DEVELOPMENT AND STEM CELLS RESEARCH ARTICLE 3667
Development 138, 3667-3678 (2011) doi:10.1242/dev.057778 © 2011. Published by The Company of Biologists Ltd Depletion of Kcnq1ot1 non-coding RNA does not affect imprinting maintenance in stem cells Michael C. Golding1,2,3,*,†, Lauren S. Magri1,2,3,†, Liyue Zhang2,3, Sarah A. Lalone1,2,3, Michael J. Higgins4 and Mellissa R. W. Mann1,2,3,‡
SUMMARY To understand the complex regulation of genomic imprinting it is important to determine how early embryos establish imprinted gene expression across large chromosomal domains. Long non-coding RNAs (ncRNAs) have been associated with the regulation of imprinting domains, yet their function remains undefined. Here, we investigated the mouse Kcnq1ot1 ncRNA and its role in imprinted gene regulation during preimplantation development by utilizing mouse embryonic and extra-embryonic stem cell models. Our findings demonstrate that the Kcnq1ot1 ncRNA extends 471 kb from the transcription start site. This is significant as it raises the possibility that transcription through downstream genes might play a role in their silencing, including Th, which we demonstrate possesses maternal-specific expression during early development. To distinguish between a functional role for the transcript and properties inherent to transcription of long ncRNAs, we employed RNA interference-based technology to deplete Kcnq1ot1 transcripts. We hypothesized that post-transcriptional depletion of Kcnq1ot1 ncRNA would lead to activation of normally maternal-specific protein-coding genes on the paternal chromosome. Post-transcriptional short hairpin RNA-mediated depletion in embryonic stem, trophoblast stem and extra-embryonic endoderm stem cells had no observable effect on the imprinted expression of genes within the domain, or on Kcnq1ot1 imprinting center DNA methylation, although a significant decrease in Kcnq1ot1 RNA signal volume in the nucleus was observed. These data support the argument that it is the act of transcription that plays a role in imprint maintenance during early development rather than a post-transcriptional role for the RNA itself.
KEY WORDS: Genomic imprinting, Noncoding RNA, RNA interference, Kcnq1ot1, Mouse
INTRODUCTION paternally expressed ncRNA, Kcnq1ot1, and eight maternally Genomic imprinting is a specialized transcriptional regulatory expressed protein-coding genes, including Slc22a18 (solute carrier mechanism that restricts expression to the maternally or paternally family 22a, member 18), Cdkn1c (cyclin-dependent kinase inherited allele (Verona et al., 2003; Barlow and Bartolomei, 2007). inhibitor 1c), Kcnq1 (potassium voltage-gated channel, KQT-like Imprinted genes often cluster together in large domains that are subfamily, member 1) and Ascl2 (achaete-scute homolog 2) (Fig. coordinately regulated by cis-acting regions known as imprinting 1). The Kcnq1ot1 transcription start site (TSS) is located within the centers (ICs) or imprinting control regions (ICRs). ICRs harbor ICR (Lee et al., 1999; Mitsuya et al., 1999; Smilinich et al., 1999; gamete-derived parental allelic marks and are responsible for Mancini-DiNardo et al., 2003). When methylated on the maternal imprinted gene regulation over hundreds of kilobases in a allele, Kcnq1ot1 is silent (Mancini-DiNardo et al., 2003). On the bidirectional