en los criterios estudio debido a que no existen datos Las razas fueron clasificadas según su demográficos utilizados por FAO (10) y a la oficiales públicos con anterioridad. codificación propuesta por Alderson (2003), Tabla 1. Table 1. Codificación de las variables utilizadas para estimar el riesgo de extinción. CodificationVariable of variables used to estimateCodificación the risk of extinction. NH en 2013 >1000=0; 1000-100=1; <100=2 NM en 2013 >20=0; 20-5=1; <5=2 NP en 2013 >1000=0; 1000-100=1; <100=2 Bovino: >700=0; 700-225=1; 225-75=2; <75=3 Équidos: >450=0; 450-150=1; 150-45=2; 45=3 Promedio anual de NRD en Ovino y caprino: >900=0; 900-300=1; 300-90=2; <90=3 2011-2013 Porcino: >1000=0; 1000-345=1; 345-105=2; <105=3 Aves: >2000=0; 2000-600=1; 600-200=2; <200=3

NH: número de hembras reproductoras de raza pura inscritas en el libro genealógico; NM: número de machos reproductores de raza pura inscritos en el libro genealógico; NP: número total de reproductores de raza pura inscritos en el libro genealógico; NRD: variación anual del número de hembras de raza pura inscritas en el registro definitivo del libro genealógico. NH: number of purebred females registered in the herd book; NM: number of purebred males registered in the herd book; NP: total number of purebred animals registered in the herd book; NRD: annual variation of the number of purebred females registered in the definitive register of herd book.

Tomo 50 • N° 1 • 2018 175 J. Perea et al.

La tasa de crecimiento anual (r) se hembras y 181 a machos, y se distribuyeron estimó como: en 128 rebaños de media, lo que supone un tamaño promedio de 30 reproductores

r = anti-log((log N2–log N1)/t) por rebaño.

donde: rebaños decrece su tamaño medio A medida que crece el número de N1 y N2 (r=-0,52) y la población tiende a un mayor de cada raza t = el intervalo s = el primer temporal y el en último años. censo másnúmero antiguo de machos tendieron (r=0,35). a presentar mayores A partir de la tasa de crecimiento poblacionesLas razas con(r=0,30). reconocimiento Asimismo, oficial los anual se establecen tres categorías: rebaños de mayor tamaño corresponden a "tendencia decreciente", si r<0,99; poblaciones mayores (r=0,70). "tendencia estable", si 0,991,01 (13). a 99,55% y la tendencia de la población De las 128 razas que conforman la durante el período 2009-2013 fue población objeto de estudio, solo se creciente. Predominó la ausencia de pudieron obtener datos completos de 97 (77,3%). Las restantes 31 razas presen- de calidad diferenciada (66%) y la ausencia taron datos faltantes en algunas variables, desistemas banco de comerciales germoplasma basados (55,7%). en figuras por lo que no formaron parte del estudio. El 55,4% de las razas presentó una Los datos obtenidos fueron analizados mediante el programa estadístico de la población en un radio superior a los SPSS versión 14 (24). Como variables dispersión geográfica con más del 75% dependientes se utilizaron el riesgo de relación positiva con el tamaño del rebaño extinción y la tasa de crecimiento anual. Dado 50 km. El índice de Panmixia mostró una que algunas variables no mostraron buen Un total de 1436 publicaciones cientí- ajuste a la distribución normal, se utilizaron (r=0,41) y el número de rebaños (r=0,34). técnicas estadísticas no paramétricas. La asociación entre variables publicacionesficas fueron encontradas fue la caprina para Payoya el período con métricas se estudió mediante correla- 54estudiado. manuscritos La raza y la con de menormayor producciónnúmero de ciones de Spearman. Se utilizaron los test La mayor parte de la producción variables cuantitativas, y tablas de contin- científica la ovina Chamarita con 0. Kruskal-Wallis y W de Mann-Whitney2 en las variables en las (61,0%), seguida de los aspectos zootéc- cualitativas para comparar grupos de nicoscientífica y sistemas correspondió de producción al área de (16,9%),genética riesgogencia y y de la tendencia prueba de de Χ población. producción y productos (13,6%) y aspectos reproductivos (7,6%). Las razas

Resultados tendieron a una mayor producción con reconocimiento oficial más antiguo Las razas autóctonas españolas en El área de genética tiende a ganar peligro de extinción tuvieron una población importanciacientífica (r=0,22). en las poblaciones más media de 3850 reproductores en el año pequeñas (r=-0,21) y con rebaños de 2013, de los que 3669 correspondieron a menor tamaño (r=-0,29).

176 Revista de la Facultad de Ciencias Agrarias Conocimiento científico y políticas de conservación en las razas autóctonas españolas Los documentos divulgativos encon- y elevado, que mostraron valores trados fueron 780, lo que supone un ratio homogéneos y superiores (p=0,004). Sin investigación/divulgación de 1,84. La embargo, la tasa de crecimiento anual ha divulgación se ha concentrado en el área de sido la misma en los tres grupos de riesgo. genética (55,6%), seguida de las producciones y productos (18,1%), aspectos áreas de genética y producciones y zootécnicos y sistemas de producción Las publicaciones científicas en las- (16,7%) y aspectos reproductivos (9,7%). mientrasproductos que se las diferenciaron demás variables significativa relativas mostraron también mayor divulgación mente según grupos de riesgo (p<0,05), (r=0,53).Las razas Las con poblaciones mayor producción de mayor cientifica tamaño comportamiento homogéneo. han tendido a una mayor divulgación de al conocimientoLas razas en situación científico crítica mostraron han sido un sus producciones y productos (r=0,29). - En la tabla 2 (pág. 178-179), se ciones sobre genética que las razas en muestra la composición de los grupos otrasobjeto situaciones. de un mayor Sin númeroembargo, de en publica el área de producciones y productos son las razas 12,4% de las razas, mayoritariamente en situación de riesgo moderado las que raciales según su riesgo de extinción. El mayor atención han recibido, obteniendo de riesgo moderado. El grupo mayori- - tarioovinas, fue fueron el de riesgo clasificadas elevado, en agrupando situación vamente menor. al 51,5% de las razas. En situación crítica los Respectodemás grupos de launa divulgación, atención significati ha sido

La asociación entre la especie y el nivel de de producción y sistemas y producciones y fueron clasificadas el 36,1% de las razas. - productossignificativamente (p<0,05). diferenteEn ambas áreas en las la divul áreas- nando el ovino y el caprino en los menores nivelesriesgo fue de riesgosignificativa y las razas (p=0,002), bovinas, predomi asnales las situaciones de riesgo moderado que en y aviares en los mayores niveles. lasgación razas ha en sido situación significativamente crítica. mayor en Las razas en situación crítica han En la tabla 3 (pág. 180-181), se muestra comenzado a gestionar su libro genealógico más tarde que las razas en situaciones de la tendencia de la población. la composiciónEl 28,9% de de las los razasgrupos mostraron raciales según una rebaños ha sido similar entre grupos de tasa de crecimiento anual decreciente, riesgo,menor no riesgo así su (p=0,044). tamaño Elmedio, número que dese el 10,3% estable y el 60,8% mostró una incrementa a medida que el nivel de riesgo tendencia creciente. disminuye (p<0,000). A niveles de riesgo La tendencia de la población se asoció inferiores le corresponden poblaciones reproductoras de mayor tamaño (p<0,000). genealógico (p=0,007) y a la distribución El índice de Panmixia fue significativamente a la antigüedad del libro Las razas que tienden a decrecer comenzarongeográfica de lala población gestión (p=0,018). del libro frentesignificativamente a las razas menoren riesgo en moderado las razas genealógico más tarde y se concentran en clasificadas como en situación crítica pequeñas áreas.

Tomo 50 • N° 1 • 2018 177 J. Perea et al.

Discusión

El objetivo principal de los programas agregación, por lo que no arrojan resul- de conservación es minimizar la pérdida tados uniformes y muchas veces crean de razas por lo que sus decisiones críticas deben basarse en el grado de amenaza (9). En consecuencia, las decisiones de los Aunque a nivel práctico es necesaria una programasconfusión yde dificultad conservación interpretativa. deberían estar visión más amplia, dado que todavía no hay sujetas a valoraciones conjuntas, en cierta - mente medible de los factores que afectan formales de riesgo se complementan con toda aluna riesgo definición de extinción clara, estandarizada (2). Esto explicay fácil lamedida información subjetivas, adicional donde relevante las clasificaciones disponible. que los procedimientos metodológicos El modo en que se ha estimado el adoptados por instituciones y organiza- riesgo de extinción en este trabajo podría ciones internacionales para estimar el constituir un indicador de amenaza robusto grado de amenaza empleen diferentes indicadores, principios y modos de de conservación en el contexto español. que puede ser útil para orientar las políticas

Tabla 2. típica en las variables métricas, porcentaje en las variables categóricas). Características según el grupo de riesgo de extinción (media + desviación Table 2. deviation for metric variables, percentage for categorical variables). Characteristics according to the extinction risk group (mean ± standard Variable Moderado Elevado Crítico Valor crítico Especie (%) 0,002 Bovina 16,7 23,1 42,9 Ovina 75,0 34,6 8,6 Caprina 8,3 13,5 5,7 Porcina 0,0 7,7 8,6 Equina 0,0 17,3 5,7 Asnal 0,0 0,0 11,4 Aves 0,0 3,8 17,1 DG (%) 0,442 0,00 8,0 2,9 58,3 46,0 37,1 75% < 12,5 km 41,7 46,0 60,0 75% 12,5 a 50 km DC (%) 0,231 75% > 50 km Si 25,0 42,0 25,7 No 75,0 58,0 74,3 BG (%) 0,998 Carente 58,3 56,0 54,7 Medio 33,3 34,0 34,3 Completo 8,3 10,0 11,0

DG: distribución geográfica; DC: producción acogida a denominación de calidad; BG: banco de germoplasma. DG: geographical distribution; DC: production under denomination of quality; BG: germplasm bank.

178 Revista de la Facultad de Ciencias Agrarias Conocimiento científico y políticas de conservación en las razas autóctonas españolas Tabla 2 (cont.). típica en las variables métricas, porcentaje en las variables categóricas). Características según el grupo de riesgo de extinción (media + desviación Table 2 (cont.).

Characteristics according to the extinction risk group (mean ± standardVariable deviationModerado for metric variables,Elevado percentageCrítico for categoricalValor crítico variables). AOC 23,5 + 9,3 20,8 + 10,7 17,3 + 10,7 0,155 AOL 13,5 + 7,0b 14,4 + 9,1b 9,8 + 7,3a 0,044 AOM 1,6 + 0,7 1,7 + 3,1 0,9 + 0,8 0,333 NR 65,5 + 116,3 183,2 + 451,1 71,1 + 111,8 0,252 TR 151,6 + 231,3c 25,7 + 123,5b 7,6 + 23,1a 0,000 NH 9644 + 9503c 4465 + 4861b 482 + 547a 0,000 NM 286 + 271b 243 + 209b 57 + 57a 0,000 NP 9931 + 9766c 4708 + 4994b 540 + 547a 0,000 NRD 1311 + 492c 202 + 236b 34 + 39a 0,000 IPX 99,92 + 0,09b 99,87 + 0,12b 98,95 + 2,16a 0,004 TCA 1,037 + 0,054 1,046 + 0,104 1,025 + 0,137 0,693 IGE 5,4 + 5,9a 5,8 + 4,4a 9,8 + 8,1b 0,045 IZP 4,5 + 7,7 1,9 + 2,4 1,2 + 1,7 0,361 IRP 0,2 + 0,6 1,1 + 4,1 1,0 + 1,8 0,151 IPP 5,2 + 7,6b 1,3 + 1,9a 0,9 + 1,4a 0,019 IT 15,2 + 18,7 10,1 + 8,4 13,0 + 11,6 0,652 DGE 4,0 + 2,4 3,4 + 3,0 4,6 + 5,6 0,613 DZP 3,0 + 4,0b 1,3 + 3,2ab 0,5 + 0,8a 0,034 DRP 0,4 + 0,9 0,7 + 2,9 0,8 + 3,9 0,819 DPP 3,2 + 4,6b 1,3 + 3,2a 0,6 + 1,3a 0,023 DT 10,7 + 9,0 6,8 + 10,3 6,6 + 7,1 0,121

Letras diferentes indican diferencias significativas (p < 0,05). AOC: año de inclusión en el catálogo oficial; AOL: año de la aprobación oficial del libro genealógico; AOM: año de la aprobación oficial del programa de mejora; NR: número de ganaderías inscritas en el libro genealógico; TR: tamaño medio del rebaño; NH: número de hembras reproductoras de raza pura inscritas en el libro genealógico; NM: número de machos reproductores de raza pura inscritos en el libro genealógico; NP: número total de reproductores de raza pura inscritos en el libro genealógico; NRD: variación anual del número de hembras de raza pura inscritas en el registro definitivo del libro genealógico; IPX: índice de Panmixia; TCA: tasa anual de crecimiento; IGE: producción científica en el área de genética; DGE:IZP: documentosproducción científica divulgativos en aspectos en el área zootécnicos de genética; y sistemasDZP: documentos de producción; divulgativos IRP: producción en aspectos científica zootécnicos en aspectosy sistemas reproductivos; de producción; IPP: DRP: producción documentos científica divulgativos en producción en aspectos y productos; reproductivos; IT: documentos DPP: documentos indexados; divulgativos en producción y productos; DT: documentos divulgativos.

Different letters indicate significant differences (p < 0.05). AOC: year of inclusion in the official list; AOL: year of official approval of the herd book; AOM: year of official approval of the conservation program; NR: number of herds registered in the herd book; TR: mean herd size; NH: number of purebred females registered in the herd book; NM: number of purebred males registered in the herd book; NP: total number of purebred animals registered in the herd book; NRD: annual variation in the number of purebred females registered in the definitive register of herd book; IPX: Panmixia index; TCA: Annual growth rate; IGE: scientific production in the area of genetics; IZP: scientific production documentsin zootechnical in the aspects area of andgenetics; production DZP: disclosure systems; IRP: documents scientific in productionzootechnical in aspects reproductive and production aspects; systems;IPP: scientificDRP: disclosure production documents in production in reproductive and products; aspects; IT: DPP:total indexeddisclosure documents; documents DGE: in production disclosure and products; DT: total disclosure documents.

Tomo 50 • N° 1 • 2018 179 J. Perea et al.

El nivel de riesgo obtenido no tiene en - cuenta factores genéticos, cuya correcta mente en cada situación. En este trabajo se estimación depende de la existencia de sobre aspectos clave identificados específica bases de datos que solo están disponibles clave para el contexto español. hanDe identificado acuerdo algunoscon Ruane de estos (2000) aspectos el razas (14). En el futuro es muy probable tamaño y la tendencia de la población son quehoy parase pueda un pequeño incorporar y selecto el componente número de los dos factores más importantes para priorizar actuaciones en conservación; disponible en la actualidad no lo permite. y los resultados han mostrado que en genético,Las prioridades aunque en la conservación información cambian oficial el contexto español ambos factores son con las condiciones de la población, desde independientes. Así, aunque las razas con el objetivo básico de evitar la extinción, a poblaciones mayores se encuentran en otros posteriores encaminados a asegurar la una situación más ventajosa, es necesario monitorear la tendencia de la población La consecución de objetivos será más para detectar precozmente el declive. autosuficiencia (13). eficiente si se basa en actuaciones focalizadas Tabla 3. en las variables métricas, porcentaje en las variables categóricas). Características según la tendencia de la población (media + desviación típica Table 3. metric variables, percentage for categorical variables). Characteristics according to population tend (mean ± standard deviation for Variable Decreciente Estable Creciente Valor crítico Especie (%) 0,081 Bovina 30,0 3,3 66,7 Ovina 19,3 12,9 67,8 Caprina 30,8 23,1 46,1 Porcina 37,5 20,2 42,3 Equina 16,4 20,0 63,6 Asnal 0,0 0,0 100,0 Aves 70,0 0,00 30,0 DG (%) 0,018 60,0 20,0 20,0 30,2 18,6 51,2 75% < 12,5 km 24,5 2,0 73,5 75% 12,5 a 50 km DC (%) 0,189 75% > 50 km No 23,4 9,4 67,2 Si 39,4 12,1 48,5 BG (%) 0,142 Carente 37,0 9,3 53,7 Medio 21,2 15,1 63,6 Completo 10,0 0,0 90,0

de germoplasma. DG: distribución geográfica; DC: producción de la raza acogida a denominación de calidad; BG: banco

DG: geographical distribution; DC: production under denomination of quality; BG: germplasm bank.

180 Revista de la Facultad de Ciencias Agrarias Conocimiento científico y políticas de conservación en las razas autóctonas españolas Tabla 3 (cont.). típica en las variables métricas, porcentaje en las variables categóricas). Características según la tendencia de la población (media + desviación Table 3 (cont.). deviation for metric variables, percentage for categorical variables). Characteristics according to population tend (mean ± standard Variable Decreciente Estable Creciente Valor crítico AOC 17,6 + 10,5 24,2 + 9,4 19,9 + 10,6 0,197 AOL 9,6 + 6,4a 12,4 + 6,3b 13,8 + 9,4b 0,007 AOM 1,7 + 0,8 1,6 + 1,0 1,5 + 2,8 0,723 NR 112,8 + 230,4 68,2 + 86,8 111,5 + 279,4 0,862 TR 27,5 + 341,3 66,9 + 342,1 28,0 + 543,1 0,211 NH 2885 + 3514 4352 + 3139 2978 + 5140 0,623 NM 217 + 282 212 + 112 146 + 168 0,225 NP 3102 + 3718 4564 + 3217 3124 + 5246 0,624 IPX 99,26 + 2,25 99,89 + 0,10 99,63 + 0,46 0,256 IGE 8,2 + 8,4 5,0 + 2,6 7,2 + 7,2 0,764 IZP 2,3 + 5,1 1,7 + 1,7 1,8 + 3,1 0,742 IRP 1,9 + 5,3 0,7 + 1,1 0,5 + 1,0 0,300 IPP 2,2 + 4,2 2,1 + 3,1 1,3 + 3,1 0,689 IT 14,6 + 14,3 9,5 + 5,2 10,8 + 9,8 0,627 DGE 4,9 + 5,4 3,8 + 3,2 3,7 + 3,7 0,926 DZP 1,6 + 3,8 1,8 + 3,4 0,9 + 1,9 0,737 DRP 1,5 + 5,4 0,6 + 1,6 0,3 + 0,9 0,843 DPP 1,5 + 3,0 2,6 + 5,2 0,9 + 2,4 0,341 DT 9,5 + 12,6 8,9 + 10,5 6,0 + 5,9 0,584

Letras diferentes indican diferencias significativas (p < 0,05). AOC: año de inclusión de la raza en el catálogo oficial; AOL: año de la aprobación oficial del libro genealógico de la raza; AOM: año de la aprobación oficial del programa de mejora; NR: número de ganaderías inscritas en el libro genealógico; TR: tamaño medio del rebaño; NH: número de hembras reproductoras de raza pura inscritas en el libro genealógico; NM: número de machos reproductores de raza pura inscritos en el libro genealógico; NP: número total de reproductores de raza pura inscritos en el libro genealógico; IPX: índice de Panmixia; IGE: producción científica en el área de genética; IZP: producción científica en aspectos zootécnicos y sistemas de producción; IRP: producción científica en aspectos reproductivos; IPP: producción científica en producción y productos; IT: documentos indexados; DGE: producción científica en el área de genética; DZP: producción científica enDT: aspectos documentos zootécnicos divulgativos. y sistemas de producción; DRP: producción científica en aspectos reproductivos; DPP: producción científica en producción y productos;

Different letters indicate significant differences (p < 0.05) AOC: year of inclusion in the official list; AOL: year of official approval of the herd book; AOM: year of official approval of the conservation program; NR: number of herds registered in the herd book; TR: mean herd size; NH: number of purebred females registered in the herd book; NM: number of purebred males registered in the herd book; NP: total number of purebred animals registered in the herd book; NRD: annual variation in the number of purebred females registered in the definitive register of herd book; IPX: Panmixia productionindex; IGE: andscientific products; production IT: total in indexed the area documents; of genetics; DGE: IZP: disclosurescientific production documents in in zootechnical the area of genetics; aspects DZP:and disclosure production documents systems; IRP: in zootechnical scientific production aspects and in reproductive production systems; aspects; DRP: IPP: scientificdisclosure production documents in in reproductive aspects; DPP: disclosure documents in production and products; DT: total disclosure document

Tomo 50 • N° 1 • 2018 181 J. Perea et al.

De acuerdo con Zander et al. (2013), como son su orientación al deporte y uso asignar recursos para recuperar razas con de silla, así como la producción cárnica en - zonas quebradas de monte donde resulta ciente que actuar sobre poblaciones de competitiva. La situación del bovino y ciertopoblaciones tamaño muy aunque pequeñas en declive. es más inefi de las aves se vincula con la pérdida de Las estimaciones precisas sobre la competitividad de los sistemas tradicio- situación y evolución de cualquier raza nales españoles (21). La expansión de dependen del registro periódico de datos genotipos bovinos cárnicos especializados y la avicultura industrial han relegado a la las asociaciones de criadores y el entorno mayoría de estas razas a pequeñas granjas administrativodemográficos y genéticos.de las razas En este juegan sentido, un de ocio orientadas al autoconsumo. papel importante. Esto es lo que sugiere En general, una raza no estaría en que las razas con poblaciones en declive y peligro de extinción si fuese económi- situaciones más críticas hayan comenzado camente competitiva en los sistemas a gestionar más recientemente el actuales de producción y en las condi- libro genealógico. ciones de mercado (27, 28). Los resultados han mostrado además Las razas en situación de amenaza una relación entre declive poblacional y son normalmente percibidas como de - escasa rentabilidad, sin embargo, muy menta la vulnerabilidad de las razas que poca documentación existe sobre estos seconcentración concentran en geográfica, pequeños territorios lo que incre (4). aspectos. Adicionalmente, los resul- La priorización de estas razas es tados han mostrado que las razas mejor todavía más oportuna si se tiene en cuenta conocidas y divulgadas en sus aspectos el valor adaptativo a las condiciones productivos y en sus producciones y medioambientales de sus entornos (25). productos son las que menor riesgo de Las razas aviares, bovinas y asnales se extinción presentan. El mercado cambia con rapidez y probablemente, las carac- de mayor amenaza en comparación al terísticas consideradas hoy de valor restoencuentran de las en especies. una situación Las razas demográfica caprinas pueden no serlo en un futuro cercano. Del y ovinas, típicamente mediterráneas, mismo modo, aspectos como la resistencia han logrado mantener un mayor nivel de a enfermedades, características reproduc- competitividad en sus áreas tradicionales de difusión; mientras que las razas asnales siempre de valor y deberían ser objetivo han perdido utilidad económica debido tivas o adaptación a medios difíciles serán- al cambio tecnológico experimentado gativos. Sin embargo, son los aspectos genéticosde mayores los esfuerzos que han científicos recibido y mayor divul consecuencia de la mecanización de la atención en las razas más amenazadas, agriculturaen España (16). en los últimos 50 años, especialmente los esfuerzos se han La situación de amenaza corresponde a todas las razas asnales, a diferencia de a caracteres de interés. la especie equina, que a pesar de sufrir focalizadoDocumentar en identificar y divulgar genes las características que afectan las mismas consecuencias derivadas productivas y de las producciones de las razas, incluyendo aspectos ambientales y las explotaciones agrarias, ha logrado culturales, también tiene importancia para desarrollarde la tecnificación otras alternativas y modernización funcionales de optimizar los programas de conservación

182 Revista de la Facultad de Ciencias Agrarias Conocimiento científico y políticas de conservación en las razas autóctonas españolas in situ focalizada en el área de genética. Mientras para modular las ayudas económicas que que en los menores niveles de riesgo se compensan. Por la ejemplo,pérdida de podrían rentabilidad ser útilesa los han investigado más intensamente los productos y las características producen situaciones de riesgo. tivas de las razas; y se ha hecho una mayor ganaderosLa conservación que continúan in situ utilizando consume razasgran divulgación de estos aspectos junto a cantidad de recursos, aunque constituye los de interés zootécnico y sistemas de producción. Por todo ello, se recomienda deseables en el futuro, de especial interés que las políticas de conservación y uso parala base adaptar para los identificar sistemas de las producción situaciones a sostenible de recursos genéticos animales cambios irreversibles del medio ambiente, concentren sus apoyos en una fase inicial como los que muy probablemente ocurran relativa al estudio y caracterización con el cambio climático (9, 18, 20). racial basada en aspectos genéticos y una segunda fase centrada en el incremento del conocimiento y divulgación de las carac- Conclusiones terísticas productivas y de los sistemas de producción, incluyendo aspectos ambien- Los mayores niveles de riesgo tales y culturales, que permitan conocer el corresponden a razas concentradas en nivel de productividad y competitividad de pequeñas áreas, con poblaciones y rebaños estas poblaciones en sus sistemas tradicionales de explotación. de menor tamaño, reconocimiento oficial más reciente y una producción científica Bibliografía

1. Alderson, L. 2003. Criteria for the recognition and prioritisation of breeds of special genetic importance. Animal Genetics Resources Information. 33: 1-9.

2.3. Alderson,ARCA. 2014. L. 2009. Sistema Breeds Nacional at risk: de DefinitionInformación and de measurement Razas Ganaderas. of the Ministerio factors which de Agricultura, determine endangerment.Alimentación y LivestockMedio Ambiente. Science. 123:Gobierno 23-27. de España. Disponible en: (http://www. magrama.gob.es/es/ganaderia/temas/zootecnia/razas-ganaderas/) 19 de enero de 2017. 4. Bertaglia, M.; Joost, S.; Roosen, J.; Econogene Consortium. 2007. Identifying European marginal areas in the context of local sheep and goat breeds conservation: A geographic information system approach. Agricultural Systems. 94: 657-670. 5. BOE. 1979. Orden de 30 de julio de 1979 por la que se establece el catálogo nacional de razas de

6. BOE. 1980. Orden de 31 de enero de 1980 por la que se catalogan como razas de fomento y de ganadoespecial de protección España. Boletín a las caballares Oficial del yEstado asnales de autóctonas9/08/1979, y núm. se extiende 190, 18725-18726 a las mismas p. la aplicación de estímulos para el fomento de las razas ganaderas españolas. Boletín

7. BOE. 1997. Real Decreto 1682/1997, de 7 de noviembre, por el que se actualiza el Catálogo Oficial del Estado de 19/03/1980. 68: 6183 p. 279: 34205-34207 p. Oficial de Razas de Ganado de España. Boletín Oficial del Estado de 21/11/1997. que se establece el programa nacional de conservación, mejora y fomento de razas 8. BOE. 2009. Boletín Oficial del Estado, nº Real Decreto 2129/2008, de 26 de diciembre, por el

ganaderas. Boletín Oficial del Estado de 27/01/2009. 23: 9211-9242 p.

Tomo 50 • N° 1 • 2018 183 J. Perea et al.

9. Fadlaoui, A.; Roosen, J.; Baret, P. V. 2006. Setting priorities in farm animal conservation choices- expert opinion and revealed policy preferences. European Review of Agricultural Economics. 33: 173-192. 10. FAO. 2010. La situación de los recursos zoogenéticos mundiales para la alimentación y la

(http://www.fao.org/3/a-a1250s.pdf) 19 de enero de 2017. 11. FAO. 2011.agricultura, Draft guidelines editado forpor the Barbara cryoconservation Rischkowsky of yanimal Dafydd genetic Pilling. resources, Roma. Disponible Commission en: on Genetic Resources for Food and Agriculture; Food and Agriculture Organization of the United Nations, Thirteenth Regular Session. Roma, Italia. 18-22 Julio. 12. FAO. 2014. Domestic Animal Diversity Information System (DAD-IS). United Nations Food and Agriculture Organization.

13. Gandini, G. C.; Ollivier, L.; Danell, B.; Distl, B.; Georgoudis, A.; Groeneveld, E.; Martyniukg, E.; van 14. Groeneveld,Arendonk, L. F.; Lenstra, J. A. M.; Woolliams,J. A.; Eding, J. H.; A. Toro,2004. M.Criteria A.; Scherf, to assess B.; Pilling, the degree D.; Negrini, of endangerment R.; Finlay, of livestock breeds in Europe. Livestock Production Science. 91: 173-182. diversity in farm animals-a review. Animal Genetics. 41: 6-31. 15. Jaric, I.;E. Gessner, K.; Jianlin, J. 2012. H.; Groeneveld, Analysis of E.;publications Weigend, S.on 2010. sturgeon GLOBALDIV research Consortium: between 1996 genetic and 2010. Scientometrics. 90: 715-735. 16. Kalantzopoulos, G.; Dubeuf, J.-P.; Vallerand, F.; Pirisi, A.; Casalta, E., Lauret, A.; Trujillo, T. 2004.

goat dairy sectors. International Dairy Federation Bulletin. 390: 17-28. 17. MAGRAMA.Characteristics 2014. Ministerio of sheep de and Agricultura, goat milks: Alimentación qualityand hygienic y Medio factors Ambiente. for the Gobierno sheep and de España. Disponible en: (http://www.magrama.gob.es/es/alimentacion/temas/ calidad-agroalimentaria/calidad-diferenciada/) 19 de enero de 2017.

18. Mara, L.; Casu, S.; Carta, A.; Dattena, M. 2013. Cryobanking of farm animal gametes and embryos asevolution a means ecology. of conserving Scientometrics. livestock 80:genetics. 657-682. Animal Reproduction Science. 138: 25-38. 19.20. Otta,Neff, S.;M. Quiroz, W.; Corley, J.; Juaneda, E. A. 2009. E.; Salva, 35 years J.; Viani, and M.; 160,000 Filippini, articles: M. F. 2016. A bibliometric Evaluación deexploration sustentabilidad of the de un modelo extensivo de cría bovina en Mendoza, Argentina. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 48(1): 179-195. 21. Perea, J.; Blanco-Penedo, I.; Barba, C.; Angón, E.; García, A. 2014. Organic beef farming in

22. Rege, J. E.Spain. O.; Gibson, Typology J. P. 2003.according Animal to livestockgenetic resources management and economicand economic development: variables. issues Revista in Científica.relation to 24:economic 347-354. valuation. Ecological Economics. 45: 319-330.

at the national level: a Norwegian case study. Conservation Biology. 14: 1385-1393. 23.24. Ruane,SPSS. 2005. J. 2000. Guía A frameworkBreve de SPSS for prioritizing14.0. SPSS inc. domestic Chicago. animal breeds for conservation purposes

12: 499-500. 25. Warren, J.T. 1998. Conservation biology and agroecology in Europe. Conservation Biology. 27. Zander, K. K. 2013. Understanding public support for indigenous natural resource management 26. Wright, inS. 1931.northern Evolution Australia. in Mendelian Ecology and populations. Society. 18: Genetics. 11-25. 16: 97-159.

to value local cattle breeds in East Africa. Ecological Economics. 68: 34-45. 28. Zander, K. K.; Drucker, A. G. 2008. Conserving what's important: using choice model scenarios

29. Zander, policy.K. K.; Signorello, Ecological G.;Economics. De Salvo, 93: M.; 219-229. Gandini, G.; Drucker, A. G. 2013. Assessing the total economic value of threatened livestock breeds in Italy: Implications for conservation

184 Revista de la Facultad de Ciencias Agrarias AnalysisRev. FCA UNCUYO. of social 2018. capital 50(1): of mexican 185-202. cacao ISSN impresoproducers 0370-4661. ISSN (en línea) 1853-8665.

The falling production of mexican cacao analyzed through the lens of Mincerian earnings function in the context of social capital of smallholders

La caída de la producción del cacao mexicano analizada a través de la función Minceriana en el contexto del capital social de pequeños productores

Tomáš Hes 1, Samuel Mintah 1, Haiyan Sulaiman 1, José Samuel Banda Arrieta 2, José Ramírez Esquivel 2, Tomás Martínez Saldaña 3, Juan Manuel Aguirre López 2

Originales: Recepción: 28/07/2016 - Aceptación: 14/02/2017

Abstract

The cacao belongs to most important agricultural crops worldwide, in recent decades facing increasing demand as well as falling production capacity. The dramati- is becoming a serious concern for diversity of local production, as local producers are substitutingcally fall of production cacao plantations of cacao with in Mexican more rentable agriculture, crops where thus giving it was awayfirst domesticated, a rich genetic as well as agricultural legacy that could under adequate conditions provide a source of the answer in studying the social capital of cacao producers of Tabasco region, coming to theincome conclusion for large that region it is collective while maintaining action and the social natural capital diversity. led production The paper set triesof practices to find that is crucial for the re-installment and prosperity of the plantations, rather than a single motive such as the recent invasion of Moniliophthora roreri fungus.

Keywords Moniliophthora roreri

social capital • cacao • Mexico • • Mincerian function

1 Czech University of Life Sciences Prague. Faculty of Tropical AgriSciences. Kamýcká 129, 165 21. Prague 6. Czech Republic. [email protected] 2 Chapingo Autonomous University. Economics-Management Science Division. Km. 38.5 Carretera México-Texcoco. Chapingo. Texcoco. Estado de México. México. C. P. 56230. 3 Colegio de Posgraduados. Estudios del Desarollo Rural. Carretera México-Texcoco Km. 36,5. Montecillo. Texcoco 56230. Estado de México. México.

Tomo 50 • N° 1 • 2018 185 Tomáš Hes et al.

Resumen

El cacao pertenece a los cultivos agrícolas más importantes en todo el mundo. En las últimas décadas se enfrenta con una creciente demanda, así como con la caída de la capacidad de producción. La caída de la producción de cacao en la agricultura mexicana, donde fue el cacao domesticado por primera vez, se está convirtiendo en una seria preocupación por la diversidad de la producción local, ya que los productores locales están sustituyendo las plantaciones con cultivos más rentables, perdiendo la riqueza genética y cultural. El artículo trata de encontrar la respuesta en el análisis del capital social de los productores de cacao de la región de Tabasco, llegando a la conclusión de que la produccion de cacao es una acción colectiva y relacionada con el tejido sociocultural y por lo tanto el capital social sirve como una base de conjunto de prácticas cruciales para la prosperidad de las plantaciones y lucha exitosa contra Moniliophthora roreri, uno de lo motivos de caída de la producción.

Palabras claves Moniliophthora roreri

capital social • cacao • México • • función Minceriana Introduction

The cacao (Theobroma cacao L.) regional (43), while almost three quarters belongs to the family Stericuliniacea, of the world’s cacao is produced by small which is naturally distributed in humid landholders, and therefore being intrinsi- tropics of the western hemisphere cally involved in socio-economic processes in higher altitudes between 18°00’N of base populations (10, 39). (Tabasco and Chiapas, Southern Mexico) and 15°00’S (Northern Brasil, Bolivia). cacao increases the biodiversity due to culti- Cacao was domesticated in Olmecan vationBesides of cacao social trees benefits under for smallholders,shade condi- Central America over 5,000 years ago, tions (13), even though cacao monocultures and its production has spread globally to tropical areas of west Africa and south- comparative to agroforestry systems (6). east Asia, and belongs today to the most provideThree moremorpho-geographic profits for households groups in important crops. In these days cacao is of cacao are know: Theobroma Cacao being cultivated in 58 countries with Cacao (Criollo), which is the gourmet contribution about US$ 4.5 billion per year type of cacao, Theobroma Cacao Sphaero- to the world economy. In some countries, capum (Guayaquil) and Theobroma the importance of cacao is paramount to Cacao Trinitario, which is the result of culti- local economy. vation that took place in Trinidad y Tobago In Ghana for example 75% of house- in the 1960s (27). holds are involved in cacao production, Three types of cacao are exported: while Ivory Coast supplies about 30% of pods, wet beans and dry beans, while the world’s total cacao (48). famers used to sell pods which is easier Cacao is considered to be the second for them, take the advantage of selling most essential cash crop in tropics

186 Revista de la Facultad de Ciencias Agrarias Analysis of social capital of mexican cacao producers dry beans that could be stored and trans- The production of cacao, concen- ported for long distances (16). Despite trated in small parcels of 1.8 hectares per producer in average (45) is dramatically cacao producer in the past, Mexico ranked falling in the past decades in Mexico. While inbeing 2014/2015 the first domesticatoronly 8th post and in a majorworld the country produced in 1993, 51% of cacao production producing over 80,000 the international production, the current metric tons of cacao beans (12, 41), thus production as of 2015, only supplies 1.6%, belonging along with coffee, rice, corn, provided by 37,000 smallholders (12). wheat, soybeans, cotton to most important One of the major motives for dramatic export commodities of the country. decrease of cacao production is the Even though the surface of cacao impact of Moniliophthora roreri, a patho- plantations reaches only 10% of the genous fungus invading active cacao pods surface of coffee plantations in Mexico, the yearly production of value of cacao in Panama and now is being found in comes near to 25% when compared to 11that countries appeared of for tropical the first America, time in repre 1956- coffee (33) denoting importance of this senting a serious threat for cultivation of crop for Mexican countryside further cacao on global level (34). enhanced by the fact that the presence of In Mexico, 90% of the 61,000 hectares cacao in federal states of Chiapas, Oaxaca, seem to be infected by moniliasis (45). Tabasco and Guerrero also corresponds to Resilient and rapidly dispersing spores occurrence of high levels of rural poverty, are apparently susceptible for most which in the abovementioned states cacao crops. reaches 40%.

Seeded Harvested 85000 83174 81987 81964

80000 83130 80903

75000 80879 70000

65000 61221 61024 60000 60866 60933

55000 2002 2003 2004 2005 2006

Figure 1. The falling production of cacao between 2002-2006 (19). Figura 1. La caída de la producción de cacao entre 2002-2006 (19).

Tomo 50 • N° 1 • 2018 187 Tomáš Hes et al.

The fungus is best controlled through the goal to illuminate possible strategies avoidance, due to human-mediated for revival of declining traditional sector dispersal of the pathogen into new planta- of production. tions, however strategies based on chemical More than 50 years old mincer's as well as biological basis seem to far less potentially analogue theoretical construct such as removal of attacked pods as well as usableearning for function the solution was of identified the abovemen as a- pruningefficient ofthan the adoption shade and of cacaocultural trees practices (23). tioned problem as the rentability of the Especially, it is the weekly removal of cacao producers could be viewed through attacked pods seems to be a crucial tool the lens of a function of social capital for prevention of the dispersion of spores, comprising of their social connectivity as but at the same time a reason for discour- well as of adopted practices and hence agement of production of cacao, due to being correlative with the schooling and increased requirements for manual work, experience related models. The model also combined with the age of the plantations being in average 70 years old and modelled the logarithm of earnings as therefore providing low rentability (44). awas sum first of education described in by years, J. Mincer, combined who One of the reasons for th with a quadratic function of a period of of such practice is a possible reduction potential experience, which become one of of dispersion potential of thee spores efficiency of the cornerstones of empirical economics moniliasis fungus that thrive on old, not (18). While Becker (1964) considered the pruned plantations and high cacao trees. internal rate of return to schooling as the The removals of infected pods as well as key concept of the theory of human capital, cutting the cacao trees in height and heavy Hermann (2008) employed the mincer pruning does bring results, as showed and model on analysis of the effects on social experiment in Tabasco in 2013, where on wages in European countries. Besides 5,000 hectares were subjected to intense these applications there was rather a practices of removal and pruning and led scarce application of the Mincerian wage to increase of productivity per hectar from on social capital. 350 to 800 kilograms (44). The problem of Mexican cacao Social capital and cacao production production however could be more Before applying the concept of social complex than just a challenge related to capital on cacao production in order to chemical or biological elimination of the derive possible connection between the fungus. It is a problem of a social and success of cacao production and social demographic nature, related to cultural capital present in the countryside, the practices, age of producers, abandonment social capital concept is to be inducted of the traditional production manners, and related with the problematics of which could be understood as a function of cacao production. Interest of many dynamics of social capital in the Mexican scholars in the social capital concept has countryside (8). The study hence attempts grown over the past years due to the fact that, there exists a relationship between productivity of the producers in a cacao the social capital stock and economic producingto find a link region between in Central social Tabasco, capital with and development, besides others. However, the notion of social capital is not a new

188 Revista de la Facultad de Ciencias Agrarias Analysis of social capital of mexican cacao producers phenomenon (24), although it became controlled forests, enabling villagers to subject of too many different meanings. control the forest from illegal logging, The concept of social capital as year grazing forest area, contributing a clear theoretical framework by Coleman enormouslyfires and cultivation to the development whiles ensuring of the all (1990)identified who by states Bourdieu that, social (1986) capital was can given be forest and the village at large. referred to as a collection of different bodies Durlauf and Fafchamps (2005), suggest consisting of aspects of social structure that that, through social capital, involvement facilitate presence of personal or corporate in community organisations can help in actors, within the structure (8). Putnam the facilitation of information channels. (1995) describes social capital as connec- Interactions between individual often tions among individual social networks comes with the sharing of information and the trustworthiness and reciprocity which bring about knowledge transfer of norms. and sharing. Wollcock (2001) on the other hand According to Coleman (1990) and states that social capital is the network Putman (1993), there is a positive facilitating a collective action, leading to a group formation and formation of other growth, as the promotion of trust and forms of civic or collective actions. Narayan cooperationinfluence of among social agents capital results on economic in social as the accumulation of resources contrib- collective action (9, 17, 25). utingand Pritchett to higher (1997) generation define of social income capital and capitalThe increasesvalue of social due tocapital more lies efficient in its explaining how it enhances cooperation, community cooperative action and leads production through the investment into relationshipsability to relinquish encouraging an efficient the reduction cycle of at the local level, as shown by Heller of transaction costs as well as the friction (1996)to solution on the of casecommon of horizontal property solidarity conflicts of productive activities (40). Davies contribution to economic development of (2001) suggests two theoretical models Kerala state in India. which underpins the concept of social According to this view, social capital capital by embracing a neo-Marxist and a speeds up the assimilation of innovation neo-Liberalist perspective. by strengthening the linkages among The former according to Davies (2001) individuals and amounts to improved is an approach proposed by Bourdieu quality and quantity of information Putnam asymmetry helping to reduce transaction (1995), who is considered as the pioneer costs, but also pooling risks allowing ofwhiles the concept the later into typifies the wider that media of from households to engage in higher risk the academic arena. The neo-Marxist activities with higher return on such approach of social capital places more activities (19), thus being an important emphasis on resource accessibility and the contribution to economic development. issues of power in societies. As suggested Baland and Platteau (1996) described by Baum (2000), Bourdieu highlights the how through social capital and community different roles played by the various forms based group formation helped villagers in of capital in the reproduction of unequal Madras to form a community-managed power relations. Coleman (1990) from forests through gaining access to state- the view point of rational action views

Tomo 50 • N° 1 • 2018 189 Tomáš Hes et al. social capital as not a single entity but as a variety of many entities having different contributor to improving the income of characteristics in common as inscribed in thesuch, poor social through capital improving is identified the as outcome a major its function. of activities of the poor that might affect Many empirical studies have tried to them. Social capital improves rural house- ts between social hold's access to credit, education and capital and production. Wolz et al. (2005) infind their the linkwork that on existhe impact of social towards agricultural productivity. capital on farm and household income on enhancesSocial capital efficiency as evidently in rural presented programs individual farmers in Poland found out by these studies above suggests that - higher participation levels, implemen- mining the level of agricultural income, tation of social networks and local organi- howeverthat, social also capital concluding is significant that, the in impactdeter zations increases an individual’s ability to of social capital on the level of agriculture access credit and this perhaps is the view is not as clear cut as expected. social in a way that, building of trust and if individual farmers are able to increase networkingin which social among capital individuals is identified onas trulythe the Theirlevel findingsof their pointagricultural out the income fact that, if background of a social setting spills over they are able to actively participate in formal organizations. Adding to this, also of social capital has been described in working on the effect of Social Capital on previousinto the materialstudies by benefits. Putnam Such et al meaning. (1993). the choice to use sustainable agricultural As suggested by Sharma and Zeller (1997), practices concluded that, the partici- there is a positive spillover effect on the pation of farmers in community based number of self-help groups on the credit performance of groups. on their choice of practicing sustainable Other studies such as Kahkoonen agriculture,organisations while has the a positiveextent to influencewhich a (1999) on the spillover effects found out farmer adopts the practice of sustainable that, community efforts to build water delivery channels is enhanced by the The study of Lawal et al. (2009) presence of non-water related associa- suggestsagriculture that, is influenced though the by status social of capital. social tions and networks in the community. As far as social capital and cacao suggests the involvement of farmers in production is concerned, several associationscapital was found at the to localbe low, level its influencethat will researches were done with varied focus increase their social capital level which that however could have an expressive in turn will enable them have access to value on the social capital related matters. more credit and therefore improve their The Abia State research in south- production capacity. eastern Nigeria interviewed 80 respon- Evidently, Grootaert and Bastelaer, (2002) on their work in Madagascar and contribution to farm decision making Bangladesh opined that, economic hetero- amongdents showed cacao farmingthat women households, have significant where geneity among groups, especially, groups age, level of education, marital status with varied income sources improves and farm size have negatively affected the rate of repayment due to the ability women's contribution to farm decision of group members to pool risks and as making however, farmer organization and

190 Revista de la Facultad de Ciencias Agrarias Analysis of social capital of mexican cacao producers extension institutions have a positively falling production of Mexican cacao, impact (32). not reduced only to impact of fungi nor Effendy et al. (2013) found that market related impacts. In more detailed education and farming experience could focus, the objectives of the work are to help to increase cacao production by adoption a modern technology, another characteristics of chosen variables related study, while a study Ondo State Nigeria tofind a acacao potential production relationship such as between annual showed that gender and level of education production per hectare, rentability of each have a positively associated with adoption producer, a combination of production of the disseminated cacao technologies (31). processes such as pruning or shortening The study of Yahaya et al. in 2015 of cacao trees and characteristics of social found out that farmer demographic capital fragmented into concrete chapters such as trust, norms and rules, interaction cacao production, and concluded that and network related effects. governmentcharacteristics should have significantsupport producers effect on In order to test the results of the with technology adoption as the most questionnaire, the following hypothesis were formulated, to proof the whether there Another important factor should is a potential link between the social capital takeefficient in consideration way of support. that cacao farmer's of smallholders as understood through the access to rehabilitation techniques infor- lens of Social Capital Theory and the impact mation which also could help them to on production due to information access, get more knowledge about modern information transfer, collaboration as well cacao production (2), by the study of as access to networks and infrastructures, Abbeam et al. (2014), with trying to the following hypothesis were formulated. determine the ability of cacao farmers to H1 use agrochemicals through interviews of between social capital associated with 156 cacao farmers in Ghana, the results a producer: There and is a significantrentability relationshipof annual showed that gender, age, size of household production of cacao per hectare. and farm, educational level and the average H2: Social capital of type D has higher age of cacao farms have an important effect impact than social capital of dimension A, in agrochemical usage but in general the B and C on the rentability of the producers. purchasing power of these inputs are very H3 low and these agrochemicals play a crucial between social capital associated with a role in increasing the productivity of cacao producer: There and isa acombination significant relationshipof pruning, farms in south-eastern Asian countries. reduction of height of cacao trees and age of the producers. Objectives and hypothesis

The aim of this work is to show that Methodology there is a relationship between the behavior of cacao producers expressed as Data a function of social capital and production Data collection took place in February output related variables. If such aim is 2016 in municipality C-16 Gral. Emiliano proven, it would provide a hint on the Zapata, Cardenas, in Central Tabasco explanation what may lie behind the in south-eastern Mexico, where 101

Tomo 50 • N° 1 • 2018 191 Tomáš Hes et al. semi-structured questionnaires with a trees, age of plantation, height of trees, cost combination of 50 principal questions of chemical care as well as cost of pruning, entailing 230 subquestions which however quantity produced and total production include aksi monthly calendars. The are described in table 1 (page 193) and questions are closed as well as open ended table 2 (page 194) below. of a dichotomous and contingency type, as well as based on level of measurement Theoretical framework and related to agricultural and socio-economic definition of dimensions of social capital standing of smallholders, were distributed - among the rural population of cacao producers landowners. The poor definition and inconsis The collection was done by an inter- oftencies several in definingdimensions on what of social social capital,capital disciplinary team composed of both conceivingstands for different have resulted forms, in levels definition and agronomists as well as economists and characteristics that divide the concept on cacao producers and was possible due to different dimensional levels. a collaboration between Czech University On the aspect of characteristics of social of Life Sciences Prague, Autonomous capital, the concept can be grouped as University Chapingo and the department relational dimension, resource dimension of Economic Development of Municipality and structural dimension. of Cardenas as well as of an Association of However there exist other forms of Cacao Producers of Tabasco. dimensions of social capital and as opined No collection of this type was done in by Molina-Morales (2010) these include the past in the locality, which was chosen expressive ties and instrumental ties, for its importance for the cacao production relational dimension, cognitive dimension on national level, as the production of cacao and structural dimension (45). in Tabasco State ranks 3rd in its economic Social capital can also be divided into importance in the state and 1st in terms of cacao plantation surface on national level, distributed between four munipalities asindividual a result levelof social which networking, consists of while benefits the of Comacalco, Cardenas, Cunducan and nextor potential dimension benefits is communal that an actor level enjoyswhich Huimanguillo (38), while C-16 belongs includes civic spirit, community trust, and to most important cacao plantation in Cardenas being positioned in a coastal As one of the main dimension is plateau at altitude of 10 meters. In terms consideredadherence to the beneficial trust (8, norms. 25, 45), followed of socio-economic standing, the C-16 by rules and norms governing social municipality was according to the 2010 action accompanied by sanctions and census inhabited by 3684 inhabitants, types with 7.6% occurrence of analfabetism, low of social interaction (11) and network presence of indigenous groups (0.11%) resources.information The flow theoretical capacity (9, framework 11), and cocoa being a predominant cash crop summarizations upon which is based being produced in 818 farms, out which the outcome of this analysis, could be 0.71% were equipped with computer. described in the illustrative hypothesis The descriptive statistics of selected (a,b,c) as mentioned below. variables such as age, years of experience, The social capital increases according family character, size of cacao plantations to the level of participation in voluntary in terms of surface as well as number of associations (20).

192 Revista de la Facultad de Ciencias Agrarias Analysis of social capital of mexican cacao producers 4 5 8 2 of 10 100 trees 4.43 0.13 1.26 1.58 4.82 1.39 Height 5 30 30 1.3 101 120 125 3.82 Age 29.07 13.06 28.49 170.69 of trees 600 101 480 3.26 1200 5720 6200 94.36 13.55 trees 948.35 1266.24 899371.7 Number of 2 1 1 9 10 100 2.21 0.18 1.84 3.37 11.1 3.19 cacao Surface of Surface plantation 1 1 0 3 3 32 0.8 1.44 0.14 0.64 0.22 -0.23 Children 2 1 1 4 5 93 0.1 1.3 1.87 0.94 0.97 1.22 Women Family members Family 2 1 1 4 5 92 0.1 1.3 1.85 0.92 0.96 1.61 Men 5 25 30 50 94 55 of 1.12 0.02 -0.45 26.37 117.7 10.85 Years experience 58 50 26 70 96 1 Estadística descriptiva de variables colectadas elegidas. de variables 1 Estadística descriptiva 100 1.41 14.1 0.13 -0.54 Age 58.41 198.73 Descriptive statistics of chosen quantitative data variables collected. collected. data variables statistics of chosen quantitative Descriptive Tabla 1. Tabla Table 1. Table Descriptive statistics variables Descriptive Mean Standard error Standard Median Mode Sample Variance Sample Variance Standard deviation Standard Kurtosis Skewness Minimum Range Count Count Maximum

Tomo 50 • N° 1 • 2018 193 Tomáš Hes et al. 20 3.1 800 101 780 200 300 1.43 13.86 235.74 139.34 Dec 19414.69 20 101 980 200 300 1.84 6.17 1000 15.04 237.32 151.19 Nov 22857.68 20 700 101 680 200 300 0.99 0.81 13.71 Oct 232.17 137.77 18979.8 10 3.7 850 101 840 160 300 1.48 13.78 211.14 138.44 Mar 19166.94 Total monthly production monthly Total 15 700 101 685 175 300 1.41 2.34 13.74 Feb 218.27 138.04 19055.22 15 800 101 785 180 300 1.48 12.4 3.96 Jan 214.65 124.65 15536.63 101 100 2.95 5000 4900 1000 1000 64.01 14.15 643.27 1044.55 - baba Quantity produced produced 413795.05 35 101 425 500 1.01 0.84 1500 1465 31.29 496.08 314.46 1 ha Estadística descriptiva de variables colectadas elegidas. de variables Estadística descriptiva cost per cost Pruning 98887.77 Descriptive statistics of chosen quantitative data variables collected. data variables statistics of chosen quantitative Descriptive 26 101 250 4.33 Tabla 2. Tabla 1500 1474 197.4 18.51 26.37 166.67 186.04 cost cost per 1 ha 34611.32 Chemical protection Tabla 2. Tabla statistics variables Descriptive Descriptive Maximum Count Range Minimum Skewness Mean Standard error Standard Sample variance Kurtosis Median Mode deviation Standard

194 Revista de la Facultad de Ciencias Agrarias Analysis of social capital of mexican cacao producers

Networking leads to higher accumu- relationship using mincer's regression lation of social capital (9, 17, 26) model through cross sections of data Interaction, mentoring nd mutual support leads to higher social capital (19, 35). Least Square (OLS) method, as depicted in formulaanalysis below.with fixed effects within Ordinary and creating and intersection of the The advantage of mincer's framework availableTaking data these and definitions in the assumption into account of is that its capture of two different social capital being a sum of the following economic concepts. While the hedonic variables, we award the following criteria or wage function reveals rewards of the as social capital prone qualities in table 3. labor market for productive assets such as experience and schooling, the rate of Estimation method used return of education provides a compa- We compare the production of chosen rison which could be used to determined variables products with four chosen the optimal level of investments of human Social Capital indicators, searching for a capital (14).

Table 3. Dimension of social capital related to the questionnaire. Table 3. Dimensiones de capital social relacionadas con el cuestionario.

Question Dimensions of social capital Questions in the questionnaire number

5 Years of experience A. Trust 44 3 Education B. Rules and norms governing social action Increased level of confidence 6 Children studying university degree 16 Relative economic importance of the activity

29.34 Assessment by professional agronomists

29.36 Group work participation C. Types of social interaction 29.38 Experience interchange

43 Participation in the past year

33 Technical assistance

7 Number of family members

13 Number of families living the household D. Network resources 29.35 Membership in an organization

29.40 Institutional relationship

Tomo 50 • N° 1 • 2018 195 Tomáš Hes et al.

The original equation provided by Results and discussion Mincer (1974), as per Formula 1, is listed below: (page 198), below revealed that there 2 (1) cannotThe be first found examination a convincing inrelationship table 6 Iny  Iny0  rS  β1 X  β1 X between social capital and cacao where: production her hectar, as all p-values are y = earnings above the required 5% threshold (A=0.16; y0 = earnigs of those without education B=0.62; C=0.50; D=0.22, Cacao Care=0.8). nor experience In the second examination as per table S = years of schooling 7 (page 198) below, in a similar tone most X = years of potential experience in of the variables could not be considered as labour markets the 5% threshold (A=0.27; B=0.48; D=0.40). The tailored substitution of the statisticallyHowever, significant the social as thecapital p-values of typeexceed C original Mincer was done through substi- shows signs of statistical relationship with tution of earnings (y) by output of cacao Cacao Care dependent variable. production and analogically of y0, while The result point at rather a surprising years of schooling were substituted by result of a negligent importance of

Social CapitalA,B,C,D and Cacao Care variable. social capital and productivity of the cacao plantation. 1 (Formula 1) the statistical relationship betweenIn the firstthe annual calculation cacao of rentabilitythe Regression per relationship between social capital associated The hypothesis on a significant 1 ha and the Social CapitalA+B+C+D sets was with a producer and rentability of annual sought, while providing an answer to production of cacao per hectare cannot be the H2. Formula 2 (table 4, page 197). show low level of social connectivity not Regression 1-the relationship between necessarilyconfirmed. have In other to show words, lower producers productivity that the different types of social capital and per hectar, while the productivity is rather rentability. dependent on other factors. In the second calculation of Regression With this particular result comes and 2, the Cacao Care variable and Social uncertainty in relation to the second

CapitalA+B+C+D was provided, employing the hypothesis H2, which therefore cannot be Formula 2 (table 4, page 197) below. The Cacao Care variable is provide in Formula The third hypothesis can be however 2 (table 4, page 197). confirmed either.

2 Iny  Iny0  β1 A1  β2 Bi  β3Ci  β4 Di  ωi  εi capitalconfirmed associated as there with seemsa producer to be and a his/hersignificant social relationship interaction betweensuch as group social Formula 3 (table 5, page 197). Regression work, interchange of experience, requested 1: relationship between the Cacao Care technical assistance or assessment by variable and Social CapitalA+B+C+D experts. Combination of approaches including pruning, reduction of height of cacao trees and age of the producers are robustness.Statistic fit and F-test was applied for indeed boosted by the social capital that is both calculations in order to confirm the created in a collective interaction.

196 Revista de la Facultad de Ciencias Agrarias Analysis of social capital of mexican cacao producers

Table 4. Variables applied in formula 1 (page 196). Table 4. Variables aplicadas en fórmula 1 (page 196).

be a dependent variable y in market i related to cacao output, where P corresponds to annual production and S corresponds to cacao producing surface calculated as yi

Pi i  ∑ / Si

yo average cacao output of 20% producers with low social capital according to Pareto principle

be the independent variables related to different type of social capital A as calculated in A , B , C , D i i i i table 7 (page 198).

1, 2, 3, 4 x: social capital A,B,C,D � be the coefficient of be the intercept of the regression line and the Y axis

i be an error term - residual value describing market i ᶓ be a performance variable of Cacao Care where: AP*HP ωi  In AP = Age of Plants CP *CCh i HP = Height of Plants C = Cost of Pruning � P CCH= Cost of Chemical Care

Table 5. Variables applied in formula 2 (page 196). Tabla 5. Variables aplicadas en fórmula 2 (page 196).

i be a performance variable of Cacao Care as described in table 4 (page 197) be the independent variables related to different type of social capital A �A , B , C , D i i i i as calculated in table 4 (page197)

1, 2, 3, 4 x: social capital A,B,C,D � be the coefficientintercept of of the regression line and the Y axis

αi be an error term - residual value describing market i and time t average performance of 20% of producers with low performance variable ᶓ i of Cacao Care, according to Pareto principle �

Tomo 50 • N° 1 • 2018 197 Tomáš Hes et al.

Table 6. Model 1: OLS, dependent variable Rentability. Tabla 6. Modelo 1: OLS, variable dependiente Rentabilidad.

Coefficient Std. Error t-ratio p-value const 0.013646 0.0450645 0.3028 0.7627 A 0.000599971 0.000428577 1.3999 0.1648 B -0.00358642 0.00737424 -0.4863 0.6278 C -0.00532681 0.00790991 -0.6734 0.5023 D 0.00561049 0.00463063 1.2116 0.2287 Cacao Care -1.19122e-06 5.74432e-06 -0.2074 0.8362

Mean dependent var 6.165696 S.D. dependent var 0.869020 Sum squared resid 0.253936 S.E. of regression 0.051701 R-squared 0.996671 Adjusted R-squared 0.996461 F(6, 95) 4740.020 P-value(F) 2.4e-115 Log-likelihood 161.0461 Akaike criterion -308.0923 Schwarz criterion -289.7175 Hannan-Quinn -300.6517

Table 7. Model 2: OLS, dependent variable Cacao Care variable. Tabla 7. Modelo 2: OLS, variable dependiente Cacao Care. Coefficient Std. Error t-ratio p-value const -1.22555 1.22929 -0.9970 0.3213 A 0.0238686 0.0216546 1.1022 0.2731 B 0.258438 0.370624 0.6973 0.4873 C 0.778547 0.389362 1.9995 0.0483 ** D -0.0366215 0.043771 -0.8367 0.4048

Mean dependent var 1.184230 S.D. dependent var 2.677351 Sum squared resid 678.0635 S.E. of regression 2.643926 R-squared 0.063434 Adjusted R-squared 0.024812 F (4, 97) 1.642456 P-value(F) 0.169788 Log-likelihood Akaike criterion 492.6788 Schwarz criterion 505.8037 Hannan-Quinn 497.9935 −241.3394

Conclusion

This type of interaction may therefore The study proposes to enhance be crucial in the strategy of implemen- agronomic approach focused on solution tation of new practices that may be vital in of complex agroindustrial phenomenons by categorical considerations related to may have higher importance than network social capital of the moving force of the resources,the fight against trust moniliasisand rules outbreakand norms and agroindustry itself: the smallholders and implemented through external action. their social ecosystems.

198 Revista de la Facultad de Ciencias Agrarias Analysis of social capital of mexican cacao producers

In the particular case of mexican cacao, of employed used methods in smaller if only the mean age of producers reaches communities such as the community C-16 58 years is to be mentioned it is clear that Gral. Emiliano Zapata in Central Tabasco. the nature of the individual smallholders Less convincing results on the relationship must have an inevitable and intrinsic between social capital and the general impact on care and thus on the fate of cacao productivity point at the fact that social plantations, while it is possible to move capital may be an overrated concept or on beyond this simple indicator and look for the other hand a too complex phenomenon more complicated, social capital related that is to be studied from many deeper patterns behind the production output. angles before there is a certainty of the Result of the analysis using the lens answer to the question on what it actually of Mincerian wage function on the cacao is and how dependent/how impacting is production related data Central Tabasco, this phenomenon on local collectivities. Even if the paper can however raise a action can possible be one of the most question on the extent to the claim of the yielded a result confirming that collective Mincer model on the exogeneity of the that will actually translate into adoption ofefficient new wayspractices of creatingand implementation social capital result on pointing at social interaction of innovations in the countryside. This asproductive the most efficiency, important the messageclass of ofsocial this result was distilled from the statistically capital is distinct and could become a signal for the focus of subsidies in the of activities such as interaction between cacao producing sector. This could be producers,significant sharing relationship of local between knowledge a sumand essential for the perspective of the sector, interaction with external sources of information and impact of the abovementioned rapidly expanding plague that is according fungus on the production output. toespecially cacao duringproducers an era also of fightfomented against by a Collective work and frequent ancient practices that naturally support interaction thus seem to be a most the dissemination of spores of moniliasis, dissemination, but also to synchronization height of the cacao plants. efficient vehicle not only for information such as insufficient pruning and excessive

References

the experience of smallholder cacao farmers in Ghana. Research in Applied Economics. 1. Abbeam, G.6(4): D.; Setsoafia, 1-16. E. D.; Ansah, I. G. K. 2014. Modelling farmers investment in agrochemicals: 2. Adeogun, S. O.; Olawoye, J. E.; Akinbile, L. A. 2010. Information sources to cacao farmers on cacao rehabilitation techniques (CRTs) in selected states of Nigeria. Journal Media and Communication Studies. 2(1): 9-15. 3. Baland, J. M.; Platteau, J. P. 2000. Halting Degradation of Natural Resources: Is There a Role for Rural Communities? Oxford University Press. 4. Baum, F.; Palmer, C.; Modra, C. 2000. Families, social capital and health. In Winter, I. (Ed) -Social capital and public policy in Australia. Melbourne: Australian Institute of Family Studies p. 250-274. 5. Becker, G. S. 1964. Human capital: a theoretical and empirical analysis, with special reference to education. National Bureau of Economic Research, New York. Distributed by Columbia University Press.

Tomo 50 • N° 1 • 2018 199 Tomáš Hes et al.

6. Blare, T.; Useche, P. 2013. Competing objectives of smallholder producers in developing countries: examining cacao production in Northern Ecuador. Environmental Economics. 4(1): 72-80. 7. Bourdieu, P. 1986. The Forms of Capital. 1985. Handbook of Theory of Research for the Sociology of Education. p. 56.

de apoyo público de microempresarios rurales de la zona central de Chile. Revista de 8. Boza, S.; Marcos,la Facultad G.; Cortés, de Ciencias M.; Mora, Agrarias. M. 2016. Universidad Perfiles basados Nacional en deactitudes Cuyo. Mendoza. hacia los programasArgentina. 48(2): 161-175. 9. Coleman, J. S. 1988. Social capital in the creation of human capital. American Journal of Sociology 94: 95-120. 10. Coleman, J. S. 1990. Foundations of Social Theory. Harvard University Press, Cambridge, M A.

12. Dahlquist, R. M.; Whelan, M. P.; Winowiecki, L.; Polidoro, B.; Candela, S.; Harvey, C. A.; 11. Collier, P.; Hoeffler, A. 1998. On Economic Causes of Civil War. Oxford Economic Papers. biodiversity conservation: A case study of cacao agroforestry systems in Talamanca, Wulfhorst,Costa Rica. J.Biodiversity D.; McDaniel, and P. Conservation.A.; Bosque-Pérez, 16: 2311-2333.N. A. 2007. Incorporating livelihoods in 13. Davies, A. 2001. But we knew that already! - A study into the relationship between social

14. Durlauf, S. N.; Fafxhamps, M. 2005. Social Capital. In: P. A. a. S. N. Durlauf, ed. Handbook of capitalEconomic and Growth. volunteering. North Holland:Conference Elsevier paper. B.V. Anne 2: 1640-1666.Davies. Home Start. Sheffield. 15. Effendi, Y.; Jones, A. M.; Scherer, G. F. E. 2013. Auxin-Binding-Protein1 (ABP1) in phytochrome- B-controlled responses. Journal of Experimental Botanics. 64: 5065-5074. 16. Fleming, K.; Smith, V. E.; Bittenbender, H. C. S. 2009. The Economics of Cacao Production in Kona. Honolulu (HI). University of Hawaii. 17 p. 17. Food and Agriculture Organization of the United Nations (FAO). 2015. Trade Reforms and Food Security. Rome. 18. Franzen, M.; Mulder, M. B. 2007. Ecological, economic and social perspectives on cacao. Biodiversity and Conservation. 16(13): 3835-3849. 19. Geomexico.com. 2012. The Geography of cacao production in Mexico. Available in: http:// http://geo-mexico.com/?p=5900. (Accessed January 2016). 20. Grootaert, C.; Bastelaer, V. 2002. Understanding and measuring social capital: A multidisciplinary tool for practitioners. Washington: World Bank. 21. Heckman, J.; Lochner, L.; Todd, P. 2003. Fifty Year of Mincer Earnings Regressions. National Bureau of Economic Research. Working Paper 9732. 22. Heller, P. 1996. Social capital as a product of class mobilization and state intervention:industrial workers in Kerala, India, World Development. 24: 1055-1071. 23. Hermann, Z. 2008. The effect of social capital on wage income. Institute of Economic of the Hungarian Academy of Sciences. 24. Kahkonen, M. P.; Hopia, A. I.; Vuorela, H. J.; Rauha, J. P.; Pihlaja, K.; Kujala, T. S. 1999. Antioxidant activity of plant extracts containing phenolic compounds. Journal of the Agricultural and Food Chemistry. 47: 3954-3962. 25. La Porta, R.; Lopez-de-Silanes, F.; Shleifer, A.; Vishny, R. W. 1997. Trust in large organizations. American Economic Review. 87: 333-338. 26. Lawal, J.; B. Omonona, O.; Ajani, O. 2009. Determinants of contraints to credit access among cacao farming households in Osun State, Nigeria. Pakistan Journal of Social Sciences. 6(3): 1683-1691. 27. Mendoza-López A, R. A.; Gallardo-Méndez, C. H. 2011. El mundo del cacao (Theobroma cacao L.) kawa (Maya) cacahuatl (Náhuatl). Agroproductividad. 4: 20-26. 28. Mincer, J. 1974. Schooling, Experience and Earnings. New York: National Bureau of Economic Research. 29. Molina-Morales, X. F.; Martínez-Fernández, M. T. 2010. Social Networks: effects of social capital

on firm innovation. Journal of Small Business Management. 48: 258-279.

200 Revista de la Facultad de Ciencias Agrarias Analysis of social capital of mexican cacao producers

30. Narayan, D.; Pritchett, L. 1997. Cents and sociability: household income and social capital in rural Tanzania. World Bank Research Working. Paper No. 1796, Washington: The World Bank. 31. Nmadu, J. N.; Sallawu, H.; Omojeso, B. V. 2015. Socio-economic factors affecting adoption of innovations by cacao farmers in Ondo State, Nigeria. European Journal of Business, Economics and Accountancy. 3 (2): 58-66. 32. Obinna, A. P.; Ifenkwe, G. E. 2013. Farm decision making among cacao farming households in Ikwuano L. G. A. Of Abia State Nigeria. International Jurnal of Academic Research in Progressive Education and Development. 2(1): 275-286. 33. Ocampo, B.; Rios, B.; Soria, B. 2012. Production of Cacao in Mexico. FCA UNAM. 34. Philips-Mora, W.; Wilkinson, M. 2007. Frosty pod of cacao: a disease with a limited geographic range but unlimited potential for damage. The American Phytopathological Society, 97(12): 1643-1648. 35. Porters, A, 1998. Social capital: its origins and application in modern sociology. Ann. Rev. Soc., No. 24: 1-25. 36. Putnam, R. D. 1993. Making democracy work: civic traditions in modern Italy. Princeton University Press, Princeton, New Jersey. 37. Putnam, R. D. 1995. Tuning in, tuning out: the strange disappearance of social capital in America. PS: Political Science & Politics. 28: 664-683. 38. Ramirez-Meneses, A.; Garcia-Lopez, E.; Obrador-Olan, J.; Ruiz-Rosado, O.; Camacho-Chiu, W. 2011. Plant diversity in cocoa agroforestry systems in Cardenas, Tabasco, Mexico. Universidad y Ciencia, Trópico Húmedo. Cardenas, Tabasco. Retrieved 2016, Available at: http://www.dof.gob.mx/SEDESOL/Tabasco_002.pdf 39. Ramos, G.; Gonzalez, N.; Zambrano, A.; Gomez, A. 2013. Olores y sabores de cacaos venezolanos ícola. (1): 114-127. 40. Rupasingha,obtenidos A.; Goetz, usando S. J.un 2007. panel Social de catación and political entrenado. forces Revista as determinants Científica UDOof poverty: Agr A spatial analysis. The Journal of Socio-Economics. 36: 650-671. 41. Sanchez, P.; Jaffe, K. 1992. Rutas de migraciones humanas precolombinas a la Amazonia sugeridas por la distribucion del cacao. Interciencia.17(1): 28-61. 42. Sharma, M.; Zeller, M. 1997. Repayment performance in group based credit programmes in Bangladesh. World Development. 25(10): 1731-1742. 43. Steffan-Dewentera, I.; Kesslerc, M.; Barkmannc, J.; Bosa, M.; Buchorig, D.; Erasmih, S.; Fausth, H.; Geroldh, G.; Glenke, K.; Gradsteind, S.; Guhardjai, E.; Harteveldd, M.; Herteld, D.; Höhna, P.; Kappash, M.; Köhlerh, S.; Leuschnerd, C.; Maertensj, M.; Marggrafe, R.; Migge-Kleiank, S.; Mogeai, J.; Pitopangl, R.; Schaeferk, M.; Schwarzem, S.; Spornd, S.; Steingrebek, A.; Tjitrosoedirdjoi, S.; Tweleh, A.; Weberh, R.; Woltmannk, L.; Zellerm, M.; Tscharntkea, T. 2007. Tradeoffs between income, biodiversity and ecosystem functioning during tropical

Academy of Sciences, 104. Available at: http://www.pnas.org/cgi/doi/10.1073/ rainforestpnas.0608409104. conversion and agroforestry intesification, Proceedings of the National 44. Teorema Ambiental. 2015. La producción de cacao en México desciende al octavo sitio. Disponible en: http://www.teorema.com.mx/biodiversidad/ecosistemas/la- produccion-de-cacao-en-mexico-desciende-al-octavo-sitio. (Accessed January 2016). 45. Wei-ping Wu. 2008. Migrant Settlement and Spatial Distribution in Metropolitan Shanghai. Professional Geographer. 60(1): 101-120. 46. Wolz, A.; Fritzsch, J.; Reinsberg, K. 2005. The impact of social capital on agricultural income among corporate farms in the Czech Republic. Paper presented at the XIth Congress of the European Association of Agricultural Economists (EAAE). "The Future of Rural Europe in the Global Agri-food System”, Copenhagen, Denmark. 24-27 August. Available in: http://www.eaae2005.dk/CONTRIBUTED_PAPERS/S46_285_Wolz_etal. pdf (Accessed: 21 November 2005).

Tomo 50 • N° 1 • 2018 201 Tomáš Hes et al.

47. Wollcock, M. 2001. The place of social capital in understanding social and economic outcomes. Canadian Journal of Public Policy. 2: 11-17. 48. Worldatlas. 2015. Top 10 Cacao Producing Countries. Available at: http://www.worldatlas. com/articles/top-10-cacao-producing-countries.html [Accessed in 15 March 2016]. 49. Yahaya, A. M.; Karli, B.; Gül, M. 2015. Economic analysis of cacao production in Ghana: the case of eastern region. Custos e @gronegócio on line. 11(1): 336-352.

Acknowledgment

This research was enabled Partnershipdue to financing EM A2-Strand provided by 1 Lot CULS 8 project. IGA project reg. nr. 20165006 and further enhanced thanks the participation of the first author in Eulalinks Sense Erasmus Mundus

202 Revista de la Facultad de Ciencias Agrarias FactoresRev. FCA UNCUYO. contextuales 2018. en50(1): la adopción 203-216. deISSN modelos impreso de 0370-4661. agricultura ISSN insustentables (en línea) 1853-8665.

Influencia de factores contextuales en la adopción de modelos de agricultura insustentables. La incorporación del invernáculo en agricultores platenses

Influence of contextual factors in the adoption of models of unsustainable agriculture. The adoption of the greenhouse in farmers in the horticultural belt of La Plata

1 2, Santiago Javier Sarandón 3

Originales:María Luz Blandi Recepción: , Raquel 02/11/2016 María Rigotto - Aceptación: 10/03/2017

Resumen

En las últimas décadas, en el Cinturón Hortícola Platense, gran parte de la producción hortícola al aire libre fue reemplazada por producción bajo invernáculo. A pesar de ser más rentable, esta modalidad afecta de una forma más acentuada las dimensiones ecológica y social de la sustentabilidad. El proceso de toma de decisiones de los agricultores es complejo y en él se ponen en juego factores individuales y factores contextuales (económicos, técnicos y políticos). Se analizó la influencia de los factores contextuales en la toma de decisión de incorporar la tecnología del invernáculo en diferentes agricultores del Cinturón Hortícola Platense. Se utilizó una metodología cualitativa, con entrevistas en profundidad a horticultores de diferente origen y que trabajan con diversos sistemas de producción. Los resultados demuestran que los factores contextuales fueron de gran importancia para que los agricultores optaran por incorporar innovaciones tecnológicas no sustentables. A su vez, se observó que los agricultores que cultivan bajo invernáculo fueron más influenciados por los factores contextuales que aquellos que cultivan al aire libre. Ante un Estado ausente, una ciencia débil y la falta de valoración de bienes ambientales, predominó la dimensión económica en laPalabras adopción clave de sistemas no sustentables.

Desarrollo agrario • agricultores • Agroecología • estudio de caso • horticultura

1 Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). Facultad de Ciencias Agrarias y Forestales (UNLP). Cátedra de Agroecología. calle 60 y 119 s/n. La Plata. Buenos Aires. [email protected] 2 Universidade Federal do Ceará. Departamento de Saúde Comunitária. Centro de Ciências da Saúde da. 3 Facultad de Ciencias Agrarias y Forestales (UNLP). Cátedra de Agroecología. Comisión de Investigaciones de la Provincia de Buenos Aires (CIC). Tomo 50 • N° 1 • 2018 203 M. L. Blandi, R. M. Rigotto, S. J. Sarandón

Abstract

In recent decades, in the Horticultural Platense Region, much of the open field horti cultural farming has been replaced by greenhouse cultivation systems. Even though this practice is more profitable than open field farming, it has a more accentuated negative impact on the ecological and social dimensions of sustainability. The decision-making process of farmers is complex and it's subject to individual and contextual factors (economic, technical, political and social). The influence of contextual factors in the adoption of greenhouse technology in different Horticultural Platense farmers was analyzed. A qualitative methodology was used, with in-depth interviews with farmers of different origin, who work with various production systems. The results confirm that contextual factors exerted great pressure on farmers when it came to incorporating unsustainable technological innovations. Additionally, it was observed that farmers who practiced greenhouse farming were more influenced by contextual factors than those who practiced open field farming. With a mostly absent State, a weak science and the lack of monetary valuation of environmental assets, the economic dimension prevails whenKeywords it comes to adopting unsustainable systems.

Rural development • farmers • Agroecology • case study • horticulture Introducción

- A través de la agricultura, los seres Los agroecosistemas son sistemas humanos modifican los ecosistemas para ecológicos insertos en una matriz sociocul transformarlos en agroecosistemas. Esas tural. En ellos, son los agricultores quienes- modificaciones tienen diferentes impactos definen el estilo de agricultura a realizar. sobre los recursos naturales según el Entender cómo es que los agricul- estilo de agricultura que se realice. Por tores toman estas decisiones es algo que ejemplo, en las últimas décadas, el modelo ha suscitado la atención de los investiga de agricultura basada en el enfoque de la dores. Los mecanismos utilizados para Revolución Verde, ha estado asociado a tomar estas decisiones son complejos y un uso intensivo de insumos (plaguicidas,- multicausales y han sido analizados por fertilizantes, entre otros) que, aunque algunas corrientes de pensamiento que lo- impactosha permitido negativos un aumento en aspectos de la sociales,produc atribuyen a diferentes causas. - tividad y rentabilidad, generó importantes En un extremo, los deterministas (u obje- tivistas) afirman que las acciones de los agri ambientales y económicos (1, 9, 15, 17, 35). agentescultores pasivos,son condicionadas sin capacidad por de las reacción estruc Por el contrario, una agricultura anteturas, esos y percibencondicionantes a los externosagricultores (13). como sustentable busca conservar los recursos naturales y preservar la integridad del ambiente en el ámbito local, regional y En el otro extremo, los conductistas global; y es a su vez, cultural y socialmente (o subjetivistas), afirman que los aceptable; y económicamente viable (39). agricultores son activos, y pueden tomar

204 Revista de la Facultad de Ciencias Agrarias Factores contextuales en la adopción de modelos de agricultura insustentables

condicionantes externos (13). decisiones "racionales" libremente sin de producción que varían en el grado de incorporación tecnológica y con procesos Dentro de esta escuela, se podría nombrar históricos y políticos particulares. Pero a Rogers (1962) con su famosa "teoría ello no siempre fue así. Esta realidad es de la difusión de innovaciones". Por su la consecuencia de la modernización parte, Bourdieu (1988) afirma que ambas hortícola representada, principalmente, concepciones no son excluyentes y que, por la incorporación del invernáculo y su además, están relacionadas. Este autor paquete tecnológico. postula que, aún en ámbitos donde la Según García (2014), la incorporación estructura y las reglas son sofocantes, hay del invernáculo comenzó en la década- espacios para la toma de decisiones. Por lo del 80. Hasta ese momento el cinturón tanto, ambas deben ser consideradas. hortícola estaba conformado por agricul En el presente trabajo, se entiende que tores italianos y, en menor medida, por los agricultores son reflexivos, activos y portugueses y sus descendientes. toman decisiones, pero están situados y El perfil de los productores era bastante condicionados por la estructura, el espacio homogéneo, pequeños y medianos con bajas y el tiempo (7). Por ello, se asume que, en inversiones de capital y con producción el proceso de toma de decisiones sobre diversificada (3). Sin embargo, el invernáculo la tecnología a utilizar, se ponen en juego empezaba a incorporase en forma incipiente, factores individuales y factores contextuales con un manejo muy similar al realizado al aire (5, 20, 46). En relación con las variables libre. También, hubo escasa asistencia técnica contextuales, se pueden citar las de tipo desde organismos públicos y privados. económicas (22, 25, 26, 33, 42), científico- En la década del 90, se expandió técnicas (14, 38, 44), políticas (23, 30) fuertemente su superficie, liderada por y sociales (24). A su vez, estos factores agricultores de origen europeo o sus contextuales exigen un estudio localizado descendientes. Además, ocurrieron grandes porque pueden influir de forma diferente migraciones de trabajadores de Bolivia para según las particularidades de cada región. el sector hortícola, cumpliendo el papel Uno de los aspectos que genera de peones o medieros. En esta década, el más interés en el logro de modelos de sector hortícola platense profundiza la producción más sustentables es que, a incorporación tecnológica del invernáculo, pesar de que existe un consenso en varias transformando a La Plata en el cinturón instituciones sobre la necesidad de lograr hortícola más tecnificado del país (20). nomodelos necesariamente que mejoren va laen sustentabilidad, esta dirección. La incorporación del cultivo bajo la toma de decisiones de los agricultores- decobertura semillas plástica de alto modificópotencial radicalmente de rendimiento, los sistemas productivos, a través de la utilización Este es el caso de lo ocurrido con la incor poración del invernáculo en la región antitrips,mayor uso entre de agroquímicos, otros (41). equipos de riego hortícola de La Plata, Argentina. localizado, fertirriego, polietilenos y mallas El Cinturón Hortícola Platense (CHP), territorioubicado en donde la provincia coexisten de variasBuenos territo Aires,- La complejidad del manejo de los Argentina, puede ser entendido como un- cultivos bajo invernáculo fue creciendo, lo tores de diversos orígenes, con sistemas que generó que el asesoramiento técnico rialidades (35) representadas por agricul se transformara en un insumo más del paquete tecnológico (20).

Tomo 50 • N° 1 • 2018 205 M. L. Blandi, R. M. Rigotto, S. J. Sarandón

- Con las políticas neoliberales de los- El cultivo bajo invernáculo, a pesar años 90, los organismos del estado retra de ser más rentable que el cultivo al aire estejeron período, sus intervenciones, la expansión tomando de las cadenasprepon libre, afecta de una forma más acentuada derancia el asesoramiento privado (20). En las dimensiones ecológica y social de la sustentabilidad. En este sentido, bajo de supermercados, tuvo un impacto en invernáculo, se utilizan varias prácticas la estructura general de circulación y intensivas de manejo, que impactan de distribución de los productos hortícolas, manera más agresiva sobre los recursos desplazando el poder de negociación naturales y sociales, en comparación con hacia las etapas finales, otorgándole al las prácticas utilizadas en los cultivos al supermercado un peso decisivo (21). aire libre (6). A partir del año 2002 con la pos Tanto el INTA (Instituto Nacional de devaluación, muchos agricultores tecnología Agropecuaria) (2005) como abandonaron la actividad, debido a los EMBRAPA (Empresa Brasileira de Pesquisa vaivenes del mercado y a la recesión Agropecuária) (2006), han reconocido económica, generando un aumento en la la necesidad de pasar de una agricultura disponibilidad de tierras y, consecuente, altamente dependiente de insumos, a depreciación del valor de la renta. En otra basada en tecnologías de procesos- este contexto, fueron los agricultores de ecológicos que sea más sustentable. Para nacionalidad boliviana quienes continuaron ello, el INTA ha creado el Instituto de Inves con la incorporación del invernáculo. Esto tigación y Desarrollo Tecnológico para la fue posible porque la población boliviana Agricultura Familiar (IPAF) y el EMBRAPA ya representaba una gran proporción de ha desarrollado numerosos programas y la mano de obra mediera, y gracias a su proyectos que incentivan la Agroecología. autoexplotación del trabajo y ahorro, se Sin embargo, se presume que los convirtieron en productores arrendatarios factores contextuales de la región no se han e invirtieron en invernáculos. adecuado para favorecer estos objetivos. Actualmente, aunque las condiciones Además, la diversidad cultural que hay en el contextuales sean diferentes, todavía su territorio, lleva a pensar que tal vez, existan adopción continúa en pleno apogeo por- diferencias en el impacto de los factores este mismo agricultor. Según un informe contextuales sobre los agricultores. del Consulado Boliviano, el 85% de los agri- Según Bédard (2005), existen cultores del Cinturón Hortícola Platense- diferencias entre la visión occidental son bolivianos (12). En cuanto a la super (o sociedad moderna) y la andina. ficie con invernáculos, el Censo Hortiflo Mientras que para la primera el ser rícola (10) arroja que La Plata cuenta con humano es el centro del universo, para el 30% de su superficie bajo esa tecnología; la segunda, el hombre se ubica en una sin embargo, a través de estimaciones, se relación de horizontalidad con el resto piensa que ya supera el 75% (43). de la naturaleza. Si bien los agricultores Estos cambios en la manera de bolivianos aprendieron a cultivar de forma producir, hicieron que, en general, la “comercial” en La Plata, conllevando una horticultura de La Plata avanzara hacia pérdida de características netamente sistemas menos sustentables (4). condicióncampesinas, intermedia,se podría conpensar identidad que este actor social se encuentra en una

206 Revista de la Facultad de Ciencias Agrarias Factores contextuales en la adopción de modelos de agricultura insustentables

Metodología porosa: "horticultor capitalista con rasgos campesinos" ya que, siendo agricultores, todavía conservan algunas características Se trabajó en el Cinturón Hortícola de campesinas, como el aporte del trabajo La Plata (CHP), provincia de Buenos Aires, físico y el papel decisivo de la mano de que cuenta con una alta heterogeneidad obra familiar (19). de agricultores en cuanto a nacionalidad, Entender entonces las razones que grado de capitalización,et al organización social llevaron a los agricultores a adoptar un del trabajo y canales de comercialización. modelo tecnológico menos sustentable es Con base en Hang . (2010) se realizó entonces un desafío a encarar a fin de diseñar la clasificación de agricultores que se estrategias adecuadas en este sentido. encuentra en la tabla 1. Se entrevistaron, El objetivo del trabajo es analizar la como estudio de caso, a agricultores hasta influencia de los factores contextuales que las entrevistas no aportaran nueva (económico, técnico, y político) en la información (16). Como resultado, se adopción de la tecnología del invernáculo entrevistaron a 4 de cada grupo descripto de las diferentes territorialidades del a continuación, resultando un total de 16. Cinturón Hortícola Platense.

Tabla 1. Table1. Caracterización de los grupos de agricultores entrevistados del CHP.

CharacterizationAgr. origen of the groupsAgr. origen of farmers Agr.interviewed origen by theAgr. CHP. origen boliviano que europeo que europeo que boliviano que cultivan bajo cultivan bajo cultivan al aire cultivan al aire invernáculo invernáculo libre libre Sistema de producción Invernáculo Invernáculo Aire libre Aire libre Origen

Tenencia de la Bolivia Europeo Europeo Bolivia tierra Alquila Propia FamiliarPropia Pago canon anual Familiar complementada, complementada, a Familiar Mano de obra a veces, con veces, con socios Asalariada y mediero familiar Mercados Mercados concentradores concentradores, Comercialización mercados Culataconcentradores de camión* concentradoresQuinta y y mercados y venta directa a culata de camión, supermercados ferias

*Culata de camión: modalidad de venta donde el intermediario compra las verduras directamente en la quinta, pactando cantidad y precio en el momento. *Culata de camión: sale mode where the intermediary buys vegetables in the farm, agreeing quantity and price at the time.

Tomo 50 • N° 1 • 2018 207 M. L. Blandi, R. M. Rigotto, S. J. Sarandón

Relevamiento y análisis de la información discursivo acumulado en cada categoría y se organizaron de una forma argumental Se realizaron en promedio 4 visitas y narrativa (28, 32). Se complementó el a cada agricultor en sus fincas, de una análisis con una búsqueda bibliográfica duración de entre 1 hora y 1 hora y media- sobre el tema. por visita. La información a campo fue Resultados relevada partir de entrevistas en profun didad (31). Para utilizar esta técnica, se realizó un guión de entrevista con los temas a tratar por el entrevistador. En A continuación, se muestra un cuadro ningún caso hubo preguntas cerradas o resumen (tabla 2) sobre las principales- con opciones de respuesta para elegir. diferencias encontradas en los factores Luego, las mismas fueron desgrabadas contextuales de diferentes grupos de agri en su totalidad. Para su análisis, se cultoresMercado del CHP. siguieron los lineamientos de Minayo (2012) y Huberman y Miles (1994). Se realizaron varias lecturas de las En esta categoría todos los grupos de transcripciones, con el objetivo de agricultores coincidieron en relación con la delimitar fragmentos textuales según las incertidumbre que tiene la actividad. Los categorías descriptas a continuación: agricultores aclararon que nunca saben a qué - Dimensión económica (mercado) precio se va a vender la mercadería. Además, - Científico-técnica relataron que cuando los compradores se (asesoramiento técnico) ejercidaenteran quepor fuelos cultivadacompradores al aire en libre relación la pagan con - Dimensión Política (políticas públicas) menos. También, remarcaron la presión Los fragmentos fueron agrupados interpretaciónde forma manual se centraron en suen elcategoría material la calidad cosmética de los productos, tanto correspondiente. Luego, el análisis e en los mercados concentradores, a través de consignatarios y en la venta directa. Tabla 2.

Principales diferencias entre los factores contextuales en agricultores de Table 2. diferentes grupos del CHP. Main differences between Airecontextual libre factors in farmers of Invernáculodifferent CHP groups.

Mercado Agr. europeo- Agr. boliviano- Agr. europeo-- Agr. boliviano------

Asesoramiento técnico -- + -- -- Políticas

+: aspecto que favorece la adopción de modelos más sustentables; - : aspecto que no favorece la adopción de modelos más sustentables. El número de símbolos representa la intensidad con que ese aspecto influye en los agricultores. +: aspect that favors the adoption of more sustainable models; - : an aspect that does not favor the adoption of more sustainable models. The number of symbols represents the intensity with which that aspect influences the farmers.

208 Revista de la Facultad de Ciencias Agrarias Factores contextuales en la adopción de modelos de agricultura insustentables

Por último, los agricultores resaltaron La mayoría de los agricultores de que la mercadería tiene que estar origen boliviano con invernáculos, vende- visualmente perfecta, con color homogéneo su mercadería a "culata de camión" desde y brillante, sin ningún tipo de marca o su quinta, y aclararon sobre la nece picadura, ya que todo es excusa para sidad de utilizar pesticidas para que los disminuir el precio. productos tengan mejor color, brillo y Además, se registraron las siguientes tamaño, de lo contrario tendrían que diferencias entre los grupos: venderlosAsesoramiento más baratos. técnico Algunos de los agricultores de origen europeo que cultivan al aire libre, venden parte de sus productos directamente a los Los agricultores europeos que cultivan consumidores, y aclararon que ese público al aire libre resuelven sus dudas en busca el sabor. Además, los clientes las casas de venta de agroquímicos en reconocen que la verdura rinde más. situaciones muy puntuales. Resaltaron Los agricultores de origen boliviano- otrasla gran empresas presión eque ingenieros estas ejercen agrónomos. en la que cultivan al aire libre, venden parte construcción de invernáculos, junto con de su mercadería en la quinta a consumi dores interesados por una alimentación Además, afirmaron que actualmente no se más sana y se mostraron esperanzados fomenta el cultivo al aire libre. en relación con el futuro de la agricultura Según“(hablando como lode expresópesticidas) un en agricultor las agro- alde mercadobaja utilización concentrador de insumos, pero o tienende la químicasde origen (…) europeo, se vende así,que como cultiva si fuera, al aireque agricultura orgánica. El resto, la envían selibre: yo, caramelo, mucha gente (…) si tiene un problema va al vendedor, le dice tomá, muchos problemas para ubicarla. echale esto y punto (…) en las agroquímicas Según"Una como vez llevélo expresó una jaula un deagricultor acelga, favorecen el comercio, ese de hacer inverna- estede origen es orgánico, boliviano, llevate, que le decíacultiva yo alque aire es deros, porque es más consumidor de insumos orgánico,libre: no tiene nada de químico, ah, yo que el campo (…) es una horticultura no conozco de eso, dame de aquel (…) en plastificada (…) hay una gran presión de el mercado no lo ven (…) si yo tengo una empresas, los ingenieros que se enganchan verdulería tengo que tener cosas buenas, (…) no tenés la otra cara, de fomentar el aire brillosas, tenga el químico que tenga (…) si libre (…) está todo muy fogoneado.” va fea no lo voy a vender."

Agregaron que actualmente tanto los Los agricultores de origen europeo puesteros de los mercados como algunas- vendenque cultivan en los bajomercados invernáculo concentradores. realizan empresas de venta de insumos para armar venta directa con supermercados y/o invernáculos, ofrecen préstamos infor males para aquellos agricultores que- Afirmaron que para obtener un buen quieran instalar invernáculos. precio, la mercadería debe adecuarse a- Los agricultores de origen boli los parámetros de calidad establecidos. viano al aire libre, coincidieron en que También resaltaron que trabajan gene la casa de venta de agroquímicos ayuda demandenrando marcas, la quemercadería hay que imponerlaspara poder y y asesora bien, porque los que trabajan- negociarque la estrategia el precio. es que los compradores son ingenieros, ofreciendo varios tipos de productos, de acuerdo con la disponibi lidad económica de cada agricultor. Tomo 50 • N° 1 • 2018 209 M. L. Blandi, R. M. Rigotto, S. J. Sarandón

Aunque algunos agricultores remar cultores de origen boliviano que cultivan caron que los vendedores de insumos al aire libre, hace unos años, recibieron sontambién tan necesarios. "hacen su negocio", intentando apoyo de un técnico del Estado para vender varios productos que a veces no cultivar sin el uso de pesticidas. Además, han tomado algunos subsidios estatales y Todos los agricultores de origen microcréditos que invirtieron en mejoras europeo que cultivan bajo invernáculos productivas y comerciales fomentando afirmaron que el papel del ingeniero es manejos más sustentables. muy importante, principalmente en lo que Discusión se refiere a pesticidas y fertilizantes; ya que, frecuentemente, es preciso cambiar de pesticidas para que las plagas no se conviven diversas territorialidades, repre- acostumbren. Coincidieron en que es- En el Cinturón Hortícola Platense necesario contar con un técnico para "hacer las cosas bien" y lograr sus obje sentadas por los grupos de agricultores tivos, principalmente más rendimiento entrevistados, que son el resultado del por hectárea. Demostraron tener amplia impacto de la modernización tecnológica.- confianza en el técnico. Tal como lo afirma Bourdieu (1991), la Según como"Con lo expresóbastante un frecuenciaagricultor estructura, el tiempo y el espacio condi consultamos,de origen europeo,cuando vinieron que cultiva los inverna bajo- cionan las decisiones de los agricultores, derosinvernáculo: tuvimos que entrar a la parte práctica y ello se puede notar en el análisis de con la parte del ingeniero (…) para hacer cómo los factores contextuales influyeron las cosas bien y buscar más rendimiento en la adopción de una tecnología por hectárea (…) se apunta fuerte a eso". (la del invernáculo) menos sustentable a pesar del interés supuesto de ir hacia- sentadaotro modelo. por En loseste sentido,diversos la dimensiónmercados Los agricultores de origen boliviano con económica fue la que más influyó, repre invernáculos afirmaron que consultan en las agroquímicas con mucha frecuencia, porque creados en torno a la actividad hortícola- son atendidas por ingenieros y tienen (figura 1, pág. 211). mucho conocimiento en lo que respecta Tanto el mercado de los insumos (agro- a nuevos productos, dosis, periodos de vieronquímicos, constantemente semillas, plásticos, presentes entre enotros) los curación, entre otros, y afirmaron que como los mercados de consumo, estu siempre escuchan sus consejos. Según como"(consulto) lo expresó cuando un agricultor uno se relatos de los agricultores, demostrando su- encuentrade origen másboliviano, complicado, que cultivaporque bajopor gran influencia. ahíinvernáculo: estás curando y no le estás dando en En la economía neoliberal, el creci la tecla, curás y ves que no paró la enfer- miento económico queda librado a medad o la peste". las fuerzas del mercado, quien busca favorecer el capital por sobre la sociedad Políticas y la naturaleza (34). Esto se debe a que predomina una visión antropocéntrica - donde la naturaleza está al servicio Los agricultores no reconocieron del hombre y es vista como una fuente políticas de apoyo al sector. Solo los agri inagotable de recursos (34).