manner. Interestingly, imprinting domains are paternal allele, the ICR is unmethylated and Kcnq1ot1 is associated with a non-coding RNA (ncRNA) that may regulate transcribed. Paternal deletion of the Kcnq1ot1 ICR results in imprinted gene expression for the entire cluster (Barlow and domain-wide loss of imprinting, demonstrating broad control by Bartolomei, 2007). Generally, imprinted ncRNAs are transcribed the ICR of imprinted gene regulation (Fitzpatrick et al., 2002). from the unmethylated ICR and can range from 2.2 to possibly Activation of the normally silent paternal alleles of the protein- more than 1000 kb in length and thus are duly referred to as long coding genes is also seen when Kcnq1ot1 is truncated, possibly or macro ncRNAs. indicating a functional role for the macro ncRNA in imprinted The Kcnq1ot1/KCNQ1OT1 (potassium voltage-gated channel, domain regulation (Mancini-DiNardo et al., 2006; Shin et al., member 1, overlapping transcript 1) imprinting domain is located 2008). on mouse chromosome 7 and human 11p15.5 (Verona et al., 2003; The mechanism by which Kcnq1ot1 represses the expression of Barlow and Bartolomei, 2007). This domain contains one genes located more than 300 kb away is not completely understood, although various models have been proposed. These include a role for the ncRNA in nucleating silent chromatin, similar 1 Departments of Obstetrics and Gynecology and Biochemistry, University of Western to Xist in X inactivation; a role for Kcnq1ot1 transcription in Ontario, Schulich School of Medicine and Dentistry, London, ON N6A 5W9, Canada. 2Children’s Health Research Institute, London, ON N6C 2V5, Canada. 3Lawson initiating chromatin silencing through transcriptional interference, Health Research Institute, London, ON N6C 2V5, Canada. 4Department of Molecular repressive chromatin compartmentalization or chromatin looping; and Cellular Biology, Roswell Park Cancer Institute, Buffalo, NY 14263, USA. or a combination of these mechanisms (Mancini-DiNardo et al., *Present address: Department of Veterinary Physiology, College of Veterinary 2003; Lewis et al., 2004; Lewis et al., 2006; Pauler et al., 2007; Medicine, Texas A&M University, College Station, TX 77843, USA Pandey et al., 2008; Shin et al., 2008; Terranova et al., 2008; † These authors contributed equally to this work Koerner et al., 2009; Nagano and Fraser, 2009). Important ‡Author for correspondence ([email protected]) regulatory elements have been identified by mutational analysis but
Accepted 17 June 2011 such studies do not differentiate between these various possibilities. DEVELOPMENT 3668 RESEARCH ARTICLE Development 138 (17)
Deletion studies of the Kcnq1ot1 ICR domain indicate that the Kcnq1ot1 at 82 kb (K82), or with an shRNA targeting the luciferase gene ICR, a functional promoter and/or transcription are required for (LUC) (Golding et al., 2010). K43 shRNA, which starts at Kcnq1ot1 domain imprinting (Fitzpatrick et al., 2002; Mancini-DiNardo et position 43,804, 5Ј-TGCTGTTGACAGTGAGCGACCAGAGTTTGT - al., 2006). Truncation studies suggest that it is the transcript or CTTTCATAAATAGTGAAGCCACAGATGTATTTATGAAAGACAAA- CTCTGGGTGCCTACTGCCTCGGA-3Ј, was processed into the 22mer transcription that has a role in silencing, as premature termination Ј Ј of Kcnq1ot1 results in the derepression of imprinted