210 Revista de la Facultad de Ciencias Agrarias Factores contextuales en la adopción de modelos de agricultura insustentables

Los círculos alrededor del Cinturón Hortícola Platense simbolizan las dimensiones contextuales, donde su tamaño indica la importancia relativa en el proceso de modernización. Las flechas curvas indican la interacción entre el territorio y las dimensiones contextuales, y las rectas, expresan la interacción entre ellas. Circles around the Horticultural Platense Region symbolize the contextual dimensions, where its size indicates the relative importance in the modernization process. The curved arrows indicate the interaction between the territory and the contextual dimensions, and straight express the interaction between them. Figura 1

. Los molinos representan las diferentes territorialidades que se formaron a Figure 1. partir de la llegada del invernáculo y su paquete tecnológico. The mills represent different territorialities that formed from the arrival of the greenhouse and it technological package.

principalmente relacionados con los Por otra parte, los costos ocultos o mercados existentes y creando mercados externalidades no son tenidos en cuenta al no tener un precio de referencia. Por ello insumos del invernáculo)et al. (2014) para las reproducir empresas se prioriza la ganancia sobre los daños esa forma de agricultura industrial. ecológicos y sociales. Desde la década del Según Seibane - 90 en el CHP el sector privado promovió el que producen las semillas y los agroquímicos invernáculo y todo un paquete tecnológico cuentan con una gran presencia en el terri asociado. Fue así que se fueron creando torio, organizando ensayos a nivel local y varios mercados (aprovechando los demostraciones para difundir sus productos. Tomo 50 • N° 1 • 2018 211 M. L. Blandi, R. M. Rigotto, S. J. Sarandón

La adopción de una tecnología insumo Los resultados presentados en este dependiente se ve favorecida, además, trabajo confirman que, en ausencia porque, tanto los puesteros de los mercados de otros factores, el mayor peso de la como algunas empresas de venta de insumos dimensión económica subordinó las otras- para armar invernáculos, ofrecen préstamos dimensiones favoreciendo una elección “informales” para aquellos agricultores que económicamente rentable pero insus quieran instalar invernáculos, tal como lo tentable en otras dimensiones. afirmaron los agricultores entrevistados en La dimensión técnico-científica fue este trabajo y en concordancia con Cieza también afectada por la prevalencia (2012), quien agrega, que estos préstamos del factor económico, induciendo a tienen altas tasas de interés. la propia ciencia a generar técnicas Se encontró que los mercados rentables pero ecológica y socialmente concentradores y los consignatarios incorrectas (6, 38) (figura 1, pág. 211). influyen con distinta intensidad según Esto se debe a que tradicionalmente los el tipo de agricultor. Ejercen una mayor profesionales de las Ciencias Agrarias influencia en los agricultores que cultivan han sido formados de acuerdo con un bajo invernáculo, porque son la principal modelo agrícola productivista, basado en vía de comercialización (hegemónica), y una intensa mecanización agrícola, un uso tienen una menor influencia en algunos creciente de agroquímicos y variedades agricultores/as que cultivan al aire libre, mejoradas de cultivos (36). Por lo tanto, porque estos, además de vender en los no es de extrañar que reproduzcan, en la grandes mercados participan en ferias o investigación y extensión, el mismo estilo tienen venta directa desde sus quintas. de agricultura con el que fueron formados. Es importante resaltar que esta Según los agricultores entrevistados, modalidad de venta es solo un nicho los ingenieros que los asesoran y/o los que comercial, para satisfacer a una pequeña trabajan en las casas de insumos tienen parte de los consumidores. mucho conocimiento sobre la actividad y Muchas veces, para el presente trabajo, son muy respetados, principalmente en lo los agricultores señalaron las grandes que se refiere a pesticidas y fertilizantes. presiones que los intermediarios de la Este avance tecnológico ha generado comercialización ejercen para que logren un alejamiento del agricultor respecto obtener un producto según los "estándares de su sistema productivo, haciendo que de calidad", que son, principalmente, el dependa menos de su conocimiento color y tamaño homogéneo, sin marca y más de las tecnologías de insumos ni mancha de ningún tipo, ya que todo produciendo un quiebre en la relación es excusa para disminuir el precio. Estas dependenciaentre la cultura (45). y el manejo de los recursos, características también son incentivadas generando una erosión cultural y una gran por los medios de comunicación al utilizar varias dependencias, en relación con: semillas, "la belleza cosmética"et de al las. (2014), verduras para en Específicamente, se pueden enumerar- sus propagandas. Sin embargo, tal como lo afirman Marasas fertilizantes, pesticidas, invernáculos, cono obtener ese tipo de producto se debe cimiento técnico-científico, traduciéndose en utilizar una gran cantidad de pesticidas, una mayor subordinación al mercado (34). actividad compatible con la producción bajo invernáculo.

212 Revista de la Facultad de Ciencias Agrarias Factores contextuales en la adopción de modelos de agricultura insustentables

En este trabajo se confirmó que las casas En la figura 1 (pág. 211) se lleva a cabo de venta de agroquímicos ejercen una gran etuna al .representación (2014). gráfica de la situación influencia sobre los agricultores, ya que se analizada, sobre la base de Marasas encuentran en permanente contacto con ellos, brindándoles información técnica En los últimos años, algunas continua y los insumos necesarios. Este dimensiones han comenzado a influenciar vínculo es particularmente fuerte con los la adopción de modelos más sustentables. agricultores bolivianos con invernáculo ya Desde la dimensión política, el Estado que no consiguen pagar un asesor privado. empezó a tener presencia en el territorio. Se pudo percibir, además, un "mercado del- Entre sus estrategias de desarrollo se asesoramiento técnico", donde el técnico destacan el programa de extensión rural (asesor privado) cumple un papel funda llamado Cambio Rural, perteneciente al mental para los agricultoress que cultivan INTA, que si bien fue creado en la década bajo invernáculo de origen europeo. del 90 con un rol técnico, a partir de la En concordancia con Selis (2012), última década incorporó aspectos sociales se encontró que los técnicos también y organizativos. Las articulaciones entre promueven la incorporación del el Ministerio de Agricultura de la Nación invernáculo con especial énfasis en el y el Municipio de La Plata a través del rendimiento, aspecto que ya ha sido programa del periurbano; y el Ministerio señalado como una de las características de Asuntos agrarios de la Provincia de del modelo productivista y una de las Buenos Aires y el SENASA con charlas principales dificultades para avanzar hacia sobre buenas prácticas agrícolas (40). - modelos más sustentables (36). Estos datos mentarEs importante políticas paradestacar crear el condiciones gran papel confirman la necesidad de un cambio en que cumple el Estado a la hora de imple este sentido. Los relatos de los agricultores confirman lo dicho por García (2014), económicas, fiscales (como reducción quien afirma que con la complejización del de impuestos u otorgar subsidios) y de cultivo bajo invernáculo, el técnico resultó mercado que favorecen el avance hacia general,un “insumo” coinciden más del con paquete lo encontrado tecnológico. por sistemas de producción sustentables (30). Los relatoset al. (2014),de los enagricultores, relación conen En ese sentido, algunos agricultores - reconocieron que en los últimos años, con Seibane el apoyo de algunas instituciones públicas, que el sector privado promueve la incor se lograron formar cooperativas y grupos poración del invernáculo junto con su de agricultores. paquete tecnológico. Desde la dimensión científico- La dimensión política también quedó académica, se está comenzando a reconocer subordinada a los intereses económicos, que la incorporación de la problemática del porque durante la década del 90 el manejo sustentable de agroecosistemas, Estado prácticamente no tuvo injerencia implica un nuevo paradigma, una nueva sobre el territorio, dejando que el sector concepción de la relación del hombre con privado se ocupara del "desarrollo" de la la naturaleza, donde se permita cambiar región (figura 1, pág. 211). Este hecho se el objetivo productivista y cortoplacista confirma en las entrevistas realizadas, ya por uno sustentable a largo plazo: que los agricultores no hicieron referencia deecológicamente ello es la incorporación adecuado, económicamente de la materia al Estado y no reconocieron políticas de viable y socialmente más justo (38). Prueba apoyo al sector. Tomo 50 • N° 1 • 2018 213 M. L. Blandi, R. M. Rigotto, S. J. Sarandón

Conclusiones de varias Universidades. Agroecología en las currículas académicas - mientoActualmente en el territorio la incorporación (19). Se reconoce del Los resultados del trabajo demuestran invernáculo continúa en pleno creci cómo los factores contextuales pueden- - ejercer grandes presiones para que los que el vínculo entre el sector privado, agricultores opten por incorporar inno a través de las casa de venta de agro vaciones tecnológicas no sustentables. químicos, y los agricultores todavía es Se considera que para revertir esta lamuy región" fuerte. se Fueron dejó en décadas manos ('80del mercado,y '90) de situación y avanzar hacia sistemas más exclusiva relación donde el "desarrollo de sustentables es necesario cambiar la visión de algunos agricultores, de ámbitos donde se superpusieron sus intereses científicos-académicos, de los mercados sobre la naturaleza y la sociedad. Sin y principalmente del Estado, ya que embargo, a partir del 2002, se visualiza un puede propiciar las condiciones para Estado que, en sus diversas formas, está que ello suceda. Por último, y no menos retomando su presencia y puede jugar importante, se encuentra la sociedad, un papel decisivo en un real "desarrollo" quien debería tomar conciencia que la sustentable, dando contención a aquellos producción de los alimentos es un proceso- menosagricultores importante, que por sería diversas interesante razones iden no- complejo y asumir la responsabilidad de han adoptado la tecnología. Además, y no exigir alimentos que se cultiven preser vando la calidad de vida y el equilibrio del resistirtificar y aprofundizar las presiones las del razones contexto. "internas" medio ambiente. de estos agricultores/as que han podido

Bibliografía

1. Andrade, F. 2011. La tecnología y la producción agrícola. El pasado y los actuales desafíos. Balcarce, Ediciones INTA. 42 p. 2. Bédard, L. 2015. El ecologismo de la cosmovisión andina. Tinkuy boletín de Investigación y Debate. 22: 116-125. 3. Benencia, R. 2002. Transformaciones territoriales en la horticultura periurbana bonaerense en los últimos 50 años. El papel de la tecnología y la mano de obra. En: XIII Economic History Congress. Buenos Aires, Disponible en: http://eh.net/XIIICongress/cd/ papers/52Benencia447.pdf 4. Blandi, M. L. 2016. Tecnología del invernáculo en el Cinturón Hortícola Platense: análisis de la sustentabilidad y los factores que condicionan su adopción por parte de los productores. Tesis doctoral. Facultad de Ciencias Agrarias y Forestales. UNLP. 303 p. Disponible en: http://hdl.handle.net/10915/52015. 5. Blandi, M. L.; Paleologos M. F.; Sarandón, S. J.; Veiga, I. 2013. Identificación de impedimentos para avanzar hacia una "conducta sustentable" en pequeños horticultores de La Plata, Argentina. Revista Cuadernos de Agroecología. 8(2). 5 p. 6. Blandi, M. L, Sarandón S. J.; Flores C. C.; Veiga, I. 2015. Evaluación de la sustentabilidad de la incorporación del cultivo bajo cubierta en la horticultura platense. Revista de la Facultad de Agronomía de La Plata. 114(2): 251-264. 7. Bourdieu,127-142. P. 1991. El sentido práctico. Madrid: Taurus. 227p. 8. Bourdieu, P. 1988. Espacio social y poder simbólico, en: Cosas Dichas, Buenos Aires, Gedisa.

214 Revista de la Facultad de Ciencias Agrarias Factores contextuales en la adopción de modelos de agricultura insustentables

9. Caporal, F. R. 2009. Em defesa de um plano nacional de transiçao agroecológica: Compromisso com as atuais e nosso legado para as futuras geraçoes. Brasilia. 35 p. 10. Censo Hortiflorícola de la Provincia de Buenos Aires. 2005. Gobierno de la Provincia de Buenos Aires. Ministerio de Economía, Dirección Provincial de Estadística. Ministerio de asuntos Agrarios, Dirección Provincial de Economía Rural. 115 p. 11. Cieza, R. 2012. Financiamiento y comercialización de la agricultura familiar en el Gran La Plata. Estudio en el marco de un proyecto de desarrollo territorial. Mundo Agrario. 12(24): 18 p. 12. Cieza, R. I.; Ferraris, G.; Seibane, C.; Larrañaga, G.; Mendicino, L. 2015. Aportes a la caracterización de la agricultura familiar en el Partido de La Plata. Revista de la Facultad de Agronomía, La Plata. 114(3): 129-142. 13. Corcuff, P. 2001. As Novas Sociologias: construções da realidade social. São Paulo: Edusc. 205 p. 14.15. Darnhofer, I.; Schneeberger, W.; Freyer, B. 2005. Converting or not converting to organic farming in Austria: farmer types and their rationale. Agriculture and Human Values. 22: 39-52. Durán, A.; Paris, M.; Maitre, M. I. Marino, F. 2016. Diagnóstico ambiental en la zona del cinturón hortícola de la ciudad de Santa Fe. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 48(1): 129-143. 16. Eisenhardt, K.M. 1989. Building theories from case study research. Academy of Management Review. 14(4): 532-550. 17. EMBRAPA (Empresa Brasileira de Pesquisa Agropecuária). 2006. Marco referencial em Agroecología. Grupo de trabajo em agroecología. Brasilia. 74 p. Disponible en: www. embrapa.br/publicacoes/transferencia/marco_ref.pdf/view . 18. FAO (Organización de las Naciones Unidas para la Alimentación y la agricultura). 2007. El medio ambiente y la agricultura. Comité de Agricultura. 16 p. Disponible en: www.fao.org 19. Garcia, M. 2011. Proceso de acumulación de capital en campesinos. El caso de los horticultores bolivianos de Buenos Aires (Argentina). Cuadernos de desarrollo rural.v 8(66): 47-70. 20. García, M. 2014. Crítica al enfoque clásico de innovación tecnológica: Estudio de caso del invernáculo en el Cinturón Hortícola Platense. Geograficando. 10 (1). Disponible en:http://www. geograficando.fahce.unlp.edu.ar/article/view/GEOv10n02a01. Último acceso: 15 de marzo de 2015. 21. Garcia, M., Hang, G. 2007. Impacto de la devaluación de principios de 2002 en el Cinturón Hortícola Platense. Estrategias tecnológicas adoptadas, sus resultados y consecuencias. Mundo agrario. 8(15). 22. Garrido-Fernandez, F. E. 2006. Los agricultores como actores de la política agroambiental. Un enfoque multidimensional. Revista de Sociología. 81: 37-62. 23. Gonzales Figueroa, R.; Gerritsen, P.R.W.; Maliscke, T.K. 2007. Percepciones sobre la degradación ambiental de agricultores orgánicos y convencionales en el Ejido la ciénega, municipio del Limón, Jalisco, México. Economía, Sociedad y Territorio. 7(25): 215-239. 24. Guillou,26(3): E. M.; 227-235.Moser, G. 2006. Commitment of farmers to environmental protection: From social pressure to environmental conscience. Journal of Environmental Psychology.

25. Guzmán Casado, G. I.; Alonso Mielgo, A. M. 2007. La investigación participativa en agroecología: una herramienta para el desarrollo sustentable. Ecosistemas. 16(1): 24-36. 26. Hang, G.; Seibane, C.; Larrañaga, G.; Kebat, C.; Bravo, M. L.; Ferraris, G.; Otaño, M.; Blanco, V. 2007. Comercialización y consumo de tomate en La Plata, Argentina. Un enfoque mediante el análisis de la cadena agroalimentaria. Bioagro. 19(2): 99-107. 27. Hang, G.; Kebat, C.; Bravo, M. L.; Larrañaga, G.; Seibane, C.; Ferraris, G.; Blanco, V. 2010. Identificación de sistemas de producción hortícola en el partido de La Plata, Provincia de Buenos Aires, Argentina. Bioagro. 22(1): 81-86. 28. Huberman, A. M.; Miles, M. B. 1994. Data management and analy sis methods. En Denzin NK & YS Lincon. Handbook of Qualitative Research. Thousand Oaks, CA: Sage. 428-444. 29. INTA (Instituto Nacional de Tecnología Agropecuaria) (2005) Programa Nacional de investigación y desarrollo tecnológico para la pequeña agricultura familiar. Documento base.

Tomo 50 • N° 1 • 2018 215 M. L. Blandi, R. M. Rigotto, S. J. Sarandón

30. Marasas, M.; Blandi, M. L.; Dubrovsky Berensztein, N.; Fernandez, V. 2014. Transición agroecológica de sistemas convencionales de producción a sistemas de base ecológica. Características, criterios y estrategias. En: Agroecología: bases teóricas para el diseño y manejo de agroecosistemas sustentables. SJ Sarandón & CC Flores editores. La Plata. Editorial de la Universidad de La Plata. Capítulo 15: 411-436. 31. Marradi, A.; Archentti, N; Piovani, J. 2007. Metodología de las Ciencias Sociales. Buenos Aires. Emecé.17(3): 621-626. 328 p. 32. Minayo, M. C. 2012. Análise qualitativa: teoria, passos e fidedignidade. Ciência & Saúde Coletiva.

33. Piazza Recena, M. C.; Caldas, E. D. 2008. PercepÇao de risco, atitude e práticas no uso de agrotóxicos entre agricultores de Culturama. MS. Revista Saúde Pública 42(2): 294-301. 34. Porto Goncalves, C. W. 2006. El desafío ambiental. Programa de las Naciones Unidas para el medio ambiente. México. 153 p. 35. Porto Goncalves, C. W. 2012. A ecologia política na América latina: reapropiação social da natureza e reinvenção dos territórios. INTERthesis. 9(1): 16-50. 36. Pretty, J. 2003. Agroecology in developing countries: the promise of a sustainable harvest. Environment: Science and Policy for Sustainable Development, 45(9): 8-20. Disponible en: http://dx.doi.org/10.1080/00139150309604567. 37. Rogers, E. 1962 Diffusion of innovations. Nueva York: The Free Press. 4° edición. 51 p. 38. Sarandón, S. J. 2008. La agroecología en la formación de profesionales de la agronomía: una necesidad para una agricultura sustentable. VIII Congreso SEAE, Bullas, Murcia 6pp. 39. Sarandón, S. J.; Flores, C. C.; Gargoloff, N. A.; Blandi, M. L. 2014. Análisis y evaluación de agroecosistemas: construcción y aplicación de indicadores. En: Agroecología. Bases teóricasnet/10915/37280 para el diseño y manejo de agroecosistemas sustentables. Editores: Sarandón, Santiago Javier y Flores, Claudia Cecilia. 375-410 p. Disponible en: http://hdl.handle.

40. Seibane, C. S.; Larrañaga, G.; Kebat, C.; Hang, G.; Ferraris, G.; Bravo, M.L. 2014. Redes para la promoción del desarrollo territorial en el cinturón hortícola platense. Reflexiones y aportes. Mundo Agrario. 15(29). 41. Selis, D. 2012. Análisis de la institucionalidad asociada a los procesos de innovación tecnológica en el sector hortícola del Gran La Plata. Mundo Agrario. 12(24): 25 p. 42. Silva Carvalho, M. L. 2006. As politicas ambientais e os objectivos dos agricultores: o caso dos agricultores do sul de Portugal. XLIV Congresso da Sociedade Brasileira de Economia e Sociologia e Rural Questões Agrárias, Educação no Campo e Desenvolvimento. Livro de Resumos. Disponible en: http://www.sober.org.br/palestra/5/1216.pdf 43. Staviski, A. 2010. Situación de la plasticultura en Argentina. Informe frutihortícola. Abril. Disponible en:nhttp://www.infofrut.com.ar/index.php?option=com_content&view=a rticle&id=1069:plasticultura-en-la-argentina&catid=92:sanidad. Último acceso: 20 de febrero de 2016 44. Tito, G.; Chifarelli, D. 2007. La transición agroecológica de los productores familiares del Parque Pereyra Iraola. Revista brasileira de Agroecología. 1(2): 156-159. 45. Toledo, V. M. 2005. La memoria tradicional: la importancia agroecológica de los saberes locales. LEISA Revista de Agroecología. 20-4: 16-19. 46. Waisman, M. A. 2011. Superando dualismos: trayectorias socio-productivas en el abordaje de las transformaciones en la estructura social hortícola platense. Mundo agrario. 12(23). Agradecimientos

A los agricultores que dedicaron su valioso tiempo para participar del trabajo.

216 Revista de la Facultad de Ciencias Agrarias CollembolanRev. FCA UNCUYO. community 2018. 50(1): structure 217-231. ISSN impreso 0370-4661. ISSN (en línea) 1853-8665.

Change of collembolan (Hexapoda: Collembola) community structure related to anthropic soil disturbance

Cambio de la estructura de la comunidad de colémbolos (Hexapoda: Collembola) en relación con el disturbio antrópico de los suelos

Rosana V. Sandler 1, Liliana B. Falco 1, César A. Di Ciocco 1, Ricardo Castro Huerta 1, 2, Carlos E. Coviella 1

Originales: Recepción: 02/06/2016 - Aceptación: 27/04/2017

Abstract

In order to evaluate the effects of the anthropic impact on the structure of de soil collembolan community, three different soil uses were researched: agricultural fields (AG) (34°53'49with 50 years S, 60°01'09 of continuous W, elev. 60 farming, m) and pastures Navarro entering(34°51’30 the S, 59°12’25 agricultural W, elev. cycle 43 (CG), m), Buenosand naturalized Aires Province, grasslands Argentina. (NG). The study was carried out in fields of Chivilcoy as replicates, with three soil samples per replicate and sample date (10) for a total of 216 For each of the three uses, three fields were selected to family level. Five families were found: Hypogastruridae, Onychiuridae, Isotomidae, Entomobryidae,samples analyzed. and Collembolans Katiannidae. (Hexapoda: Soils were Collembola) also characterized were extracted by means and of identified physical and chemical analyses. The index of degree of change of collembolan diversity was calculated with the biological data. The results show that the biological index of degree of change can detect soil use effects on the collembolan community. Somewhat surprisingly, the index showed that the diversity of collembolans was higher in the high anthropic families respond differently to soil use. The families Hypogastruridae, Onychiuridae, and Isotomidaeimpact site AG,presented followed differences by CG and between lowest in systems. NG. The Therefore, results also collembolan show that collembolan community structure can be a useful tool to assess agricultural practices´ impacts on soil.

Keywords

soil use intensity • collembolans • anthropic impact

1 Universidad Nacional de Luján. Departamento de Ciencias Básicas e Instituto de Ecología y Desarrollo Sustentable. Programa de Ecología Terrestre. Av. Constitución y Ruta 5 (6700). Luján. Buenos Aires. Argentina. [email protected] 2 Escuela de Agronomía. Universidad Católica del Maule. Campus San Isidro. Los Niches. Chile.

Tomo 50 • N° 1 • 2018 217 Rosana V. Sandler et al.

Resumen

Con el objetivo de evaluar el efecto que produce el impacto antrópico sobre la estructura de la comunidad de colémbolos, tres usos diferentes del suelo fueron inves- atigados: cabo en campos campos de de agricultura los partidos (AG) de Chivilcoy con 50 años(34°53'49 de agricultura S, 60°01'09 continua, W, elev. pasturas60 m) y Navarroingresando de laal provinciaciclo agrícola de Buenos (CG) y Aires,campos Argentina. naturalizados Para cada (NG). uno El deestudio los tres fue usos llevado del suelo, tres campos fueron seleccionados como réplicas. Cada muestreo consistió en tres muestras de suelo por réplica y por fecha de muestreo (10) para un total de 216 muestras recolectadas y analizadas. Los colémbolos fueron extraídos de las muestras

Onychiuridae, Isotomidae, Entomobryidae y Katiannidae. Los suelos fueron además e identificados a nivel de familia. Se identificaron cinco familias: Hypogastruridae, el índice de grado de cambio de la diversidad de colémbolos. Los resultados muestran quecaracterizados el índice biológico mediante del análisis grado defísicos cambio y químicos. puede detectar Con los los datos efectos biológicos del uso se del calculó suelo sobre la comunidad de colémbolos. Sorpresivamente, el índice muestra que la diversidad de colémbolos medida a través del índice de grado de cambio es más alta en los

- bolossitios deresponden mayor impacto de manera antrópico diferente (AG), al seguido uso del de suelo. CG y laLas menor familias diversidad Hypogastruridae, en el sitio Onychiuridaede menor impacto e Isotomidae (NG). Los presentaron resultados diferenciasmuestran ademásentre los que usos. las En familias consecuencia, de colém la estructura de la comunidad de colémbolos puede ser una herramienta útil para evaluar el impacto en el suelo de las prácticas agrícolas.

Palabras clave

intensidad de uso del suelo • colémbolos • impacto antrópico Introduction

It is increasingly recognized that invertebrate assemblages, particularly the community structure and composition arthropods (1, 8). may be used as ecological state indicators Some of these methods are based on (11, 14, 18), and the use of biological the information provided by only one taxon information to assess ecological quality is (28), while others are based on a general evaluation of the presence and abundance While several tools have been already of the soil arthropods (6, 11, 48, 53). Even adoptedcurrently anfor active the fielduse ofof research. invertebrate though diversity is a characteristic that community composition and structure as can be used to differentiate ecosystem ecological state indicators in freshwater structure, another important characteristic ecology in both Europe (20, 44, 52), and in - the US (2, 3), the development of these tools dance of its components (13). is lagging behind for terrestrial ecosystems. of a system is the fluctuation in the abun Several authors have proposed new role in the different processes that occur in methods to evaluate soil quality, based on Soil invertebrates play a very significant

the soil, influencing its formation, nutrient 218 Revista de la Facultad de Ciencias Agrarias Collembolan community structure cycles, organic matter decomposition, and soil microstructure (46). They also porosity, aggregates' formation, and water respond to a variety of environmental and retention capacity. Soil structure, can also ecological factors, such as changes in soil be related to the edaphic biota, because forestry and agricultural practices (29). Is in turn well correlated to water retention inchemistry, this context microhabitat that the use conﬁguration, of collembolans and capacitythey increase (45). soil Earthworms specific surface, in particular, which is as indicators of ecological state has been contribute not only to soil structure but recommended by several authors (2, 53). also to soil physical stability (22). In The response of the Collembola addition, each component of the edaphic community to changes in the agricultural practices is wide ranging, but in general the agricultural soils are expected to bycommunities others present has in a the specific system role(32). in its have low species richness, including the specificFurthermore, niche that soil can invertebrate hardly be replacedcommu- disappearance of key functional groups nity composition and structure are (50). In this way, the reduction in biodiversity is usually associated with an and thus, are useful for the development increase of management intensity and a ofstrongly tools for influenced soil quality by assessmentsoil characteristics (4, 17) general reduction in the environmental and soil sustainability (48, 53). heterogeneity (21). The index of degree of The diverse ecosystem services that change developed by Cancela Da Fonseca the edaphic fauna provide play a crucial and Sarkar (1996), integrates abundance role on soil sustainability, and it can have analysis, richness and diversity in a way both direct and indirect impacts on soil that provides an analysis of the structure of sustainability. Direct impacts are those the community, and allows for comparisons between different communities. immediately. Indirect ones include those This study was performed in the providedwhere specific by soil organisms organisms affect participating crop yield in rolling pampas in the Argentine pampean carbon and nutrient cycles, soil structure ecoregion (54), one of the most extensive and productive agricultural regions in the that generate ecosystem services that ulti- world. Since the mid 1970s, this region matelymodification, affect productivity. and food web interactions has suffered an increase in agriculture - the greatest contributors to the loss of biodi- poration of new technology, increased versityAgriculture due to the has large been amount identified of landas one allo of- productionintensification, and characterized changing the useby the of a incor large cated to this practice. Agricultural activities number of hectares from cattle grazing to such as tillage, drainage, crop rotation, agriculture (54). grazing, and the intensive use of pesticides In this context, the objective of this and fertilizers, have all strong effects on the work was to evaluate the degree of change in the structure of the soil collembolan However, reduced or no-tillage systems can community as an indicator of the degree beflora useful and fauna in terms species of found maintaining in the soil native (42). of anthropic impact, under the hypothesis species populations (35). that the anthropic impact of different agri- Collembolans (Hexapoda: Collembola) cultural practices affects the structure are one of the most abundant and varied of the collembolan community lowering groups among soil organisms, playing a diversity and structure when compared to naturalized grasslands. very significant role in nutrient cycling Tomo 50 • N° 1 • 2018 219 Rosana V. Sandler et al.

Material and methods

The study was carried out in and in each replicate 3 random samples were taken each one of the eight sampling 60°01'09 W, 60 m a. s. l.) and Navarro dates. Samplings were performed every (34°51'30fields of S, 59°12'25 Chivilcoy W, (34°53'4943 m a. s. l.), S, three months over a 2 year period, in order to maximize the collembolan abundance The soils of the sampling sites were all and diversity of the samplings. Therefore, typicalBuenos Argiudols, Aires Province, order Argentina Mollisols (figure (52). 1). a total of 216 samples were collected and Three different management systems analyzed. This sample size is similar to the were evaluated: 1) A naturalized grassland number of samples collected in similar - studies in Argentina (7, 26, 28). Samples for the extraction of the collembolans were leastsystem 50 (NG),years; old 2) A and cattle abandoned grazing system grass lands without anthropic influence for at- following Bardgett et al. (1993), and Hutson culture and livestock; and 3) An agricul- andtaken Veitch from (1983) to the who first found 0 to that 5 cm in a of range soil, (CG), fields with mixed history of agri of upland grassland soils, 92 to 98% of Acari intensive agriculture for 50 years and and collembolans were extracted from the undertural system no-tillage (AG), agriculture fields under during constant the upper 0 to 2 cm soil. From these top 5 centi- last 16 years prior to the start of this work. metres, a pooled 150 c3. of an undisturbed For each management system, 3 sample was collected per random sample. different sites were selected as replicates

Source: NationalFigure Geographic 1. Map Institute showing / Fuente: the Institutolocation Geográfico of the sampling Nacional - Repúblicasites. Argentina Figura 1. Mapa con la localización de los sitios de muestreo.

220 Revista de la Facultad de Ciencias Agrarias Collembolan community structure

Upon arrival to the laboratory, collem- For parameters S, n, Hx, and Hy, the bolans were extracted from the soil by variation (V) for any parameter (m) is - calculated as: cient for Collembola extraction than the flotation, since this method was more effi to family level (36). Vm:where: (Em-Cm)/(Em+Cm) BerlesseWith the system data (47) obtained, and later the classifiedindex of the degree of change in the biodiversity, proposed by Cancela da Fonseca and systemm = taken parameters as a reference ẋ, S, n, Hx, or orcontrol Hy Sarkar (1996) was calculated for each soil Cm= value of parameter m of the use, following Cortet et al. (2002), and system to compare to Mazzoncini et al. (2010). Em= value of parameter m of the In order to characterize the studied soils, physical (bulk density, electric -1 when the evaluated environment shows conductivity, and mechanical resistance), and lowerThe diversity index ranges than the from one -1 it isto compared +1, being chemical variables (organic matter content, phosphorus content, total nitrogen, and pH) The behavior of this index was evaluated were analyzed from samples taken at the byto, itsand authors +1 when as wellit is higheras Cortet (15). et al. (2002) same moment and from the same sampling for taxonomic resolutions to order and places as the collembolans. Microbiological higher. For this reason it was considered important to go a step further in this work, bacteria activity) were measured as well. and use this index to collembolans and variables (soil respiration and nitrogen fixing the families within, in the assumption that Statistical analysis a lower taxonomic level could provide a Physical and chemical characterization better detail of the effects of anthropic With the physical and chemical variables, activities on soil communities. a discriminant analysis was performed to determine how these variables characterize Abundance the different environments. A Kruskall-Wallis test was carried out for the abundance of each one of the collembolan Index of degree of change of the diversity families present between environments. of ecological systems For the calculation of the degree of Results this formula was used following Cancela dachange Fonseca of the diversityand Sarkar (Δ) between(1996), sites,and Physico-chemical characterization Cortet et al. (2002): Data on the physico-chemical variables measured are shown in table 1 (page 222).

Δwhere: = [V( )+V(S)+V(n)+V(Hx)+V(Hy)] ẋ shows a clear separation between the two The discriminant analysis (figure 2, page 223) group ẋ = mean abundance of the taxonomic electricanthropized conductivity systems (CG(EC), and pH, AG) mechanic and the resistancenatural environment (MR), bulk (NG), density given by(BD), a higher and S = number of taxonomic groups microbiological acetylene reduction activity n = number of sample-units Hx= group index of diversity (γ) Hy= Shannon index of diversity (ARA) in NG. Tomo 50 • N° 1 • 2018 221 Rosana V. Sandler et al.

Table 1. Physical, chemical, and microbiological variables. Tabla 1.

Sites Parameter VariablesMethod físicas, químicas y microbiológicas. NG CG AG P (ppm) Kurtz y Bray OM (%) Walkey-Black 11 +/- 8.5 ac 15 +/- 12 b 14 +/- 12 bc CE (dS/m) Conductivimeter 4 +/- 1.5 a 4 +/- 1.5 a 4 +/- 1.4 a Ph 1.5 +/- 1.3 a 0.8 +/- 0.5 b 0.7 +/- 0.5 c Bulk density (gr/cm3) Porta 7.5 +/- 1 a 6 +/- 0.6 b 6 +/- 0.5 b Hr (%) calculation 1.2 +/- 0.2 a 1.1 +/- 0.1 b 1.2 +/- 0.1 a N (%) Kjeldahl 0.2 +/- 0.1 a 0.3 +/- 0.1 b 0.2 +/- 0.1 a Nitrogenase activity 0.28 +/- 0.1 a 0.32 +/- 0.1 b 0.29 +/- 0.05 b (nanolitres of ethylene/g dry ARA soil*incubation hour) 0.3 +/- 0.3 a 0.2 +/- 0.2 b 0.2 +/- 0.3 b Respiration (mg de CO2 Incubation in alkaline produced/g dry soil per day) MR 0-5 (Kg/cm2) Cone 0.09 +/- 0.06 a 0.07 +/- 0.05 b 0.05 +/- 0.05 c 2) Cone 10 +/- 6 a 2.5 +/- 3 b 5.5 +/- 4 c MR 5=10 (Kg/cm 13 +/- 7 a 5 +/- 5 b 8 +/- 5 c

Mean values and standard deviationdifferent offrom the each different other systems (Kruskal-Wallis shown. NG: p<0.05). Naturalized grassland, CG: Cattle grazing, AG: Agricultural system. Values in the same row followed by the same letter are not significantly

Se muestran valores de las medias y desviación estándar de los diferentes sistemas. NG: pastizal naturalizado, CG: sistema mixto, AG: sistema agrícola. Los valores con las mismas letras no presentan diferencias significativas unos de otros (Kruskal-Wallis p<0,05).

Between the two anthropogenic which indicates that the biodiversity of soil phosphorus, humidity, and organic matter collembolansNG and the CG community environments as measured is positive, by systems, the AG system presented higher higher nitrogen values. This analysis (table 2a, page 223). showsvalues, that while Root the 1 CGclearly system separates presented the thisThe index index is higher of degree in the of CGchange environment between anthropized environments. which indicates that the biodiversity of soil natural environment (NG) from the two collembolansthe CG and AG communityenvironments measured is also positive, by this Index of degree of change of the index is higher in the agricultural envi- diversity between systems ronment (table 2b, page 224). This procedure calls for the calculation to Lastly, the index of degree of change be made between the three soil uses by pairing between the grassland and agricultural them, thus obtaining three indexes of degree environments is positive as well, which of change, according to the methodology indicates that the biodiversity of soil proposed by Cortet et al. (2002). collembolans community measured by The results of this analysis show that this index is higher in the agricultural the index of degree of change between the environment (table 2c, page 224).

222 Revista de la Facultad de Ciencias Agrarias Collembolan community structure

conductivity (Ec), mechanical resistance (MR), organic matter content (OM), Phosphorus content (P), total NG: naturalized grassland, CG: cattle grazing, AG: agricultural system. Variables: bulk density (Bd), electric

conductividad eléctrica (Ec),Nitrogen resistencia (N), pH, mecánica nitrogen (MR), fixing contenido bacteria deactivity materia (ara). orgánica (OM), contenido de NG: pastizal naturalizado, CG: sistema mixto, AG: sistema agrícola. Variables: densidad aparente (Bd),

Figurefósforo 2. (P),Discriminant Nitrógeno total analysis (N), pH, performedactividad bacteriana with the fijadoras physical, de nitrógeno chemical, (ara). and microbiological variables. Figura 2.

Table 2a. Análisis Index ofdiscriminante degree of change realizado of thecon diversitylas variables between físicas, thequímicas naturalized y microbiológicas. grassland and the cattle grazing. Tabla 2a. Índice de grado de cambio de la diversidad entre el pastizal naturalizado y el sistema mixto. Cattle grazing- V(ẋ) V(S) V(n) V(Hx) V(Hy) Σ V Δ Naturalized grassland feb-09 0.0862 0.5 0 1 0.3944 1.8081 0.3616 may-09 0.5342 0.2 0.0588 0.7890 0.3160 1.8981 0.3796 aug-09 0.9782 0.2 0.6363 0.8198 0.7215 3.3559 0.6711 dec-09 0.6232 0 0 0.1761 0.0161 0.4631 0.0926 mar-10 0.4792 0.1428 0.0588 0.0866 0.0585 0.7084 0.1416 jun-10 0.7048 0 0.1428 0.1409 0.0815 1.0702 0.2140 sep-10 0.8406 0.1428 0.0588 0.3102 0.0977 1.4503 0.2900 dec-10 0.5107 -0.2 0 0.5915 0.2562 0.1370 0.0274 0.2491

The sum of the last column being positive, indicates that the biodiversity measured by this index was

greater in the CG environment. V: valueHy: of theShannon degree index of change of diversity. of each parameter. ẋ: mean abundance of the taxonomicLa suma group, de S:la numberúltima columna of taxonomic es positiva, groups, indicando n: number que of la sample-unit, diversidad medida Hx: group por index este índice of diversity fue (γ),

del grupo taxonómico, S: número de grupos taxonómicos; n: número de unidades por muestra; mayor en el sistema CG. V: valor del grado de cambio de cada parámetro; ẋ: abundancia media

Hx: índice de diversidad de grupo (γ); Hy: índice de diversidad de Shannon. Tomo 50 • N° 1 • 2018 223 Rosana V. Sandler et al.

Table 2b. Index of degree of change of the diversity between the cattle grazing and the agricultural system. Tabla 2b. Índice de grado de cambio de la diversidad entre el sistema mixto y el sistema agrícola. Agricultural system- V(ẋ) V(S) V(n) V(Hx) V(Hy) Σ V Δ Cattle grazing feb-09 0.5835 -0.20 0.1667 -0.3372 -0.2676 -0.0547 -0.0109 may-09 0.1913 0 -0.1250 0.0276 -0.1551 -0.0612 -0.0122 aug-09 -0.6441 0 -0.0588 -0.4624 -0.1987 -1.3639 -0.2728 dec-09 0.3558 0 0.2308 -0.0640 0.1350 0.6576 0.1315 mar-10 0.2351 0 0.0588 0.2356 0.0619 0.5914 0.1183 jun-10 0.4792 0.1429 0.0588 0.3736 0.2128 1.2673 0.2535 sep-10 -0.3842 0.1111 0.0000 -0.1888 -0.0355 -0.4974 -0.0995 dec-10 0.4479 0.3333 0.0588 0.1816 0.1263 1.1480 0.2296 0.0422 The sum of the last column being positive, indicates that the biodiversity measured by this index was

greater in the AG environment. V: valueHy: of theShannon degree index of change of diversity. of each parameter. ẋ: mean abundance of the taxonomicLa suma de group, la última S: number columna of taxonomices positiva, groups, indicando n: number que la diversidad of sample-unit, medida Hx: por group este indexíndice of fue diversity mayor en(γ),

S: número de grupos taxonómicos; n: número de unidades por muestra; Hx: índice de diversidad de grupo el sistema AG. V: valor del grado de( cambio de cada parámetro; ẋ: abundancia media del grupo taxonómico,

γ); Hy: índice de diversidad de Shannon. Table 2c. Index of degree of change of the diversity between the naturalized grassland and the agricultural system. Tabla 2c. Índice de grado de cambio de la diversidad entre el pastizal naturalizado y el sistema agrícola. Agricultural system - V(ẋ) V(S) V(n) V(Hx) V(Hy) Σ V Δ Naturalized grassland feb-09 0.5236 0.3333 0.1667 1 0.1418 2.1653 0.4331 may-09 0.6583 0.2000 -0.0667 0.7993 0.1693 1.7601 0.3520 aug-09 0.9036 0.2000 0.6000 0.5756 0.6103 2.8895 0.5779 dec-09 -0.3436 0.0000 0.2308 0.1135 0.1192 0.1198 0.0240 mar-10 0.6420 0.1429 0.0000 0.3158 0.1200 1.2207 0.2441 jun-10 0.8851 0.1429 0.2000 0.4888 0.2893 2.0062 0.4012 sep-10 0.6743 0.2500 0.0588 0.1290 0.0624 1.1745 0.2349 dec-10 -0.0814 0.1429 0.0588 0.6982 0.3705 1.1890 0.2378 0.3131 The sum of the last column being positive, indicates that the biodiversity measured by this index was

greater in the AG environment. V: valueHy: of theShannon degree index of change of diversity. of each parameter. ẋ: mean abundance of the taxonomicLa suma group, de S:la numberúltima columna of taxonomic es positiva, groups, indicando n: number que of la sample-unit, diversidad medida Hx: group por index este índice of diversity fue (γ),

del grupo taxonómico, S: número de grupos taxonómicos; n: número de unidades por muestra; mayor en el sistema AG. V: valor del grado de cambio de cada parámetro; ẋ: abundancia media

Hx: índice de diversidad de grupo (γ); Hy: índice de diversidad de Shannon.

224 Revista de la Facultad de Ciencias Agrarias Collembolan community structure

the changes in the quality and dynamics vs. of litter inputs are all factors that affect the The degree of change between AG edaphic fauna and are responsible for the and NG is higher than between AG CG, Thesetherefore results AG and show NG that are morethe diversity separated of In this way, changes introduced by agricul- soilbetween collembolans each other community than AG resultedand CG are.in a turalfluctuations practices in theirdetermine populations changes (11, in 38).the amount of resources available to the soil organisms whose distribution and abun- rangeComparison were AG > CGof > NG.the abundances dance are determined by the availability between systems of food, the texture and porosity of the A total of 2028 individual collembolans soil, water retention, and the existence of were retrieved throughout the whole predators and parasites (40). Disturbance or perturbation of soils is (page 226), collembolan families behaved usually expected to depress microarthropod differentlysampling period.when their As shown abundances in figure were 3 - compared between the studied systems. cations typically reduce populations but The Entomobryidae and Katiannidae recoverynumbers. may Tillage, be rapid ﬁre, and and micro pesticide arthropod appli groups respond differently. Regarding the abundance data gathered families were significantly different differences(P<0.01) betweenfor the NG Hypogastruridae and AG. The differences between the environments three environments showed significant tested.in this Contrary study, to there what are was significantexpected, and unlike what other authors have found family, being higher in CG, followed by AG, (7, 11, 15, 26, 31), the results show higher and with NG having the lowest abundance. collembolan diversity in the anthropized systems,The Onychiuridaebut no differences was were significantly found systems than in the naturalized grassland different between AG and the other two and Rodriguez (2005) found that undis- andbetween the other NG and two CG. anthropized Isotomidae systems, showed turbed,in a gradient fertile were soils AG show > CG >high NG. densitiesSocorrás whichdifferences were between not different the natural from each system other. (NG) of collembolans and mites. The results presented here show that no-tillage agricultural practices with very low or null Discussion and conclusions soil movements, with high levels of litter on the surface, high content of organic The physical and chemical variables matter, and the indirect effect of nutrient are important in the characterization of enrichment through fertilization, can the edaphic environments. In this sense, result in an increase of these groups, as the results presented here allow for a clear shown in this study. separation between the soil uses, which are The analyses performed on collem- related to management practices, deter- bolans at the family level, show that mining changes in the edaphic environment the response depends on the particular that modulate the fauna’s composition and family. These results also show the need abundance. The increase of nitrogen and of further identifying key collembolan phosphorus as a result of fertilization, the families that can be used as indicators of changes in the use of the soil water, and particular ecological states.

Tomo 50 • N° 1 • 2018 225 Rosana V. Sandler et al. CG AG AG NG CG CG Katiannidae p=0.1697 p=0.5523 p=0.0552 0 0 0 500 500 500 3500 3000 2500 2000 1500 1000 3500 3000 2500 2000 1500 1000 3500 3000 2500 2000 1500 1000 CG AG AG NG CG CG Entomobryidae p=0.5339 p=0.1820 p=0.502 0 0 0 500 500 500 3500 3000 2500 2000 1500 1000 3500 3000 2500 2000 1500 1000 3500 3000 2500 2000 1500 1000 AG AG CG CG CG NG Isotomidae NG: pastizal naturalizado, CG: sistema mixto, AG: sistema agrícola. sistema AG: mixto, sistema CG: NG: pastizal naturalizado, p=0.6240 p=0.0048 p=0.0013 0 0 0 500 500 3500 3000 2500 2000 1500 1000 3500 3000 2500 2000 1500 1000 500 3500 3000 2500 2000 1500 1000 COLLEMBOLAN FAMILIES (ABUNDANCES) FAMILIES COLLEMBOLAN CG AG AG ) of each of the collembola community families across the three systems. systems. the three across collembola community families ) of each the 2 NG CG CG Onychiuridae p=0.8586 p=0.000002 p=0.00008 0 0 0 500 500 500 3500 3000 2500 2000 1500 1000 3500 3000 2500 2000 1500 1000 3500 3000 2500 2000 1500 1000 CG AG AG NG CG CG Hypogastruridae p=0.000007 p=0.0696 p=0.0045 0 0 0 500 500 500 3500 3000 2500 2000 1500 1000 3500 3000 2500 2000 1500 1000 3500 3000 2500 2000 1500 1000 Analysis of the abundances (ind/m Analysis vs. vs. . Análisis de las abundancias (ind/m²) de cada familia de la comunidad de colémbolos entre los tres sistemas de uso. sistemas los tres de la comunidad colémbolos entre . Análisis de las abundancias (ind/m²) cada familia Se muestra el valor P (Kruskal-Wallis p<0,1) así como la media y el SD. p<0,1) así como la media y el SD. P (Kruskal-Wallis el valor Se muestra P values (Kruskal-Wallis p<0.1) as well as means and SD are shown. NG: Naturalized grassland; CG: Cattle grazing; AG: Agricultural system. Agricultural AG: Cattle grazing; CG: grassland; NG: Naturalized shown. as means and SD are p<0.1) as well (Kruskal-Wallis P values Sites system system Naturalized Naturalized Agricultural Agricultural grassiand grassiand grassiand grassiand Cattle grazing Figure 3. Figure Cattle grazing vs. Cattle grazing Figura 3 Figura

226 Revista de la Facultad de Ciencias Agrarias Collembolan community structure

The biological indexes assess the soil high population densities under intensive global state in a simple way. Since they soil disturbances. represent an integrated response of the The results of the index of degree of soil fauna to conditions over an extended change between the ecological systems period of time, they have some clear analyzed in this study show that the advantages for ecological state assessment agricultural system, under no-tillage when compared to classical time-point management practices extended over physical and chemical analyses. several years have a positive effect Therefore, the analysis of the structure on collembolan assemblages, when of the edaphic community provides infor- compared to the other two systems mation on the effects of several factors evaluated. The results differ from those (management practices, pesticide use, by Cancela da Fonseca and Sarkar (1996), crop residuals) integrated over time. who found a negative index in their study, Furthermore, the biological indexes which implies a higher global diversity in diminish the number of analysis and the uncultivated system when compared interventions demanded by other indi- to the cultivated one. The positive index cators, with the objective of obtaining a of degree of change presented here indi- good representation of the quality of the cates a higher ecological diversity in the soil (37, 41). Therefore, they are useful in agricultural systems, in which it would to the other two systems. be hard to focus on one or a few impact no-tillage agricultural field in comparison factors such as pesticides, crop rotation, that is supposed to be the most disturbed, sowing, harvest, fertilization and other alsoThe coincides higher withdiversity the higherfound abundancein the field factors that are present in different combi- of some collembolan families in these nations (10, 39). The index of degree of change of the can be due to the fact that the no-tillage diversity calculated for the different soil systemfields. These, usually somewhat leaves some surprising 15% or results more uses in this work is a synthetic variable of the harvest residuals on the surface of the soil, diminishing erosion processes the biota to the environmental conditions, (51), preserving water, as well as adding andthat allows reflects for this the integrated comparison response between of organic matter to the system. systems with different soil uses and The thick layer of crop residues left therefore different anthropic impact. on the surface and accumulated year Work by several authors suggest that after year, creates a mulch that provides intensive agricultural practices tend to a source of organic matter as food, keeps reduce collembolan densities (7, 16, 25, temperature variations low and soil 33, 43). According with these authors, humidity high, all conditions that favor collembolan densities are generally lower the development of the soil collembolan in agricultural land than in natural sites communities. (43, 25). Maraun et al. (2003) suggest that The results of this work show that collembolans are particularly sensitive to low impact agricultural practices, which mechanical disturbances, even more than include crop rotation, little use of pesti- Oribatids (Acari: Oribatida). cides, and a high organic matter input may Results by Filser (2002) however, have positive effects on the soil collem- indicate that collembolans can maintain bolans’ community.

Tomo 50 • N° 1 • 2018 227 Rosana V. Sandler et al.

An increasing number of works provide and lowers diversity and abundance, growing evidence that soil fauna can be the results of this work go in a different a reliable indicator of anthropic distur- direction. According to the structure of bances (7, 19, 23, 25, 27, 28, 53). Earth- the collembolan communities tested in worms, Enchytraeids, Acari, and Collem- this work, an intensive soil use can lead to bolans are all groups being considered an increase in collembolan diversity. as candidates for the development of Even though more information needs to soil quality indexes (18, 23, 47). The be gathered on the biology and particular results presented here support this view requirements by collembolans, what the with a cautionary note. Even though the results presented in this work clearly structure of the collembolan community show is that the presence, abundance and can be used to assess anthropic impact diversity of collembolan families can be in the soil ecosystem, not always does useful indicators to assess the degree of it in the expected direction. While most anthropic soil disturbance as more basic published works support the idea that biology of these groups becomes available. anthropic impact simplifies the soil fauna, References

1. Baldigo, B.Mountains. P.; Lawrence, New G. York. B.; Bode, USA. R. Ecological W.; Simonin, Indicators. H. A.; Roy, 9(2): K. M.;226-239. Smith, A. J. 2009. Impacts of acidificatin on macroinvertebrate communities in streams of the western Adirondack

2. Barbourd,In M. Monitoring T.; Gerritsen, and J.; Snyder,Assessing B. D.;Water Stribling, Quality. J. B. Appendix 1991. Rapid B: bioassessment(Part I). U.S. Environmental protocols for use in streams and wadeable rivers: Perriphyton, Benthic Macroinvertebrates and fish.

Protection Agency. Office of Water. Washington. D. C. 3. Barbourd,In M. Monitoring T.; Gerritsen, and J.; AssessingSnyder, B. D.;Water Stribling, Quality. J. B. Appendix 1999. Rapid B: (Part bioassessment I) Second protocolsEdition. EPA for use in streams and wadeable rivers: Perriphyton, Benthic Macroinvertebrates and fish. 4. Bardgett, R. D. 2005. The biology of soil: A community and ecosystem approach. Oxford 841-B-99-002.University Press. U.S. Oxford. Environmental Protection Agency. Office of Water. Washington. D.C.

soil biota of some upland grasslands. Agric. Ecosyst. Environ. 45: 25-45. 5.6. Bardgett,Bardgett, R. R. D.; D.; Frankland, Cook, R. J.1998. C.; Whittaker, Functional J. B.; aspects 1993. The of effectssoil animal of agricultural diversity practicesin agricultural on the grasslands. Applied Soil Ecology. 10: 263-276.

under no-till on litter and soil invertebrates in areas with different soil types. Soil and 7. Bedano, J.Tillage C.; Dominguez, Research. 158:A.; Arolfo, 100-109. R.; Wall, L. G. 2016. Effect of good agricultural practices

large river bioassessment. Ecological Indicators. 9(2): 313-328. 8.9. Brennan,Blocksom, A.; K. Fortune, A.; Johnson, T.; Bolger, B. R. 2009.T.; 2006. Development Collembola ofabundances a regional andmacroinvertebrate assemblage structures index for in conventionally tilled and conservation tillage arable systems. Pedobiologia. 50: 135-145. 10. Büchs, W. 2003. Biodiversity and agri-enviromental indicators-general scopes and skills with special reference to the habitat level. Agriculture. Ecosystem and Environment. 98: 35-78.

In D. M. Rosemberg and V. H. Resh (eds): Freshwater Biomonitoring and Benthic 11. Cairns, J.macroinvertebrates. Jr.; Pratt, J. R.; 1993. A Chapmanhistory of biological& Hall. New monitoring York. 10-27 using p. benthic macroinvertebrates.

12. Cancela da Fonseca, J. P.; Sarkar, S. 1996. On the evaluation of spatial diversity of soil microarthropod communities. Eur. J. Soil Biol. 32(3): 131-140. 228 Revista de la Facultad de Ciencias Agrarias Collembolan community structure

ecological systems (Tripura, India). Applied Soil Ecology. 9: 105-107. 13.14. Carlisle, Cancela daD. M.; Fonseca, Meador, J. P.;M. Sarkar,R.; Moulton, S. 1998. H.; SoilRuhl, microarthropods P. M. 2007. Estimation in two differentand application managed of indicator values for common macroinvertebrate genera and families of United States. Ecological indicators. 7: 22-33.

15. Cortet, J.; Ronce, D.; Poinsot-Balaguer, N.; Beaufreton, C.; Chabert, A.; Viaux, P.; Cancela da Fonseca,38: 239-244. J. P. 2002. Impacts of different agricultural practices on the biodiversity of microarthropod communities in arable crop systems. European Journal of Soil Biology. environments of Espirito Santo. Brazil. Appl. Soil Ecol. 21: 49-58. 16. Culik, M.; de Souza, J.; Ventura, J. 2002. Biodiversity of Collembola in tropical agricultural

17. Decaëns,discharges T. 2010. Macroecological and the health patterns of the in river soil communities.environment. Global Aquatic Ecol. Ecosystem Biogeogr. 19: Health 287-302. and 18. Dickens,Management. C. W. S.; Graham, 1: 199-217. P. M.; 1998. Biomonotoring for effective management of wastewaters

agroecosystem functioning in Argentinean temperate soils: Evidence from litter 19. Domínguez,decomposition A.; Bedano, and J. soil C.; fauna. Becker, Appl. A. Soil R.; Arolfo,Ecol. 8: R.170-176. V. 2014. Organic farming fosters 20. European Parliament 2000. Directive 2000/60/EC of the European Parliament and of the Council of 23 October 2000 establishing a framework for Community action in the

fieldBiodiversity of water inpolicy. managed (OJ L 327,landscapes. 22-12-2000, Oxford p. 1). University Press, Oxford. European 21. Erwin, Parliament D. 1996. The 2000. geologic Directive history 2000/60/EC of diversity. of In:the Szaro, European R. C.; Parliament Johnston, D.and W. (Eds.).of the Council of 23 October 2000 establishing a framework for Community action in the

22. Falco, L.; Coviella, C. 2016. Contribution of Amynthas gracilis (Megascolecidae) and Octolasion cyaneumfield of water (Lumbricidae) policy. (OJ Lto 327, soil 22-12-2000,physical stability: p 1). a mesocosm experiment. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 48(1): 115-127.

23. Ferraro, D.; Ghersa, C. 2007. Exploring the natural and human-induced effects on the assemblage of soil microarthropod communities in Argentina. Europ. J. Soil. Biol. 43: 109-119. 24. Filser, J. 2002. The role of Collembola in carbon and nitrogen cycling in soil. Pedobiologia (Jena).methods 46: from 234-245. the UK arable ecosystem. Proceedings. Pedobiologia. 41(1-3): 179-184. 25.26. Frampton,Fredes, N. G.A.; K. Martinez, 1997. The P. potential A.; Bernava of collembola Laborde, V.; as Osterrieth,indicators of M. pesticide 2009. Revista usage: Argentinaevidence and de Ciencias del Suelo. 27(1): 89-101.

27. Gomez-Anaya,Colombiana J. A.; Palacios-Vargas, de Entomología J. 36(1): G.; Castaño-Meneses, 96-105. G. 2010. Abundancia de colémbolos (Hexapoda: Collembola) y parámetros edáficos de una selva caducifolia. Revista

28. Graham,richness, J. H.; Krzysik, equitability, A. J.; Kovacic, and D.abundance A.; Duda, J.of J.; antsFreeman, in disturbed D. C.; Emlen, landscapes. J. M.; Zak, EcologicalJ. C.; Long, W.Indicators. R.; Wallace, 9(5): M. 866-877. P.; Chamberlin-Graham, C.; Nutter, J. P.; Balbach, H. E. 2009. Species 29. Hopkin, S. P. 1997. Biology of the Springtails (Insecta: Collembola). Oxford University Press. Oxford.

30.31. Kautz,Hutson, T.; B. Lopez-Fando, R.; Veitch, L. C.;G. Ellmer,1983. Mean F. 2006. annual Abundance population and densitiesbiodiversity of Collembolaof soil microarthropods and Acari in the soil and litter of three indigenous South Australian forests. Aust. J. Ecol. 8: 113 -126. Central Spain. Applied Soil Ecology. 33: 278-285. 32. Lavelle, asP.; Bignell,influenced D.; Lepage,by different M.; Wolters, types of V.; organic Roger, manure P.; Ineson, in aP.; long-term Heal, O. W.; field Dhilloin, experiment S.; 1997. in

Soil Biol. 33(4): 159-193. Soil function in a changing world: the role of invertebrate ecosystem engineers. Eur. J.

Tomo 50 • N° 1 • 2018 229 Rosana V. Sandler et al.

diversity, density and community structure in a modern beech forest (Fagus sylvatica): 33. Maraun,effects M.; Salamon, of mechanical J.; Schneider, perturbations. K.; Schaefer, Soil M.; Biol. Scheu, Biochem. S. 2003. 35: Oribatid 1387-1394. mite and collembolan

Cristani, C.; Barberi, P. 2010. Comparison of organic and conventional stockless arable 34. Mazzoncini,systems: M.; Canali, A multidisciplinary S.; Giovannetti, approach M.; Castagnoli, to soil qualityM.; Tittarelli, evaluation. F.; Antichi, Applied D.; SoilNannelli, Ecology. R.; 44: 124-132. 35. McLaughlin, A.; Mineau, P. 1995. The impact of agricultural practices on biodiversity. Agric. Ecosyst. Environ. 55: 201-212. 36. Momo, F.; Falco, L. 2010. Biología y Ecología de la fauna del suelo. Ed. Imago Mundi. 37. Muller, F.; Hoffmann-Kroll, R.; Wiggering, H. 2000. Indicating ecosystem integrity- theoretical concepts and environmental requirements. Ecological Modeling. 130: 13-23.

1998. The Famatinian magmatic arc in the central Sierras Pampeanas. In: Pankhurst, 38. Pankhurst, R. J.; Rapela, C. W.; Saavedra, J.; Baldo, E.; Dahlquist, J.; Pascua, I.; Fanning, C. M.;

39. Paoletti,R. M. J. 1999. and C.Using W. Rapelabioindicators (Eds.): based The Proto-Andeanon biodiversity Marginto assess of landscape South America. sustainability. Spetial PublicationAgriculture, ofEcosystems the Geological and Environment.Society. London. 74: 142: 1-18. 343-368.

1998. Earthworms as useful bioindicators of agroecosystem sustainability in orchards 40. Paoletti,and M. vineyardsG.; Sommaggio, with different D.; Favretto, inputs. M. AppliedR.; Petruzzelli, Soil Ecology. G.; Pezzarossa, 10: 137-150. B.; Barbafieri, M.;

as a tool to assess soil quality and biodiversity: a new approach in Italy. Agriculture, 41. Parisi, V.;Ecosystem Menta, C.; and Gardi, Environment. C.; Jacomini, 105: C.; 323-333.Mozzanica, E. 2005. Microarthropod communities

Labranza y fertilización como moduladores de la dinámica de comunidades 42. Pérez, G.microbianas R.; Barbieri, asociadas P. A.; Hernandez a un cultivo Guijarro, de trigo K.; en Echeverría. el sudeste H. bonaerense E.; Covacevich, (Argentina). F. 2017. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 49(2): 219-234. 43. Petersen, H. 2002. Effects of non-inverting deep tillage vs. conventional ploughing on

collembolan populations in an organic wheat field. Eur. J. Soil Biol. 38: 177-180. 44. Quintana,ecosystems: X. D.; Boix, size-based A.; Badosa, vs . A.;taxon-based Brucet, S.; approaches. Compte, J.; Limnetica.Gascón, S.; 25: López-Flores, 303-320. R.; Sala J.; Moreno-Amisch, R. 2006. Community structure in mediterranean shallow lentic

45. Ruiz, H.retención A.; Oliverio hídrica. Sarli, Revista G.; de Gonçalvesla Facultad Reynaudde Ciencias Schaefer, Agrarias. C.Universidad E.; Filgueira, Nacional R. R.;de SilvaCuyo. deMendoza. Souza, Argentina. F. 2016. La 48(2): superficie 95-105. específica de oxisoles y su relación con la

Biodiversity and Conservation. 7: 1207-1219. 46. Rusek, J. 1998. Biodiversity of Collembola and their functional role in the ecosystem.

47. Sandler,de R. laV.; provincia Falco, L. B.; de DiBuenos Ciocco, Aires. C.; De Cs. Luca, Suelo. R.; 28(1): Coviella, 1-7. C. E. 2010. Eficiencia del embudo Berlese-Tullgren para extracción de artrópodos edáficos en suelos Argiudoles típicos químicas y mesofauna en una bordura del cordón hortícola de Laguna de los Padres, 48. Scampini,provincia E. M.; Osterrieth,de Buenos Aires, M. L.; Argentina. Martinez, Neotrópica. P. A. 2000. 46: Estudio 3-10. de las propiedades físico- 49. Socorrás, A.; Rodriguéz, M. 2005. Utilización de la mesofauna como indicador biológico en pareas con Pinus cubensis en la zona minera de Moa, Holguín, Cuba. Cuba.

Biodiverstiy and Ecosystem Function (eds. E.D. Schulze and H. A. Mooney). Springer- 50. Swift, M.Verlag, J.; Anderson, Berlin. J.15-41. M. 1993. Biodiversity and ecosystem function in agricultural systems.

residue management, advances in soil science. CRC Press. Inc. Boca Ratón. p. 37-61. 51. Unger, P. W. 1994. Residue management strategies-great plains. In: Hatfield, J. L. (Ed.). Crops

230 Revista de la Facultad de Ciencias Agrarias Collembolan community structure

52. USDA United States Department of Agriculture. 2010. Keys to soil taxonomy. Eleventh Edition. Washington. 53. Van Stralen, N. M.; Verhoef, H. A. 1997. The development of a bioindicator system for soil

Scale aciditydependent based controls on arthropod on ecological pH preferences. functions Journal in of agroecosystems Applied Ecology. 34:of 217-232.Argentina. 54. Viglizzo,Agriculture, E. F.; Pordomingo, Ecosystems A. J.;and Castro, Environment. M. G.; Lértora, 101: 39-51. F. A.; Bernardos, J. N. 2004.

Acknowledgements The authors wish to acknowledge the collaboration of Agr. Eng. Eduardo Penon and Loreta

Gimenezspecial for acknowledgment their field and lab goes assistance, to Edgardo and Ferrari, Dr. Andrés Pablo Duhour Peretto, for and his Rominahelp with de the Luca statistics for analyses. Dr. Edward T. Johnson was helpful in revising the English version of this manuscript. A allowing the use of their propertiesUniversidad as sampling Nacional sites. Thisde Luján. work was partially funded by a Grant by the Agencia Nacional de Promocion Cientifica y Técnica, Argentina (PICT 02293-2006) and

Tomo 50 • N° 1 • 2018 231 SensometríaRev. FCA UNCUYO. con 2018.lógica 50(1): difusa 233-248. y métodos ISSN de impreso análisis 0370-4661. multivariados ISSN (en línea) 1853-8665.

Análisis de datos sensoriales de tomate triturado con lógica difusa y técnicas multivariadas

Sensory data analysis crushed tomatoes with fuzzy logic and multivariate techniques

Matilde Inés Césari 1, Nancy Beatriz Ventrera 2, Adriana Gámbaro 3

Originales: Recepción: 04/04/2016 - Aceptación: 27/04/2017

Resumen

El conjunto de las técnicas de recolección y análisis de datos, generados en la evaluación sensorial, constituye una rama de la estadística llamada sensometría. Si - ciones humanas, la estrategia más apropiada para obtener conocimiento preciso ase partirtiene ende cuenta valoraciones la vaguedad subjetivas, e incertidumbre consiste en con transformar la que se manifiestan los datos sensorialeslas percep mediante la matemática borrosa. No obstante el potencial que muestra el razonamiento borroso, en la actualidad, existen pocas referencias sobre la aplicación de la lógica difusa en la evaluación sensorial, y no se dispone de criterios y métodos armonizados y sistematizados para una evaluación sensorial objetiva y reproducible, en alimentos vegetales. Los resultados obtenidos en pruebas sensoriales en tomate triturado, permitieron exponer un marco metodológico para el análisis sensométrico de datos borrosos con la utilización de la lógica difusa y métodos de análisis multivariado de datos. De esta manera se optimizan las técnicas en las pruebas sensoriales, para así renovar el proceso en la producción alimentaria argentina. de análisis sensorial, desarrollando un área específica que mejorará el valor económico Palabras clave

análisis de correspondencias evaluación sensorial • tomate • datos sensoriales • sensometría • lógica borrosa •

1 CeReCon (Centro de Investigación en Computación y Neurociencia). Facultad Regional Mendoza. Universidad Tecnologica Nacional Rodriguez 273. 5500. Mendoza, Argentina. [email protected] [email protected] 2 Universidad Nacional de Cuyo. Facultad de Ciencias Agrarias. Dpto. de Ciencias Enológicas y Agroalimentarias. Cátedra de Bromatología. Alte. Brown 500. Chacras de Coria. Mendoza. Argentina. M5528AHB. [email protected] 3 Universidad de la República. Facultad de Química. Cátedra de Ciencia y Tecnología de Alimentos. Sección Evaluación Sensorial. Avda. Gral. Flores 2124. C.P.11800. Montevideo. Uruguay. [email protected]

Tomo 50 • N° 1 • 2018 233 M. I. Césari, N. B. Ventrera, A.Gámbaro

Abstract

All data collection and analysis techniques, generated in the sensory evaluation, constitute a branch of the statistic called sensometry. If it is taking into account the vagueness and uncertainty with which human perceptions are manifested, the most appropriate strategy for obtaining precise knowledge from subjective evaluations is to transform the sensory data through fuzzy mathematics. However the potential of fuzzy reasoning, there are currently few references about the application of fuzzy logic in sensory evaluation, and there are no harmonized and systematized criteria and methods for objective sensory evaluation and reproducibly in plant foods. The results obtained in sensory tests of crushed tomato allowed to expose a methodological framework for the sensometric analysis of fuzzy data with the use of fuzzy logic and methods of multivariate analysis of data. In this way the techniques in the sensorial tests are optimized, improve the economic value in the Argentinean food production. and thus the process of sensorial analysis is renewed, developing a specific area that will Keywords sensometrics

sensory evaluation • tomato • sensory data • • fuzzy logic • correlation analysis Introducción

El término "datos sensoriales", se articulación de datos sensoriales e aplica a todos aquellos datos generados instrumentales, y evaluación individual en la percepción de características de o grupal del rendimiento de un panel de un producto alimenticio, a través de jueces (12, 13, 25, 27). los sentidos. El conjunto de las técnicas Una problemática de los métodos de de recolección de este tipo de datos y evaluación sensorial (ES), reside en el métodos estadísticos de análisis asociados trabajo con paneles de laboratorio consti- constituyen la rama de la Estadística tuidos por personas que proporcionan la llamada Sensometría (3), la cual información percibida por sus sentidos resulta, de gran utilidad en estudios que (16, 22, 28) y se debe lograr que la involucran degustaciones en la industria respuesta humana sea precisa y se pueda alimentaria. Estas técnicas se encuentran determinar de modo cuantitativo. en continua expansión, dada la creciente Existen diferencias en las percepciones competitividad de los mercados, y que sensoriales individuales en cuanto a gustos, genera continuamente nuevos problemas, sonidos, formas, iluminación, olores, etc., de exigentes de técnicas de análisis de datos tal forma que cada sujeto tiene una imagen global del mundo. Esta variabilidad esta reforzada por la educación, nivel social, medidasmás sofisticadas. sensoriales, de aplicación en el cultura y personalidad del catador (2), por áreaCon de productos la finalidad de origen de disponer vegetal, dese lo que los resultados de las pruebas senso- han adoptado metodologías basadas en el riales se expresan en términos relativos y no en términos absolutos, por ende, este tipo de diseño de producto, calidad poscosecha, información implica siempre subjetividad o concepto de perfil descriptivo, además de

234 Revista de la Facultad de Ciencias Agrarias Sensometría con lógica difusa y métodos de análisis multivariados vaguedad. La incerteza es aquella que surge la calidad de los alimentos. El empleo de procesos humanos, como la sensación, la de la lógica borrosa permitirá repre- percepción, la experiencia cognoscitiva, el sentar y manipular los datos sensoriales razonamiento y el pensamiento. subjetivos, con métodos multivariados y La percepción que se logra del entorno univariados conocidos. En este sentido,

(ojos, oídos, nariz, etc.) contiene incertezas representan los distintos valores de cada quefísico no a pueden través deser loscaracterizadas sensores naturales usando variable,la definición es un de primer los conjuntos paso en difusosun proceso que estadística o incluso razonamiento lógico de razonamiento aproximado en el que se opera sobre la base de percepciones en léxica, trata la imprecisión propia en la lugar de medidas de las mismas. mayoríatradicional. de las Específicamente, palabras humanas, la incerteza usadas La teoría de la posibilidad, constituyen para evaluar conceptos y derivar conclu- modelos, basados en la lógica borrosa, siones. Con el uso de abstracción y analogías, que resultan especialmente útiles para unas pocas oraciones describirán contextos tratar con la imprecisión de manera más "natural" y más "humana". Emplean una precisión matemática (20, 23, 32). terminología particular: "Fuzzy"(difuso o complejosEl estudio que sonexploratorio difíciles de de modelar los datos con imprecisos, presenta restricciones, puestas en evidencia por Ávila-de Hernández et al. borroso); "Crisp" (nítido); "Fuzzification" (2011). Variables que presentan elevado (borrosificación: convertir un conjunto número de valores perdidos, lo cual implica borrosonítido en en un borroso); valor "Crisp"). y "Defuzzification" (desborrosificación:El concepto de la convertirlógica borrosa, un conjunto surgió análisis, y por otro lado, frente a la posibi- en Estados Unidos de América (1965) lidadpor un de lado, que pérdidalos valores de eficienciaperdidos ensigan el con Zadeh, y el enfoque difuso explica los un patrón no aleatorio, tanto ignorarlos valores ambiguos, inexactos, por medio como estimarlos, mediante alguno de de variables lingüísticas borrosas, donde los sistemas de imputación, implica un cada uno de sus valores, se representan sesgo, inconveniente en la obtención de con un número borroso. Básicamente, se patrones mediante el análisis factorial (21). asignan diferentes valores de verdad a los Barda et al. (2011) señala que los valores enunciados y no solamente los clásicos medios y la dispersión alertan de posibles «falso» o «verdadero». Asimismo, ofrece un marco de trabajo natural donde las canti- relación con problemas de la realidad dades borrosas son interpretadas como estudiadadeficiencias e deincluso los datosla propia observados, naturaleza en distribuciones de posibilidad, describiendo subjetiva de las mediciones (26, 36). los valores del conocimiento incierto o A partir de estos problemas, es indis- impreciso de conjuntos borrosos (31). pensable el empleo de métodos robustos, El supuesto de dicha teoría es que como los que provee el análisis multi- existen conjuntos en los que no está variado, con el diseño de una estrategia claramente determinado si un elemento que permita minimizar el efecto de valora- pertenece o no al conjunto, a veces, un ciones atípicas (outlier) y faltantes. elemento pertenece al conjunto con El amplio intervalo de respuestas del cierto grado. En el caso de un conjunto de ser humano a los estímulos sensoriales, muestras de alimentos dulces, constituye genera complejidad en la percepción de un conjunto difuso, pues no está claro

Tomo 50 • N° 1 • 2018 235 M. I. Césari, N. B. Ventrera, A.Gámbaro el límite de dulzura que establece cuál Los humanos poseen habilidad para alimento sería dulce o no lo sería, ese asignar grados de pertenencia a objetos límite es borroso y, por tanto, el conjunto determinados, sin un entendimiento que delimita también lo será. consciente de cómo llegar a ese valor. El enfoque difuso permite representar Otra característica, que aporta a su subje- los datos de las escalas sensoriales por tividad, es que dependerá del contexto. medio de variables lingüísticas borrosas, función de donde cada valor es un número borroso pertenencia como una curva donde un (conjunto difuso). Por ejemplo, la variable valorFormalmente, de entrada se definees mapeado a una a un valor lingüística "intensidad aroma" puede de pertenencia o membresía al conjunto tomar los valores lingüísticos "ausente", difuso (36). "muy débil", "débil", "medio, fuerte" Transformar los datos sensoriales mediante la matemática borrosa, es semántico y se pueden expresar numéri- un enfoque apropiado para obtener camentey "muy por fuerte", un grado tienen de un verdad significado entre conocimiento preciso a partir de 0 y 1 (30, 31, 32). valoraciones subjetivas. Sin embargo, - aunque el razonamiento borroso puede nentes básicos de un conjunto difuso: (1) LaEje figura x (números 1, muestra reales los trescrecientes) compo el análisis de datos, en la actualidad, hay que constituyen el Dominio del conjunto pocastener potencialreferencias como sobre método cómo eficazllevar ena difuso; (2) Eje y con valores entre 0 y cabo la aplicación de la lógica difusa en la sensometría, y no se dispone de criterios y conjunto; y (3) función de pertenencia métodos armonizados y normalizados para 1 que significa grado de pertenencia al una evaluación objetiva y reproducible, elemento del dominio con su grado de utilizando la matemática borrosa (8, 10, 20). pertenencia.(superficie) delEl conjunto,grado de quepertenencia conecta unde En cuanto al análisis de datos borrosos, un conjunto difuso es subjetivo, implica el Análisis Factorial Multivariado de Datos (AFMD) en la versión de la escuela francesa, surge en la década de los 70, planteando una "definición" más que "medición". Estadística tradicional. Su objetivo general esfines la búsqueda menos deterministas de una estructura que lospresente de la en los datos, en un contexto de tipo más abductivo que deductivo, que revaloriza el rol del individuo estadístico (3). En la actualidad, las técnicas de AFMD tales como el Análisis Factorial de Correspondencias Simples (ACS) y las pruebas de asociación y validación de tablas de contingencia, presentan salidas

Figura 1. Representación de los tres relaciones no lineales entre las modali- gráficas fáciles de interpretar y revelan Componentes de un Conjunto difuso. dades de diferentes variables que otros métodos no permiten observar. En el Figure 1. Representation of the three análisis de números borrosos es apropiado components of a fuzzy set.

236 Revista de la Facultad de Ciencias Agrarias Sensometría con lógica difusa y métodos de análisis multivariados el uso de estas técnicas al representar los objeto de evaluar la percepción sensorial datos en tablas de contingencia. de tomate triturado, a través de descrip- El tema que se desarrolla en este trabajo tores de aspecto general y consistencia, busca exponer un esquema metodológico entre otros. Los datos obtenidos dentro del basado en el enfoque difuso, para el análisis marco del proyecto SeCTyP "Evaluación sensorial de productos frutihortícolas", el empleo del análisis multivariado a partir fueron provistos por la Cátedra de Broma- de datos.datos Condifusos la finalidad que representan de demostrar la infor que- tología de la Facultad de Ciencias Agrarias, mación de los individuos de manera más Universidad Nacional de Cuyo, Mendoza. realista, enriquece el proceso de análisis, Y se obtuvieron al aplicar una prueba ya que constituye un instrumento de obser- descriptiva, con escalas estructuradas de 5 vación apropiado que facilita la explo- puntos, a través de un panel de 8 jueces, en tación de datos cuantitativos, cualitativos y siete muestras ("M954", "M632", "M125", también borrosos. "M471", "M580", "M369" y "M293") de Para lograr este propósito, en el tomate triturado con agregado de Aloe marco de la tesis "Estudio y Aplicación vera elaborado dentro del proyecto SeCtyP de la lógica borrosa para medir, analizar "Uso de gel de Aloe sp en alimentos". y evaluar calidad sensorial en alimentos", La propuesta Metodológica de Análisis para optar al título de Doctora en Alimen- de Datos Borrosos, involucra 4 grandes tación, de la carrera en Red Norte de - Argentina, se planteó la representación darización de los datos medidos; -2- La de la incertidumbre a través de la lógica procesos: -1- La codificación y estan difusa y presentó, a partir del estudio de un difusas y su empleo en la transformación caso, la aplicación de técnicas de análisis dedefinición los datos de estandarizados las variables en lingüísticas números factorial de correspondencia y técnicas borrosos representados en una tabla de de validación y descripción, en el trata- contingencia; -3- La obtención de un valor miento de datos borrosos en estudios de borroso colectivo de todo el panel y un percepción sensorial de tomate triturado, - con datos otorgados por la cátedra de Bromatología de la Facultad de Ciencias evaluadas;valor cuantitativo -4- aplicación (crisp) final de represenmétodos Agrarias, Universidad Nacional de Cuyo. multivariadostativo de la calificación para análisis, de lasvisualización muestras y obtención de conocimiento sobre los datos borrosos (métodos factoriales de Materiales y métodos correspondencias para tablas de contingencia y factorial múltiple para estudio de Para establecer un marco de trabajo múltiples tablas de contingencia. de información imprecisa asociada con el La codificación y estandarización de análisisque resulte de flexibledatos, se y eficiente representó en el la manejo incer- datos sensoriales tidumbre a través de la lógica difusa y se Las valoraciones obtenidas de las aplicó técnicas de análisis multivariante pruebas sensoriales se presentan en en el tratamiento de datos borrosos, en diversas tablas de datos; naturaleza el ámbito del análisis sensométrico de cuantitativa (datos no estructurados alimentos de origen vegetal. tratados como números) o de naturaleza Se utilizaron los resultados de pruebas cualitativa (datos estructurados en sensoriales realizadas en el 2015, con el categorías o etiquetas verbales).

Tomo 50 • N° 1 • 2018 237 M. I. Césari, N. B. Ventrera, A.Gámbaro

En el caso de aplicación, la tabulación se Descriptores lingüísticos realizó en una matriz de datos cuantitativos Se elige un conjunto de etiquetas o de discretos. Se dispuso cada muestra valorada términos lingüísticos (conjuntos difusos). vs. cada descriptor evaluado, en Se consideraran i etiquetas lingüísticas columnas, las valoraciones se represen- en filas taron por un número, de 1 a 5 para los dos C={ c0,c1,…,ci}, c0 1 i , donde finitas y totalmente ordenadas, como descriptores sensoriales (tabla 1). cada etiqueta ci representa la valor- Opcionalmente, las puntuaciones en ación lingüística , para ≤ c cada≤,…,c descriptor los atributos se normalizan a efectos de (se denomina granularidad de la variable). eliminar problemas de cálculo originados en la utilización de diferentes escalas. De por el analista en función de los objetivos esta manera se utiliza una misma variable deEl númerola prueba. de conjuntosValores típicos difusos, de se "granu define- lingüística difusa. Para la estandarización laridad" son aquellos impares como 5, 7 de los datos, se propone utilizar el método ó 9, donde el término medio representa de normalización lineal a valores de 0 a 1, un valor indiferente o punto medio, y el usando la ecuación de la recta. resto se distribuye simétricamente a su alrededor. Sin embargo, las etiquetas y Transformar las valoraciones a datos borrosos escalas utilizadas en las pruebas, por lo Los atributos medidos se repre- quesu significado no siempre deben el valor ser central acordes determina con las sentan a través de una o varias variables la indiferencia, y no siempre las escalas lingüísticas borrosas, lo que requiere son simétricas (4, 11). seleccionar los descriptores lingüísticos adecuados y su semántica. Semántica de los conjuntos difusos

conjunto difuso (términos lingüísticos) una funciónEste matemática procedimiento que representa define para el grado cada Tabla 1. Representación esquemática de (posibilidad o verdad de una percepción) de la Tabla de datos donde se tabularon pertenecer a un conjunto borroso. los datos sensoriales observados de la Los tipos de funciones de pertenencia prueba con muestras de tomate triturado. comúnmente utilizados son: la función Table 1. Schematic representation of the Triangular, Trapezoidal y Gaussiana, entre data table where the observed sensory otras (36). Las estimaciones lingüísticas con test data are tabulated with samples of una escala de medición de la cual se obtiene crushed tomatoes. observaciones numéricas, tienden a seguir una distribución normal y es apropiado el Juez Muestra Aspecto general Consistencia J01 uso de números borrosos Gaussianos. ... M954 En un conjunto difuso con función J08 J01 dos parámetros (a y b) que determinan la ...... Apreciación (valores de 1 a 5) mediaGaussiana o desvío (figura de 2,una pág. campana 239), se de definen Gauss, J08 donde a representa el valor medio central, J01 con total pertenencia al conjunto (µ=1), y ... M293 b es el desvío que representa la amplitud J08 de la campana.

238 Revista de la Facultad de Ciencias Agrarias Sensometría con lógica difusa y métodos de análisis multivariados

de las ecuaciones de las funciones de

lingüísticas en punto -2-, se compara el valorpertenencia sensorial definidas con la función para las matemática variables correspondiente, obteniendo un valor entre cero y uno para cada conjunto difuso. Figura 2. Cada uno de estos valores de posibilidad parámetros de la Función de Pertenencia de asociarse a cada etiqueta lingüística, Gaussiana. A Representación la derecha se representa gráfica y el constituye un número borroso. Los datos (x) eje vertical a,b de contingencia, en columna se representa Figure 2. Graphical representation and losborrosificados conjuntos borrosos se representan de cada en descriptor, una tabla parameterscálculo of de the � Gaussian membership function. To the right is represented panelista de cada muestra, la celda repre- (x) axe vertica. a,b sentaen fila else identificavalor de laposibilidad percepción obtenido. para un calculate � En el caso de estudio, se determinó la expresión de la intensidad de las percep- Otra forma alternativa es la de la ciones de los jueces sobre cada una de Ecuación 1: las características de las muestras de −b (x−a)2  tomate evaluadas, mediante etiquetas    (1) µa,b (x)  exp lingüísticas. Para cada valoración de los jueces, se aplicó la Ecuación 1, con los En el caso de estudio, para la represen- tación de la intensidad (Aspecto y Consis- 240, para determinar el valor de pertenencia,parámetros de cada definidos conjunto en borrosola figura en3 (pág.cada lingüística y correspondiente función de atributo (tabla 2, pág. 241). tipotencia), Gaussiana se definió para unaambos misma atributos, variable con 5 conjuntos difusos, para transformar Agregación valores de 1 a 5 respecto de "intensidad o En esta etapa, se determina un valor colectivo del panel, para cada carac- terística, aplicando un "operador de apreciación" (figura 3, pág. 240). agregación" sobre las evaluaciones borrosi- (MicrosoftLa representación Excell) y la gráficaherramienta se efectuó para desarrolloa través dede los sistemas gráficos XYde dispersióninferencia borrosa de FisPro (Fuzzy Inference System precisoficadas, (crisp). y posteriormente El procedimiento un "método consiste, de Professional). Dicho sistema es un Software endesborrosificación" calcular para cada para conjunto calcular borroso un valor c la de código abierto que permite crear modelos i unión t(ci) del conjunto difuso. simples de inferencia difusa y utilizarlos con Se propone un operador de la familia de el propósito de razonamiento, sobre todo t-conormas, denominado suma algebraica

de los valores de pertenencia µ(ci) de los biológico (17). p panelistas (ecuación 2, pág. 240). Es para la simulación de un sistema físico o considerado apropiado para la agregación Borrosificación de datos sensoriales, siendo un operador Los datos sensoriales tabulados en probabilístico; este calcula la suma menos punto -1-, se convierte en un número el producto de los valores de posibilidad de borroso derivado empíricamente. A través cada conjunto.

Tomo 50 • N° 1 • 2018 239 M. I. Césari, N. B. Ventrera, A.Gámbaro

c0: Muy Malo / Inconsistente . c1: Malo / Poco Consistente . c2: Intermedio / Media . c3: Bueno / Consistente c4: Muy Bueno / Muy Consistente c0: Very Bad / Inconsistent . c1: Bad / Little Consistent . c2: Intermediate . c3: Good / Consistent . c4: Very Good / Very Consistent

Figura 3.

Definición de Variable lingüística difusa de Intensidad (Aspecto General y Figura 3. Consistencia) para borrosificar datos de tomate triturado. Variable fuzzy linguistic definition Intensity (General and Consistency Aspect) for data borrosificar crushed tomatoes. Se obtiene un valor agregado colectivo donde S podrá tomar valores de 0 a 4 (se del grupo de degustadores, para cada redondea para obtener un valor discreto), conjunto difuso correspondiente un la etiqueta lingüística es la representada atributo sensorial. por l . k s t ⋅i ∑1 ci (3) p p S  entero k  µ − µ (2) t t(ci ) ∑ (ci ) ∏ (ci ) ∑1 ci 1 1 k = granularidad de la variable lingüística donde: (número de conjuntos difusos). p = número de panelistas (jueces y/o i = consumidores). (toma valores de 0 hasta k-1). identifica cada etiqueta o conjunto difuso ci t(ci) = agregación del conjunto difuso ci variable lingüística (toma valores desde 0). (unión). = identifica cada conjunto difuso de la Por medio de los métodos de

Luego, a partir de la agregación t(ci) , se de valores borrosos agregados, se obtiene difuso colectivo de los p panelistas; para informacióndesborrosificación, precisa a expresada partir del mediante conjunto unaidentifica granularidad la etiqueta de 5,lingüística son k = 5 o conjuntos conjunto un valor crisp. Cada método utiliza una difusos, representados por ci etiquetas fórmula matemática para calcular la (i varía de 0 a 4), se calcula la etiqueta lingüística agregada según la Ecuación 3, salida final.

240 Revista de la Facultad de Ciencias Agrarias Sensometría con lógica difusa y métodos de análisis multivariados c2 0,000 0,064 1,000 0,064 0,000 0,000 1,000 0,064 CO-c4 0,000 1,000 0,064 1,000 0,000 0,064 0,064 1,000 CO-c3 0,000 0,064 0,000 0,064 0,064 1,000 0,000 0,064 CO-c2 0,064 0,000 0,000 0,000 1,000 0,064 0,000 0,000 CO-c1 ) i i ) ⋅ i a c ) . i t i c 2 ) t c k 1 i 2 b ( k 1 c t b ( ( t ∑ k 1 ( ∑ 1,000 0,000 0,000 0,000 0,064 0,000 0,000 0,000 CO-c0 k 1 ∑ o ∑ r e  n t P S e I R  C 1 4 5 4 2 3 5 4 V S = Valor Borroso (Ecuación 3) (Ecuación Borroso = Valor 3,49 = DesBorrosificación (Ecuación 4) (Ecuación = DesBorrosificación

c2 Consistencia 3,49 c3 / c3 3,97 / 0,064 1,000 1,000 1,000 0,064 0,000 0,000 1,000 4,13 AG-c4 1,000 0,064 0,064 0,064 1,000 0,064 0,000 0,064 ) AG-c3 i   c 2 ( ) a µ − x ( p 1  0,064 0,000 0,000 0,000 0,064 1,000 0,000 0,000 AG-c2 b ∏ −   − ) i x p c e ( µ 0,000 0,000 0,000 0,000 0,000 0,064 0,064 0,000 AG-c1  and consistency of the M632 sample crushed tomatoes. and consistency ) p 1 ∑ x aspecto y consistencia de la muestra M632 de tomate triturado. M632 de tomate de la muestra y consistencia aspecto (  b = Agregación (Ecuación 2) (Ecuación = Agregación , ) a i 0,000 0,000 0,000 0,000 0,000 0,000 1,000 0,000 AG-c0 µ c ( 4,13 t 0,000 = Borrosificación (Ecuación 1) (Ecuación 0,000 = Borrosificación 4 5 5 5 4 3 1 5 3,97 General Aspecto Aspecto Representación de los cálculos de borrosificación, agregación, valor borroso y desborrosificación de los valores de de los valores y desborrosificación borroso valor agregación, de los cálculos borrosificación, Representación M632 M632 M632 M632 M632 M632 M632 M632 M632 Muestra Representation fuzzification calculations, aggregation, and defuzzification fuzzy value of the securities in appearance of the securities in appearance and defuzzification fuzzy value fuzzification calculations, aggregation, Representation J08 J07 J06 J05 J04 J03 J02 J01 Juez Tabla 2. Tabla Table 2. Table

Tomo 50 • N° 1 • 2018 241 M. I. Césari, N. B. Ventrera, A.Gámbaro

- Estrategia metodológica para el análisis de datos borrosos (36).La En bibliografía el caso de sugiere usar funciones diversas alternade tipo Se establecen dos sistemas de tablas gaussianas,tivas de operadores se propone de desborrosificación implementar el de contingencia, a partir de los números borrosos agregados en la unión y las la agregación t del conjunto difuso ci, por el desvíométodo (parámetro de la Altura b )modificado; elevado al cuadrado, se divide Todos los datos son estandarizados mediantevaloraciones el borrosificadas.método de normalización correspondiente se utiliza la Ecuación 4. lineal en valores de 0 a 100, de esta manera finalmente para obtener el valor preciso se representa porcentaje de posibilidad k t(ci ) (4) ∑1 ( 2 .ai ) V  b elemento columna. La visualización de CRISP que asocia un elemento en fila con un k t(ci ) asociaciones se realiza a través de un ∑ ( 2 ) 1 b Análisis factorial de correspondencias simples (AFCS) (6, 14, 15, 18). donde: La interpretación, descripción y k = granularidad de la variable validación, se efectúa por las pruebas del lingüística (número de conjunto difuso) chi2, y prueba exactas de Fischer y el valor i de prueba Valor de Test (5, 6, 9, 19, 24, 29). (etiqueta lingüística de 0 a k-1) Para la puesta en práctica de la estrategia de = identifica a un conjunto difuso ai= centro de gravedad de cada análisis factorial y pruebas de asociación, 2 conjunto ci y b = desvió al cuadrado se utilizó el software de libre distribución

t (ci) = unión de los valor de pertenencia para uso académico DTM. Minería de Datos de los p panelista para un conjunto ci. y Textos, que trata la estadística exploratoria multidimensional de datos complejos, Para el caso de aplicación, a través de incluyendo datos numéricos y textuales (18); y el módulo de análisis sensorial del un valor colectivo, para cada característica, alas través valoraciones de la aplicación borrosificadas, del operador se calculó de para investigar 2015 (30). agregación "suma algebraica" (Ecuación 2, software comercial Xlstat, bajo la licencia pág. 240). Los resultados por muestra, se traspusieron en una tabla de contingencia. Resultados y discusión A partir de la Ecuación 3 (pág. 240), para cada etiqueta ls, se asignó un número A partir del cálculo del valor colectivo borroso según los parámetros (a y b) de la borroso, para cada característica, se variable lingüística. construyeron las tablas de contingencia A partir de las valoraciones borrosi- para cada atributo, de manera de comparar las muestras de tomate triturado. tablas de contingencia apropiadas, con En la tabla 3 (pág. 243), los datos asocian ficadas y agregadas, se construyeron las propuesta en el siguiente procedimiento difusos de las variables lingüísticas parafines dela explotacióncontinuar la deestrategia los datos de análisisdifusos las muestras (filas) con los conjuntos obtenidos (tabla 2, pág. 241). y representa el porcentaje de posibilidad, unautilizadas muestra en laestará borrosificación caracterizada (columnas), por un conjunto difuso en particular por la mayor posibilidad de pertenecer al mismo.