protein-coding 5 -CCCAGAGTTTGTCTTTCATAAA-3 ; and K82 shRNA, which begins at Kcnq1ot1 position 82,541, 5Ј-TGCTGTTGACAGTGAGCGATGGCT- genes within their domains (Mancini-DiNardo et al., 2006; Shin et TAAGCTGATCAATTAATAGTGAAGCCACAGATGTATTAATTGAT- al., 2008). However, these studies are unable to differentiate the CAGCTTAAGCCACTGCCTACTGCCTCGGA-3Ј was processed into function of the transcript from that of transcription. Additional the 22mer 5Ј-GTGGCTTAAGCTGATCAATTAA-3Ј. Production of complexity arises from tissue-specific differential imprinted gene recombinant virus, infection, puromycin selection and passage of cells regulation (Caspary et al., 1998; Lewis et al., 2004; Umlauf et al., were performed as described (Golding et al., 2010). Cells were collected 2004; Shin et al., 2008; Weaver et al., 2010). Osbpl5, Tssc4, Cd81 between passages 7 and 27. For the shRNA depletion studies, multiple and Ascl2 are imprinted only in the placenta, whereas Phlda2, independent cell lines were generated and independent biological Slc22a18, Cdkn1c and Kcnq1 are imprinted in embryonic and replicates of wild-type (WT), LUC, K82 and K43 samples were used; six placental tissues (Fig. 1). Thus, functional studies should include to ten each for XEN cell samples, four each for ES cell samples, and four these different lineages in the analyses. to six each for TS cell samples. Robust depletion was observed in K43- transduced stem cells (82-93% depleted) compared with control cells (see Because long ncRNAs may be central regulators of imprinted Fig. S1 in the supplementary material). Importantly, there was considerable domains, it is important to elucidate their modes of action. In this sample overlap for Kcnq1ot1 length analysis, allelic expression analysis study, we investigated the mouse Kcnq1ot1 ncRNA and its role in and fluorescence in situ hybridization. imprinted gene regulation, specifically during preimplantation NIH 3T3 cells were obtained from the American Type Culture development by utilizing embryonic and extra-embryonic stem Collection (Manassas, VA, USA). Custom siRNAs targeting the putative cells. Our findings demonstrate that the Kcnq1ot1 ncRNA Kcnq1ot1 ncRNA were designed using RNAi Codex terminates 471 kb from the TSS, exists primarily as a full-length (http://hannonlab.cshl.edu/GH_siRNA.html) and synthesized by transcript and originates from the Kcnq1ot1 ICR. The length of Dharmacon (Thermo Scientific, Lafayette, CO, USA). si7, 5Ј- GGCAUACUGUCCAUACGUAUU-3Ј, starts at Kcnq1ot1 position 6933, Kcnq1ot1 is conserved in various tissues and at different Ј Ј developmental time points, suggesting that Kcnq1ot1 length does and si463, 5 -CCGAGCAGAUGAUACAGUAUU-3 , starts at Kcnq1ot1 position 463,032. Control siRNAs were an siGLO Green Transfection not contribute to differential tissue-specific silencing. However, the Indicator to monitor transfection success and a scrambled sequence non- length is significant as it raises the possibility that transcription targeting siRNA (Dharmacon). Lipofectamine 2000 transfection reagent through downstream genes might play a role in their silencing, (Invitrogen, Burlington, ON, Canada) was used to transfect 40 M siRNAs including tyrosine hydroxylase (Th), which we show possesses into NIH 3T3 cells as per the manufacturer’s protocol. Cell collection was maternal-specific