242 Revista de la Facultad de Ciencias Agrarias Sensometría con lógica difusa y métodos de análisis multivariados

Tabla 3. Tablas de contingencia representativas de la agregación difusa de todas las muestras para cada descriptor. Datos agregados y normalizados que indican porcentaje de posibilidad de pertenecer a un conjunto difuso. Resaltado en celeste, asociación de

valor crisp agregado de cada atributo. fila-columna con alto nivel de significación estadística (alfa 0,05) Dos columnas con el Table 3. Contingency tables representative of fuzzy aggregation of all samples for each descriptor. aggregated and normalized data indicating percent chance of belonging to a

(alpha 0.05) Two columns with crisp added value of each attribute. fuzzy set. Highlighted in blue, row-column association with high statistical significance AG- AG- AG- AG- AG- CO- CO- CO- CO- CO- Aspecto Agregación Consistencia c0 c1 c2 c3 c4 c0 c1 c2 c3 c4 general M954 0 0 0 7 100 0 0 0 7 100 4,93 4,93 M632 14 2 16 33 59 15 16 18 46 31 3,97 3,49 M125 2 29 17 19 58 46 47 18 15 1 3,81 2,04 M471 43 5 30 31 16 0 1 19 74 33 2,79 4,10 M580 3 44 17 5 57 16 30 19 45 17 3,56 3,13 M369 0 4 57 7 57 16 29 5 58 18 3,94 3,25 M293 3 47 60 5 14 100 21 1 0 0 2,85 1,19

Los resultados de la prueba exacta de entre dos características (muestra- Metha et al. (1983) y Connelly (2016), conjunto difuso), esto indica que el para caracterizar cada atributo, permiten mayor porcentaje de posibilidad se da en resaltar en la tabla, en celeste, el nivel de forma más o menos pareja entre esos dos conjuntos, por lo tanto ambas son carac- para cada descriptor respecto a la muestra- terísticas de esa muestra. conjuntosignificación posiblemente estadística asociado. de la asociación, Visualmente el tamaño indica la Los resultados de las pruebas calidad de representación en el mapa. estadísticas se expresan indicando la La interpretación de un punto pequeño probabilidad (p.value) de que un resultado cercano al centro, indica que el mismo no está asociado a una característica no sea una diferencia real. Si un resultado en particular debido a presentar una ocurreespecífico por puedacasualidad ocurrir 5 de por cada casualidad 100 veces, y distribución de posibilidad muy pareja se dice que la probabilidad es de 0,05. para todas las características sin poder Por lo general, un resultado estadístico se asociarla a alguna en especial. probabilidad de 0,05 o menos. No es posible posible validar la tendencia de que la leerconsidera la tabla significativo, directamente, solamente en este si tiene caso una el muestraCon altoM471 nivel es la de de peor significación, aspecto (c0), es análisis simultáneo de todas las muestras a no así para la consistencia, la muestra más través del Análisis factorial de Correspon- inconsistente es la M293. dencias Simple (AFCS), permite visualizar en Sin embargo, es posible observar que un mismo mapa perceptual las mismas de la muestra M471 también se acerca a un aspecto bueno, esto se debe a que la La proximidad de puntos, muestra posibilidad es mayoritaria casi para ambos lamanera asociación comparativa por mayor(figura 4,porcentaje pág. 244). de posibilidad. Si una muestra se encuentra problema de entrenamiento de los jueces. conjuntos (características), lo que refleja

Tomo 50 • N° 1 • 2018 243 M. I. Césari, N. B. Ventrera, A.Gámbaro

Figura 4. Mapa perceptual de la agregación borrosa de todas las muestras, comparativo del a) aspecto general y b) consistencia. Proximidad representa

Figure 4. Perceptual map of fuzzy aggregation of all samples, comparison of a) general appearance and b) consistency.asociación, Proximity tamaño nivel represents de significación. association, size and quality of

Visualmente se puederepresentation observar en and significanceconjunto difuso level. a la muestra. En el caso de la muestra M471 se observa la asociación M471 se encuentra en el medio del aspecto de un aspecto general tanto muy malo (c0) muyel plano malo de y labueno, figura siendo 4a, cómo su distribución la muestra de probabilidad mayoritaria para ambas del panel y la imposibilidad de discriminar características. elcomo aspecto bueno de (c3),dicha lo muestra que refleja por lala divisiónfalta de En cuanto a Consistencia no es posible una referencia. Sin embargo, el valor de test validar una tendencia para la muestra M632, indica la tendencia de que el grupo mayori- debido a la gran dispersión entre los jueces tario de jueces consideran la muestra de para valorar esta muestra, sin embargo se muy mal aspecto (AG-c0). puede observar visualmente en el plano de 3, lo medias aritméticas de las muestras y el que indica una muestra Consistente. valorLa de tabla test 4bobtenidos (pág. 245),a partir refleja de una las la figuraPara 4b,la suinterpretación proximidad al de conjunto los mapas C prueba de varianza de un factor a través resulta de gran importancia el uso del "Valor de Fisher, las medias características. A Test", que se calcula a partir de la prueba exacta de Fisher, siendo la tabla normalizada es posible observar que las medias están a valores de 0 a 100, los resultados coinciden distorsionadaspesar del nivel dey no significación muestran laestadístico, realidad, para la prueba del Chi2 afectadas por la alta dispersión del panel de para valores mayores a 1,95 un nivel de jueces en cuanto al aspecto de las muestras. ; (este valor refleja Siguiendo con el ejemplo, la muestra M471 de 2,58 un niel de alfa = 0,01). significaciónEn la tabla de 4a alfa (pág. = 0,05, 245), y separa sintetiza mayores el por una media esperada de 2,8 en aspecto, muyse caracteriza alejado de con la alto realidad nivel deque significación se expone test indica la validez en la asociación de un en la tabla 4a (pág. 245). perfil difuso de cada muestra, el valor de

244 Revista de la Facultad de Ciencias Agrarias Sensometría con lógica difusa y métodos de análisis multivariados

Tabla 4. difusos asociados por muestras a partir del porcentaje de posibilidad validado por los valores deComparativa test; b) media del aritméticaperfil difuso esperada y clásico de de los las atributos muestras sensoriales de tomate. medidos a) Conjuntos por muestra y validada por el valor de test (VTest >2 alfa = 0,05). Table 4. associated with samples from the percentage of possible values validated by test; b) expected Comparison arithmetic ofaverage fuzzy andof the classical sensory profile attributes samples measured tomato. per a) Fuzzysample sets and validated by the test value (vTest> 2 alpha = 0.05).

a) b) Variables Conjunto difuso % posibilidad Valor-Test Media esperada Valor-Test características M954 M954 CO-c4 47 14,26 *** Aspecto general 4,9 29,91 *** AG-c4 47 9,05 *** Consistencia 4,9 24,96 *** M471 M471 AG-c0 17 9,44 *** Consistencia 4,1 14,75 *** CO-c3 29 6,77 *** Aspecto general 2,8 -22,86 *** AG-c3 12 3,85 *** M632 M632 Aspecto general 4,0 7,85 *** AG-c3 13 4,37 *** Consistencia 3,5 5,49 *** M369 M369 AG-c2 23 5,47 *** Aspecto general 3,9 7,13 *** CO-c3 23 4,01 *** Consistencia 3,3 1,94 ** M580 M580 AG-c1 17 5,51 *** Aspecto general 3,6 -2,89 *** CO-c1 12 2,01 ** M125 M125 Aspecto general 3,8 3,78 *** CO-c1 19 5,48 *** Consistencia 2,0 -16,39 *** CO-c0 18 3,37 *** M293 AG-c1 12 2,41 ** Aspecto general 2,9 -21,01 *** M293 Consistencia 1,2 -29,26 *** CO-c0 40 13,30 *** AG-c1 19 6,22 *** AG-c2 24 5,92 ***

Conclusiones

Los resultados obtenidos, constituyen pueden utilizar diferentes variables y un instrumento de mejora a la evaluación ponderaciones. Sin dudas, inclusive, sensorial, optimizando la obtención de describen herramientas complementarias que aportan mucha información en cuanto La descripción de propiedades senso- al estudio del producto vegetal en fresco, rialesperfiles de de loscalidad productos sensorial es del complicada, alimento. mínimamente procesado o procesado. incluso para los expertos, ya que Entre ellas, un análisis de la dinámica y

Tomo 50 • N° 1 • 2018 245 M. I. Césari, N. B. Ventrera, A.Gámbaro evolución de atributos relacionados con propuesta ayuda a determinar en qué la calidad sensorial, estudio de factores atributos hay mayores discrepancia, lo - tamiento a través de la lógica borrosa. Lo del panel concentrándose en los descrip- propuestoinfluyentes se y consideramodelización una debase su inicialcompor de torescual permiterelevantes. planificar Otra característica el entrenamiento es que futuros trabajos generadores de nuevas es posible trabajar con datos faltan obser- metodologías instrumentales para la vaciones de algunas variables, sin implicar determinación de atributos de calidad, que se suprima de todo el vector que adaptación de tecnologías existentes, y representa a la unidad muestral. Final- desarrollo de nuevos dispositivos para uso en laboratorio o en línea. que los "valores test" basados en la prueba Quedan en evidencia las propie- demente, Fisher, los resultadosconstituyen obtenidos una herramienta confirma dades ventajosas del uso de números rápida para la interpretación y validación borrosos y métodos multivariados: el de los resultados de análisis factoriales. borrosa, es apropiado para calcular simili- del Análisis Multivariado a partir de tudesproceso cuando de borrosificación las características y agregación que se valoracionesSe puede borrosas, afirmar plantea que el un empleo nuevo miden involucran variables de diferente paradigma en la sensometría, y enriquece naturaleza (cuantitativa, cualitativa, el proceso de análisis sensorial de un binaria, textual). Los "números borrosos" alimento constituyendo un instrumento son capaces de captar por sí mismos la de observación apropiado, facilitando la vaguedad lingüística de palabras y frases explotación de datos sensoriales. Queda comúnmente aceptadas en los estudios abierta la discusión sobre la metodología sensométricos, como "bastante intenso", planteada y se requiere profundizar acerca "algo aceptable" o "ligero cambio". Se de las dispersiones de las funciones de logró representar información que casi pertenencia, las correlaciones de dichas siempre es poco precisa, de manera más funciones, etc. Lo dicho lleva a proponer apropiada y que facilita la convergencia nuevas líneas de investigación como la - orientada a la forma de estimar de manera tidos. Permite lograr mayor precisión y objetiva, los parámetros de la variable detalledel lenguaje en el análisis hacia multivariado significados de compar datos, lingüística en función de las valoraciones, sin que las valoraciones atípicas, afecten diseñando variables lingüísticas a la los resultados. También, la metodología medida de cada estudio.

Bibliografía

1. Ávila de Hernández, R. M.; González-Torrivilla, C. C. 2011. La evaluación sensorial de bebidas a base de fruta: una aproximación difusa. Universidad, Ciencia y Tecnología. 15(60): 171-182.

en: http://www.biblioteca.org.ar/libros/210470.pdf 2.3. Barda,Bécue-Bertaut, N. 2011. M.,Análisis Salazar, sensorial B. C.; Vinué,de los alimentos.P. F. 2009. FruticulturaExtensión del & Diversificación.análisis factorial Disponible múltiple

Estadística e Investigación Operativa; V Jornadas de Estadística Pública: Murcia, 10-13 jerárquicode febrero ade datos 2009: textuales: Libro de AplicaciónActas. p. 27. en sensometría. In XXXI Congreso Nacional de 4. Bonissone, P. P.; Decker, K. S. 2013. Selecting uncertainty calculi and granularity: An experiment

in trading-off precision and complexity. arXiv preprint arXiv: 1304.3425. 246 Revista de la Facultad de Ciencias Agrarias Sensometría con lógica difusa y métodos de análisis multivariados

5. Césari, M.; Rodríguez, D.; Rancan, C.; Merlino, H.; Britos, P. V.; García Martínez, R. 2008. Métodos municación aplicados a la minería de

6. Césari, R.;iconográficos Césari, M. 2012.de observación, Material pedagógico exploración de y cocursos de postgrado en métodos para textos.analizar In datos X Workshop como soporte de Investigadores a la investigación en Ciencias en ingeniería, de la Computación. Capítulo 03: 5 "Las p. técnicas del análisis multivariado de datos" y Capítulo 04 "Procedimiento de descripción y validación estadística", Maestría en Medio Ambiente de la UNCuyo y Especialización en Redes de Datos de la FRM, UTN, Mendoza, Argentina. 7. Connelly, L. M. (2016). Fisher's exact test. MedSurg Nursing. 25(1): 58-60. 8. Debjani, C.; Das, S.; Das, H. 2013. Aggregation of sensory data using fuzzy logic for sensory quality evaluation of food. Journal of food science and technology. 50(6): 1088-1096. 9. Díaz, S. P.; Fernández, S. P. 2004. Asociación de variables cualitativas: el test exacto de Fisher y el test de McNemar. Cuadernos de atención primaria. 11(5): 304-308. 10. Espinilla, M.; Martínez, L.; Pérez, L. G. 2008a. A linguistic multigranular sensory evaluation model for olive oil. International Journal of Computational Intelligence Systems. 1(2): 148-158. 11. Espinilla, M.; Martínez, L.; Pérez, L. G.; Liu, J. 2008b. Modelo de evaluación sensorial con

sobre Tecnologías y Lógica fuzzy. Cuencas Mineras (MieresLangreo). p. 249-255. 12. Ferreira,información M. S.; Santos, lingüística M. C.; Moro, multigranular T. M.; Basto, para G. elJ.; aceiteAndrade, de R.oliva. M.; XIVGonçalves, Congreso É. C.Español 2013. Formulation and characterization of functional foods based on fruit and vegetable

13. Fiszman, S. 2005. Análisis sensorial aplicado a la evaluación de las frutas y hortalizas residuecortadas. flour. nuevas Journal tecnologías of food descience conservación and technology. y envasado 52(2): de 822-830.frutas y hortalizas. Centro de Investigación en Alimentación y Desarrollo, AC, Hermosillo. México. 14. Greenacre, M. 2007. Correspondence analysis in practice. Second Edition CRC Press, 7 may. 2007. 296 p. 15. Greenacre, M. 1994. Correspondence analysis and its interpretation. Correspondence analysis in the social sciences. 3-22.

de Análisis sensorial. Valdediós, Villaviciosa, Asturias. 16.17. Guerrero,Guillaume, L.; S.; Guardia, Charnomordic, M. D. 1998. B. Evaluación2012. Fuzzy de inferencela fiabilidad systems: de un panel An integrated de cata. III modelingJornadas environment for collaboration between expert knowledge and data using FisPro. Expert Systems with Applications. 39(10): 8744-8755. 18. Langrand, C.; Pinzón, L. M. 2009. Análisis de datos: métodos y ejemplos. C. S. Perdomo (Ed.). Editorial Escuela Colombiana de Ingeniería Julio Garabito, Bogotá, Colombia. 388 p. 19. Lebart, L. 2007. DTM. Data and Text Mining, Software Estadística Exploratoria Multidimensional para datos complejos que incluyen datos numéricos y textuales. Disponible en: http:// ses.telecom-paristech.fr/lebart/ 20. Liébana, F. J. E. 2013. Modelo de evaluación sensorial para el aceite de oliva basado en una nueva escala lingüística no balanceada. Trabajo Tutelado de Iniciación a la Investigación. Universidad De Jaen. Disponible en: http://sinbad2.ujaen.es/cod/archivosPublicos/ dea/TTII_Estrella.pdf 21. 22. Loyola, N.; Acuña, C.; Fuentes, D.; Arriola, M. Production of cured, voided meat sausage with Little, R.apple J.; Rubin, pomade D. B. 2014.added Statistical (Malus domestica analysis )with and missing its impact data. in John nutritional Wiley & and Sons. sensorial values. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 50(1): 249-262. 23. Martínez, L. (2007). Sensory evaluation based on linguistic decision analysis. International Journal of Approximate Reasoning. 44(2): 148-164.

contingency tables. J. Amer. Statist. Assoc. 78: 427-434. 24.25. Pattee,Меhtа, H.С.; E. Patel, 2014. N. Evaluation R. 1983. A of network quality of algorithm fruits and for vegetables. performing Springer, Fisher's 14 exact nov. 2014.test in 428 r X p. с

Tomo 50 • N° 1 • 2018 247 M. I. Césari, N. B. Ventrera, A.Gámbaro

26. Ponce-Donoso, M.; Vallejos-Barra, O. 2016. Valoración de árboles urbanos, comparación de fórmulas. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 48(2): 195-208. 27. Stone, H.; Bleibaum, R.; Thomas, H. A. (Eds.). 2012. Sensory Evaluation Practices. Academic Press, 4th Edition. 448 p. 28. Torres, J. G.; Busto, O.; Mestres, M. 2011. Nariz electrónica. Aplicaciones enológicas. ACE: Revista de enología. 126: 3. 29. Upton, G. J. 1992. Fisher's exact test. Journal of the Royal Statistical Society. Series A (Statistics in Society). 395-402.

Excel desarrollada por Addinsoft 1996-2016. Disponible en: www.xlstat.com/es/ 30. Xlstat versiónproducts/xlstat-pro/ 2015, licencia para investigación. add-in de análisis estadístico para Microsoft 31. Zadeh, L. A. 1965. Fuzzy sets. Information and control. 8(3): 338-353.

Company. 32.33. Zadeh,Zadeh, L. A.2014a. 2015. Computing The information with Words: principle. Principal Information Concepts Sciences. and Ideas. 294: 540-549.Springer Publishing 34. Zadeh, L. A.; Fu, K. S.; Tanaka, K. (Eds.). 2014b. Fuzzy Sets and Their Applications to Cognitive and Decision Processes: Proceedings of the US–Japan Seminar on Fuzzy Sets and Their Applications, Held at the University of California, Berkeley, California, July 1-4, 1974. Academic press. 35. Zimek, A.; Schubert, E.; Kriegel, H. P. 2012. A survey on unsupervised outlier detection in high‐dimensional numerical data. Statistical Analysis and Data Mining: The ASA Data Science Journal. 5(5): 363-387. 36. Zimmermann, H. J. 2014. Fuzzy Set Theory-and Its Applications 3. Springer Publishing Company, 435 p.

248 Revista de la Facultad de Ciencias Agrarias SensorialRev. FCA UNCUYO. and nutritional 2018. 50(1): values 249-262. in meat ISSN sausage impreso with 0370-4661. apple pomad ISSN (en línea) 1853-8665.

Production of cured, voided meat sausage with apple pomade added (Malus domestica) and its impact in nutritional and sensorial values

Elaboración de embutido cárnico curado sellado al vacío con pomasa de manzana (Malus domestica) y su valoración nutricional y sensorial

Nelson Loyola, Carlos Acuña, Diego Fuentes, Mariela Arriola

Originales: Recepción: 26/08/2015 - Aceptación: 19/09/2016

Abstract

The research was to compare 4 treatments with different percentages of vegetable fats,fiber sugarsadded, replacingand phenols; animal sensory fat, determining attributes objectives, acceptability to use evaluate apple pomade the presence as source of of fiber in replace to meat sausage pork fat, assessment of nutritionalMalus recovery domestica as). fiber, The treatments were evaluated according to the goals set during the days 2, 15 and 30, to becoliform processed, bacteria, the resultsthe sausage of nutritional of pork includinganalyzes showedpomade differences apple ( in treatments with content fat. Regarding perceived by trained panelists thirteen observed differences in evaluatinghigher content sensory of pomace, attributes increasing such as the texture amount and of acceptability fiber and mainly of processed by decreasing sausages the when as much pomade apple was used. The results of microbiological analyzes met the requirements of the sanitary regulation of food Chile. The addition until 3% of apple pomade exhibited a higher score on the acceptability of the product.

Keywords

meat sausages • apple pomade • vegetable fiber

Department of Agricultural Sciences. Faculty of Agricultural and Forestry Sciences. Catholic University of Maule. Carmen 684. Curico. Chile. [email protected]. [email protected]

Tomo 50 • N° 1 • 2018 249 N. Loyola, C. Acuña, D. Fuentes, M. Arriola

Resumen

La investigación consistió en comparar 4 tratamientos con diferentes porcentajes de fibra vegetal adicionada, en reemplazo de la grasa animal, determinando como objetivos, sensorialesutilizar pomasa y aceptabilidad; de manzana presencia como fuente de bacterias de fibra coliformes, y reemplazo del embutido de grasa de animal carne ende cerdoembutidos con inclusión de cerdo, de valorización pomasa de nutricional;manzana (Malus fibra, domestica grasas, azúcares). Los tratamientos y fenoles; atributos fueron los resultados obtenidos en los análisis nutricionales demostraron diferencias en evaluados según los objetivos planteados durante los días 2, 15 y 30, de ser elaborados, disminuyendo principalmente el contenido de grasa. En relación con lo percibido por los tratamientostrece panelistas con entrenados, mayor contenido se observaron de pomasa, diferencias aumentando al evaluar la cantidad atributos de fibrasenso y- riales como la textura y la aceptabilidad de los embutidos elaborados, cuando se utilizó la mayor cantidad de pomasa de manzana. Los resultados de los análisis micro- biológicos cumplieron con lo exigido por el reglamento sanitario de los alimentos de Chile. La adición de hasta un 3% de pomasa de manzana fue sensorialmente aceptada en el producto.

Palabras claves

embutidos de carne • pomasa de manzana • fibra vegetal Introduction

Meat really constitutes an important which authorized condiments are added, component of any diet in the western to later undergo a ripening process (6). hemisphere, although it is not compulsory At present, it is intended to enlarge the due to the economic problems that affect period of time in which any food is ready some groups of people. to be eaten, as well as increasing a diet The principles that rule the engineering processing of food are the same ones used colors, aromas and textures, offering the necessaryvariety by nutrientswidening forthe good amount health of flavors, condi- improvement and search of the quality in any other field of engineering (9). The the producer (7). and it should be focused mainly on raw tionsDifferent and for organizations the seeking recommend of benefits forfat material.of meat productsThe same is thecharacteristics main objective can and sodium reduction, so that they might not be searched for a meat to be eaten not exceed the 30% of the requirements established and no more than 10% of such production of sausages (22). fat is saturated (8). afterRaw cooked and thancured that meat to besausages used in theare products that traditionally were used for sausage seems a good idea to contribute meat preservation through fermentation to itsThe added introduction value, thus of fiber to increase to a meat its and dryness. In general, they are produced population consumption, favoring and through the cutting of meat and fat, to helping in the digestive process in human

250 Revista de la Facultad de Ciencias Agrarias Sensorial and nutritional values in meat sausage with apple pomad beings. The addition of apple pomade seems - so that it is treated in such a way to obtain Fat content of pork 7% and fat were a good alternative in the fiber contribution, compared in a national network of super to the maximum usability of apples for the ofmarkets, rancidness. with Later, a temperature they were washed, of 2°C, an insipid and odorless final product, due weighedaroma and and pinky cut into color pieces without to grid signals and As a hypothesis it was considered that extraction of juice and aroma. the sausage. meat sausage would increase the content mixThe it soTamix® as to product obtain theis a finalbase massmixture of the addition of apple pomade to pork for the preparation of sausages, in this case, grilled sausage, that contain all the innocuousnessof fiber and would as a food. improve its texture andTo its sustainsensorial such acceptability, hypothesis, keeping it was its and necessary preservers. The ingredients werenecessary natural ingredients condiments, to offer such color,as: cayenne flavor determined as a main objective, to use nutritional,apple pomade sensorial as source and of microbiologicalfiber in replace andpeppers, sodium garlic, erythorbate. wild marjoram, Their soya physico fiber,- to meat sausage pork fat, to evaluate the polyphosphates, flavor suppliers, dextrose apple pomade added. allergens produced in lines where soy, whey appraisal of the pork meat sausage with chemical specifications are: 16% salt; the effects of apple pomade over the nutri- According to Codex 1999 (a) and 2013, The specific objectives were to evaluate sodium(milk ) and erythorbate flour (gluten is used ) are as an processed. antioxidant agent in the food industry because it helps totional identify appraisal, total coliformsthe contents in the of sausagesfiber, fat, produced;sugar and phenolsto verify in porkthe microbiologicalmeat sausages; requisites of Salmonella sp. and Staphylo- ofto toxicitymaintain and food side color effects. and flavor, as well as coccus aureus established in the chilean to enlargePig's thebowels storage were time withoutobtained any withkind sanitarian rules for food; and to evaluate sources granted by the CEAP that bought it to Tagler Food ®. Natural bowels highlight texture and level of acceptability of the qualities such as possessing a similar size sausagessensorial produced.attributes such as: color, flavor, with almost no microbiological weight due to the long-time curing. Apple pomade was obtained in Materials and methods Agrozzi enterprise, which is engaged in

The experiment was carried out in the Curicó province, latitude 34°52'38" S laboratory of basic sciences at the Catholic andthe productionlongitude 71°08'45" of juice, located West. inLater Teno, it University of Maule, Campus "Nuestra was dehydrated in an oven, brand Binder, Señora del Carmen", located in the region model FD 115 at 65°C for 48 hours and it of Maule, Carmen 684, Curicó province, was shredded in a mixer brand Somela, Chile, 684 Carmen St., 34°59'1.9278" S model BL1900. latitude and 71°14'19.701" W longitude. The mass of meat was mixed and made an homogeneous mass; 80% meat, 3% fat, with sources offered by the "Centro de 16% water, 0.5% Tamix®, 1.5% salt to AlimentosPork meat Procesados and fat(CEAP)". were obtained produce the sausage and after a generic

Tomo 50 • N° 1 • 2018 251 N. Loyola, C. Acuña, D. Fuentes, M. Arriola meaty base was obtained for all treatments The degree of intensity of the evaluated for each treatment were completed for were determined through a non-structured of 6.28 kg, then percentages assigned chart;attributes, besides color, the aroma, level of flavor acceptability and texture was evaluated through a structured chart with a the filling of the sausages, according to grilledthe treatments sausage assigned.were hanged Once up the for filling 24 each sensorial evaluation and to measure hoursfinished in up,the about same 70laboratory g of each in piece which of the1 to 9perception defined scale. degree At the timeof organoleptic to carry out they were produced at an environmental attributes, each of thirteen was given 10 g temperature of 25°C and 55 to 60% of relative humidity, to get airy and cured. at 100°C during 60 seconds; they were The pieces of previously selected meat offeredsamples, in previously a small white cooked plate. in boiling In general, water were cut into smaller pieces of about 5 to 10 cm, they were washed with clean sensorial evaluation and another chart to water and later they were frozen at a each panelist was given a first chart for vertical freezer brand Fensa, model FFV product. These charts allowed panelists to 4765 during 24 hours at -5°C to reduce its measure the level of acceptance of the final pollution. The cutting was carried out to To get down each panelist's opinion, offer their final perceptions (21). Meat and fat were grinded separately a line over the horizontal one of 13 cm somake as theto dose grinding each process ingredient, easier. according long,they were according asked toto thetick degreeeach attribute of intensity with to the assigned treatment. The grinding observed; being the least intense the left process was carried out with a small meat border of the line and more intense the right border of the line. with a 3 mm disc. To measure the general level of grinderThe additionbrand Porkert®, of ingredients: horizontal water, knife, salt, Tamix® and apple pomade was carried out on all samples given and after getting a after the grinding process. It consisted on acceptability of the final product, based incorporating all ingredients and on mixing the mass to later produce the sausage. accordingfirst impression, to a structured they were sensorial asked to chartstate The curing process was carried out evaluation.their likes and For dislikes that reason, about panelists each sample, were for 24 hours with environment light and temperature around 25°C, in the basic level of acceptance of the product, from 1 sciences laboratory. The storage was asked to circle from 1 to 9, to show their in a cold place at 2°C and 90% relative very much" (14). humidity during 30 days, simulating those "I do not like it very much" to 9 "I like it Determining the amount of fat It was carried out through Soxhlet conditionsParameters found evaluated in supermarket shelves. method, with previously dehydrated For sensory analysis samples in an oven brand Binder, model Two sensorial evaluations were FD-115 at 105°C for 6 hours. It consisted carried out 30 days after its production on a semi-continuous extraction with an to diminish the variability of results, once organic dissolving item (ethyl ether P.E. the required storing days have passed by. 40-60°C and Petroleum ether P.E. 40-60°).

252 Revista de la Facultad de Ciencias Agrarias Sensorial and nutritional values in meat sausage with apple pomad

0.01; 0.015; 0.02 and 0.025 mg of gallic difference in weight between the product acid per ml, measuring its absorbance with analyzed,The fat which content was is quantifiedweighed bybefore the a wavelength of 760 nm in an UV-visible the fat extraction and after the process

spectrophotometer,Presence of pathogenic brand PerkinElmer. microor- finishedDetermining (17). the vegetable fiber ganisms It was carried out through a gravi- It was carried out through a series of metric method, according to the Instituto microbiological tests, where the presence of total coliforms was determined through with previously dehydrated samples in ande oven Salud brand Pública Binder, de Chilemodel (ISP) FD-115 (2009), and 2001. The observation of the presence of defatted with sulphur acid, in a digester Staphylococcusthe chilean norm aureus 2635/2, was made made official through in

Five, which eliminated the rest of the 2002 and the observation of the presence amountof fiber of brand fat from Velp the Scientifica, sample, then serial it ofthe Salmonella chilean norm sp. 2671,was made officially through made the in was incinerated in an oven brand Omega, serial LMF at 500°C for 12 hours. all of them were analyzed in the micro- biologicalchilean norm laboratory. 2675, made The official samples in 2002;were Determining the amount of sugar carefully labeled to avoid confusions in It was carried out through the Luff- the results (16). Schoor method (12), with previously dehydrated samples in an oven brand Experimental design Binder and deffated, where the amount of simple and complex sugar in food carried out at random (DBCA) for the could be observed, in values expressed in evaluationThe study of usednutritional a block properties,design completely with a g /100 g of product. At the beginning sugar is dissolved in Ethanol dissolved in water the moments of its production and being the and after it is free from alcohol, they were amount95% level the ofpomade confidence, added being the main the factor. blocks analyzed through the already-mentioned The experimental unit was a meat method, before and after the investment, sausage of about 62 g, of a total amount of obtaining results by titration. 1,240 g for each treatment. For the sensorial evaluation of Determining the phenolic compounds organoleptic atributes, there was a design The Folin‐Ciocalteu test has been used completely carried out at random, with a for years to measure the content in total phenol compounds in natural products. factorial varietal test of a factor with However, the main mechanism this repeated95% level measures, of confidence, and underbeing thean ANDEVA amount method is a reduction reaction, thus it can the apple pomade added the main factor. be considered as a method to measure the Later, an exploratory test of data was total antioxidant activity (23). carried out, considering elements such as To measure total phenol, expressed averages, standard deviation, minimum in mg equivalent to gallic acid* 100 g-1 of rates and maximum rates as well as the product, it was designed a calibrating graphs; besides, methods of multiple curve with different concentrations 0.005; comparisons were carried out through the

Tuckey method (p > 0.05). Tomo 50 • N° 1 • 2018 253 N. Loyola, C. Acuña, D. Fuentes, M. Arriola

Four treatments were carried out; a treatments, due to its capacity and role witness one called T0 and three testing to retain liquid and, different from other treatments called T1, T2, T3. The experi- retaining elements. Besides, vegetable mental unit was 62 g, with three replicates per treatment, with different doses et al of apple pomade, animal fat and Tamix ®, containedfiber is not insoluble the apple in water pomade or fat. isMahawar near to detailed in table 1. 2.5%. (2012), in wet weight. state that the amount of fiber

increases when apple pomade is Discussion of results dehydrated;The percentage it happened of the in the fiber present value research because the dried weight is Fiber content between 25 and 30% of the wet weight of The results obtained from the evalua- the apple pomade. tions carried out in all treatments to the Content of total sugar (page 255). The results obtained in the tests contentValues of show fiber areamount shown of in vegetable figure 1 carried out in the treatments in regards to

According to the treatments assigned, (page 255). basedfiber contained on a dried in theweight, sausages where obtained. a great the Thecontent biggest of sugar amount are of shown total contents in figure of 2 sugar contained in sausages was obtained expressed in percentages in the sausages in those ones produced in treatments amount of the content of fiber is shown, that had a contribution of apple pomade, T1, T2 and T3, in contrast with sausages especially in treatments T1, T2 and T3, produced in treatment T0, with minor contrasting the sausage with T0 which quantities. For that reason, it is possible had not contribution of apple pomade. to say that the biggest amount of total Aloida et al. (2008) found something content of sugar contained in each sausage similar and said that the contribution of was closely related to the amount of apple pomade added in each treatment. soya fiber in meat products preserve its fiber percentage at the time to analyze its

Table 1. Detail of the treatments assigned for the production of sausages. Tabla 1. Detalle de los tratamientos asignados para la elaboración de embutidos.

Treatments

T 0 grilled sausage, 1.5% of salt. Sausage produced with 70% of pork meat, 10% of animal fat, 16% of water, 2.5% of Tamix® for T 1 grilled sausage, 1.5% of salt, 7% of apple pomade. Sausage produced with 70% of pork meat, 3% of animal fat, 16% of water, 2.5% of Tamix® for T 2 grilled sausage, 1.5% of salt, 5% of apple pomade. Sausage produced with 70% of pork meat, 5% of animal fat, 16% of water, 2.5% of Tamix® for T 3 grilled sausage, 1.5% of salt, 3% of apple pomade. Sausage produced with 70% of pork meat, 7% of animal fat, 16% of water, 2.5% of Tamix® for

254 Revista de la Facultad de Ciencias Agrarias Sensorial and nutritional values in meat sausage with apple pomad

10 8.84a 9 8.43a 8 7.34b 7 g e 6 n t a e c 5 e r p

r 4 e b

F i 3

2 1.37c 1 0 T0 T1 T2 T3 Treatments

* Different letters show significant statistical differences (p = 0.05). Figure 1. * Letras distintas muestran diferencias estadísticas significativas (p = 0,05). Figura 1. Results with average valuespor tratamiento.obtained in the content of fiber per treatment. Resultados con valores promedios en la medición del contenido de fibra

10 9.18a 9 8 7.29a 7

g e 5.96ab 6 n t a e

c 5 r e p

r 4 a g

u 3 S 2.3c 2 1 0 T0 T1 T2 T3 Treatments

* Different letters show significant statistical differences (p = 0.05). Figure 2. * Letras distintas muestran diferencias estadísticas significativas (p = 0,05). total content of sugar for each treatment. Average values of the results obtained in the tests carried out to know the Figura 2. Resultado con valores promedios obtenidos en la medición del contenido

azúcares totales por tratamiento. Tomo 50 • N° 1 • 2018 255 N. Loyola, C. Acuña, D. Fuentes, M. Arriola

According to Mahawar et al. (2012), to the highest amount of pomade it had after measuring the nutritional values of the apple pomade, 3.6 g of sugar were obtained in 100 g of pomade, according to (figureContents 2, page of 255). fat test carried out in such research; besides According to the results obtained in the identifying pectins, carbohydrates, cellu- tests carried out in sausages in regards to loids and proteins. For that reason, they the content of fat, there was a little tendency pointed out that the apple pomade is considered to be a high nutrient source. fat in those sausages that had less contri- et al. (2010), butionbut not of significant apple pomade to a higherin its production, amount of stated that the composition of sugar in apple as in the treatment T0 At the same time, Queji The sausages produced in treatment (figure 3). glucose and sucrose, with a value near 40% T1, which had a higher contribution of ofpomade the total is a amount kind of theof soluble simple solids.type; fructose, apple pomade in its production apparently showed the least content of fat, but it was according to the evaluations carried out on the Insausages the produced, present the scientific total amounts work, In this sense, in spite of adding apple of sugar were found out, either simple pomadenot significantly to the sausages different. produced, there was no variation in the contribution of the total amount of fat, and no statistical difference or complex kinds of sugar, ratifying the to sausages produced in treatment T1 due was found among the sausages indepen- major amounts of total sugar associated dently produced in the different treatments.

20 18.82a 18.65a 18 17.18a 16

14 12.99a % ) (

t 12 a f

o f

10 n t s

e 8 o n t

C 6 4 2 0 T0 T1 T2 T3 Treatments

* Different letters show significant statistical differences (p = 0.05). Figure* Letras 3. Average distintas values muestran of diferenciasthe results estadísticas obtained significativas in the measurement (p = 0,05). of fat per treatment. Figura 3. Resultados con valores promedios obtenidos en la medición del contenido de grasa por tratamiento.

256 Revista de la Facultad de Ciencias Agrarias Sensorial and nutritional values in meat sausage with apple pomad

Content of phenol The results obtained in the tests carried In regards to the sausages produced in out in the treatments in regards to the treatment T0, which had no contribution of apple pomade, the small amount of In the measurement of the total phenol found was mainly because of the content ofof phenol phenol, are with shown a wave in figure length 4. of 760 nm, there was statistical difference in Tamix® had, it has direct coincidence the content of phenol because of the values withcontribution what was of previously vegetable stated.fiber from Soya obtained according to different homoge- The total yielding of phenol, after a test carried out with pure apple pomade is in the The increase in the content of phenol was range of 200 y 300 mg/100 g, being higher possibleneous subgroups due to the by amount the Tukey of apple test. pomade than the amounts obtained in the present added to the sausages in each treatment and research, what probably happened at the it is related with Preedy et al. (2013), who time it was cropped and due to the level of pointed out, it would be possible because ripeness of the apple used and of pomade these elements are only found in plants and obtained, as well as because of the mixture used in each treatment (18). in the present research. This would explain vegetable, confirming the results obtained that the sausages produced in treatments T1,

T2 y T3 had a higher amount in the content of phenol.

100 e l

p 90 87.16a m a s 80 e t h

69.48ab 70 o f g 60 53.84ab 1 0

g / 50 m 40 n o l e

h 30 p 20.70b

o f 20 n t e 10 o n t C 0 T0 T1 T2 T3 Treatments

* Different letters show significant statistical differences (p = 0.05). Figure 4. * Letras distintas muestran diferencias estadísticas significativas (p = 0,05). content of phenol for each treatment. Average values of the results obtained in the tests carried out to know the Figura 4. Resultado con valores promedio obtenidos en la medición del contenido de fenoles por tratamiento.

Tomo 50 • N° 1 • 2018 257 N. Loyola, C. Acuña, D. Fuentes, M. Arriola

General acceptability

The results obtained in the for sensory y T2, considered to be granular, because analysis, showed a higher level of acceptance the apple pomade retains a big amount of by panelists for sausages produced in treatments T0 and T3 sensation of dryness in the mouth. waterSausages of the masswith produced,the highest provoking levels of a Additionally, sausageswith values produced 7.5 "I lightly in treat like- acceptability were produced in treat- it" and 7.7 "I like it very much" (figure 5). ments T1 and T2, were the ones that showed ments T0 without apple pomade and T3 that contained the lowest amount of apple well as of an increase in the contents and pomade, coinciding with the percep- the highest contents of fiber and sugar, as phenol; therefore, that treatment (T1, T2) did tions of organoleptic attributes, being not show good acceptance by the panelists the attributes color and texture the most controversial aspects because they vary panelists made to such products and their all this was reflected in the best evaluations added (table 2, page 259). For panelists, the sausages obtained in according to the amount of vegetable fiber level of acceptance (figure 5). treatments T1 and T2 obtained the lowest Organoleptic attributes Average values of the results obtained in the sensorial evaluations of color, marks with values of 5.5 "I neither like it tonor the dislike brown-red it" and color5.95 "Iand lightly to the like texture it". table 2 (page 259). The lowest mark by panelists was given aroma, flavor and texture are shown in of the sausages produced in treatments T1

9 7.77a 8 7.50a

t y 7 i l i

b 5.96b 6 t a 5.54b p e c

c 5 a

o f 4 s k r a 3 m

l a

r 2 n e

G e 1

0 T0 T1 T2 T3 Treatments

* Different letters show significant statistical differences (p = 0.05). Figure 5. Average* Letras distintasvalues ofmuestran the results diferencias obtained estadísticas in the significativas sensorial (p evaluations = 0,05). carried

Figura 5. Resultados promedios por tratamientos obtenidos en la evaluación sensorial out with acon structured la cartilla primer estructurada to know de the aceptabilidad general levels general. of acceptability.

258 Revista de la Facultad de Ciencias Agrarias Sensorial and nutritional values in meat sausage with apple pomad

Table 2. Average values of the results obtained in the evaluations of sensorial attributes. Tabla 2. Resultados promedios por tratamientos obtenidos en la evaluación de atributos organolépticos. Color Aroma Flavor Texture Media Media Media Media

T0 4.65 a 8.07 a 8.46 b 5.00 a T 8.34 b 6.15 a 6.69 a 8.85 b Treatments 1 T2 6.73 ab 8.27 a 8.04 ab 7.89 b

T3 5.27 ab 8.69 a 8.73 b 5.77 a

* Different letters show significant statistical differences (p = 0.05). * Letras distintas muestran diferencias estadísticas significativas (p = 0,05).

Color attribute which is typical of fresh meat (2). In the present research, what was also observed between sausages produced in treat- There were significant differences ments T0 and T1 Tamix® support the red color of meat by panelists, referred to the attribute thereforeby Bazán does (2008), not ithelp was to confirmed eliminate thatthe color, pointing out(p =that 0.038) those and sausages perceived in treatment T0 showed a lighter color, almost brown darkening of the vegetable fiber. 1 Aroma attribute a color near red. It would possible due to For aroma attribute, there were not pinky and those produced in treatment T observed statistical differences among treatments (table 2). Panelists graded this contributedthe dark tone by the apple meat pomade. mass was turned attribute as intense in sausages, probably to, which depended on the amount of fiber associated to the amount of fat in the products elaborated. This could be the The coffee-like color adopted by the reason why panelists perceived an intense itsfiber vegetable was due tissues, to the which lack of is watertransferred, in its aroma, but they did not associate it with invegetable a great tissues,extent, tocausing the food a darkening where it inis the addition of fruits such as apples. These results do not coincide with what Salas and original color. A clear example about it is Olivas (2011), who described and stated added to, provoking a darkening of the that apples produce volatile chemical compounds which are responsible of the shownIn spite in cereals of including of the "flakes" Tamix®, kind it tois characteristic aroma of the fruit. normalwhich fiber that is theadded product (8). produced may Flavor attribute Flavor attribute in sausages was perceived thatadopt one a coffee-like of the functions color, produced of the perseby thein a different way by panelists during the verantdarkening that ofcontains the fiber, Tamix® because is to highlight knowing the red coloring of meat as it helps differences among sausages produced in evaluation process, observing significant myoglobin, an exclusive element of blood, treatment T1 and those in treatments T0 and

T3 to fix oxygen and to highlight the red color (p = 0.028 and p = 0.029), respectively. Tomo 50 • N° 1 • 2018 259 N. Loyola, C. Acuña, D. Fuentes, M. Arriola

Sausages produced in treatments T0 Determining Salmonella sp. and T3 were perceived by panelists with an From the microbiological point of view, all sausages tested showed an absence produced in treatment T1 that were of the Salmonella bacteria. According characterized"intense flavor", as in "insipid", contrast mainlywith sausages due to to Ministerio de Salud de Chile (2008), through the sanitary requirements of food As Salas and Olivas (2011) pointed out, (not shown data). the fiber content of apple pomade added. explaining for the present research, that Recounting Staphylococcus aureus theflavor variation includes of the flavor amount itself of andingredients aroma, According to Ministerio de Salud de added to sausages would be responsible Chile (2008), through the sanitary requirements of food, in the chapter related to of theTexture flavor attributeperceived. beef, norms rule that this group of food In regards to texture, panelists did shouldmicrobiological have a given specifications value for the raw presence dried not perceive differences in sausages from of S. aureus, minor to 102 ufc/g (<10 ufc/g), treatments T0 and T3 for those sausages in treatments T1 and T2 (p = 0.2), as well as requirementsthrough which of this food kind were of accomplished.food could not be risky for health. In this test the sanitary (p = 0.121). Those meant there were no Sausages in treatments T1 and T2 were Recounting total mushrooms, yeast evaluatedstatistically with significant a "more (table granular 2, page texture", 259). and coliforms different to sausages from T0 and T3 that Recounting total mushrooms, yeast were evaluated with a "soft texture". and coliforms showed the presence of According to Aloida et al. Colony Forming Units (CFU), exceeding 1.0 x 103 ufc/g in coliforms and 7.5 x 105 the retention of liquids, affecting(2008), fibers and ufc/g in mushrooms and yeast. are soluble in water and fat, which flavors No matter Codex Alimentarius (1999) is aimed at recommending international theninfluencing the hardness in the texture of the ofproduct the product, would microbiological criteria, but governments alsothus increase. if the amount of fiber increases, could choose and adopt international According to what has been stated by microbiological criteria from Codex in the already-mentioned authors, panelist their national systems or could use them as a starting point to achieve their public sausages, especially in those in treat- health goals. In this respect, the Minis- could find differences in texture in the ments T1 and T2 with T3 terio de Salud de Chile (2008), does not case differences associated to possibilities establish the content of mushrooms, to chew and swallow the, findingproduct, in being each yeast and coliforms as a microbiological those from treatments T1 and T2 the most According to Leyva et al. (2008), time, those of a least level of acceptance, coliformsparameter are in this highly kind resistant of food. to natural accordingdifficult ones, to what which was were, explained at the before; same conditions and can undergo dryness, although they can not stand under selecting the product evaluated in the low temperatures and they are inacti- panelists granted average marks of 5.5, vated by pasteurizing. Mushrooms and category "I neither like it nor dislike it".

260 Revista de la Facultad de Ciencias Agrarias Sensorial and nutritional values in meat sausage with apple pomad yeast grow slower in non-acid food that because these treatments were developed preserves humidity. one with the highest percentage of apple Sausages produced in the present pomade and this was perceived by the research allowed to ensure their panelists highest score when evaluated innocuousness, according to the sanitary the color and texture attributes. Sausages requirements of food and the national made without apple pomade or low

Codex (15). percentage of this, as shown by T0 and T3, panelists perceived attributes of aroma

Conclusions acceptability of the product. andAccording flavor, reflecting to the higher Chilean score sanitary on the

Sausages made in T1 and T2 treat- - biology contamination in the grilled sausagerequirements elaborated, there wasindependently not risk of microof the acceptabilityments exhibited by the higher panelists. content This of fiber,was treatment carried out. sugars and phenols, which reflected lower

References

1. Aloida, M.; Pérez, D.; Fernández, M.; Hernández, U.; Beldarraín, T.; Frómeta, Z.; Rodriguez, F. 2008. Disponible en: < Productos cárnicos con fibra de soya: Una alternativa para la población celíaca. 2. Bazán, E. 2008.http://sibib2.ucm.cl:2518/ehost/pdfviewer/pdfviewer?vid=4&sid=54b83c6e-5c21- Nitritos y Nitratos: Su uso, control y alternativas en embutidos cárnicos. En: 454a-a134-6d4d21cb59cc%40sessionmgr198&hid=121Nacameh: Difusión vía red de cómputo semestral sobre>. avances Consulted: en Ciencia May 06, y 2014. Tecnología de la carne. Estado de Mexico. 2: 160-187. 3. Codex Alimentarius 1999. Norma del Codex para contaminación en alimentos cárnicos. Disponible en: <

http://www.codexalimentarius.org/normas-oficiales/lista-de-las- normas/es/?no_cache=1< >. Consulted: May 08, 2014. 4. Codex Alimentarius 1999 (a). Norma del codex para grasas especificadas. Disponible en: 5. Codex Alimentarius.http://www.codexalimentarius.org/normas-oficiales/lista-de-las-normas/es/?no_ 2013. Norma general del Codex para Aditivos Alimentarios. Disponible en: cache=1< >. Consulted: May 08, 2014.

6. Federaciónhttp://www.codexalimentarius.org/normas-oficiales/lista-de-las-normas/es/?no_ Madrileña de Detallista de la Carne. 2005. Elaboración de embutidos frescos. Revista cache=1Ediporc.>. Disponible Consulted: en: May < 10, 2014. EDIPORC%2081.pdf 7. Fellows, P. 2007. Tecnología del procesadohttp://www.ediporcguia.com/sites/default/files/revista/ de los alimentos. Zaragoza. España. Editorial Acribia. S.A. 707 p. >. Consulted: December 16, 2013. 8. Gil, A.; López, M. 2010. Tratado de nutrición: Composición y Calidad nutritiva de los alimentos. Madrid, España. Editorial Médica Panamericana S.A. 2° edición. 2: 812 p. 9. Ibarz, A.; Barbosa, G. V.; Garza, S.; Gimeno, V. 2000. Métodos Experimentales en la Ingeniería Alimentaria. Editorial ACRIBIA, S.A. Zaragoza. 283 p.