expression during early development. To performed at passage 4. differentiate between the function of the transcript and that of transcription, we employed RNA interference (RNAi)-based DNA and RNA isolation DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen, technology to induce degradation of Kcnq1ot1 transcripts. We Mississauga, ON, Canada) and total RNA was extracted either using the hypothesized that post-transcriptional depletion of Kcnq1ot1 Roche High Pure RNA Tissue Kit (Roche Applied Science, Laval, QC, ncRNA would lead to activation of maternally transcribed genes Canada) or Trizol (Invitrogen) according to the manufacturers’ instructions. from the paternal chromosome. Short hairpin RNA (shRNA)- mediated Kcnq1ot1 RNA depletion in embryonic stem (ES), cDNA synthesis trophoblast stem (TS) and extra-embryonic endoderm stem (XEN) cDNA was synthesized from total RNA using Superscript II or III reverse cells had no observable effect on imprinted gene expression, nor transcriptase (Invitrogen). Reactions were primed using both random hexamers and oligo(dT) primers (Invitrogen). It was essential to ensure that on ICR DNA methylation, although a significant decrease in successful PCR amplification was not a result of contaminating genomic Kcnq1ot1 nuclear volume was observed. These data suggest that it DNA nor was impeded by any remaining RNA in the cDNA pool. To is the act of ncRNA transcription that predominantly influences eliminate DNA contamination, two DNase steps were performed, one imprint maintenance during early development, rather than there during and one after RNA extraction. Only Invitrogen DNaseI was used, being a post-transcriptional role for the RNA itself. as DNases from other manufacturers (Sigma-Aldrich, Oakville, ON, Canada; Roche Diagnostics, Laval, QC, Canada) were unable to MATERIALS AND METHODS completely remove genomic DNA. After cDNA synthesis, samples were Embryo collection treated with RNaseA to remove any residual RNA. Once the no-reverse- C57BL/6J (B6) and Mus musculus castaneus (CAST) mice were obtained transcriptase controls for each sample showed no RNA or DNA from Jackson Laboratory (Bar Harbor, ME, USA). B6(CAST7) mice contamination following beta-actin amplification (Table 1), the sample was contain Mus musculus castaneus chromosome 7s on a B6 background used for PCR amplification. (Mann et al., 2004). B6 females were mated to CAST males to obtain embryonic day (E) 7.5, 8.5 and 9.5 B6XCAST embryos and placentas. PCR amplification CAST7 females were crossed with B6 males to recover E12.5 CAST7XB6 Approximately 660 kb of DNA sequence was obtained from Ensembl embryos and placentas. E9.5 placentas with a paternal IC2 deletion were (http://www.ensembl.org/index.html) for distal chromosome 7 also analyzed (Fitzpatrick et al., 2002). Experiments were performed in (150,418,839 to 149,758,443 bp). Primers were manually designed within compliance with guidelines set by the Canadian Council for Animal Care intronic and intergenic regions, with confirmation of appropriate primer and policies and procedures approved by the University of Western Ontario attributes by NetPrimer (http://www.premierbiosoft.com/netprimer/ Council on Animal Care. index.html) (Table 1), and were synthesized by Sigma Genosys (Oakville, ON, Canada). Primers were initially designed at ~50 kb increments from Transduction and transfection of stem cells the Kcnq1ot1 TSS to 619 kb downstream. Once amplification was B6XCAST XEN, ES and TS cells were generated as described (Golding et narrowed to a ~50 kb window, primer pairs were designed at ~5 kb al., 2010). Stem cells were transduced with an shRNA targeting Kcnq1ot1 intervals, and then at 1 kb intervals to locate the end of the transcript. PCR