Método gravimétrico. Disponible en: Á (Autor). Temas de Higiene de los Alimentos. Consulted: La Habana, March Cuba. Editorial24, 2014. Ecimed. 20- 28 p. Editorial Mundi Prensa. 570 p.

12. Madrid, A. 1994. Métodos oficiales de análisis de los alimentos.

Tomo 50 • N° 1 • 2018 261 N. Loyola, C. Acuña, D. Fuentes, M. Arriola

products. Food and Bioproducts Processing. Disponible en:

14. Meilgaard,cl:2370/ehost/pdfviewer/pdfviewer?vid=4&sid=11563360-2037-4a2a-9658-a785d M.; Civille, G.; Carr, B. 1999. Sensory Evaluation Techniques. 3° edición. Estados 58ffa3c%40sessionmgr4004&hid=4207Unidos. Editorial CRC Press. 354 p. >. Consulted: March 18, 2014. 15. Ministerio de salud de Chile. 2008. Reglamento Sanitario de los Alimentos. Santiago. Chile. Galas Ediciones. 151 p. 16. Ministerio de salud de Chile. 2011. Memoria departamento de nutrición y alimentos. Disponible en: < http://web.minsal.cl/ALIMENTOS_Y_NUTRICION

>. Consulted: August 27, 2014. 17. Nielsen, S. 2003. Food Analysis Laboratory Manual; Kluwer Academic/Plenum Publishers, Nueva York. USA. 142 p. 18. Preedy, V.; Srirajaskanthan, R.; Patel, V. 2013. Handbook of food fortification and health. Volumensimple sugars, II. London. malic UK.acid Humana and total Press. phenolic 453 p.compounds in apple pomace by infrared 19. Queji, M.spectroscopy D; Wosiacki, and G; PLSR.Cordeiro, International G; Peralta-Zamora, Journal of P.;Food Nagata, Science N. and2010. Technology. Determination Paraná, of Brazil. 602-609. 20. Salas, N.; Olivas, G. 2011. El aroma de la manzana. Revista Interciencia. Disponible en: Consulted: May 18, 2014. 22. Varnam, Alan H.; Sutherland, Jane P. 1998. Carne y productos cárnicos: Tecnología química y Monographs.microbiología. New Editorial York. ACRIBIAEE. UU. Academic S.A. Zaragoza. Press. España. 338 p. 423 p. 23. Waterman, P. G.; Mole, S. 1994. Analysis of Phenolic plant Metabolites. Editorial Wiley. 238 p.

Acknowlegments

support and colaboration. ThisAknoledge research was to Centro sponsored de Elaboracion by the Center de Alimentos of Processed Procesados Food (CEAP) (CEAP) of the for Regional your Government in Maule and the National Commission of Science and Technology (Conicyt) in Chile.

262 Revista de la Facultad de Ciencias Agrarias AnalysisRev. FCA UNCUYO. of some 2018.physical, 50(1): chemical 263-271. and ISSN microbiological impreso 0370-4661. aspects ISSN of (en honey línea) sample 1853-8665.

Analysis of some physical, chemical and microbiological aspects of honey samples produced and consumed in Turkey

Análisis de algunos aspectos físicos, químicos y microbiológicos de las muestras de miel producidas y consumidas en Turquía

Sezgin Bakirdere 1 *, Tolga Yaroglu 2, Nihan Tirik 3, Mehmet Demiroz 4, Abdullah Karaca 5

Originales: Recepción: 27/08/2015 - Aceptación: 17/08/2016

Abstract

Analysis of honey produced in the western part of Turkey was carried out in this study. Fifty honey samples, collected from the local market in this region were analyzed for their physicochemical parameters including hydroxymethylfurfural (HMF), electrical conductivity, sucrose, free acidity, moisture and water insoluble impurities, in addition to pathogenic microorganisms present. HMF amounts determined in 47 samples were found to be between 1.9 and 98.0 mg/kg with good reproducibilities (%RSD: 3.2% or better). There were no pathogenic microorganisms in any of the investigated samples. Electrical conductivity that gives information about their mineral contents was measured, and the mean value was found to be 0.33 mS/cm (N=34). In general, most of the samples were considered to meet the requirements of Turkish Food Codex and European Commission Directives.

Keywords

honey • quality • HMF • sucrose • moisture

* [email protected] 21 FacultyYıldız Technical of Veterinary University. Medicine. Department Ankara University. of Chemistry. Ankara. İstanbul. Turkey. Turkey.

4 Karacabey MYO. Uludag University. Karacabey-Bursa. Turkey. 3 Department of Biology. Samsun 19. Mayıs University. Samsun. Turkey.

5 Faculty of Veterinary Medicine. Fırat University. Elazig. Turkey.

Tomo 50 • N° 1 • 2018 263 S. Bakirdere et al.

Resumen

En este estudio se analizó muestras de miel producida en la zona oeste de Turquía. Se trabajó con 50 muestras del mercado local de la región, en las cuales se determinaron eléctrica, sacarosa, acidez libre, humedad e impurezas insolubles en agua además de microorganismosparámetros físico-químicos patógenos incluyendopresentes. elLas hidroximetilfurfural cantidades de HMF (HMF), determinadas conductividad en 47 muestras oscilaron entre 1,9 y 98,0 mg/kg con buena desviación estándar de la repro- ducibilidad (% de RSD/DSR 3,2% o mejor). No se encontraron microorganismos patógenos en ninguna de las muestras analizadas. La conductividad eléctrica, que aporta información sobre el contenido mineral, resulta en un promedio de 0,33 mS/cm (N=34). En general se encontró que la mayoría de las muestras cumple los requerimientos del Codex alimentario turco y de las directivas de la Comisión Europea.

Keywords

miel • calidad • HMF • sacarosa • humedad Introduction

does not provide any information about reliable sweetener which has been used botanical and/or geographical origin (2). by Honeyhuman isbeings known until as thenow. first High and nutri most- Electrical conductivity, closely related tional value and the fast absorption of its to the concentration of mineral salts, carbohydrates upon consumption are some organic acids, and proteins, is another of the main characteristics of honey (11, 32). parameter in quality control, as well It was found that honey has antimicrobial as for the discrimination of honeys. properties in addition to some positive Measurement of honey electrical conduc- health effects in healing wounds and burns, tivity is an effective tool to ascertain its and in cancer care (3, 9, 16). mineral contents. In literature, many Floral origins utilized by bees and studies can be found on this topic (1, 33). climatic conditions are the main factors It has been shown that free acidity in affecting its composition and properties. honey is an indication of its organic acid Honey mainly consists of water, sugars content and this parameter is useful for (glucose, fructose, sucrose, maltose, and the evaluation of honey fermentation (19). higher sugars), gluconic acid, lactone, Another criterion for honey quality is its nitrogenous compounds, minerals, and content of simple carbohydrates (sugars). some vitamins (21). The sugar content of honey is about Hydroxymethylfurfural (HMF) content 95% dry matter, mainly in the form of is the parameter used for the evaluation of monosaccharides. Glucose and fructose honey freshness and/or overheating. are the predominant sugars in honey. The European regulation allows a Sucrose is in low amounts because it is maximum HMF content of 40 mg/kg (10). converted to glucose and fructose in the In general, HMF is determined in honey process of honey maturing (8). samples during quality control, but HMF

264 Revista de la Facultad de Ciencias Agrarias Analysis of some physical, chemical and microbiological aspects of honey sample

The water content of natural honey and barbituric acid (0.5%) were applied for samples is an indicator of the degree of the color development. All of the measure- maturity and storage method. Hence, ments were performed at 550 nm. moisture determinations have long been Intensities measured were used to done to assess the quality of natural honey calculate the HMF amounts in the samples. samples (5). Electrical conductivity of the honey The main purpose of this study was to samples was measured with a TetraCon analyze honey samples for their physico- 325 model LF 330 conductivity meter. Sucrose cannot react with the Fehling they are in conformity with the Turkish Food reagents, but the other reducing sugars give Codexchemical and parameters European Commission to figure out Directives whether positive reactions. In the case of heating in terms of hydroxymethylfurfural, electrical at 65-67°C and with the help of conc. HCl, conductivity, sucrose, free acidity, moisture, sucrose splits into its monosaccharides, water insoluble impurities and pathogenic and then it readily reacts with the Fehling microorganisms. reagents positively. Hence, HCl was added to honey samples and the mixture was heated to 65-67°C for the conversion. Materials and Methods Fehling A solution (hydrated copper (II) sulfate in water) and Fehling B Chemicals solution (potassium sodium tartrate and Only analytical reagent grade sodium hydroxide in water) were used chemicals were used throughout this for the determination of sucrose. Reaction study. Pure water, obtained from a Nüve with Fehling reagents using 2-3 drops of methylene blue with continuous boiling used in all sample and standard prepa- gave a brick-red precipitate. rationNS 112 processes. water purification All working system, standards was The volumes of honey solution used and solutions were prepared daily and to obtain the brick-red precipitate before stored in the refrigerator. and after inversion were used for the calculation of sucrose in honey (26, 31). Methods For the moisture determinations, a All of the parameters investigated Macnimpex Abbe Refractometer was used. were determined according to procedures This method is based on the measurement listed in Turkish Standards (TS). of the refraction extent as light passes TS 3036 standard (26, 31) was used for through a sample. The amount of refraction the determination of hydroxymethylfurfural, sucrose, free acidity, moisture and in the honey sample. All measurements water-insoluble impurities, and TS 13366 wereis related done to atthe 20°C. amount Refractive of solid andindex fluid as standard (30) was used for the electrical measured by refractometry was converted conductivity measurements. to %moisture using the conversion table Each sample was analyzed 3 times for given in TS 3036 standard (26, 31). the calculation of both the mean value and Free acidity of the honey samples was standard deviation. measured by titration with 0.10 M NaOH A Nova 60 UV-VIS instrument was used using phenolphthalein as indicator. for the determination of hydroxymethylfur- For the determination of water-insoluble fural. For each HMF measurement, 10.0 g of impurities, 20.0 g honey was mixed with honey was used. Para-toluidine (100 g/L) distilled water set to 80°C.

Tomo 50 • N° 1 • 2018 265 S. Bakirdere et al.

Although these honey samples were crucible and the crucible was washed several supplied in this region, the origin of the timesThe with mixture hot water was at filtered80°C. The by crucible Gooch honey samples analyzed is from different was dried at 135°C until no difference was observed between 2 consecutive weight highlands in different parts of Turkey. measurements (26, 31). typesAll the of samples wild flowers taken and on transferred mountain In the determination of pathogenic to the laboratory were kept at 2-4°C until microorganisms, procedures prescribed analysis. Samples were analyzed within a in Turkish Standards were used: TS week for hydroxymethylfurfural, electrical 12812 for Clostridium botulinum (25), TS conductivity, sucrose, free acidity, moisture, EN ISO 16654 for E.coli O157:H7 (27), TS and water-insoluble impurities to avoid any EN ISO 6579 for Salmonella spp. (28), TS possibility of decomposition. A map showing 6582-2 for Staphylococcus aureus (24), TS EN ISO 7937 for Clostridium perfringens (29), and TS EN ISO 11290-1 for Listeria Kocaeli,the sample Sakarya origins isand shown Düzce, in figure and 1. their monocytogenes (23). townsIn can the be figure seen. 1,Total the surface western area cities and population of this region are 11122 m2 Sample collection and storage and 2771198, respectively. Fifty honey samples were obtained from local markets in the western part of Turkey (Kocaeli, Sakarya and Düzce).

Source / Fuente: http://www.csb.gov.tr Figure 1. Sample points in Turkey. Figura 1. Puntos de muestreo en Turquía.

266 Revista de la Facultad de Ciencias Agrarias Analysis of some physical, chemical and microbiological aspects of honey sample

Results and Discussion In another study, determinations of HMF in 11 types of honey sold in Porto The results for hydroxymethylfur- Alegre were made and it was observed fural, electrical conductivity, sucrose, free that HMF amounts were in the range of acidity, moisture, and water-insoluble 0.191 to 6.206 mg/kg (6). impurities are given in table 1 (page 268). In another study performed in Argentina Each sample was analyzed at least 3 times (one of the World's largest producers), and mean value of the results is reported. the physico-chemical properties of honey Free acidity, humidity and water insoluble produced in the province of Chaco were impurities were determined in all samples analyzed for the contribution to the charac- while HMF, electrical conductivity and terization of these honeys and HMF amount sucrose were determined in 47, 34 and was found between 2.3-24.5 mg/kg (20). 49 samples, respectively. Electrical conductivity Hydroxymethylfurfural Electrical conductivity of honey HMF is a parameter used for honey samples was measured to obtain infor- quality (2). It can be seen in table 1 mation about their mineral contents. (page 268), that 47 honey samples were The mean value was found to be analyzed for their HMF contents. Concen- 0.33 mS/cm (N=34). Conductivity of trations of HMF were found to be in the samples was measured and the results range of 1.9-98.0 mg/kg, with a mean were in the range of 0.01 to 0.76 mS/cm. value of 25.64 mg/kg. In TFC and EUD, the allowable maximum In the Turkish Food Codex (TFC) and limit for this parameter is 0.80 mS/cm the European Union Directive (EUD), the (10, 22). It is seen in table 1 (page 268), maximum limit for HMF is given as 40 mg/kg. that all of the honey samples analyzed met In this study, 7 honey samples were found the TFC and EUD criteria. Similar results to be of unacceptable quality based on the were found by Feas (2010) and others who HMF limits given in TFC and EUD (10, 22). investigated some properties of artisanal honey samples (n = 45) collected from the well above the legal limit might be due to northwest of Portugal. the Significantlyheat-treatments higher of samples. values which are Electrical conductivity was found in In literature, there are many studies the range of 0.46 to 0.94 mS/cm, with on the HMF content of different honey mean value calculated as 0.66 mS/cm. samples. In one study, the physicochemical In another study, Gomes et al. (2010), parameters of honey samples taken from analyzed 5 commercial honey samples Marmara region and East Anatolia of taken from Portuguese markets for Turkey are provided and the HMF amount were 31.8 ± 1.20 and 30.5 ± 1.38 mg/kg parameters including electrical conduc- in honey samples from these 2 regions, tivity,their and floral microbial origins, safety. physicochemical It was found respectively (15). Gulfraz et al. (2010) that electrical conductivity ranged from analyzed 40 samples of different honey 0.19 to 0.53 mS/cm (13). types collected from Pakistan and concentrations of HMF were found to be 30.5 ± 0.49 mg/kg. The HMF results were comparable with those above (14).

Tomo 50 • N° 1 • 2018 267 S. Bakirdere et al.

Table 1. Results for honey samples interested (number of replicates for each sample is 3). Table 1. Resultados para las muestras de miel de interés (el número de repeticiones para cada muestra es 3).

Electrical Sucrose. Free acidity. Water insoluble HMF amount. Humidity conductivity. g/100g meq/kg impurities. mg/kg, %RSD: mS/cm %RSD: %RSD: mg/100 g %RSD: 3.2% 0.9% or %RSD: 0.5% 6.2% or 1.4% or %RSD: 5.7% or or better better or better better better better

Codex Limits 5.0 (TFC, 2005, EUD, 40 (Max.) 0.8 (Max.) 50 (Max.) 20% (Max.) 100 (Max.) (Max.) 2002) Sample 1 79.1 0.11 3.46 9.8 16.6 70 Sample 2 36.2 0.32 3.80 5.7 18.0 95 Sample 3 12.7 0.42 2.90 25.2 17.2 80 Sample 4 86.7 0.10 0.78 1.5 16.4 82 Sample 5 8.4 0.70 1.38 16.2 16.6 27 Sample 6 7.8 0.10 2.60 2.7 17.8 15 Sample 7 13.8 0.24 3.29 4.4 17.8 37 Sample 8 80.9 0.51 2.08 7.7 17.4 40 Sample 9 79.6 0.66 2.11 5.4 17.4 45 Sample 10 - 0.69 3.36 3.8 16.6 57 Sample 11 - 0.21 2.97 4.0 18.2 55 Sample 12 8.0 0.34 4.40 3.5 17.6 75 Sample 13 36.0 0.18 3.50 3.8 16.4 77 Sample 14 66.3 0.76 0.51 17.7 15.4 72 Sample 15 9.1 0.59 0.50 3.9 16.8 70 Sample 16 2.3 0.15 4.85 9.5 16.8 70 Sample 17 5.9 0.11 4.04 7.0 17.0 <10 Sample 18 30.4 0.17 4.69 5.8 18.6 79 Sample 19 30.9 0.50 3.80 3.8 19.4 70 Sample 20 30.9 0.43 2.23 18.0 18.2 59 Sample 21 6.1 0.23 0.92 14.3 16.6 10 Sample 22 50.5 0.02 0.61 2.6 17.8 46 Sample 23 19.1 0.44 2.20 9.3 16.6 42 Sample 24 23.8 0.68 4.59 20.9 18.4 60 Sample 25 4.5 0.40 3.76 2.8 19.4 80 Sample 26 8.2 0.43 3.02 2.2 19.0 23 Sample 27 4.1 0.30 3.60 3.9 19.7 80 Sample 28 11.8 0.01 4.46 33.2 19.8 62 Sample 29 3.8 0.23 3.46 4.1 16.8 23 Sample 30 98.0 - 3.40 5.8 14.8 90 Sample 31 37.0 - 4.00 14.1 14.8 50 Sample 32 37.7 - 3.40 12.2 16.4 50 Sample 33 18.7 - 4.10 3.7 17.8 87 Sample 34 31.6 - 4.10 2.4 16.4 52 Sample 35 12.5 - 4.30 4.1 16.6 80 Sample 36 11.7 0.46 3.05 4.1 16.5 72 Sample 37 3.4 0.23 3.20 6.7 16.8 60 Sample 38 3.0 0.30 4.20 4.4 17.8 61 Sample 39 1.9 0.04 4.20 1.7 18.4 62 Sample 40 15.8 0.10 3.31 3.1 17.2 32 Sample 41 17.2 - 4.12 13.7 17.0 75 Sample 42 35.0 - 3.90 1.3 13.8 40 Sample 43 - - 2.03 20.4 17.4 74 Sample 44 16.3 - 4.07 15.8 16.3 73 Sample 45 27.7 - 3.73 4.1 17.4 25 Sample 46 12.0 - 4.07 13.6 16.3 74 Sample 47 22.8 - 3.75 24.9 17.6 74 Sample 48 14.0 - 4.36 13.7 16.4 42 Sample 49 16.2 - 2.80 16.7 16.4 59 Sample 50 15.8 - - 2.4 16.4 83

268 Revista de la Facultad de Ciencias Agrarias Analysis of some physical, chemical and microbiological aspects of honey sample

Sucrose 33.2 meq/kg and the mean value was In literature, it is stated that the calculated as 8.83 meq/kg. It is seen in sucrose amount in honey is an important table 1 (page 268), that all of the honeys parameter to detect heavy sugar feeding of the bees or adulteration by direct addition of free acidity. of sucrose (17). In the Turkish Food metSimilar TFC and results EUD specifications are shown inin terms the Codex and the European Union Directives, literature. Rodriguez et al. (2010) and maximum allowable limit for sucrose in others characterized the citrus blossom honey is 5.0 g/100 g (10, 22). honey of Sierra Morena by melissopaly- In the study, concentration range for nological and physicochemical analyses. sucrose was found to be between 0.50 It was found that free acidity ranged from and 4.85 g/100 g (N=49), with the mean 7.0 to 26.3 meq/L (18). value of 3.22 g/100 g. In literature, many In another study, Forcone et al. (2009) scientists have reported on sucrose for the performed the palynological and physico- characterization and/or quality control of chemical characterization of honeys from the honey samples. northwest area of Santa Cruz (Argentinean Devillers et al. (2004), analyzed 469 Patagonia). They found the free acidity to range between 9 and 20 meq/kg (12). forsamples moisture, of fir,conductivity, cinder heather, diastase chestnut, activity, Moisture pH,lavender, free acacia,acidity, rape, color, and hydroxymethylfur sunflower honey- Moisture content is another indication fural, and percentages of fructose, glucose, for the quality of honey. Crystallization in certain types of honey can be accelerated and found that sucrose concentrations by high moisture content. In addition, weresucrose, in the erlose, range raffinose, of 0-5.3%, and with melezitose a mean high moisture can increase water activity of 0.742% (7). to values where certain yeasts could grow It is clear that our mean value was (13). Good-quality honey has a low water much higher than that. content. Mendes et al. (1998), analyzed Honey is likely to ferment and lose 25 different honey samples taken from Portu- its freshness and unpasteurized honey guese markets and they found that the mean may show wild yeast growth if the water percentage of sucrose for 2 samples was content is greater than 19%. above the allowable limit of 5.0%, while in The moisture of raw honey can be as our study none of the honey samples showed low as 14% and honey containing up to sucrose values above 5.0 g/100 g (17). 20% of water is not recommended for mead-making (4). Free acidity The maximum limit for moisture set by Free acidity is the indication of the TFC and EUD is 20.0% (10, 22). organic acid content of honey and it is an In this investigation, the mean value for moisture was found to be 17.2% and fermentation (19). values varied between 13.8 and 19.8%. efficientAccording tool to for TFC the and evaluation EUD, 50.0 of meq/kg honey None of the samples exceeded the legal of free acidity is the maximum allowable limit limit of 20.0%. for honey (10, 22). This results were similar to those In this study, the contents of free published by Gomes et al. (2010) with acidity were found to be between 1.3 and 15.9 to 17.2% in their study (13).

Tomo 50 • N° 1 • 2018 269 S. Bakirdere et al.

A range for moisture contents of honey All of the samples were collected via was found to be 16.8-18.6% by Feas et al. sterile containers and stored at 2-8°C (2010). before the analysis. According to the Turkish Food Codex, there must be no Water-insoluble impurities pathogenic microorganisms present (22). One of the parameters to decide All of the analyses were performed whether honey is of good quality is the in sterile media and it was observed amount of water-insoluble impurities. that there were no live cells in any of the Visually clean and clear honeys can be samples investigated. categorized to be of good quality. Contaminants include particles of wax, parts of bees, splinters of wood, and dust Conclusion certainly make honey look unappetizing. Therefore, such honey is of low quality (4). Fifty honey samples taken from the In this study, water-insoluble impurities western part of Turkey were analyzed and in samples were in the range of 10 to 86% of the samples reached the quality 95 mg/100 g, except for sample 17 which parameters and met national honey speci- had a value lower than 10 mg/100 g. The mean value for this parameter was It was observed that physicochemical calculated to be 58.5 mg/100 g. In TFC propertiesfications and showed European variations Union Directives. among and EUD, the legal maximum limit for this honey samples. parameter is 100 mg/100 g. In this study, Results found for electrical conduc- all samples met the legal requirements set tivity, sucrose, free acidity, humidity and by TFC and EUD (10, 22). water insoluble impurities were within the imposed legal limits of the Turkish Food Microbiological analysis Codex and European Union Directives. Microbiological analysis was also HMF amounts did not fall within the performed in this study on the quality maximum limits in seven honey samples. of honey samples. Pathogenic microor- There were no pathogenic microorganisms, namely, Clostridium botulinum, ganisms found in the analyzed samples. E.coli O157:H7, Salmonella spp., Staphy- Moisture content as an indication for the lococcus aureus, Clostridium perfringens quality of honey due to acceleration of and Listeria monocytogenes were deter- crystallization with high moisture content mined due to their categorization as was determined in all samples and values health-impairing microorganisms. were found to be lower than 20.0% which is the maximum limit set by TFC and EUD.

References

1. Accorti, M.; Piazza, M. G.; Persano Oddo, L. 1986. Conduttivita elettrica e ceneri nei mieli. Apicoltura Moderna. 77: 165-166. 2. Anklam, E. 1998. A review of the analytical methods to determine the geographical and botanical origin of honey. Food Chem. 63: 549-562. 3. Bardy, J.; Slevin, N. J.; Mais, K. L.; Molassiotis, A. 2008. A systematic review of honey uses and its potential value within oncology care. J. Clin. Nurs. 172: 604-2623.

4. Benefits of honey. 2010. Recuperado de: http://www.benefits-of-honey.com/good-quality-honey.html.

270 Revista de la Facultad de Ciencias Agrarias Analysis of some physical, chemical and microbiological aspects of honey sample

5. Conti M. N. 2000. Lazio region (central Italy) honeys: A survey of mineral content and typical quality parameters. Food Control. 11: 459-463. 6. Da Silva, S. J. N.; Schuch, P. Z.; Vainstein, M. H.; Jablonski, A. 2008. Determination of 5-hydroxymethyl-2-furaldehyde in honey by micellar eletrokinetic capillary electrophoresis. Ciencia tecnología de alimentos. 28: 46-50.

honeys based on their quality control data. Food chem. 86: 305-312. 7.8. Diminish, Devillers, F.; J.; Kuka, Marlot, P.; Cakste, M.; Pham-Delegue, I. 2006. The criteria M. H.; of Dore, honey J. G.quality 2004. and Classification its changes during of monofloral storage and thermal treatment. LLU Raksti. 16: 73-78. 9. Estevinho, L.; Pereira, A. P.; Moreira, L.; Dias, L. G.; Pereira, E. 2008. Antioxidant and antimicrobial effects of phenolic compounds extracts of northeast Portugal honey. Food Chem. Toxicol. 46: 3774-3779. 10. European Union Directive (EU). 2002. European Union Directive 2001/110/EC, 32001L0110 relating to honey. 11. Feas, X.; Pires, J.; Ibglesias, A.; Estevinho, M. L. 2010. Characterization of artisanal honey produced on the Northwest of Portugal by melissopalynological and physico-chemical data. Food chem. Toxicol. 48: 3462-3470. 12. Forcone, A.; Aloisi, P. V.; Munoz, M. 2009. Palynological and physico-chemical characterisation of honeys from the north-west of Santa Cruz (Argentinean Patagonia). Grana. 48: 67-76. 13. Gomes, S.; Dias, L. G.; Moreira, L. L.; Rodrigues, P.; Estevinho, L. 2010. Physicochemical, microbiological and antimicrobial properties of commercial honeys from Portugal. Food Chem. Toxicol. 48: 544-548. 14. Gulfraz, M.; Iftikhar, F.; Raja, S.; Asif, S.; Mehmood, S.; Anwar, Z.; Kaukob, G. 2010. Quality assessment and antimicrobial activity of various honey types of Pakistan. Afr. J. Biotechnol. 9: 6902-6906. Available in: quality-honey.html, 14.04.2012. http://www.csb.gov.tr, 22.12.2012. 15. Kahraman, T.; Buyukunal, S. K.; Vural A.; Altunatmaz,http://www.benefits-of-honey.com/good- S. S. 2010. Physico-chemical properties in honey from different regions of Turkey. Food Chem. 123: 41-44.

J. Nurs. 17: 32-36. 16.17. Lay-FlurrieMendes, E.; K.Proenca, 2008. Honey E. B.; Ferreira,in wound I.; care: Ferreira, effects, M. clinicalA. 1998. application Quality evaluation and patient of Portuguesebenefit. Br. honey. Carbohdr. Polym. 37: 219-223. 18. Rodriguez, I.; Salud, S.; Hortensia, G.; Luis, U. J.; Jodral M. 2010. Characterisation of Sierra Morena citrus blossom honey (Citrus sp). Int. J. Food Sci. Tech. 45: 2008-2015. 19. Ruoff, K.; Luginbühl, W.; Bagdanov, S. 2007. Quantitative determination of physical and chemical measurands in honey by near-infrared spectrometry. Eur. Food Res. Technol. 225: 415-423. 20. Salgado, C. R.; Maidana, J. F. 2014. Physicochemical characterisation of honey produced in the Chaco province (Argentina). Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 46(2): 191-201. 21. Turhan, K. 2009. Content and diastase activity of honeys collected from middle Anatolia in Turkey. Innovations in Chemical Biology. 233-239. 22. Turkish Food Codex 2005. Number 26026, Food Codex, No. 2005/49.

23. Turkish Standard Institute, TS EN ISO 11290-1. 1997. Türk Standartları Enstitüsü, Ankara, Turkey. 24. Turkish Standard Institute, TS 6582-2. 2001. Türk Standartları Enstitüsü, Ankara, Turkey. 25. Turkish Standard Institute, TS 12812. 2002. Türk Standartları Enstitüsü, Ankara, Turkey. 26. Turkish Standard Institute, TS 3036. 2002. Türk Standartları Enstitüsü, Ankara, Turkey. 27. Turkish Standard Institute, TS EN ISO 16654. 2003. Türk Standartları Enstitüsü, Ankara, Turkey. 28. Turkish Standard Institute, TS EN ISO 6579. 2005. Türk Standartları Enstitüsü, Ankara, Turkey. 29. Turkish Standard Institute, TS EN ISO 7937. 2006. Türk Standartları Enstitüsü, Ankara, Turkey. 30.32. TurkishViuda-Martos, Standard M.; Institute,Ruiz-Navajas, TS 13366. Y.; Fernaandez-Lopez, 2008. Türk Standartları J.; Perez-Alvarez, Enstitüsü, J. Ankara, A. 2008. Turkey. Functional 31. Turkish propertiesStandard Institute, of honey, TS propolis, 3036. 2010. and royal Türk jelly. Standartları J. Food Sci. Enstitüsü, 73: 117-124. Ankara, Turkey. 33. White, J. W. 1978. Honey. Adv. Food Res. 24: 287-374.

Tomo 50 • N° 1 • 2018 271 ProposalRev. FCA UNCUYO. for severe 2018. injury 50(1): reduction 273-294. targets ISSN impreso in Spain 0370-4661. ISSN (en línea) 1853-8665.

Proposal for severe injury reduction targets in Spain by territory and sector. The importance for rural areas of traffic accident

Propuesta de objetivos territoriales y sectoriales de reducción de heridos graves. Importancia de los accidentes de tráfico en áreas rurales

María Dolores Ramírez Román 1, Xavier Bolívar Lastra-Bravo 2, Alfredo Tolón-Becerra 1, Fernando Bienvenido-Bárcena 3, Isabel Flores-Parra 3

Originales: Recepción: 01/03/2017 - Aceptación: 31/03/2017

Abstract

The Spanish road safety strategy for 2011-2020 proposes a 35% reduction in the number of severe injuries in 2011-2020. In this context, this article analyses provincial methodology to dynamic severe injuries reduction targets for 2011-2020 for the purposetraffic accident of setting rates accident in Spain rate bytargets type in of each road of and the appliesSpanish aprovinces. nonlinear Targets distribution were weighted considering 2010 as the base year. This resulted in proposals for reducing the number of severe injuries in each province by type of road as a function of the starting situation of the indicators used in the study. In general, higher reduction must be made on highway and other type of roads (including city streets), and provinces with low population density (rural areas) such as Avila, Cuenca and Soria. The results found seek safety policy target, mainly for rural areas. to provide policymakers with a more local view for achieving the overall Spanish traffic Keywords

Spanish road safety policy • safety indicators • non-linear distribution method for reduction targets • national comparisons • Spain

1 University of Almeria. Area of Engineering Projects. Ctra Sacramento s/n. La Cañada de San Urbano. 04120. Almeria. Spain. [email protected] 2 Universidad Central del Ecuador. Facultad de Ciencias Agrícolas. Carrera de Turismo Ecológico. Jerónimo Leiton y Av. La Gasca s/n. Ciudadela Universitaria. Quito. 170521. Ecuador. 3 University of Almeria. Dept. of Computer Science.

Tomo 50 • N° 1 • 2018 273 M. D. Ramírez Román et al.

Resumen

En la Estrategia de seguridad vial 2011-2020 para España se ha propuesto reducir el número de heridos graves en un 35% para el período 2011-2020. En este contexto, en este artículo se analiza la siniestralidad vial en España a nivel provincial y por tipo de carretera, y se aplica una metodología de distribución no lineal de valores objetivos dinámicos de reducción del número de heridos graves para el período 2011-2020, con el objeto de establecer objetivos provinciales de siniestralidad, para cada una de las provincias españolas. La ponderación de los valores objetivos se realizó considerando como año base a 2010. Como resultado se obtuvieron propuestas de reducción del número de heridos graves para cada provincia, y por tipo de carretera, en función de la situación inicial de los indicadores considerados en el estudio. En general, las mayores reducciones se deberían alcanzar en vías convencionales y otro tipo de vía (incluido vías urbanas), y en provincias con menor densidad de población (áreas rurales) como Ávila, Cuenca y Soria. Los resultados obtenidos buscan dar una visión más local a los tomadores de decisiones en relación con la consecución del objetivo de la política de seguridad vial en el conjunto de España, especialmente en áreas rurales.

Palabras claves

Política de seguridad vial española • indicadores de seguridad vial • método de distribución no lineal de objetivos de reducción • comparación nacional • España Introduction

Road safety in Spain has undergone demonstrating that the most progress a very positive change in recent years, with a 53% reduction in the number of cost-effective road safety measures (11), fatalities from 2000 to 2009, when it was suchin this as field those may applied be achieved in Spain, by and applying that in in line with the European Road Safety general require more studies to identify Strategy and the 50% reduction target new measures (24). for 2010 (4). These improvements are These positive changes in user mainly the result of an increase in the use behaviour may quite possibly have been of safety systems, such as helmets (73% to due to having set reduction targets (for 98.9%) and safety belts (70% to 90.6%), example, 50% in road fatalities), which and also a reduction in risk factors, such have acted as a catalyst for the efforts as average speed (‑2 km/h) and drinking of the various actors involved in road while driving (deceased drivers with safety, who are aware that they alone do a blood alcohol level over 0.3 g/l went not exert a direct effect on the results of from 35% to 29%). These measures have the programs implemented (21, 37, 38). Better infrastructures and modernization the most effective in road safety (13, 16, of vehicles in circulation and their 28,previously 29), so beenthe results identified are therefore as among in safety systems have also contributed to improved road safety in Spain (4). These studies done on road safety policies measures have been validated in previous agreement with various cost/benefit

274 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain studies (28, 36). But road safety policy suffered by those who, though they have must continue to be strengthened, and not lost their lives, have been severely especially, coordination on different levels injured and their psychophysical condi- of competence (national, regional and local governments) and among the many Setting the 13 indicators and their quantitativetions impaired targets by traffic in the accidents. Spanish strategy involved (4). reinforces the need to set thresholds and qualified economic and social agents quantitative targets. road safety policy based on an optimum The more ambitious the quantitative set Moreof measures road safety and requirestargets selectedan efficient by targets are, the more effect they have on the corresponding authorities, who must policymakers and on the execution of road safety programs (9, 35). Therefore, a achievement as an indispensable part of road safety target must be achievable and thebe process committed (10, to15, their29). Therefore, fulfilment Spain and ambitious, and not demotivate by being too ambitious or cause complacency by being too modest (35). Sze et al. (2014), in is concentrating its efforts to reduce traffic a study evaluating the likelihood of success inaccidents the Spanish on 132011-2020 specific Road quantifiable Safety of road safety targets and the factors that Strategyscientific (4). indicators identified for 2020 The Spanish strategy includes the targets had more probability of success. principles considered by the EU in Thisinfluence reinforces them, foundthe conclusion that less ambitious reached in previous studies that setting rational from the Commission to the European but reachable targets is essential to road Parliament,COM(2010) the 389 Council, final, "Communication the European safety policy, and that such ambition must Economic and Social Committee and vary by region. the Committee of the Regions towards Therefore, the target for reducing a European road safety area: policy accidents marked by road safety policy must be different in each geographic area, be found based on its distance from a orientations on road safety 2011-2020", desirable value and be more ambitious the which are "Striving for the highest road more severe the social problem is (26). In safety standards throughout Europe", "An integrated approach to road safety" among rural and urban areas, so different principles,and "Subsidiarity, society proportionalitywould assume andits targetsthis sense, must the be traffic set. accident rates differ responsibilityshared responsibility" for achieving (12). Undermore theseroad Zwerling et al. (2005) summarize safety, a stronger bond with social safety potential explanations for the differences stronger true governance where different urban areas; among them the distances levelspolicy inof othergovernment fields, andacquire especially, more travelledin traffic accidentare higher rates in between rural areas, rural lessand responsibility for fulling the commitments likely behaviour for adopting safety measures (wearing seat belts or alcohol One of the indicators formulated in patterns), less safety conditions on rural themade Spanish and taking Road specific Safety action. Strategy was roads and rural vehicles, higher severity on rural crashes due different speed limits or road conditions, on rural areas medical "35% reduction in the number of severe injuries", to respond to the consequences

Tomo 50 • N° 1 • 2018 275 M. D. Ramírez Román et al. attention take more time and the quality of In particular, the changes in means and the medical response may not be as good. ranges (they are distributed within) over In Spain, a negative correlation between time show their variation. In addition to population density and population and the analysis of change, indicators are also the number of accidents per inhabitants analyzed for 2010, year of reference for and fatalities was founded (27) due the application of the formula. areas with the lowest populations (rural areas) are mountainous and non-urban, Real evolution in the number of severe and therefore, have less developed road injuries in traffic accidents networks, with a more irregular layout In 2000-2014, evolution in the and steeper grades, and with fewer high- reduction of the number of severe capacity roads. injuries in Spain was positive (65.5%) Spain has 52 provinces and the purpose of this article is to widen the methodology provinces was irregular, with reductions proposed by Tolón et al. (26) by applying of(figure 87.5 1,to page 26.8%. 277). Madrid But evolution stands outin the as the only province in which the number and sectorize its application by province of severe injuries did not change by over andit to type the severeof road traffic where injuries the indicator,accident 50%, which Barcelona, a province with happened. Thus provincial targets for similar population and vehicle pool reducing the number of severe injuries characteristics, did achieve. Most (32) had in 2010-2020 are found by type of road. a 12 to 33% reduction. That is, a higher It further intends to reinforce the debate reduction than Spain as a whole. The wide variation in reduction accident rates in weighting territorial percentages in Ceuta is due to its small reductionon the use targetsof different for number indicators of ofinjuries, traffic population and vehicle pool. Almeria especially for rural areas where severity was able to reduce fatality on the road by 75.9% from 2000 to 2014, in spite of (2010) and Eksler and Lassarre (2008) the negative trend (increase in number of believeof traffic that accidents comparative is usually evaluation higher. Eksler on a severe injuries) from 2001 to 2008. Fatality subnational level can provide interesting in 2014 was 78.9% lower than in 2008. new opportunities for improving road It was observed that the number of safety in the territories. severe injuries varied more in 2000-2009, and stabilized in 2010-2014, when Analysis of the evolution of accident rates during 2000-2014 tended toward reduction. Nor is behaviour To evaluate the effects of road safety similaralthough among figures thewere provinces more stable, with always the programs, not only the current situation heaviest populations, such as Madrid, in different countries must be compared, Barcelona, Valencia, Seville, Alicante, but also their evolution over time (32). Malaga and Murcia. Therefore, data and evolution of the provincial totals of severe injuries and type of road are analyzed below.

276 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain

a e

a s f r 4 1 0 i 2 4 1 0 a 2 e a a a r a j n i n s a e R

e z

e i

a r a m s t o o a a

i d l l

t a s a

r l

o n l c i o i a a i d e e b i l a r j 3 1 0 c 2 i a a r 3 1 0 n 2 r n e e a g v l n r r v c a a a a a e e a c l l a n c d a e P t u i v t a e e T i o a t d

d r k

. l r t

e d r v c e r a

r a s c u n s g v

a b i m z

u l s u a

a C

a a u u l l l u a o u i

a i a e . a a e e 2 1 0 2 2 1 0 A A 2 V M B S

B C Z S O A S C C C N A S A G C H L M C B

1 1 0 2 1 1 0 2

0 1 0 2 0 1 0 2

9 0 0 2 9 0 0 2

8 0 0 2 8 0 0 2

7 0 0 2 7 0 0 2

6 0 0 2 6 0 0 2

5 0 0 2 5 0 0 2

4 0 0 2 4 0 0 2

3 0 0 2 3 0 0 2

2 0 0 2 2 0 0 2

1 0 0 2 1 0 0 2

0 0 0 2 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 6 5 4 3 2 0 1 9 0 8 4 3 2 1 0 9 8 7 6 5 4 3 2 1 9 8 7 6 5 4 3 2 1 1 1 1 1 1 1 2 1 1 1 1 s 1 1 1 1 1 r a e s Y

e d

i a

r a l a a 4 1 0 a 2 a 4 1 0 a 2 r n a a o j b c a d a o n r e u a d n l

o d l o n g

a o r i o o e d z i l

a a

a i a n a d n l s o k g e v a l a l l n c R 3 1 0 2 3 1 0 l 2 c l r d B a o e a m z o a e C e a

n e p a n m s

a r o o a o t a e a u r d g l s u

o e a e i

i S r r g r n L L Z A V G M C J T M C l l a

p r

e u v l

i e a i u u a o a l 2 1 0 2 2 1 0 s 2

A H T S L G T I G L P P B

1 1 0 2 1 1 0 2

0 1 0 2 0 1 0 2

9 0 0 2 9 0 0 2

8 0 0 2 8 0 0 2

7 0 0 2 7 0 0 2

6 0 0 2 6 0 0 2

5 0 0 2 5 0 0 2

4 0 0 2 4 0 0 2

3 0 0 2 3 0 0 2

2 0 0 2 2 0 0 2

000 inhabitants in Spanish provinces in the period 2000-2014. injuries per 100 000 inhabitants in Spanish provinces Severe

1 0 0 2 1 0 0 2

Heridos graves por 100 000 habitantes en las provincias españolas en el período 2000-2014. en las provincias por 100 000 habitantes Heridos graves 0 0 0 2 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

0 7 6 5 4 4 3 3 2 2 0 1 1 9 0 0 8

9 8 7 6 5 4 3 2 1 9 8 7 6 5 4 3 2 1

1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 Figure 1. Figure

s t n a t i b a h n i 0 0 0 0 0 1 r e p s e i r u j n i s u o i r e S Figura 1. Figura

Tomo 50 • N° 1 • 2018 277 M. D. Ramírez Román et al.

In 2010-2014, the reduction in the severe injuries per 100 000 inhabitants number of severe injuries in Spain was 20.2%, and provincial data vary strongly Analysis of the severe injuries per (26.8±23.8%). Although the trend is population(figure 1, page indicator 277). in 2014 shows that positive in Alava, Albacete, Balearic in 23 of the 52 Spanish provinces it was Islands, Lleida, Madrid, Asturias, Las below the one for Spain, but there was Palmas and Santa Cruz de Tenerife, the no direct relationship with the resident number of severe injuries increased during population in each province. this period by 243. Half of the severe In spite of the reduction in the severe injuries in Spain occurred in Barcelona, injuries per 100 000 inhabitants indicator Valencia, Pontevedra, Alicante, Seville, in the Spanish provinces in 2010, they still Malaga and Girona, along with Madrid and the Balearic Islands, and progress was among the provinces. These data, means below the Spanish mean, except for Seville andvaried their strongly, dispersion with significant must continue dispersion going (27.5%). This situation must be reversed down to accentuate convergence toward for Spain to reach the target set, and a the desired value (zero) of this indicator. greater effort must be made there than in the rest of the provinces. Severe injuries by type of road in 2000-2014 Severe injuries per population During the period 2000-2014, a In 2000-2014, the number of severe injuries in Spain per population went percentage of severe injuries on other down from 68.6 severe injuries per typessignificant of roads increase (table 1, was page observed 279) over in total the 100 000 inhabitants in 2000 to 20.5 for all Spanish roads. This increase was severe injuries per 100 000 inhabitants mainly in 2011-2014, when it increased more than 20 percentage points. On the be favorably stressed that the number contrary, the number of severe injuries ofin severe 2014 (figureinjuries 1, per page population 277). It did should not increase in any of the provinces. total injuries. On other roads considered The provinces with the greatest inon thehighways study, slightdecreased reductions significantly from 2000over reduction in this indicator were Soria, were observed in 2014, and very few Alava and Cuenca with decreases of differences compared to the distribution over 100 severe injuries per 100 000 in 2010. inhabitants, this provinces are charac- The differences observed in the terized by lower population density. number of deaths in the distribution On the contrary, Madrid, Ceuta, Cádiz, by roads is due to a change in the Barcelona and Seville, had the lowest methodology applied by the Dirección reductions with decreases of less than 30 (Directorate General severe injuries per 100 000 inhabitants. In 2000, the severe injury per victimsGeneral are de Tráficofollowed up after 24 hours population indicator in the Spanish fromof Traffic the -DGT)accident, starting leading in 2011,to an wherebyincrease provinces varied from 27.9 (Ceuta) in severe and minor injuries, mainly in to 184.8 (Soria) severe injuries per urban areas. 100 000 inhabitants. This range was lower in 2014, from 7.6 (Ceuta) to 48.0 (Huesca)

278 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain

Table 1. 2000-2014 evolution in the number of severe injuries by type of road *. Tabla 1. Evolución 2000-2014 del número de heridos graves por tipos de vía *. 2000 2001 2002 2003 2004 2005 2006 2007 Motorway 4.1 4.9 4.0 4.6 4.3 4.1 4.1 3.4 Expressway 10.3 11.1 11.2 11.9 10.6 10.3 10.5 10.0 Highway 51.2 52.3 52.6 54.0 50.4 51.7 57.3 55.9 Local road 2.2 2.2 2.1 2.2 2.2 2.0 2.9 3.3 Service road 0.4 0.4 0.4 0.4 0.3 0.4 0.5 0.4 Interchange ramp 0.7 0.7 0.8 0.6 0.7 0.5 0.6 0.6 Other¥ 31.1 28.3 28.9 26.1 31.5 30.9 24.2 26.4

2008 2009 2010 2011 2012 2013 2014 Motorway 3.1 2.5 2.7 2.3 2.5 2.7 2.7 Expressway 11.0 10.6 10.1 8.9 8.3 8.1 7.9 Highway 52.9 48.7 49.5 44.1 41.8 35.9 35.7 Local road 3.2 3.1 2.7 3.0 2.7 2.7 1.8 Service road 0.2 0.2 0.2 0.2 0.2 0.1 0.2 Interchange ramp 0.4 0.3 0.4 0.2 0.2 0.2 0.3 Other¥ 29.3 34.5 34.5 41.4 44.2 50.3 51.4

* The data for each year are expressed as a percentage (%) of total severe injuries on Spanish roads.

* Para cada año, los valores están expresados en porcentaje (%) del total de heridos graves en las vías españolas. ¥ Starting in 2011, official accounting on other types of road (intercity) and city streets.

¥ A partir de 2011 se desglosa la contabilidad oficial en otro tipo de vía (interurbana) y vías urbanas.

Data on the starting year (2010) The averages for the severe injuries In 2010, the severe injuries per per 100 000 inhabitants indicator on 100 000 inhabitants indicator for the various types of road included in the Spanish provinces varied in a range of study were 0.8±1.4 (motorway), 3.4±3.6 9.4 (Las Palmas) to 80.3 (Avila) severe (expressway), 18.9±12.5 (highway), 1.2±1.4 (local road), 0.1±0.1 (service page 277). The mean of the severe injuries road), 0.2±0.4 (interchange ramp) and perinjuries 100 per 000 100 inhabitants 000 inhabitants indicator (figure was 1, 8.0±6.0 (other). 32.5±15.7. The variation among provinces The highest number of severe injuries observed in the severe injuries per 100 000 inhabitants indicator and by 280), with a mean of 114.1±77.3 severe injuriesoccurred and on highwaysa mean total (figure percentage 2, page application of the Tolón-Becerrra et al. of 56.1±16.8%. On other types of (2009),type of roadmethodology where they to occurreddiversify, justifiesboth by roads, the mean of severe injuries was territory (by territorial units) and sector 79.7±167.5, with a mean total percentage (by type of road) the criteria used by of 27.0±19.8%. The high variation in policymakers for decision making. these values is due to the high number of severe injuries in the most heavily populated provinces.