at 43 kb from the TSS (K43), a non-functional shRNA homologous to amplification was performed using illustra Ready-To-Go PCR Beads (GE DEVELOPMENT Kcnq1ot1 ncRNA depletion in stem cells RESEARCH ARTICLE 3669
Table 1. Primers, annealing temperature and amplicon size Primer Forward (5Ј to 3Ј) Reverse (5Ј to 3Ј) Tm (°C) Size (bp) 3k ATTGGGAACTTGGGGTGGAAGC GGCACACGGTATGAGAAAAGATTG 54 814 65k ACAGGTTTGGTAGTATGAAGG ATCCATTGTATCCATTTTGAC 58 922 65kB CCATTTTCCAACATACCCATACA TTCTACTCGAGCACAAAGACACA 60 291 94k AAACTAACTTTGTATTCCTGAACC CAGTGTCAGAAGTGAGATACCC 52.8 472 118k CTTCCTTGTGAGAAAAGCATT GCTGGGGATTGGGAGTAT 56/58 350 202k GCCAAGAGGGTACTAAGGTC ACGTCTAGCATCCATGAGG 56/57 407 228k CTCGGAGGTGGAATGGCTG TCACGGCGGAACTGGGA 58/60 293 307k ACACAGAGGTTTCCCCATCA GGAGTCAGTGTAGTGCCTATGG 58.8 220 380k TGTCCTCCTCATTTCATCC GCTGTAGCCTACCCATTAGTA 50 426 392k TGTGATAGGGTTATTTCTACTGAG AGTTTGTGCTGCTGTGTATTC 58 416 410k CAAATGAGGACCTGGAAAGAT TAACAGCACAAACTGAGGAAAT 60 211 411k ATACAATAGTCAGATAATGGGGG AACAGGTTTGCCTTGCTCA 60 333 433k AACAGAGATGTGTAGCAGTAGGG GCTCCAGTCAGCAAGCACTT 61 376 449k CCTTTTGACAATGTGGTAAC CAGACTTGGGTGTAGTGGG 58 307 457k CCACAAAGGGATAAAAACAT AACCACCAAACATTCTACCA 60 358 463k AGGGCATTGGTGGACAGGA ATTTGGTATTGATATTTTGCTCAGAC 60 497 464k CCGTTGAAAGGCATACTGTTGAA GGCAATCCAACCTCTGTGTGTC 62 224 465k GAACCAGACACAACATCACCAGT TTGTATATGATAGAGTTCTGTTTTTATAG 60 276 466k GAAGAAACAGCGTTGGCATA GGAAGAGAGGCAAAGCAAGA 59 252 467k AATGTTATCCCCCTTCCCAG GGCTGTTGCCAGGTAAATGT 60 271 468k TCGTTAGATGCGGAAAAAGC CGAATTGCTCTGGCTAGGAC 60 247 470k GGCATCATCCTGAGTGAGGT ATCCCTGGAAATGGCAGTCTT 59 270 470kZ CCCCAATGGAGGAGCTAGAG CCTACACACCCATTCCCATT 60 234 470kB1 CCAGTACCCCAGAACTCTTGA TTTCCAATGCTATCCCAAAAG 55 246 471kA1 – ATTACGTATTTTCCTCAATTA 55 281 471kA2 – TCCTTTTTTTTTTATTACGTATTTTCC 56 317 471kB2 GAAAGAGAGGCCCTTTGGTCAGGCA GCTTAAGGCTCTCCTATGTCTTTT 55 201 471 AAGAGAGGCCCTTTGGTCAGGCA CAGGCCTCTAACAGGTCTTCA 57 284 474k CAATGTCAACCTCAAGAAGA GAAAGGACCCAGATGTAGC 51 505 475k ATGAGAGTTTGAAGAATGCCTT TGTCCTCCCTGTCACCTAAAA 56 215 479k CTTCCCAGTTTTCCCTCTA TATGCCTTTGTGGTAGTTTG 58 598 486k TTTCAGATAGCAATACAAGTT TAAGGTTCCACTCCCAC 54 411 492k CTCGCTATATTTGGTCATTAT AGATAGATTACACAGTGCTTTAT 53/55 391 510k GGTAACTGTGGGGGTGGAG CAGGCAGAGAATGAGAAGGAG 63 332 619k CTACAATCAAAAACCATCAGCAA GCCTCTAAAGCCTACTCATCTTC 61 646 Slc22a18 ATCAACAGGACTTTTGCCCC ACAGAATCTAGGCCCAGTG 58 227 Cdkn1c GCCAATGCGAACGACTTC TACACCTTGGGACCAGCGTACTCC 58 364 Kcnq1 CATCGGTGCCCGTCTGAACAGG TTGCTGGGTAGGAAGAGCTCAG 58 189 Ascl2 TGAGCATCCCACCCCCCTA CCAAACATCAGCGTCAGTATAG 58 474 Th CTTCCGTGTGTTTCAGTGC ACCGTGGAGAGTTTTTCAA 58 195 Airn CCAGGAGGGAGTGTGTCAAT CAAGGGTTCAATTCCCAAAA 58 376 H19 CCTCAAGATGAAAGAAATGGT AACACTTTATGATGGAACTGC 55 641 H19 probes CCACCTGTCGTCCATCTCC-FL LC640-TCTGAGGGCAACTGGGTGTGG-P – – BIS outer GGTTAGAAGTAGAGGTGATT CAAAACCACCCCTACTTCTAT 58 571 BIS inner GTGTGATTTTATTTGGAGAG CCACTCACTACCTTAATACTAACCAC 52 207 k, kb from start site; BIS, bisulfite mutagenesis primer.
Healthcare Biosciences, Baie d-Urfe, QC, Canada) at 95°C for 2 minutes, the Kcnq1ot1 ncRNA, qPCR was performed for three E9.5 placental and two 35 to 45 cycles of 95°C for 30 seconds, Tm (see Table 1) for 30 seconds, XEN cell cDNAs in duplicate and standardized to genomic DNA and 72°C for 50 seconds, followed by 7 minutes at 72°C, with a 4°C hold. amplification to control for primer efficiency. qPCR was performed in triplicate using three different DNA samples. Mean expression levels for each Quantitative (q) PCR analysis primer set were then standardized to the 3k primer set. Standard error of the qPCR analysis of mRNA levels was carried out using the iQ SYBR Green mean (s.e.m.) was calculated. Supermix (Bio-Rad, Mississauga, ON, Canada) following the manufacturer’s instructions. Reactions were performed in triplicate on three to six samples Allelic expression analysis each for control and experimental groups in shRNA experiments, and on two Primers (Table 1), polymorphisms between B6 and CAST, and allele- samples each for control and experimental groups in siRNA experiments. specific restriction enzymes were reported for Slc22a18 (Dao et al., 1998), Using an MJ Thermocycler Chromo4 Real-Time PCR System (Bio-Rad), Cdkn1c (Doherty et al., 2000), Kcnq1 (Gould and Pfeifer, 1998; Jiang et qPCR was conducted at 95°C for 2 minutes, 35 to 40 cycles of 94°C for 20 al., 1998), Kcnq1ot1 (Rivera et al., 2008) and Ascl2 (Mann et al., 2003). seconds, 58°C for 30 seconds, 72°C for 45 seconds, then 72°C for 7 minutes. For Th, a polymorphism between B6 (G) and CAST (A) was identified at Samples were normalized to the reference gene beta-actin or to mitochondrial position 1046 (NM_009377). Restriction digestion with BsrI resulted in ribosomal protein L1 (Mrpl1). As controls for off-target effects, Airn and 124 and 71 bp fragments in B6, whereas the CAST amplicon was H19 expression was examined in the shRNA depletion study. For analyses, uncleaved. For Airn, a polymorphism at SNP rs6154084 on chromosome control samples (WT cells in shRNA studies and untreated cells in siRNA 17:12972645 between B6 (T) and CAST (C) was utilized in a restriction experiments) were set to a value of 1, and experimental reactions were assay with AvaI to produce 220 and 156 bp fragments in CAST, whereas
normalized to the control. To determine relative levels of expression across the B6 amplicon was uncleaved. To quantify the relative amounts of DEVELOPMENT 3670 RESEARCH ARTICLE Development 138 (17) amplicons, computer-assisted densitometry was performed with Statistical analysis QuantityOne 1-D Analysis Software (Bio-Rad) to calculate the adjusted One-tailed Student’s t-tests were performed on mean qPCR values and on intensity/mm2 for each band. The H19 allelic expression assay using the mean fluorescence signal volumes. P-values were considered to be LightCycler Real-Time PCR System (Roche Molecular Biochemicals) was significant at P<0.05. performed with hybridization probes (Table 1) as described (Mann et al., 2004). Parental allele-specific expression was calculated as the percentage RESULTS B6 or CAST expression relative to the total expression. Monoallelic Kcnq1ot1 expression was defined as ≥90% from one parental allele. is a macro ncRNA To better define the role of the Kcnq1ot1 ncRNA in imprinted gene 3Ј Rapid amplification of cDNA ends (3ЈRACE) regulation, we first delineated transcript length, as at least four The 3ЈRACE System Kit (Invitrogen) was used for cDNA synthesis and conflicting reports exist regarding the ncRNA length (Horike et al., for semi-nested PCR according to manufacturer’s protocol with the 470F 2000; Yatsuki et al., 2000; Pandey et al., 2008; Redrup et al., 