Tomo 50 • N° 1 • 2018 279 M. D. Ramírez Román et al. e e

100 p 100 p y t y t d d a a o o r

80 r r e e p

s s e e i i r r

60 u 60 u j j n n i

s s u u o o i i

40 r 40 r e e s s

f f o o

e e j j a a 20 20 t t n n e e c c r r e e P P 0 0 l s a a a s s a z a a a a a a a a e a z a e n n n a a l i j i t t r c e c e v o o o v n i d e n b d o o n r e j l o i s e r d l a r n a g n a a v o k o e o i j l e u l a e c e e a J a R l e r a e r z

l n L e a d r A R a i e c d e u u A c C l

u t m u u l r a d L i o c a a l b G a s a l r H a H B l a C o p r C C a B i A

d L A G d B C a A a C G A s u B i u a l C G s I Provinces Provinces e e 100 100 p p y y t t d d a a o o r

r 80 80 r r e e p p

s s e e i i r r

60 u

u 60 j j n n i i

s s u u o o i i r

r 40 40 e e s s

f f o o

e e j j a a t

t 20 20 n n e e c c r r e e P P 0 0 l a s a a a e s a a a o a d a a a e a a a a a d a o i i e i l i l i i i f i t i r s a r c g a r z g l l l n r i c d c i r c r a u r i v i u a d n n o o u r r o o l r e b l m r n a o k d n v o e e l e a g l e L e g a u d a u e e z S a e v m e r g v C o a a t l t i n l a a m a a T S e e r u l M M M s a r P n e T a M B l t

a S Z a r N a l P O A a T V s n . Z a a C a V o C S T . L P S Provinces Provinces

Other Highway Interchange ramp Expressway Service road Motorway Local road

Figure 2. Serious injuries per road type (%) in Spanish provinces in 2010. Figura 2. Heridos graves por tipo de vía (%) en las provincias españolas en 2010.

Materials and methods

Parameters considered in weighting to a new scenario, the number of severe the accident rate reduction targets circumstances, the territory (provinces) and States were encouraged to design national typeinjuries of inroad traffic where accidents the injuries and two occurred. specific roadIn safety COM(2010) strategies 389 considering final, Member their This way, policymakers can design new policies based on these parameters. circumstances (12). Thus the methodology Study of the data available enables byspecific Tolón- startingBecerra et points,al. (2009), needs is applied and better comprehension of the road safety

280 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain situation, which is usually done by spatio- Hughes et al. (2015), think road safety temporal comparison of accident rate data strategies should use fatalities and severe (7, 15, 32). injuries as primary indicators of road Researchers and policymakers have safety. Shen et al. (2015), suggest that the concentrated on studying temporal variations, even though most of the factors more political attention than fatalities which enter into road safety are spatial (7). insituation comparative of severe evaluation traffic injuriesof road meritssafety. Among them, the relative level of More so if the long-term effects on motorization, the territory (country, region, province, municipality, etc.), accidents, still not well documented, are topography, type of users on the road and consideredhealth of those (2). severely injured in traffic It is therefore suggested that the Yannis (2014) also suggested that most methodology by Tolón-Becerra et al. oftype the of studies vehicle (18,on road 20, 30). safety Theofilatos concentrate and (2009), be widened by applying it to a on expressways or urban expressways, and the rest of types of roads have been injuries and the type of road where they studied very little, since although they are occurred.new scenario, This the methodology number of severe is trafficbased more complicated to analyse in terms of on the fair and logical principle that a greater effort should be made to reduce of road safety. the number of injuries in those territories traffic,Indicators they are for of comparingmore interest road in safetyterms which had the worst values in the year among countries should be relevant, of reference (territorial differentiation) and also for those types of roads with the sensitive, and reliable comparable data worst values (differentiation by sector). mustmeasurable, be available understandable, for them specific (14). Thisand This methodology was applied in this recommendation should be taken into study to the Spanish provinces, which even more consideration when working are NUTS2 in the statistical territorial on subnational levels where fewer quality units nomenclature, on both sector and data are available. territory levels. The decision on how to specify groups The sector units were the seven types of similar areas and the size of groups for of roads differentiated in Spanish accident comparative evaluation should also be rate statistics, and the total sector was all of considered (1) such that researchers can the roads in Spain. In the territorial appli- interpret the results found. cation, the total geographic area considered One of the available indicators which was Spain, and the geographic units were provide real information on the degree of road safety is the number of severe injuries, after applying the corresponding its 52 provinces, so that severe traffic per population. Its importance for formu- 35% reduction in 2020 compared to 2010. lationinjuries of road in traffic safety accidents policies is normalizedgiven by its Wongmodulated and Sze reduction (2010) coefficients, state that the yielded year of a consequences to disability and healthcare reference set for targets is usually the year costs, so it is usually used the most often before its application. as an additional indicator of road safety (33, 34).

Tomo 50 • N° 1 • 2018 281 M. D. Ramírez Román et al.

Data - Highway: a road which does not have the this study are from the statistics published expressways and roads for automobiles. by Datathe DGTfor severe (2015) traffic and injuriesthe population used in -characteristics Local roads: which roads define belonging motorways, to a municipality which communicate towns and Estadística [National Statistics Institute] are useable by both pedestrians and vehicles. (2016)figures (19).are from According the Instituto to Orden Nacional del Minis de- - Service road: road parallel to another to terio del Interior [Ministry of the Interior which it is secondary, connected only at Order] INT/2223/2014, severe injuries certain points to serve adjacent properties are considered persons injured and hospi- or buildings. talized for over twenty-four hours, and - Interchange ramp: connecting slip roads as such are registered in the Registro with one or several carriageways which Nacional de Víctimas de Accidentes de - Other: any other type of road not Injured in Accidents]. Starting in 2014, the includedallow continuous above. traffic between two others. DGTTráfico changed [National the term Registry severe of injuries Persons to hospitalized injuries. Method The types of road considered by the The starting year for application of DGT for statistical purposes are motorway, the methodology was taken as 2010. expressway, highway, local road, service According to the Tolón-Becerra et al. road, interchange ramp and other types. - cients are expressed in relative terms of - Motorway: controlled-access highway improvement(2009), methodology, as so much reduction per one, coeffiwhich speciallyThese are definedprojected, as: constructed and varies from 1 (theoretical case of starting indicated as such for the exclusive circu- total accident rates in the population) to lation of automobiles and having the 0 (hypothetical case in which the starting following characteristics: no access to accident rate is zero). bordering properties, no at-grade crossing The calculation methodology uses a of pedestrian paths, roads, railway lines or nonlinear function through an inverse trams, or crossed by at-grade pedestrian logarithmic distribution formula paths, communicating roads or any type depending on the number of severe - injuries per population relative indicator. tions separated, except at certain points or For each application unit (i) in the temporarily,of easement, byand a trafficmedian in opposingstrip, or excep direc- methodology, whether territory or sector, tionally by other means. the relative indicator (R) in reference year - Expressway: controlled-access highway (2010) is: specially projected, constructed and Ri  Fi indicated as such with the following charac- Xi teristics: limited access from bordering properties, no at-grade crossing of other where: pedestrian paths, road, railway or tram, F = number of serious injuries nor at-grade crossing by pedestrian paths, X = relativisation per population in opposing directions is separated, except atconnecting certain points roads or or temporarily, easements, by and a median traffic strip, or exceptionally by other means.

282 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain

The premises considered in the For this, stronger efforts must be made methodology are: where accident rates were higher in the starting year (2010) and where the trend was negative (increased accident rates) in (1) recent years. By applying the methodology - cients of the number of severe injuries in where: Spanishfor calculating provinces, weighted the targetreduction reduction coeffi c - in the number of severe injuries for 2020 - was found for each. = totalcient, residualand according coefficient, to the compleSpanish Two targets were found for each target,mentary is equal to the to reduction0.65 coeffi province, one applying a general 35% F = summation of the number severe reduction in severe injuries on all roads, injuries in absolute values of each - of the unitary areas F (sector: i cients differentiated by type of road. type of road, and geographic: andAccording another to applying the formula reduction applied, coeffi the Spanish provinces) absolute values in each province, is reduced For each type of road and each heterogeneously,total number of but severe in such traffic a way injuries that the in c ' is calcu- i total enables the Spanish 35% reduction lated as a function of the following inverse target to be reached. Furthermore, the logarithmicprovince, a residualdistribution coefficient in the formula 2*. higher the indicator in the reference year Where a is the weighting factor (2010) for each of the provinces, the higher ci, found from the following expression: modulating coefficient (3) the Weightingreduction coefficientby sector (type is. of road) F c* F a i(2020) i(2020) For each type of road, different in F in *F i(2020) i(2010) that those types of road where the most 1 1 effortreduction for reducing coefficients the accident were found, rate made such in the future is where there were the most severe injuries (SI) (table 2, page 284). This methodology was applied to each As observed in table 2, reductions type of road and to each province. higher than those set for Spain as a whole must be made on highways and other types Results of applying the methodology of roads (including city streets). In the case The advances made in recent years of roads such as service roads or interchange ramps, the reductions proposed positive, but a greater effort must be made are low, because the premise is that a low toby achieve Spain in the the 35% field reduction of road safetytarget areset accident rate in the starting year is related to a low reduction percentage in the target 2011-2020. for the number of severe traffic injuries in end year, which in this case is 2020.

* (2)

Tomo 50 • N° 1 • 2018 283 M. D. Ramírez Román et al.

Highway and Expressway usually are reduction percentages, similar to or over the main type of road for connection on 50% (table 3, page 285) and therefore the rural areas, where a negative correlation highest reduction target. between mortality rate and GDP is higher, The provinces with the most inhabitants whereas it is lower with population (Madrid, Barcelona and Valencia) should density (27). reach reduction targets of about 30%, which although below the Spanish target, road accidents in rural areas are the state in absolute numbers of severe injuries, of theAmong vehicle the pool, factors the influencingstate of the risingroads (in spite of investments made, many The mean reduction percentage is 36.1±8.9%.constitutes aFurthermore, significant reduction. the high initial because of their location in mountainous dispersion of the number of severe areas),roads involve bad aweather, higher traffic and/or risk, mainlylonger injuries per 100 000 inhabitants among distance to medical centres, increasing the provinces is reduced considerably over the time required in emergencies (3). And time from a range of 9.4-80.3 to 8.7-41.8. they should be considered a priority area for improving road safety. Weighting by territory and type of road The methodology applied the total First, percentage reduction in the c) found for each type number of fatalities in 2020 was compared of road for target distribution to the terri- to 2010, both for linear sector application toriesresidual (Spanish coefficient provinces). ( The results of the 35% severe injuries reduction target found were compared to linear application by type of road, and for nonlinear sector of the Spanish target, a 35% reduction on - all types of roads. cients presented in Wheighting by sector (typeapplication of road) as. Then a function the results of the found coeffi for Weighting by territory the severe injuries by the type of road and Avila, Cuenca and Soria, provinces with per population indicators were analysed. low population density, had the highest

Table 2. Weighted reduction rates by road type. Tabla 2. Valores objetivos de reducción ponderados por tipo de vía.

Other Road type Highway (including city Spain Expressway streets) 2010 SI 5 934 4 145 11 995 1 211 Red. (%) 37.1 35.6 35 30.3 2020 SI 5 934 4 145 11 995 1 211

Local Interchange Service Motorway road ramp road

2010 321 320 45 19 23.4 23.4 10.3 3 2020 321 320 45 19

284 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain

Table 3. Reduction rates weighted as a function of serious injuries per 100 000 inhabitants. Tabla 3. Valores objetivos de reducción ponderados en función de heridos graves por 100 000 habitantes.

c = 0.65 2010 2020 Provinces SI SI rate Red. (%) SI SI rate Ávila 138 80.3 51.6 67 41.8 Cuenca 165 75.8 51.0 81 40.3 Soria 70 73.5 50.6 35 39.3 Huesca 138 60.4 48.3 71 32.9 Burgos 209 55.8 47.3 110 31.5 … Spain 11.995 25.5 35.0 7.797 16.9 … Navarra 110 17.3 25.6 82 12.9 Alicante 319 16.6 24.4 241 13.2 Murcia 230 15.7 23.0 177 12.1 Ceuta 10 12.4 15.8 8 9.6 Las Palmas 103 9.4 5.5 97 8.7

* SI rate: serious injuries per 105 inhab-1. * Tasa de SI: heridos graves por 105 hab-1.

According to the statistical data for the In general, more pressure for starting year, not all the Spanish provinces reduction is observed on those which had severe injuries, so it is assumed that in had the worst results in the starting year these provinces their accident rate statistics should remain at zero severe injuries. those geographic areas where severity of The reduction percentages proposed the(2010), social confirming problem is thethe worst premise (severe that for each province based on application injuries per population), must make the most effort. by type of road show similar general behaviour,of a reduction with coefficienta mean reduction differentiated of 8.1 Reduction percentages proposed for the to 37.3%. For linear application of the number of severe injuries on motorways reduction target to types of road, mean Nine of the 25 provinces with victims reductions were from 27.9 to 36.1%. must reduce the number of severe injuries The highest dispersion in reduction on motorways by a percentage higher percentages was observed for the types than the one set for Spain (35%), both of road with the lowest number of in linear application and in application provinces recording severe injuries (inter- differentiated by type of road (table 4, change ramps, local roads, service roads page 286). These provinces are charac- and motorways, with 19, 43, 13 and 25 terized by low population density. In provinces, respectively). Cuenca, Toledo, Malaga, Barcelona and Madrid, the reduction percentage was zero, because of the very low number of severe injuries per 100 000 inhabitants.

Tomo 50 • N° 1 • 2018 285 M. D. Ramírez Román et al.

Table 4. Reduction rates weighted as a function of serious injuries per 100 000 inhabitants on motorways. Tabla 4. Valores objetivos de reducción ponderados en función de heridos graves por 100 000 habitantes en autopistas. 2010 c = 0.65 2020a c = 0.77 2020b Red. Provinces SI SI rate Red. (%) SI SI rate Red. (%) SI SI rate 2020a - 2020b Burgos 21 5.6 44.5 12 3.3 34.5 14 3.9 9.9 S.C. Tenerife 55 5.4 44.2 31 3.0 34.2 36 3.5 10.0 Segovia 7 4.3 42.6 4 2.7 32.4 5 3.1 10.3 Castellón 25 4.1 42.4 14 2.6 32.1 17 3.0 10.3 Ávila 6 3.5 41.2 4 2.2 30.7 4 2.6 10.5 … Spain 320 0.0 35 208 0.5 23.4 245 0.5 11.6 … Málaga 4 0.2 13.1 3 0.2 0.0 4 0.2 14.0 Cuenca 1 0.5 0.0 1 0.4 0.0 1 0.5 15.2 Toledo 2 0.3 0.0 2 0.2 0.0 2 0.3 13.1 Barcelona 7 0.1 0.0 7 0.1 0.0 7 0.2 0.0 Madrid 6 0.1 0.0 6 0.1 0.0 6 0.1 0.0

As a result, variation in the severe methodology, as in the case of motorways, injuries rate per 100 000 inhabitants due to the low general pressure that would would go from a range of 0.1-5.6 in 2010 be made on this type of road (30.3%). to 0.1-3.3 in 2020 (lineal application), or The provinces with the highest number 0.1-3.9 (application by type of road). of severe injuries on expressways, Madrid, Less pressure for reduction may Valencia, Granada, Seville, Murcia, Cadiz be observed in application of the and Toledo, which together represent 49% methodology to sector (type of road) with of injuries, had reduction percentages of differences from linear application of 9.9 32.3 to 40.8% (linear application) and from to 15.2 percentage points. 27.4 to 36.5% (sector application), where Madrid stands out with a lower reduction Reduction percentages proposed for percentage than the one for Spain. number of severe injuries on expressways If the targets set for each province were On Spanish expressways, the reduction met, the severe injury rate on expressways percentages varied from 14.8 to 46.0% for per 100 000 inhabitants would decrease - from a range of 0.1-19.3 in 2010 to cient, and from 8.6 to 42.1% for application 0.1-11.3 in 2020 (linear application) or differentiatedlinear application by oftype the of reduction road (sector), coeffi from 0.2 to 12.1 (sector application). with the exception of La Rioja, Santa Cruz As shown for highways, the majority de Tenerife, Bizkaia and Barcelona which of provinces with a reduction percentage had a zero percent reduction due to the over the one for Spain are characterized low rate of severe injuries per 100 000 mainly for a low population density; due inhabitants (table 5, page 287). a large proportion of their territories are In general, the pressure for reduction rural areas. decreases with sector application of the

286 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain

Table 5. Reduction rates weighted as a function of serious injuries per 100 000 inhabitants on expressways. Tabla 5. Valores objetivos de reducción ponderados en función de heridos graves por 100 000 habitantes en autovías. 2010 c = 0.65 2020a c = 0.70 2020b Red. Provinces SI SI rate Red. (%) SI SI rate Red. (%) SI SI rate 2020a - 2020b Cuenca 42 19.3 46.0 23 11.3 42.1 24 12.1 3.9 Zamora 23 11.8 43.2 13 7.4 39.0 14 8.0 4.1 Soria 10 10.5 42.4 6 6.6 38.3 6 7.0 4.2 Granada 75 8.2 40.8 44 4.8 36.5 48 5.2 4.3 Guadalajara 19 7.6 40.3 11 4.4 36.0 12 4.7 4.3 … Spain 1.211 2.6 35.0 787 1.8 30.3 844 2.0 4.7 … Pontevedra 5 0.5 14.8 4 0.5 0.0 5 0.5 6.2 La Rioja 1 0.3 0.0 1 0.3 0.0 1 0.3 6.7 S.C.Tenerife 3 0.3 0.0 3 0.3 0.0 3 0.3 6.1 Bizkaia 3 0.3 0.0 3 0.3 0.0 3 0.3 4.2 Barcelona 7 0.1 0.0 7 0.1 0.0 7 0.2 0.0

Reduction percentages proposed for (2020 linear) or 11.9±7.4 (2020 sector). number of severe injuries on highways The highest reduction percentage for reaching the target set for 2011-2020 with highways was found with sector appli- aThis reduction would contribute in absolute significantly values of to 2,077Spain cation by type of road (37.1%). And severe injuries for linear application or contrary to the two types of roads above, 2,199 severe injuries for sector application. the reduction percentages were from 2.8 The importance of using both terri- to 2.5 percentage points higher. torial and sector application of the The results based on severe injuries Tolón- Becerra et al. (2009) methodology on highways per 100 000 inhabitants, may be seen more clearly on this type showed more uniform behaviour, with an of road. average reduction percentage of 35.3±4.3% Stronger pressure on sectors with more for linear application and 37.3±4.1% for sector application (table 6, page 288). Less will enable policymakers to focus more variation is due to the higher number of resourcestraffic accidents, and stronger in this caseeffort highways, on this severe injuries on this type of road (49.5% type of road, and in those provinces with in 2010), and therefore, the severe injury the highest reduction percentages, such rate on highways per 100 000 inhabitants in that Spain as a whole can reach its 35% the 51 provinces with injuries is higher than reduction target in the number of severe the rest of the cases included in the study. injuries on roads. In addition, highways The severe injury rate per 100 000 are located mainly in rural areas, so a inhabitants would be reduced from a stronger pressure should be applied on mean of 18.8±12.4 (2010) to 12.3±7.6 these territories.

Tomo 50 • N° 1 • 2018 287 M. D. Ramírez Román et al.

Table 6. Reduction rates weighted as a function of serious injuries per 100 000 inhabitants on highways. Tabla 6. Valores objetivos de reducción ponderados en función de heridos graves por 100 000 habitantes en vías convencionales.

2010 c = 0.65 2020 c = 0.63 2020 Red. 2020a - Provinces SI SI rate Red. (%) SI SI rate Red. (%) SI SI rate 2020b Ávila 96 55.8 42.9 55 34.3 44.7 53 33.3 -1.8 Soria 53 55.6 42.9 30 34.5 44.7 29 33.4 -1.8 Huesca 99 43.3 41.5 58 26.7 43.4 56 25.8 -1.9 Cuenca 93 42.7 41.5 54 27.1 43.3 53 26.3 -1.9 Lugo 145 41.0 41.2 85 26.1 43.1 83 25.3 -1.9 … Spain 5.934 12.6 35.0 3.857 8.4 37.1 3.735 8.1 -2.1 … Barcelona 455 8.3 30.8 315 5.9 33.0 305 5.7 -2.2 Valencia 188 7.3 29.8 132 5.3 32.0 128 5.2 -2.2 Las Palmas 64 5.9 28.1 46 4.1 30.3 45 4.0 -2.3 Ceuta 4 5.0 26.7 3 3.3 29.0 3 3.2 -2.3 Madrid 167 2.6 20.6 133 2.1 23.1 128 2.0 -2.5

Proposed reduction percentages for the the fewest provinces compared to other number of severe injuries on local roads types of roads (13). The reduction percentages found for After linear application of the local roads with the linear application of methodology to all the types of roads in the Spanish target had the second lowest average (28.7±14%) of the types of road. 13 provinces with severe injuries had a With sector application, although the reductionthe Spanish percentage reduction higher target, than five the of one the average reduction percentage went down for Spain, but in practice, the reduction in (18.8±10.7%), it was still the third highest injuries is one per province (Lugo, Cordoba, (table 7, page 289). Bizkaia, Cadiz and Alicante). Like the other types of road analysed In the remaining seven provinces, the above, the provinces with the highest low number of severe injuries (1) yielded severe injuries per 100 000 inhabitants zero percent reduction as a result. indicator had the highest reduction When the methodology was applied percentages. The indicator in the to sectorize to the Spanish target by type range of 0.1-6.0 was reduced to 0.1-3.5 of road, reduction percentages of zero (2020 linear) or to 0.2-4.1 (2020 sector) percent were found for the 13 provinces. severe injuries per 100 000 inhabitants. This was the result not only because of the low number of severe injuries in the Reduction percentages proposed for the starting year (2010), but also because of number of severe injuries on service roads Severe injuries were lowest on service type of road (c=0.97). roads in 2010 (18) and also occurred in the high residual coefficient found for this

288 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain

Table 7. Reduction rates weighted as a function of serious injuries per 100 000 inh. on local roads. Tabla 7. Valores objetivos de reducción ponderados en función de heridos graves por 100 000 habitantes en caminos vecinales.

2010 c = 0.65 2020a c = 0.77 2020b Red. 2020a - Provinces SI SI rate Red. (%) SI SI rate Red. (%) SI SI rate 2020b Cuenca 13 6.0 46.1 7 3.5 36.5 8 4.1 9.6 Teruel 8 5.5 45.6 4 3.2 35.9 5 3.8 9.7 Huesca 11 4.8 44.8 6 2.8 34.9 7 3.3 9.9 Ávila 7 4.1 43.6 4 2.5 33.6 5 2.9 10.1 Almería 22 3.2 41.9 13 1.8 31.5 15 2.1 10.4 … Spain 321 0.7 35.0 209 0.5 23.4 246 0.5 11.6 … Las Palmas 2 0.2 0.0 2 0.2 0.0 2 0.2 0.0 Bizkaia 2 0.2 0.0 2 0.2 0.0 2 0.2 0.0 1 0.1 0.0 1 0.1 0.0 1 0.2 0.0 La Rioja 1 0.3 0.0 1 0.3 0.0 1 0.3 0.0 Jaén Zamora 1 0.5 0.0 1 0.4 0.0 1 0.5 0.0

Reduction percentages proposed for the Reduction percentages proposed for the number of severe injuries on interchange number of severe injuries on other types of road ramps The second highest number of severe Similar results were found for injuries occurred on those considered the reduction percentages on interchange ramps, since only seven of the and reduction percentages were found for 19 provinces where there were severe 50"Other of the types 51 provinces of road" (tablewith severe 8, page injuries 290), injuries had reduction percentages other in 2010 as a result of the application of the than zero when the Spanish target was methodology in this study. applied linearly. When the application The mean reduction percentage was was sectorized, only three provinces had 30.1±8.1% for linear application and reduction percentages. 30.8±8.1% for sector application, with Like the service roads, there were very dispersion similar to the one for total few serious injuries on interchange ramps severe injuries on Spanish roads. Melilla, in 2010 (45), yielding as a result a high the autonomous city, stands out because c=0.90) in sector in spite of its low number of severe application of the Spanish target, which injuries compared to the other provinces, yieldedtotal residual the results coefficient described ( above. it had the highest reduction percentages (42.1 and 42.7%). This is because of the high number of severe injuries per 100 000 inhabitants resulting from its small population.

Tomo 50 • N° 1 • 2018 289 M. D. Ramírez Román et al.

Table 8. Reduction rates weighted as a function of serious injuries per 100 000 inhabitants on other types of road Tabla 8. Valores objetivos de reducción ponderados en función de heridos graves por 100 000 habitantes en otro tipo de vía.

2010 c = 0.65 2020a c = 0.64 2020b Red. 2020a - Provinces SI SI rate Red. (%) SI SI rate Red. (%) SI SI rate 2020b Melilla 25 32.9 42.1 14 16.2 42.7 14 16.1 -0.6 Zaragoza 194 19.9 39.2 118 12.3 39.8 117 12.2 -0.6 Lleida 83 18.9 38.9 51 12.0 39.5 50 11.9 -0.6 Tarragona 138 17.1 38.2 85 11.0 38.9 84 10.9 -0.6 Palencia 27 15.7 37.7 17 10.5 38.3 17 10.4 -0.6 … Spain 4.145 8.8 35.0 2.694 5.8 35.6 2.668 5.8 -0.6 … Islas Baleares 14 1.3 15.8 12 1.0 16.6 12 1.0 -0.8 A Coruña 12 1.0 13.5 10 0.9 14.3 10 0.9 -0.9 Huelva 5 1.0 12.4 4 0.8 13.3 4 0.8 -0.9 Murcia 12 0.8 10.3 11 0.7 11.2 11 0.7 -0.9 Cantabria 1 0.2 0.0 1 0.2 0.0 1 0.2 0.0

The least differences were observed 27.9-184.8 (84.3±31.7) in 2000, to between the two applications of the 5.3-155.7 (63.4±33.5) in 2005, 9.4-80.3 methodology on this type of road due to (32.5±15.7) in 2010, 7.1-48.0 (22.1±9.1) sector application (c=0.64). in 2020, for total severe injuries in the the similar residual coefficient found for Spanishin 2014 provinces.and finally to 8.7-41.8 (20.3±7.5) Severe injury rates per population In 2014-2020, the reduction is forecast for 2020 smaller because of the effort made in the According to the results found for the last few years, where stronger reduc- total severe injuries per province and type tions are observed in those provinces of road, the original dispersion in severe with the highest severe injury rates per injury rates per population among the population. It should also be considered provinces would be reduced even more that the population trend for Spain and its over time, leading to convergence as provinces is negative, that is, a reduction in population is forecast for 2020. In general, the mean and dispersion A similar situation is observed on ofobserved values diminishesin figure 3 (page over time,291). especially each type of road, with more real conver- due to the greater decrease in those areas gence in 2014, which would generally which have high starting severe injury be maintained in 2020 based on the rates per population, as also shown by reduction percentages proposed. Like the Wegman et al. (2005). total severe injuries on Spanish roads, Variation in the severe injury rates the increases found in the severe injury per population go from a range of rate per 100 000 inhabitants is due to the negative trend in population.

290 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain

Avila Leon Cuenca Salamanca Soria Girona Huesca s 180 Zaragoza t Burgos n Pontevedra a

t Segovia A Coruna i 160

b Lugo Tarragona a Palencia h Castellon

n 140 i Zamora Ciudad Real

0 Teruel Toledo 0

0 Ourense Granada 120

0 Guadalajara Cadiz 0

1 Lleida Gipuzkoa

r 100 e p

e 80 i r u j

n 60 i

s u o

i 40 r e S 20

0 2000 2005 2010 2015 2020 Year

150 Badajoz S.C.Tenerife Jaen Madrid 140 Valladolid Caceres Melilla Cantabria s t 130 Spain Huelva n

a La Rioja t Malaga

i 120

b Islas Baleares Bizkaia a 110 Albacete Sevilla

n Valencia Alicante i 100

0 Alava Navarra 0 Almeria Murcia 0 90

0 Barcelona Ceuta 0 80 Asturias Las Palmas 1

r 70 Cordoba e p

s 60 e i

r 50 u j n

i 40

u 30 o i r

e 20 S 10 0 2000 2005 2010 2015 2020 Year

Figure 3. Evolution of serious injuries per 100 000 inhabitants in Spanish provinces in 2000-2014 and forecast for 2015-2020. Figura 3. Evolución del número de heridos graves por 100 000 habitantes en las provincias españolas en el período 2000-2014 y previsión para 2015-2020.

Tomo 50 • N° 1 • 2018 291 M. D. Ramírez Román et al.

The most convergence was observed Conclusion for highways, where 56% of severe injuries occurred in 2010, with variation The results presented in this study in severe injury rates per population seek to provide Spanish Policymakers within a range of 0-150.7 (48.0±27.4) in with a wider vision on achievement of 2000, 0-120.3 (38.6±26.8) in 2005, 0-55.8 the Spanish road safety policy target by (18.7±12.2) in 2010, 0-36.0 (10.3±6.8) in offering a variety of alternatives for sector and territory distribution of the target set (sector application). for Spain. In this study, the methodology 2014The and reduction finally 0-33.4 observed (11.9±7.4) in the numberin 2020 by Tolón-Becerra et al. (2013) was applied of severe injuries from 2010 to 2014 was in two ways, on the territorial level by very positive, with severe injury rates per 100 000 inhabitants generally below of severe injuries by province, and by those proposed in the study. This would sector,finding asreduction a function targets of the for type the numberof road show that policies applied in recent years where the injuries occurred. The various results found for each of the accident rates and that Spain as a whole scenarios reinforces the need to sectorize couldhave beenreach the positive target for proposed reducing for 2020. traffic and apply differentiated road safety policies A similar situation was observed for in each of the territories, such that their appli- severe injuries in other types of roads, cation in the various regions that comprise where the second highest number of severe Spain are adjusted to their intrinsic charac- injuries in Spain occurred (27% in 2010). teristics, mainly for rural areas where the On expressways, where 10% of severe injuries occurred, the rates found were urban areas. Likewise, sectorized policies generally lower than in 2014. Therefore, whichfactors ininfluencing this study accidents were the rates type differ of fromroad stronger road safety policies are required for this type of road to reach the Spanish target. should be applied so that government action The results for the different types of canwhere focus the itstraffic technical accident and rates economic were caused, efforts road highlight the need for a greater effort on those sectors with the least road safety. to be made by the provinces which have But all the territories and sectors as a whole a worse starting situation. Based on the must always contribute to the general target effort that these provinces make, greater set, in this case a 35% reduction in severe convergence could be reached in the injuries in Spain. This methodology can be severe injury rate per population in 2020, applied in other regions, such as Argentina, and achieve more uniform road safety where national efforts for reducing road among the Spanish provinces. In addition, accidents could be distributed among terri- the proposed methodology could be tories and sectors. extrapolated to other regions, such as The results found tend to reduce the Argentina or other Latin countries, where disparities in relative accident rates among road accidents data could be analyzed and provinces and to provide citizens with used to set road targets by regions and more uniform road safety throughout type of roads, in order to reach national Spain. Not only a decrease in the mean road accidents reduction targets. number of severe injuries per population is proposed, but also of the variation existing among provinces and by type of road.

292 Revista de la Facultad de Ciencias Agrarias Proposal for severe injury reduction targets in Spain

Application of the methodology using data per kilometre by type of road and severe injuries per kilometre road as a relative indicator would enable more agencies, a situation which should be realistic targets to be found since this improvedprovince areto notprovide available researchers from official and indicator would make a better analysis policymakers with more information for decision-making on road safety. of traffic accident rates possible. But the References

1. Aarts, L. T.; Houwing, S. 2015. Benchmarking road safety performance by grouping local territories: A study in the Netherlands. Transportation Research Part A: Policy and Practice Articles. 74: 174-185.

Estimation of seriously injured persons based on risk for permanent medical impairment. 2. Berg, H. Y.; Ifver, J.; Hasselberg, M. 2016. Public health consequences of road traffic injuries-

Transportationdensity. Accident Research Analysis Part Prevention. F: Traffic 36:Psychology 967-972. and Behaviour. 38: 1-6. 3. Clark, D. E.; Cushing, B. M. 2004. Rural and urban traffic fatalities, vehicle miles, and population

4. Dirección General de Tráfico (DGT). 2011. Estrategia de Seguridad Vial 2011-2020. Dirección General de Tráfico. Madrid. 237 p. 5.6. Eksler,Dirección V. 2010. General Measuring de Tráfico and (DGT). understanding 2015. Anuario road safety estadístico performance de accidentes at local 2014. territorial Ministerio level. delSafety Interior, Science. Dirección 48(9): 1197-1202.General de Tráfico. 194 p. 7. Eksler, V.; Lassarre, S.; Thomas, I. 2008. Regional analysis of road mortality in Europe. Journal of the Royal Institute of Public Health. 122: 826-837. 8. Eksler, V.; Lassarre, S. 2008. Evolution of road risk disparities at small-scale level: example of Belgium. Journal of Safety Research: 39(4): 417-427.

and Prevention. 25(5): 569-583. 9.10. Elvik, Elvik, R. R. 1993. 2008. Quantified Road Safety road management safety targets: by A objectives:useful tool Afor critical policy analysismaking? ofAccident the Norwegian Analysis approach. Accident Analysis and Prevention. 40: 1115-1122.

11.12. Elvik,European R. 2010. Commission Strengthening (EC). incentives2010. Communication for efficient road from safety the Commission policy priorities: to the The European roles of cost–benefitParliament, theanalysis Council, and roadthe pricing.European Safety Economic Science. and 48: 1189-1196.Social Committee and the Committee of the Regions. Towards a European road safety area: policy orientations http://eur- (fecha de consulta: on10/10/2016Global road safety 2011-2020. Road Safety COM(2010) Partnership. 389 final. 2008. Brussels. Speed management: Disponible en: a road safety lex.europa.eu/legal-content/EN/TXT/?uri=celex:52010DC0389manual for decision-makers and practitioners. Geneva. 196p. 13. Hermans, E.; Brijs, T.; Wets, G. 2008. Developing a theoretical framework for road safety performance indicators and a methodology for creating a performance index. Steunpunt mobiliteit en openbare werken-spoor verkeersveiligheid. 85 p. 14. Hermans, E.; Brijs, T.; Wets, G.; Vanhoof, K. 2009. Benchmarking road safety: Lessons to learn from a data envelopment analysis. Accident Analysis and Prevention. 41: 174-182. 15. Holló, P.; Eksler, V.; Zukowska, J. 2010. Road safety performance indicators and their explanatory value: A critical view based on the experience of Central European countries. Safety Science. 48: 1142-1150. 16. Hughes, B. P.; Anund, A.; Falkmer, T. 2015. System theory and safety models in Swedish, UK, Dutchand, Australian road safety strategies. Accident Analysis and Prevention. 74: 271-278.

en: http://www.ine.es/censos2011_datos/cen11_datos_inicio.htm (fecha de consulta: 17. Instituto10/10/2016). Nacional de Estadística. 2016. Cifras de población y Censos demográficos. Disponible

Tomo 50 • N° 1 • 2018 293 M. D. Ramírez Román et al.

18. Johnston, I. R. 2006. Highway safety. In: Fwa, T. F. (Ed.), The Handbook of Highway Engineering. Taylor and Francis. New York.

case for culture change research. Safety Science. 48: 1175-1181. 19.20. Johnston,Loo, B. P. I.Y.; 2010. Hung, Beyond W. T.; Lo,"best H. practice"K.; Wong, road S. C. safety 2005. thinkingRoad safety and strategies:systems management a comparative - A framework and case studies. Transport Reviews. 25: 613-639. 21. Orden INT/2223/2014, de 27 de octubre, por la que se regula la comunicación de la información https://www. (fecha de consulta: 10/10/2016). 22. Shen, Y.;al Hermans, Registro NacionalE.; Bao, Q.; de Brijs, Víctimas T.; Wets, de Accidentes G. 2015. Serious de Tráfico. Injuries: Disponible An additional en: indicator boe.es/diario_boe/txt.php?id=BOE-A-2014-12411

tologistic fatalities regression for road model safety for possible benchmarking. factors. Accident Traffic InjuryAnalysis Prevention. and Prevention. 16(3): 73: 246-253. 242-251. 23. Sze, N. N.; Wong, S. C.; Lee, C. Y. 2014. The likelihood of achieving quantified road safety targets: A binary road safety. Accident Analysis and Prevention. 72: 244-256. 24.25. Tolón-Becerra,Theofilatos, A.; A.; Yannis, Lastra-Bravo, G. 2014. X.; A Bienvenido-Bárcena, review of the effect F. of 2009. traffic Proposal and weather for territorial characteristics distribution on of the 2010 EU road safety target. Accident Analysis and Prevention. 41: 1008-1015. 26. Tolón-Becerra, A.; Lastra-Bravo, X.; Flores-Parra, I. 2013. National and regional analysis of road

accidentsfor the EU's in Spain. 4th Road Traffic Safety Injury Action Prevention. Programme 14(5): 486-95.2010-2020. European Transport 27. Townsend,Safety E.; Avenoso,Council. Brussels. A. 2008. "Road Safety as a right and responsibility for all" A Blueprint 28. Trinca, G. W.; Johnston, I. R.; Campbell, B. J.; Haight, F. A.; Knight, P. R.; Mackay, G. M.; McLean, A. J.;

College of Surgeons. Melbourne. Petrucelli, E. 1988. In: Reducing Traffic Injury -A Global Challenge. Royal Australasian comparative study of the development of road safety in European countries. SWOV, 29. Wegman,Final F.; Report. Eksler, Leidschendam. S.; Hayes, S.; Lynam, 83 p. D.; Morsink, P.; Oppe, S. 2005. SUNflower+6: A 30. Wegman, F.; Aarts, l.; Bax, C. 2008. Advancing sustainable safety National road safety outlook for The Netherlands for 2005-2020. Safety Science. 46: 323-343. 31. Wegman, F.; Oppe, S. 2010. Benchmarking road safety performances of countries. Safety Science. 48: 1203-1211. 32. Weijermars, W.; Bos, N.; Stipdonk, H. L. 2016a. Health burden of serious road injuries in the

33. Weijermars, W.; Bos, N.; Stipdonk, H. L. 2016b. Serious road injuries in The Netherlands Netherlands. Traffic Injury Prevention. 17(8): 863-869. 34. Wesemann, P.; van Norden, Y.; Stipdonk, H. 2010. An outlook on Dutch road safety in 2020; dissected.future developments Traffic Injury of exposure,Prevention. crashes 17(1): and 73-79. policy. Safety Science. 48: 1098-1105.

Science. 48: 1182-1188. 35.36. Wong, S. S. C.; C.; Sze, Sze, N. N.N.; N.Yip, 2010. H. F.; Loo,Is the B. P.effect Y.; Hung, of quantified W. T.; Lo, H. road J. 2006. safety Association targets betweensustainable? setting Safety road safety targets and road fatality reduction. Accident Analysis and Prevention. 38: 997-1005.

fatalities: A multivariate multilevel analysis. Safety Science. 46: 738-750. 37.38. Yannis,Zwerling, G.; C.; Papadimitriou, Peek-Asa, C; Whitten, E.; Antoniou, P. S.; C.Choi, 2008. S-W.; Impact Sprince, of enforcement N. L.; Jones, onM. trafficP. 2005. accidents Fatal motor and vehicle crashes in rural and urban areas: decomposing rates into contributing factors. Injury Prevention. 11: 24-28.

Acknowledgements This work was supported by grants from the Spanish Ministerio de Economía y Competitividad (MINECO) and European Regional Development Fund (ERDF), Project CTM 2013-41750-P:

"Territorial and sector target distribution model for evaluating sustainability using indicators".

294 Revista de la Facultad de Ciencias Agrarias SustainableRev. FCA UNCUYO. use of 2018. rangelands 50(1): 295-307. of the Mendoza ISSN impreso plain 0370-4661. (Argentina) ISSN (en línea) 1853-8665.

Sustainable use of rangelands of the Mendoza plain (Argentina)

Uso sustentable de los pastizales de la llanura de Mendoza (Argentina)

Juan Carlos Guevara, Oscar Roberto Estevez

Originales: Recepción: 09/05/2017 - Aceptación: 24/08/2017

Index

Abstract and keywords 296

Resumen y palabras clave 296

Introduction 297

Location, biogegraphic characteristics and production systems of Mendoza plain 297

Carrying capacity estimation 299

Use of cactus as drought insurance and its advantages and restrictions 302

Economic feasibility of cactus plantations in the mendoza plain Plantations for cattle 304

Introduction of cactus into goat- production systems 304

Conclusions 305

References 306

Instituto Argentino de Investigaciones de Zonas Áridas (IADIZA- CCT- CONICET Mendoza) Avda. Adrián Ruiz Leal s/n. Parque Gral. San Martín. 5500 Mendoza. Argentina. [email protected].

Tomo 50 • N° 1 • 2018 295 J. C. Guevara, O. R. Estevez

Abstract

This review includes the location, the biogeographic characteristics and the production systems of the Mendoza plain. The procedure for estimating the carrying capacity for cattle was described. For its evaluation, annual forage production was estimated from the dependable annual rain (f (kg DM ha-1 year-1 mm-1). The yearlong proper use factor of available forage was 30%, while the herbaceous and woody accessible layers0.8) to andcattle the were rain-use 80% and efficiency 50%, respec factor- tively. The estimated carrying capacity was, on average, 24.3 ha AU-1. This evaluation, denoted the need to have forage reserves from 2 years, in 10 not included in the model. - tions are mentioned. The major limitation to plantations of Opuntia ficus-indica (L.) Mill. forThe fodder use of inspineless Mendoza cactus plain was is cold considered winter temperatures. as buffer feed Toreserve. overcome Its benefits this constraint, and restric ten Opuntia lindheimerii Engelm. (cold hardy) and O. ficus-indica were examined for freezing hardiness. Due to the great importance ofprogenies cactus as of suitable the interspecific crop for livestock cross between production in arid areas, the economic feasibility of its plantation for both cattle and goat production systems was included in the review.

Keywords Opuntia

carrying capacity • spp. • economic feasibility • cattle • goats • rangelands • sustainability Resumen

Esta revisión incluye la ubicación, las características sistemas de producción de la llanura de Mendoza. El procedimiento para estimar la receptividad de la misma para ganado bovino fue descripto. Para su evaluación,biogeográficas la producción y los anual f 0,8) y el factor de -1 año-1 mm-1). El factor de uso apropiado durante elde año forraje del forrajefue estimada disponible sobre fue la 30%, base mientrasde la lluvia que anual los estratos confiable de (herbáceas y leñosas accesibleseficiencia de para uso el de ganado la lluvia fueron (kg MS80% ha y 50%, respectivamente. La receptividad estimada fue, en promedio, 24,3 ha UA. Esta evaluación denota la necesidad de contar con reservas de forraje para los 2 años en 10 no incluidos en el modelo. El uso de cactus sin espinas fue considerado como reserva de forraje de amortiguación. Se mencionan sus O. ficus-indica para forraje en la llanura de Mendoza es la temperatura fría del invierno. Para superar beneficios y limitaciones. La restricción principal para las plantacionesOpuntia de lindheimerii Engelm. (resistente al frío) y O. ficus-indica fueron examinadas por su resistencia al congelamiento.este inconveniente, Debido diez a progenies la gran importancia de la cruza delinterespecífica cactus como entre cultivo apropiado para la producción de ganado en zonas áridas, la factibilidad económica de su plantación para los sistemas de producción de bovinos y caprinos fue incluida en la revisión.

Palabras clave Opuntia

capacidad de carga • spp. • factibilidad económica • ganado bovino • caprinos • tierras de pastos • sostenibilidad 296 Revista de la Facultad de Ciencias Agrarias Sustainable use of rangelands of the Mendoza plain (Argentina)

Introduction

The major use of rangelands is grazing The main plant species present, or browsing by livestock and wild herbivores. Semiarid and arid rangelands are life-cycle and use by cattle, are detailed in often fragile and subjected to accelerated tableclassified 1 (page according 298) (19). to different life-form, soil erosion if not managed appropriately. If The bioclimatic conditions may be rangelands are mismanaged, so that plants labelled as warm-arid. The long term - mean annual precipitation ranges from sition of plant community changes, resulting 150 mm in the north-eastern to 400 mm infail toreduced provide sufficientproductivity soil cover,and theincreased compo in the southeast, with a mean annual erosion. Continued abuse of the rangeland temperature varying from 13°C in the system can also result in severe land degra- south, to 20°C in the north (14). dation (23). In this sence, the importance of - a correct stocking rate to achieve sustained cation, most of soils are Entisols of the productivity, the effects of high stocking PsammentAccording order to theand American Torripsamment classifi rates on the decline of livestock produc- group (33). Soils in the Ñacuñán Biosphere Reserve, located in the centre of the plain reduction of long-term economic returns, (34°02' S; 67°54'W; 540 m a. s. l.) are havetivity, been the increasestrongly emphasizedof financial risk(22, and24, 34).the predominantly deep and silty with sandy This review focuses on the importance of patches and local sand sheets covering determining the carrying capacity of the the alluvium substrate. They present the Mendoza plain and its complementation following characteristics (33): 7.1< pH < with the plantation of O. ficus indica. 7.9 (fair); 0.5 < SAR < 6.0% (fair), with one exception in the deep layer (130-230 cm Location, biogegraphic charac- in sub sites dominated by Cercidium teristics and production systems of praecox (Ruiz & Pav.) Harms where SAR = Mendoza plain 13.2% (high); 0.1< organic matter < 0.6% Mendoza province (32°52'57'' S; (very low); 1.5 < C/N < 7.5 (very low); 0.9

68°49'19'' W) is located in the central west of < CaCO3 < 6.9% (fair), with one exception Argentina. It covers 148,827 km². The plain of 20.4%; 168 < N < 1,200 ppm (very low is situated approximately in the eastern to high); 10 < P < 70 ppm (low); 812 < K half of Mendoza province and it represents < 2,300 ppm (high to very high); 0 < clay about 38% of the mentioned area. < 20%; 1.5% < silt < 80%; 20% < sand < The vegetation of the Mendoza plain 95%; 0.5 < EC < 10 mScm-1. is typical of the Monte phytogeographic Six production systems have been province, in which it occupies a geographi- studied in the Mendoza arid zone, which cally central position (32). Vegetation is an open xerophytic savanna and shrubland of them are located in the Mendoza plain. of Prosopis flexuosa DC. The herbaceous haveThe clearly so-called defined characteristics"subsistence (9).system" Two layer consists mainly of warm-season includes, among other areas, the north- perennial grasses. eastern of the plain. It has the following The shrub layer is made by species of characteristics. Livestock activity consti- 0.3 to 3.0 m high, and total canopy cover, tutes the way of life of the producer, who under best range conditions, may achieve resides in the farm and contributes with 60 to 80% (12). all or a large part of the required labour.

Tomo 50 • N° 1 • 2018 297 J. C. Guevara, O. R. Estevez

Table 1. life-form, life cycle and use by cattle. Main plant species present in the Mendoza plain classified according to their Tabla 1. Principales especies de plantas presentes en la llanura de Mendoza

Life- Life Use by clasificadas de acuerdo conSpecie sus formas de vida, ciclo de vida y uso por los bovinos. form cycle cattle Acantholippia seriphioides (A. Gray) Moldenke S P NF Aristida inversa Hack. G P NF Aristida mendocina Phil. G P F Bouteloua aristidoides Griseb. G A F Capparis atamisquea Kuntze S P F Chloris castilloniana Lillo & Parodi G P F Condalia microphylla Cav. S P NF Conyza bonariensis (L.) Cronquist H A F Cottea pappophoroides Kunth G P F Digitaria californica (Benth.) Henrard G P F Fabiana denudata Miers S P NF Junellia seriphioides (Gillies & Hook.) Moldenke S P NF Larrea divaricata Cav. S P NF Lycium chilense Miers & Bertero var. minutifolium (J. Rémy) Terracino S P F Monttea aphylla (Miers) Hauman S P NF Panicum urvilleanum Kunth G P F Pappophorum philippianum Parodi G P F Prosopidastrum globosum (Gillies ex Hook. & Arm.) Burkart S P F Prosopis flexuosa DC. T P F Prosopis flexuosa DC. var. depressa F.A. Roig S P F Setaria leucopila K. Schum. G P F Sporobus cryptandrus A. Gray G P F Stipa tenuis Phil. G P F Tragus berteronianus Schult. G A F

G: grass; S: shrub; T: tree; H: herb; P: perennial; A: annual; F: forage; NF: non-forage. G: gramínea; S: arbusto; T: árbol; H: hierba; P: perenne; A: anual; F: forrajera; NF: no forrajera

The sociocultural environment has The presence of goats, in important determined a low training context of the proportions is linked to the need for producer, resulting in low attached importance to the vegetal resource conservation, in which the farm income exceeds the on which he depends exclusively. expensesself-sufficiency necessary of meat.to meet In the the family cases primary needs, the surplus is destined

298 Revista de la Facultad de Ciencias Agrarias Sustainable use of rangelands of the Mendoza plain (Argentina) to increase the animal quantity. This is availability of forage (rainfall, soil texture the strategy adopted by the producer to ensure the farm continuity and the reason environmental factors non-fodder (animal why land ownership does not lead to a waterand fertility, availability, floristic predators’ composition, incidence, etc.), major infrastructure investment. etc.) and management factors (instanta- and/or personal valuation" includes the neousextreme grazing cold orpressure, heat, floods,grazing snowfalls, method, farmsAnother located system, in the calledcentral of and "profitability southeast energy subsidies, etc). of the plain. They present the following All of these factors interact, in turn, particularities. The producer lives off with the producer's decisions, which the farm, manages it through salaried employees and the farm activity consti- level of risk he assumes (7). tutes for him, one among other economic reflectFor hisestimating business the objectives cattle carrying and the capacity of the Mendoza plain the is favourable or less limiting than in the following factors were considered (10). activities. The influence of external factors- Annual forage production was estimated sively cattle are exploited. There is a direct from the dependable annual rains (f 0.8) relationshipsystem firstly between described. land ownership Almost exclu and for each of the six subzones of the plain infrastructure investment. Producers are because it constitutes one of the most more progressive than those of the other common dependability indexes (12). system and pay more attention to vegetal resource conservation. (kg DM ha-1 year-1 mm-1) were 2.15 and Conversely, in the extensive cow-calf 1.4 Thefor the rain-use herbaceous efficiency and shrub factorsforage, model in the southwest of Mendoza respectively. The herbaceous layer Province the main critical points were accessible to cattle was 80%, and browse found in the social sphere, due to the limi- 50%. The inclusion of woody species tation on the access to public services, poor in the forage supply responded to their training and associativity. The economic important participation in the cattle risk was the sustainability threshold due diet in the dry season: fall-winter (13) to the lack of marketing channels, high (table 2, page 300). dependence on external inputs and low The yearlong proper use factor of available forage was 30%, given there is a growing consensus that only 25 to 30% of the productionCarrying efficiency capacity (31). estimation maximum standing crop (MSC) of herbage The most adequate conceptual should be considered as consumable forage framework to understand the factors when carrying capacity is calculated, rather determining the carrying capacity of than the level of 40 to 50% that used for animal production systems, is the model other rangeland ecosystems (12). Further details on the procedure used for the herbivores may consume only a proportion carrying capacity estimation can be found in of Aboveground energy flux. ItNet suggests Primary that Productivity domestic Guevara et al. (1995). The estimated carrying (ANPP), known as Hervest Index, to make a capacity was, on average, 24.3 ha AU-1. It sustainable use of rangelands ecosystems. ranged from 64.5 and 16.0 ha AU-1 in the The carrying capacity of a forage north-eastern and southeast of the plain, resource results from a complex network of environmental factors linked to the respectively (figure 1, page 301) (10).

Tomo 50 • N° 1 • 2018 299 J. C. Guevara, O. R. Estevez

Table 2. Botanical composition (% weight) of cattle seasonal diets. Tabla 2. Composición botánica (% en peso) de las dietas estacionales de los bovinos.

Mean dietary composition (±S. D.) Food items RSB RSH DSB/DSH Grasses Aristida sp. 2.1 (2.2) 2.8 (1.7) 1.1 (0.9) Bouteloua aristidoides + 5.1 (3.4) 1.3 (1.6) Chloris castilloniana 11.2 (4.7) 12.1 (1.9) 9.0 (6.0) Digitaria californica 10.0 (5.9) 5.5 (4.0) 5.8 (2.7) Panicum urvilleanum 21.9 (1.4) 25.6 (7.1) 10.7 (4.2) Pappophorum philippianum 5.0 (2.5) 7.8 (2.6) 3.9 (1.7) Setaria leucopila 6.6 (4.9) 6.8 (2.7) 5.4 (4.2) Sporobolus cryptandrus 7.3 (4.6) 14.1 (7.2) 5.8 (2.7) Stipa sp. + 1.6 (2.4) + Others + 2.6 (2.3) + Total 65.8 (2.9) 84.0 (3.6) 44.9 (3.8) Forbs Chenopodium papulosum 2.1 (2.1) + 4.4 (8.2) Cucurbitella asperata + 1.6 (1.5) + Gomphrena mendocina + 2.6 (4.8) 1.5 (3.5) Others + 2.1 (1.9) + Total 2.7 (2.3) 6.4 (4.9) 6.4 (8.6) Shrubs and trees Capparis atamisquea 4.9 (1.8) 2.1 (2.7) 10.8 (5.0) Ephedra ochreata 5.3 (1.8) + 3.8 (4.1) Hyalis argentea var. latisquama 12.2 (5.6) 4.2 (2.3) 29.3 (5.5) Lycium chilense var. minutifolium 5.1 (2.4) + 1.5 (0.8) Prosopis flexuosa var. flexuosa 3.6 (2.3) + 2.3 (1.2) Others + + + Total 31.4 (2.8) 9.6 (4.8) 48.6 (8.2)

RSB=rainy season beginning (spring); RSH=highest point of rainy season (summer); DSB=dry season beginning (fall); DSH=highest point of dry season (winter). +=less than 1%. Species that contributed less than 1% were: Bromus brevis, Cottea pappophoroides, Tragus berteronianus and Trichloris crinita (grasses); Coniza sp., Descurainia sp., Glandularia tenera, Lappula redowskii, Lecanophora sp., Lepidium sp., Plantago patagonica and Solanum eleagnifolium var. leprosum (forbs); Atriplex lampa, Bulnesia retama, Cassia aphylla, Condalia microphylla, Fabiana denudata, Geoffroea decorticans and Prosopidastrum globosum (shrubs and trees). RSB: comienzo de la estación lluviosa (primavera); RSH: punto más alto de la estación lluviosa (verano); DSB: comienzo de la estación seca (otoño); DSH: punto más alto de la estación seca (invierno). + = menos del 1%. Las especies que contribuyeron menos del 1% fueron Bromus brevis, Cottea pappophoroides, Tragus berteronianus and Trichloris crinita (gramíneas); Coniza sp., Descurainia sp., Glandularia tenera, Lappula redowskii, Lecanophora sp., Lepidium sp., Plantago patagonica and Solanum eleagnifolium var. leprosum (hierbas); Atriplex lampa, Bulnesia retama, Cassia aphylla, Condalia microphylla, Fabiana denudata, Geoffroea decorticans and Prosopidastrum globosum (arbustos y árboles).

300 Revista de la Facultad de Ciencias Agrarias Sustainable use of rangelands of the Mendoza plain (Argentina)

--- Limit of the plain / ---- Mean annual rainfall / A to F Subzones / 16.0 to 64.5 Carrying capacity (ha AU-1) Source: IGN (National Geographic Institute - Argentina). --- Límite de la llanura / ---- Lluvia media anual / A a F Subzonas / 16,0 a 64,5 Capacidad de carga (ha UA-1)

Figure 1. Carrying capacityFuente: IGN of (Institutothe Mendoza Grográfico plain Nacional for cattle - Argentina). by subzones in Argentina. Figura 1. Capacidad de carga de la llanura de Mendoza por subzonas en Argentina.

Tomo 50 • N° 1 • 2018 301 J. C. Guevara, O. R. Estevez

From the estimation of the carrying plantations did not have, in general, great capacity, arises the need to have forage losses of livestock compared with those reserves standing from 2 years in who did not have cactus. 10 not included in the estimated model. Moreover, reproduction rates and levels It is important to have forage reserves of production of cattle, sheep and goats were for 2 years in 10 since reliable annual superior when the ranchers supplement rainfall, that is, one that has a probability the normal diet of the livestock with cactus of occurrence of 80%, has been used for during the dry period (6). In Mexico, there determining the forage production. are 230,000 ha cultivated with cactus (30). In this sense, it is important to bear In Mendoza, about 25% of bovine in mind that the production of natural stock (115,000 animals) died during the vegetation is not only related to average dry period which lasted from late summer rainfall, but also to reliable annual rainfall, to October of 2009. This affected around that is, those that have a probability of 1,000 producers in the southwest of occurrence of 75-80% (12). Mendoza plain, where 65% of cattle are concentrated (3). Also, in the north-east Use of cactus as drought insurance of the Mendoza plain, as a consequence of and its advantages and restrictions the mentioned drought, about 75% of the Plantations of drought-tolerant and goats died and the pregnancies decreased by almost 80% (4). Producers of cattle and Opuntia species, have been established as goats affected by drought did not have cactus bufferwater-efficient feed reserves, fodder a strategy shrubs, to especially mitigate plantations. In this regard, public policy and the effects of drought in animal production credit are essential in order to increase culti- systems in various arid and semiarid areas vation of this important plant (29). of the world. In this strategy, the buffer The government should consider reserve was aimed not only as "drought appropriate incentives for establishing insurance" for inter-annual drought but fodder cactus plantations and legal also to bridge over a recurrent annual tools favouring security land tenure in period of feed scarcity (25). some areas of the plain. In this sense, Opuntia species have the ability to the Mendoza Province Government has withstand prolonged drought, high tempera- proposed to carry out two actions: a) to tures, as well as wind and water erosion (8). deliver provincial state lands on property Cactus and other drought-tolerant to settlers who are willing to implement productive projects and b) to expropriate survive under rainfall as low as 50 mm on private land to those who have a debt aand particular water-efficient year, but with fodder neither shrubs growth can to the Irrigation General Department nor production. (organism that administers the water Mean annual rainfall of 100-150 mm resource in Mendoza province) that corresponds to the minimum required to exceeds the appraisal of the land and that successfully establish rainfed plantations it is not in production. (26), with sandy and deep soils (28). The purpose of the second action is also High mortality of cattle (650,000 head) to deliver these lands to those who have occurred in northern Mexico between productive projects (5). It is believed that 1993 and 1996 as a consequence of one of these projects would be precisely drought. The ranchers with cactus cactus plantations for fodder.

302 Revista de la Facultad de Ciencias Agrarias Sustainable use of rangelands of the Mendoza plain (Argentina)

There are numerous reasons behind temperatures dropped to -16°C and -17°C the diffusion of Opuntia spp. as forage or on two consecutive days in August 1999, fodder around the world, and particularly frost damage in the young cladodes from for O. ficus-indica. They include: (a) the the 9-month-old plants reached 98% simple cultivation practices required to and the 3-year-old plants from different grow the crop; (b) rapid establishment O. ficus-indica clones exhibited mean frost soon after introduction in a new area; damage ranging from 19 to 53% (17). (c) easy multiplication practices that In none of the four sites studied in the favour rapid diffusion and exchange of Mendoza plain m was higher than 1.5°C material among users; (d) ability to grow (18). To overcome the mentioned limi- in very harsh conditions characterized by high temperature, lack of water and poor cross between two wild, spiny Texas native soil; (e) utilization in programs to prevent Opuntiatation, ten lindheimerii progenies accession of the interspecific 1250 male parents (cold hardy, red fruits, bluish pads) and (f) its response to atmospheric CO2 and a spineless commercial O. ficus-indica levelsoil erosionincrease. and These combat and other desertification; facts have fruit type Texas A&M University Kingsville contributed to such a wide distribution (TAMUK) accession 1281 (low cold hardy, from the regions of origin in Latin America spineless, fast growing, red fruits, greenish to remote areas, spanning continents, pads), O. ficus-indica and O. ellisiana cultures and traditions (29). On the other hand, some researchers and examined for freeze hardiness (20). have evaluated the effect of cactus pear GriffithsThe trial were was introduced done during to Mendoza the period plain May-September 2009 with 320 hours with that it effectively enhanced the meat temperatures below 0°C. The number of fattyinclusion acids in composition small ruminant's by increasing diets, finding the total hours with temperatures below 0°C proportion of the n-3 series and conjugated and the minimum temperatures were 6 h and -1.8°C, 77 h and -7.1°C, 146 h and human health (2). -6.1°C, 37 h and -4.7°C, 54 h and -4.7°C linoleicUnder acid different (CLA) climaticwhich are conditions, beneficial the to in May, June, July, August and September, thermal limit for frost-sensitive species respectively. Frost damage in the cladodes such as O. ficus-indica is indicated by a mean daily minimum temperature of the lower than in those of O. ficus-indica. coldest month (m) of 1.5° to 2.0°C (27). Clonesof clones 46, 42, 80, 64 83, and 89, 150 94 was and significantly O. ellisiana The major limitation to plantations had zero frost damage during the of O. ficus-indica for fodder in Mendoza considered period (20). plain, is cold winter temperatures (21). Cactus could be cultivated also In fact, when temperature in a site in Carmen de Patagones where m is located in the north-center of the plain about 2.5°C. The ten progenies of the (El Divisadero Cattle and Range Exper- iment Station, DCRES, 33°45' S; 67°41' W) be cultivated in areas of the southwest of dropped to -12.3°C in May 1996, almost Buenosinterspecific Aires crossProvince previously with m citedlower could than all the 7-month-old plants of this specie 1.5-2.0°C (1). froze to ground level. Similarly, when

Tomo 50 • N° 1 • 2018 303 J. C. Guevara, O. R. Estevez

Economic feasibility of cactus plan- and a daily consumption of 36 kg fresh tations in the Mendoza plain material per AU were assumed, the cactus plantations necessary to feed all the cattle Plantations for cattle in the 37,500 ha cow-calf model for the The economic feasibility of 50-200 ha entire year would be about 0.3% of the cactus plantations for drought fodder ranch size. The establishment cost of the and forage production in the plain was mentioned plantations would increase the examined by simulation models (15). ranch investment by 7.4 to 10% at 400 and Models were run with 200-400 mm 300 mm annual rainfall, respectively. It is annual rainfall and two management necessary to point out that without the systems: cut and carry (CAC) and direct incorporation of cactus plantations, the browsing (DB). Cactus production was cow-calf operation size necessary to yield positive returns in the Mendoza plains 15 kg DM ha-1 year-1 mm-1 for 200 mm was estimated to be 37,500 ha (11). This ofestimated rain, 18.8 from kg rain-use DM ha -1efficiency year-1 mm factors:-1 for surprisingly high ranch size was a conse- 300 mm and 22.5kg DM ha-1 year-1 mm-1 quence of: a) the high level of risk involved for 400 mm. with range livestock production. The value of production was estimated The producer must balance produc- using shadow prices: a) the cost of energy and tivity, stability and sustainability. If the protein derived from those of concentrates; production system offers high average and b) the price of steer meat on the hoof. Cactus production was found to be feasible of year-to-year variation (low stability), in the DB system with 300 mm rainfall on a orprofits risk (highthe long productivity) term productivity but a great of deal the 100 ha plantation and with 400 mm rainfall range (low sustainability), it may be less on a 50 ha plantation. With 400 mm rainfall, desirable than a system with somewhat 100-200 ha plantation would be needed if lower productivity but greater stability the CAC system was adopted. and sustainability; b) the present cow-calf operation is not, in general, an intensive system i.e. early weaning, among other suchThe as runoff profitability and erosion calculations control, didclimate not management practices, is not applied and buffering,take into accountincreased the land secondary fertility, benefits land- there is no integration with cow-steer scaping and amenities, stabilization of husbandry under irrigation farming; animal production and reduction of the c) the meat price assumed in this analysis, amount of water drunk by livestock, and representative of the 1986-1995 period, this resulted in a very large underesti- was low (15). mation of the economic impact of cactus plantations. Preliminary estimations Introduction of cactus into goat- production systems in the study. The size of cactus planta- The study was referred to the north- tionsof some necessary of these to benefits supplement are included range eastern of the plain (16). A simulation grazing to 1,576 and 2,273 animal unit model was run with 50, 100, 150 and year (AUY) in a 37,500 ha cow-calf ranch 200 does and annual rainfall probabilities were estimated to be 123 and 111 ha at (f) from 0.1 to 0.9. Investments and costs 300 and 400 mm rainfall, respectively. If were derived from data recorded through a 3-year cactus production accumulation establishment and monitoring of experimental cactus plantations in the site

304 Revista de la Facultad de Ciencias Agrarias Sustainable use of rangelands of the Mendoza plain (Argentina) previously mentioned (DCRES). Cactus Conclusions - ciency factor of 12.5 kg DM ha-1 year-1 mm-1 The future of the Mendoza plain andproduction the annual was rainfall based probabilities on a rain-use in effithe rangelands depends on: a) the adoption area (f 0.1 = 273.3 mm to 0.9 = 76.7 mm). of a sustainable carrying capacity and The CAC management method was b) the implementation of suitable crops. considered for pen feeding during Regarding to the carrying capacity it is 110 days (last third of pregnancy and considered that the use of the dependable 60-day lactation) with 3.6 kg fresh annual rain and a factor of use of available material goat-1 day-1. A decrease in goat forage of 30%, instead of 40-50%, that is annual mortality from 10 to 2% and an assumed for others rangeland ecosystems, additional annual amount of kids per goat would contribute to the sustainability of Mendoza plain rangelands. from supplementing goats with spineless The factor of use considered is more cactuswere considered in the fall-winter as direct period. benefits derived conservative due to the fragility of As a consequence of this practice, an pastoral ecosystems of arid zones. Cactus additional 0.2 kids appear to be obtainable in can meet the second requirement and act as strategic food reserves to mitigate the reduction of water consumption by goats. effects of drought on livestock production fieldThe conditions. internal A secondaryrate of benefitreturn was (IRR) the systems and it could be successfully corresponding to 0.2 additional kids, developed in the Mendoza plain, provided and the annual additional amount of frost-tolerant species or clones were used. kids per goat necessary to reach an IRR The studies done so far, such as, iden- equal to the opportunity cost of capital in Opuntia progenies of cold Argentina (12%), were determined. The hardiness and also economic feasibility of establishment cost of cactus plantations cactustification plantations, of are the starting point for ranged from US$ 525 ha-1 (50-head goat further researches. These should address herd; f0.1) to US$ 242 ha-1 (200-head goat animal performance in both rangeland and herd; f0.9). Cost of fence installation was feedlot in response to supplementation of the main item of establishment costs in its diets with cactus, including it in different most of the analysed scenarios. This cost forms such as fresh, dehydrated, silage or may be reduced if a fence made of spiny multi-nutrient blocks. cactus is established. Others efforts could be directed to If dependable annual rains (f0.8) were provide a propitious abiotic environment considered, IRR would be lower than the for a cactus to achieve higher biomass opportunity cost of capital for all goat-herd productivity and improved protein levels sizes, and the additional kids per goat by interacting with nurse plants, such as required to reach 12% IRR would range Prosopis spp. The establishment costs of from 0.21 to 0.29 for 200 and 50 does, cactus plantations appear to be high and respectively. If the same rainfall probability out of reach for most livestock producers. is considered, the amount of additional kids to reach 12% IRR decrease as goat-herd size increases. The differences are derived from the inverse relationship between the cost of plantation establishment and the goat-herd size.

Tomo 50 • N° 1 • 2018 305 J. C. Guevara, O. R. Estevez

References

in the Southwest of Buenos Aires Province, Argentina. Revista de la Facultad de Ciencias 1. Abraham,Agrarias. E. M; Guevara, Universidad J. C.; Candia, Nacional R. J.; Soria, de Cuyo. N. D. Mendoza. 2016. Dust Argentina. storms, drought 48(2): 221-241. and desertification 2. Aranda-Osorio, G.; Flores-Valdez, C. A. 2011. Calidad de la carne de animales suplementados con nopal, in: Vázquez-Alvarado, F.; Blanco Macías, F.; Valdez-Cepeda, R. D., Santos- Haliskac, A. (Eds.), Memoria del IX Simposium-Taller Nacional y II Internacional de Producción y Aprovechamiento del Nopal y Maguey. Nuevo León, Méjico: Universidad Autónoma de Nuevo León. RESPYN Edición Especial 5: 135-142. Available on line at https://www.google.com.ar/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&ved=0 ahUKEwiQnsOCmo3SAhXBE5AKHQ2VCRQQFggYMAA&url=http%3A%2F%2Fwww. respyn.uanl.mx%2Fespeciales%2F2011%2Fee-05-2011%2Fdocumentos%2F(12)_ gilberto_aranda-calidad_de_la_carne.pdf&usg=AFQjCNGSe2vtc6_YO51Nu08bnPRBxC_ OZQ&sig2=LUtC4jEOTeShX1QF-qUF-A&bvm=bv.146786187,d.Y2I (accessed: March 2017). 3. Diario Los Andes, Mendoza. 29 octubre 2009. La sequía ya mató a 115.000 vacas. Available on line at: http://www.losandes.com.ar/noticia/un-454090 (accessed: April 2017). 4. Diario Los Andes, Mendoza. 5 diciembre 2009. Puesteros de Lavalle perdieron hasta el 75% de sus cabras. Sección Economía. 2009; 12. Available on line at: www.losandes.com.ar/ noticia/economico-460574. (accessed: March 2017).

proyectos productivos. Available on line at: http://www.mdzol.com/nota/387640- 5. Diario MDZ, Mendoza, 23 mayo 2012. Tierras fiscales: solo se entregarán a los que tengan (accessed: February 2017). 6. Flores Valdez,tierras-fiscales-solo-se-entregaran-a-los-que-tengan-proyectos-productivos/ C. A.; Aranda Osorio, G. 1997. Opuntia based ruminant feeding systems in Mexico. Journal of the Professional Association for Cactus Development. 2: 3-8. 7. Golluscio, R. 2009. Receptividad ganadera: marco teórico y aplicaciones prácticas. Ecología Austral. 19: 215-232. Available on line at: http://www.scielo.org.ar/pdf/ecoaus/ v19n3/v19n3a05.pdf (accessed: February 2017). 8. Grünwaldt, J. M.; Guevara. J. C.; Grünwaldt, E. G.; Martínez Carretero. E. 2015. Cacti (Opuntia sps.) as forage in Argentina dry lands. Revista de la Facultad de Ciencias Agrarias Universidad Nacional de Cuyo. Mendoza. Argentina. 47 (1): 263-282. 9. Guevara, J. C.; Paez, J. A.; Estevez, O. R. 1993. Caracterización económica de los principales sistemas de producción ganadera en el árido mendocino. Multequina. 2: 259-273. 10. Guevara, J. C.; Estevez, O. R.; Torres, E. R. 1995. Receptividad de las pasturas naturales de la llanura de Mendoza. Multequina. 4: 29-35. 11. Guevara, J. C.; Estevez, O. R.; Stasi, C. R. 1996. Cría de bovinos. Rentabilidad potencial en la llanura mendocina. Revista de la Facultad de Ciencias Agrarias Universidad Nacional de Cuyo. Mendoza. Argentina. 28(1): 51-62.

determining potential cattle production in the Mendoza plain, Argentina. Journal of 12. Guevara,Arid J. C.; Environments. Estevez, O. R.; 33: Torres, 347-353. E. R. 1996. Utilization of the rain-use efficiency factor for 13. Guevara, J. C.; Estevez, O. R.; Stasi, C.; Monge, A. S. 1996. Botanical composition of the seasonal diet of cattle in the rangelands of the Monte Desert of Mendoza, Argentina. Journal of Arid Environments. 32: 387-394. 14. Guevara, J. C.; Cavagnaro, J. B.; Estevez, O. R.; Le Houérou, H. N.; Stasi, C. R. 1997. Productivity, management and development problems in the arid rangelands of the central Mendoza plains. Journal of Arid Environments. 35: 575-600. 15. Guevara, J. C.; Estevez, O. R.; Stasi, C. R. 1999. Economic feasibility of cactus plantations for forage and fodder production in the Mendoza plains (Argentina). Journal of Arid Environments. 43: 241-249.

goat production in Mendoza, Argentina. Small Ruminant Research. 34: 41-48. 16.17. Guevara, J. C.;C.; Estevez,Gonnet, O.J. M.;R.; StasiEstevez, C. R. O. 1999. R. 2000. Cost-benefit Frost hardiness analysis and of cactus production fodder of crops Opuntia for forage clones in the Mendoza plain. Journal of Arid Environments. 46: 199-207.

306 Revista de la Facultad de Ciencias Agrarias Sustainable use of rangelands of the Mendoza plain (Argentina)

18. Guevara, J. C.; Estevez, O. R. 2001. Opuntia spp. for fodder and forage production in Argentina: experiences and prospects, in: Mondragón-Jacobo, C.; Pérez-González, S. (Eds.), Cactus (Opuntia spp.) as forage. FAO, Rome, Italy. 63-71. Available on line at: http://www.fao. org/docrep/005/y2808e/y2808e0c.htm#bm12 (accessed: February 2017). 19. Guevara, J. C.; Estevez, O. R.; Stasi, C. R. 2006. Respuesta de la vegetación en un gradiente de intensidad de pastoreo en Mendoza, Argentina. Multequina. 15: 27-36. 20. Guevara, J. C.; Felker, P.; Balzarini, M. G.; Paez, S. A.; Estevez, O.; Paez, M. N.; Antúnez, J. C. 2011. Productivity, cold hardiness and forage quality of spineless progeny of the Opuntia ficus-indica 1281 x O. lindheimerii 1250 cross in Mendoza plain, Argentina. Journal of the Professional Association for Cactus Development. 13: 48-62. 21. Guevara, J. C.; Grünwaldt, E. G.; Grünwaldt, J. M.; Paez, M. N. 2013. Productivity, nutrient content and cold hardiness of forage clones and progenies of Opuntia in Mendoza, Argentina and economic analysis of cactus inclusion in ruminant diets. Cactusnet Newsletter, Special Issue. 13: 73-83. Availble on line at: http://www.fao.org/3/a-av251b.pdf (accessed: February 2017). 22. Heitschmidt, R. K.; Conner, J. R.; Canon, S. K.; Pinchak, W. E.; Walter, J. W.; Dowhower, S. L. 1990. Cow/calf production and economic returns from yearlong continuous, deferred rotation and rotational grazing treatments. Journal of Production Agriculture. 3: 92-99. Available on line at: https://dl.sciencesocieties.org/publications/jpa/ abstracts/3/1/92?search-result=1 (accessed: February 2017). 23. Herbel, C. H.; Pieper. R. D. 1991. Grazing management, in: Skujins, J. (Ed.). Semiarid lands and deserts. Soil resource and reclamation. Marcel Dekker. New York. 361-382. 24. Holechek, J. L.; Pieper, R. D. 1991. Estimation of stocking rate on New Mexico rangelands. Journal of Soil and Water Conservation. 47: 116-119. 25. Le Houérou, H. N. 1991. Feeding shrubs to sheep in the mediterranean arid zone: intake, performance and feed value, in: Gaston, A.; Kernick, M.; Le Houérou, H. N. (Eds.), Proceedings of the Fourth International Rangeland Congress CIRAD (SCITS) Montepellier. France. 639-644.

as a "drought insurance" in the agricultural development of arid and semi-arid zones 26. Le Houérou,in southern H. N. 1994. Africa. Drought-tolerant WRC. Pretoria. andSouth water-efficient Africa. Report fodder Nº KV shrubs 65. 139 (DTFS), p. their role 27. Le Houérou, H. N. 1995. Bioclimatologie el biogéographie des steppes arides du north de l'Afrique. Diversité biologique, developpment durable and désertisation. Options Méditerranéennes, Serie B: Etudes et Recherches N° 10. 396 p. Available on line at: http://om.ciheam.org/om/pdf/b10/CI951183.pdf (accessed: February 2017). 28. Le Houérou, H. N. 1996. The role of cacti (Opuntia spp.) in erosion control, land reclamation, rehabilitation and agricultural development in the Mediterranean Basin. Journal of Arid Environments. 33: 135-159. 29. Louhaichi, M.; Nefzaoui, A.; Guevara, J. C. 2017. Cactus ecosystem goods and services, In: Inglese, P.; Mondragón, C.; Nefzaoui, A.; Sáenz, C. (Eds.). Crop ecology, cultivation and uses of cactus pear. FAO. ICARDA. Rome Italy. 159-169. 30. Nefzaoui, A.; Ben Salem, H. 2006. Cactus: un banco de alimento para ganado en entornos áridos y semiáridos. CACTUSNET Número Especial 10: 41-57. 31. Otta, S.; Quiroz, J.; Juaneda, E.; Salva, J.; Viani, M.; Filippini, M. F. 2016. Evaluación de sustentabilidad de un modelo extensivo de cría bovina en Mendoza, Argentina. Revista de la Facultad de Ciencias Agrarias. Universidad Nacional de Cuyo. Mendoza. Argentina. 48(1): 179-195. 32. Rossi, B. E. 2004. Flora y vegetación de la Reserva de Biósfera de Ñacuñán después de 25 años de clausura. Heterogeneidad espacial a distintas escalas (thesis). Mendoza, Argentina: Programa de Posgrado en Biología de la Universidad Nacional de Cuyo. Available on

Bertilde%20Rossi.pdf (accessed: March 2017). 33. Tanquilevich,line at: R. http://www.desertificacion.gob.ar/mapas/nacunan/bertilde_rossi/Tesis%20 F. 1991. Los suelos de la reserva ecológica de Ñacuñán. Deserta. 2: 131-206. 34. Taylor Jr., C. A.; Garza, N. E.; Brooks, T. D. 1993. Grazing systems on the Edwards Plateau of Texas: are they worth the trouble? I. Soil and vegetation response. Rangelands. 15: 53-57.

Tomo 50 • N° 1 • 2018 307 Rev. FCA UNCUYO. 2018. 50(1): 309-311. ISSN impreso 0370-4661. ISSN (en línea) 1853-8665. Revista de la Facultad de Ciencias Agrarias Universidad Nacional de Cuyo Normas para la presentación de artículos

La Revista de la Facultad de Ciencias Agrarias de la Universidad Nacional de Cuyo publica trabajos originales e inéditos, escritos en inglés, cuya temática esté relacionada con la ingeniería agronómica, ciencias de los alimentos y los recursos naturales renovables.

Dichosoriginal trabajos al conocimiento; pueden ser no artículos deben superar de investigación, las dieciséis notas páginas. científicas y revisiones. Los primeros son el resultado de la investigación científica teórica, experimental o de campo y significan un aporte resultados -aunque parciales- es importante difundir rápidamente. También entran en esta categoría Lasla descripción notas científicas, de nuevas cuya especiesextensión y no cultivares, debe superar plagas, las enfermedadesocho páginas, son y ajustes trabajos de originales metodologías. y cuyos

Las revisiones serán elaboradas por especialistas destacados en las disciplinas que se abordan en la Revista. Las mismas serán solicitadas por el Comité Editorial y no deberán superar las veinte páginas. Declaración de originalidad: los artículos deberán ser originales y no pueden ser presentados simultáneamente en otra revista para su publicación.

Alos partir autores del nacionales,1 de enero delos 2016, valores para serán los autores de 20, 40 extranjeros, y 60 dólares cada respectivamente. página diagramada Se recomienda en blanco y negro,ajustarse tendrá al número un costo de de páginas 30 dólares, establecido. la página a color 50 dólares y la página extra 70 dólares. Para Los autores de los trabajos podrán pertenecer tanto a la institución editora como a otras facultades, centros de investigación u organismos en los cuales se lleven a cabo investigaciones vinculadas con las temáticas mencionadas precedentemente. El material, acompañado de una nota solicitando su publicación, será remitido al Centro de Ediciones Académicas de la Facultad de Ciencias Agrarias, UNCUYO: [email protected], de acuerdo con Descargar nota modelo). El manuscrito deberá enviarse en el modelo establecido para tal fin ( procesadorenumerarse de en texto el margen Word, izquierdo tamaño de y laspágina páginas A4, anumeradas doble espacio, arriba con y atipografía la derecha. Cambria, cuerpo 10 (los datos de: figuras, tablas y mapas deben escribirse con igual tipografía). Las líneas deberán tanto en el ámbito nacional como internacional, recibirán dicho trabajo y la correspondiente planilla Cadade evaluación. trabajo será Su sometidofunción consistirá a referato: en los revisar especialistas críticamente (al menos el material dos), de presentado reconocida y dictaminartrayectoria respecto de su publicación. El autor puede sugerir algunos evaluadores, quienes podrían ser

Comité Editorial, de procedencia nacional e internacional y el sistema de evaluación es “doble ciego”. consideradosLa pertinencia por del eloriginal Editor es en decidida el proceso por de el evaluación.Comité Editorial El origen en tanto de los que evaluadores su aceptación es externo o rechazo al trabajo. Asimismo, el Editor devolverá a los autores, sin pasar por el proceso de arbitraje, aquellos dependemanuscritos del dictamenque no se deajusten los evaluadores a las normas o del de incumplimientopresentación de dela Revista.la exigencia de originalidad del

el título, hará correcciones de estilo y llevará a cabo el diagramado. Concluida esta etapa, se le enviará al Para conferir unidad a la publicación, el Centro de Ediciones solicitará, de ser necesario, modificaciones en días corridos. Una vez impresa la Revista, al primer autor de cada artículo se le entregará diez separatas. primer autor de cada trabajo el PDF para su revisión. Dicho proceso de revisión no deberá superar los siete contenidos y no podrán apartarse de las indicaciones que a continuación se consignan: Los trabajos, redactados con lenguaje claro, preciso, deberán exponer con rigor científico los Tomo 50 • N° 1 • 2018 309 Título el título abreviado que resulta necesario para el diagramado. En inglés y en español, con una extensión no superior a las veinte palabras. Asimismo, se requiere Autores Nombres y apellidos completos, pertenencia institucional, dirección postal y correo electrónico del primer autor.

Resumen conciso y breve se planteará el tema del trabajo, la metodología, los resultados y las conclusiones. En inglés (abstract) y en español, con una extensión máxima de doscientos vocablos. De modo

NoPalabras deberán clave incluirse antecedentes del tema a tratar, ilustraciones ni citas bibliográficas.

EnIntroducción inglés (keywords) y en español: se recomienda consultar los tesauros específicos. Deberá ser concisa, incluirá una revisión sintética del conocimiento del tema a la fecha, con las citas los objetivos e hipótesis tendientes a favorecer la claridad conceptual del trabajo. específicas que respaldan ese conocimiento y establecerá los aspectos aún no resueltos. Explicitará Materiales y métodos que permita la reproducción del ensayo a otros investigadores. Se expondrá el diseño experimental, la toma de muestras y su tratamiento estadístico de forma tal Tablas

El título, en inglés y en español, debe ubicarse arriba de las mismas. Cada una debe ser autoexplicativa, vale decir que no exigirá leer el artículo para entenderla. No debe repetirse la misma información en tablas y figuras. No incluir en la tabla ninguna información que no se discuta en el texto. Deberán presentarsereferencias al en pie, formato estas deberán MS Word, estar no en como inglés imagen. y en español. Cada campo o dato deberá separarse con tabulaciones, nunca con la barra espaciadora. El ancho total no debe exceder los 15 cm. Si hubiera Figuras El título, en inglés y en español, debe ubicarse debajo de las mismas. Si hubiera referencias al pie, deberán estar en inglés y en español. Deben ser autoexplicativas y se evitará la repetición de la información contenida en las tablas. Si la figura fue elaborada en Excel, Corel Draw, Statistica para Windows, etc., además de la versión en el procesador de textos, enviar el archivo original por separado.Fotos Otra posibilidad es enviar el archivo en formato Windows Metafile (wmf). Solo deben incluirse si proveen información que favorezca la comprensión del artículo. Deben ser nítidas, con alto contraste. Deben ser enviadas como archivos electrónicos tif o jpg, con no menos de 300 ppp. Si se dispone de foto en papel, enviar con el original; al publicar el artículo serán devueltas al autor.

Mapas Solo deben incluirse si proveen información esencial para entender el artículo. en color se ubiquen en una página. Cabe señalar que de este modo se tiende a disminuir el costo Enque el deberán diagramado, asumir se losprocurará autores que por tanto cada laspágina figuras color. que requieran color, las fotos color o los mapas

Resultados más relevantes del trabajo. Deberán presentarse en forma clara y concisa, utilizando tablas y figuras y destacando los aspectos

310 Revista de la Facultad de Ciencias Agrarias Discusión teórico. Es opcional la autonomía de esta sección ya que puede formar junto con Resultados una Interpretaciónsola estructura deconceptual. los resultados, con especial énfasis en coincidencias o diferencias con el marco

Conclusiones a los objetivos e hipótesis del trabajo. Deben ser sintéticas y reflejar hallazgos, soluciones y/o aplicaciones concretas. Deben responder Bibliografía alfa-numérico, con listado ordenado alfabéticamente por el primer autor. En virtud de ello, en el Deberá constar en el listado bibliográfico toda referencia citada en el texto. Se adoptará un sistema texto la cita aparecerá con el número que tiene en el listado bibliográfico; dicho número se escribirá en el texto entre paréntesis. consultar ejemplos): - Número correspondiente a la cita. Cada- Apellido cita bibliográfica e iniciales de deberá los autores. constar de los siguientes datos ( - Año de edición de la publicación. Se indicarán las posteriores a la inicial; por ej.: 2001. 3ra ed. - Título completo de la publicación, en el idioma original. Si fuera una revista, primero se consignará el título

- - delEditorial. artículo y a continuación el nombre de la Revista, el volumen y/o número y las páginas del artículo. - Ciudad de edición (país en caso necesario).

Número de DOI (Identificador de Objeto Digital), si la cita lo tuviera. Cabe señalar que cuando se trate de una comunicación personal, se citará en el texto la fuente (nombre de la persona y año) pero no se incluirá en el listado bibliográfico. ParaAgradecimientos citas tomadas de Internet: autor, año, título, URL (dirección: http://www...) y fecha de consulta. Se hará una mención breve y concisa a cada persona o institución merecedora de dicho reconocimiento.

Los nombres científicos completos serán citados en su primera mención, luego podrá usarse solamente la inicial del géneroet al., más in vitro la especie,). sin agregar el clasificador. El nombre común deberá estar acompañado por el nombre científico en la primera mención. Las locuciones latinas deberán ir en itálica o cursiva (ej.: 2O). Se podrán utilizar Se podrán utilizar símbolos químicos en el texto (Ej.: N por nitrógeno), pero no podrán emplearse las fórmulas químicas sino el nombre correspondiente (Ej.: agua y no H abreviaturas de uso habitual, como ATP, ADN, etc. Cuando25 muestras). en el textoEn idioma se mencionen español los cantidades, decimales sese expresaránindican con encoma letra y con del puntocero al en nueve, inglés. excepto cuando estén acompañados de unidades de medida o se incluya números más grandes (Ej.: 2, 7 y Fotografía para visor artículos requeridos por las bases de datos donde la Revista se encuentra indizada, es necesario Para favorecer el proceso de gestión editorial y responder a los distintos sistemas de marcación de que trata el trabajo. Debe ser enviada como archivo electrónico tif o jpg, con no menos de 300 ppp. que los autores envíen junto con el manuscrito del artículo, una fotografía representativa del tema

que se haya cumplido con todos los requisitos señalados: Se recomienda a los autores revisar la lista de control que figura en la versión on line, para verificar http://revista.fca.uncu.edu.ar

Tomo 50 • N° 1 • 2018 311 Development and characterization of SSR markers for Trichloris crinita using sequence data from related grass species. Desarrollo y caracterización de marcadores moleculares SSR para Trichloris crinita usando secuencias de gramíneas cercanas. P. Carolina Kozub, K. Barboza, J. B. Cavagnaro, P. F. Cavagnaro. p. 1.

Assessment of soil properties, plant yield and composition, after different type and applications mode of organic amendment in a vineyard of Mendoza, Argentina. Evaluación de propiedades químicas, biológicas, rendimiento y composición vegetal en un viñedo de Mendoza (Argentina) con diferentes tipos y modos de aplicación de abono orgánico . L. E. Martínez, R. C. Vallone, P. N.Piccoli, S. E. Ratto. p. 17. de la vid (Vitis vinifera L.) sobre cultivos de cobertura: un modelo biomatemático de la transición de amensalismo a comensalismo. of grapevine (Vitis vinifera L.) on cover crops: a biomathematical model of the transition of amensalism to comensalism. C. R. Bageta, M. Alberto, C. Sartor, A. Cecconato, A. Bevaqua, M. Tirador, M. Garriga, V. Nodaro, A. Quiroga, E. Uliarte (ex aequo). p. 33. Evaluación de crecimiento, rendimiento y calorimetría de biomasa de Miscanthus x giganteus (Poaceae) establecido en el centro-sur de Chile. Evaluation of growth, yield and value of Miscanthus x giganteus (Poaceae) biomass established in south central of Chile. F. Muñoz, J. Cancino, R. Rodríguez, R. Olave. p. 47. Efecto del momento de cosecha sobre la calidad hortícola de tubérculos de topinambur (Helianthus tuberosus L.) conservados a campo y en cámara Harvest time effect on horticultural quality of topinambur (Helianthus tuberosus L.) kept in the soil or in cold storage. L. Ibarguren, C. Rebora, M. Alberto. p. 61. Physiological and production responses of olive (Olea europaea L.) cv. Frantoio under regulated irrigation on a semiarid mediterranean weather condition (Cholqui, Maipo Valley, Chile). Respuestas y productivas en olivo (Olea europaea L.) cv. Frantoio bajo riego controlado en condiciones de un clima mediterráneo semiárido (Cholqui, Valle del Maipo, Chile). C. Kremer, L. Reyes, T. Fichet, V. García de Cortázar, J. Haberland. p. 73.

Tr of harvester combines: effect on maize yields (Zea Mays L.) and soil compaction under direct sowing system. Tr de cosechadoras: efecto sobre los rendimientos de maíz (Zea Mays L.) y compactación del suelo bajo el sistema de siembra directa. G. F. Botta, A. Tolón-Becerra, F. Bienvenido, E. R. D. Rivero, D. A. Laureda, E. E. Contessotto, R. A. Fonterosa, D. W. Agnes. p. 85. Análisis de la económica y social del agua en espárrago (Asparagus L.) y uva (Vitis vinífera) de mesa del DR-037 Altar- Pitiquito-Caborca, Sonora, Mexico 2014. Analysis of physical, economic and social water in asparagus (Asparagus L.) and grape (Vitis vinifera) fruit from DR-037 of Altar-Pitiquito-Caborca, Sonora, Mexico 2014. J. L. Ríos Flores, B. E. Rios Arredondo, J. E. Cantú Brito, H. E. Rios Arredondo, S. Armendáriz Erives, J. A. Chávez Rivero, C. Navarrete Molina, R. Castro Franco. p. 101. Capacity of two vegetative species of heavy metal accumulation. Capacidad de dos especies vegetativas en la acumulación de metales pesados. J. Alcalá Jáuregui, J. C. Rodríguez Ortíz, A. Hernández Montoya, M. F. Filippini, E. Martínez Carretero, P. E. Diaz Flores. p. 123.

Development programs for female farmers: identifying clusters for the case of Chile’s “Education and training program for rural women”. Programas Formación y capacitación para mujeres campesinas” de Chile. S. Boza, T. Muñoz, M. Cortés, M. Rico, J. Muñoz. p 141. A comparison between tourists’ pro in two Italian wine routes. Una comparación entre los de los turistas de dos rutas del vino italiano. L. Galletto. p. 157. Conocimiento co y políticas de conservación: interrelaciones en las razas ganaderas autóctonas españolas en peligro de extinción. knowledge and conservation policies: interrelationships in the Spanish livestock autochthonous endangered breeds. J. Perea, C. Barba, M. Luque, A. González, E. Angón, A. García. p. 171. The falling production of mexican cacao analyzed through the lens of Mincerian earnings function in the context of social capital of smallholders. La caída de la producción del cacao mexicano analizada a través de la función Minceriana en el contexto del capital social de pequeños productores. T. Hes, S. Mintah, H. Sulaiman, J. S. Banda Arrieta, J. Ramírez Esquivel, T. Martínez Saldaña, J. M. Aguirre López. p. 185. de factores contextuales en la adopción de modelos de agricultura insustentables. La incorporación del invernáculo en agricultores platenses. of contextual factors in the adoption of models of unsustainable agriculture. The adoption of the greenhouse in farmers in the horticultural belt of La Plata. M. L. Blandi, R. M. Rigotto, S. J. Sarandón. p. 203

Change of collembolan (Hexapoda: Collembola) community structure related to anthropic soil disturbance. Cambio de la estructura de la comunidad de colémbolos (Hexapoda: Collembola) en relación con el disturbio antrópico de los suelos. R. V. Sandler, L. B. Falco, C. A. Di Ciocco, R. Castro Huerta, C. E. Coviella. p. 217.

Análisis de datos sensoriales de tomate triturado con lógica difusa y técnicas multivariadas. Sensory data analysis crushed tomatoes with fuzzy logic and multivariate techniques. M. I. Césari, N. B. Ventrera, A. Gámbaro. p. 233. Production of cured, voided meat sausage with apple pomade added (Malus domestica) and its impact in nutritional and sensorial values. Elaboracion de embutido cárnico curado sellado al vacío con pomasa de manzana (Malus domestica) y su valoración nutricional y sensorial. N. Loyola, C. Acuña, D. Fuentes, M. Arriola. p. 249. Analysis of some physical, chemical and microbiological aspects of honey samples produced and consumed in Turkey. Análisis de algunos aspectos urquía. S. Bakirdere, T. Yaroglu, N. Tirik, M. Demiroz, A. Karaca. p. 263.

Proposal for severe injury reduction targets in Spain by territory and sector. The importance for rural areas of tr accident. Propuesta de objetivos territoriales y sectoriales de reducción de heridos graves. Importancia de los accidentes de en áreas rurales. M. D. Ramírez Román, X. Bolívar Lastra-Bravo, A. Tolón-Becerra, F. Bienvenido-Bárcena, I. Flores-Parra. p. 273.

Sustainable use of rangelands of the Mendoza plain (Argentina). Uso sustentable de los pastizales de la llanura de Mendoza (Argentina). J. C. Guevara, O. R. Estevez. p. 295.

Normas para la presentación de artículos. p. 309.