2009). (first round) or 471F (second round) forward primer (Table 1) paired with Primer pairs were designed to amplify intronic and intergenic regions the universal adapter primer on E9.5 placental and E12.5 embryo RNA. from E9.5 placental cDNA starting at 3 kb from the Kcnq1ot1 TSS Following electrophoresis, bands of interest were recovered using the Qiaquick Gel Extraction Kit (Qiagen), DNA fragments were ligated into and extending to 619 kb, within Ins2. Only primer sets that the pGEM-T EASY vector (Promega, Napean, ON, Canada), and the successfully amplified genomic DNA were utilized. A failure of vector was transformed into competent Escherichia coli. DNA was primer pairs to amplify cDNA but not genomic DNA indicated that extracted from bacterial colonies using the GenElute Plasmid Miniprep Kit there was no transcript present at that location. Amplification with (Sigma-Aldrich). Sequencing was performed at the London Regional primer sets ~50 kb apart revealed that the 3Ј end of Kcnq1ot1 resides Genomics Centre (London, ON, Canada), Nanuq Sequencing Facility in a region between 449 to 486 kb (Fig. 1). Primer pairs were then (Montreal, QC, Canada) or BioBasic (Markham, ON, Canada). BLAST designed every ~5 kb within this 37 kb region. A fragment was analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was performed to align detected at 457, 463 and 468 kb, but not at 475 and 479 kb. Finally, resulting sequences with the GenBank database. primer sets were designed at less than 1 kb intervals between 463 to Bisulfite sequencing 475 kb. Whereas primers between 463 and 470 kb successfully Bisulfite mutagenesis and sequencing with agarose embedding was amplified cDNA, primers at 471, 474 and 475 kb failed to produce performed as described (Market-Velker et al., 2010; Golding et al., amplicons. To identify the 3Ј end of the transcript, 3ЈRACE was 2010). Lysed cells (10 l) were embedded in 20 l 2% low-melting- performed on E9.5 placental and E12.5 embryonic cDNA. Sequence point agarose (Sigma). Following bisulfite mutagenesis, 22 l diluted analysis of cloned 3ЈRACE products mapped the polyadenylation agarose was added to Ready-To-Go PCR Beads containing Kcnq1ot1 signal to 471 kb (Fig. 1). To confirm transcript termination at the BIS outer primers (Table 1) and 1 l 240 ng/ml tRNA. PCR reactions polyadenylation signal, primer sets were designed between 470,857 were halved, allowing for two independent PCR reactions. The first and 471,291 bp (see Fig. S2 in the supplementary material). The end round product (5 l) was seeded into each second round PCR reaction with Kcnq1ot1 BIS inner primers (Table 1). Sequencing was performed of the transcript resides at 471,164 bp. at the Nanuq Sequencing Facility or BioBasic. Sequences with less than 95% conversion rates were not included. Percentage methylation was Kcnq1ot1 transcript length is invariant calculated as the number of hypermethylated DNA strands/total number Midgestation embryos display differential regulation of of DNA strands. Hypermethylated DNA strands displayed ≥50% imprinted genes in embryonic and placental tissue. One methylated CpGs. explanation for this differential regulation is that alternative Kcnq1ot1 transcripts exist with variant lengths. To determine RNA fluorescence in situ hybridization (FISH) Kcnq1ot1 and Airn FISH probes were generated from a 32 kb region of whether Kcnq1ot1 length was tissue-dependent, B6XCAST ES fosmid Wl1-2505B3 in the Kcnq1 intronic region and a 42 kb region of cells, XEN cells, TS cells and neonatal brain samples, as well as fosmid Wl1-270O22, respectively (CHORI, Oakland, CA, USA), using the CAST7XB6 E12.5 embryo and placenta, were compared with BioPrime DNA Labeling System (Invitrogen) and fluorescein-12-dUTP B6XCAST E9.5 placenta using selected primer sets along the (Roche Diagnostics) with minor modifications; Invitrogen dNTPs were putative Kcnq1ot1 ncRNA. Amplification was observed up to used and labeling reactions were incubated for 12 hours. Unincorporated 470 kb in all tissues, but not beyond (Fig. 2A). Thus, in all three dNTPs were removed using ProbeQuant G-50 Micro Columns (GE lineages and at all developmental time points examined, Healthcare). Probes were precipitated with Cot-1 DNA, yeast tRNA and Kcnq1ot1 length was conserved. To determine relative levels of salmon sperm DNA (Invitrogen) and washed with 75% and 100% ethanol. expression across the Kcnq1ot1 ncRNA, cDNA amplifications Probes were air dried then resuspended in 100% deionized formamide and for individual primer sets were standardized to the 3k primer set denatured at 85°C for 10 minutes. After 2 minutes on ice, 2ϫ hybridization mix (25% dextran sulfate, 4ϫ SSC) was added, incubated at 37°C for 30- (Fig. 2B). No statistical difference was observed in transcript 90 minutes, then stored at –20°C. abundance across the ncRNA, supporting the premise that the XEN cells were seeded on glass slides (VWR, Mississauga, ON, Canada), ncRNA is a single RNA moiety. permeabilized with sequential transfers into ice-cold cytoskeletal extraction buffer (CSK) for 30 seconds, ice-cold CSK containing 0.25% Triton X-100 Kcnq1ot1 is primarily transcribed as a full-length (Sigma-Aldrich) for 45 seconds and ice-cold CSK for 30 seconds (Kalantry transcript that originates from the Kcnq1ot1 et al., 2009), fixed in 4% paraformaldehyde at room temperature for 10 promoter minutes (Panning and Jaenisch, 1996), washed in PBS, dehydrated in To definitively demonstrate that the amplified products sequential washes of 85%, 95% and 100% ethanol, then air dried. RNA- corresponded to the Kcnq1ot1 transcript, we employed RNAi FISH probes were hybridized overnight and washed as described (Murakami technology, as well as a targeted deletion of the paternal Kcnq1ot1 et al., 2007). Cells were mounted and stained with Vectashield augmented with DAPI (Vector Laboratories, Burlington, ON, Canada) and imaged using ICR. Given the demonstrated ability of short interfering RNAs z-stacks on a FluoView FV1000 coupled to an IX81 motorized inverted (siRNAs) and shRNAs to deplete nuclear transcripts (Robb et al., system microscope (Olympus, Markham, ON, Canada). Fluorescence signal 2005; Willingham et al., 2005; Zhao et al., 2008), we first volumes were measured using intensity-based thresholds in Volocity (v5.2.0, determined whether amplified PCR products were specific to the
PerkinElmer, Woodbridge, ON, Canada). Kcnq1ot1 ncRNA using RNAi. As a shRNA targeting Kcnq1ot1 DEVELOPMENT Kcnq1ot1 ncRNA depletion in stem cells RESEARCH ARTICLE 3671
Fig. 1. The putative Kcnq1ot1 ncRNA extends 471 kb from the transcription start site. Organization of the mouse Kcnq1ot1 and H19 imprinting domains. Top and bottom strands correspond to maternal and paternal alleles, respectively. Intronic and intergenic regions from 3 to 619 kb (arrowheads) were amplified using E9.5 placental cDNA (P) and genomic DNA (G) as a positive control. The putative Kcnq1ot1 ncRNA extends 471 kb (471k) (vertical green line). 3ЈRACE identified a polyadenylation signal (underlined) at 471 kb. Wavy lines, ncRNAs; red boxes and wavy lines, maternal expression in embryo and placenta; pink boxes, maternal expression in placenta; blue boxes and wavy lines, paternal expression; black circles, methylated CpG island; white circles, unmethylated CpG island. ICR, imprinting control region. will result in degradation of the entire Kcnq1ot1 ncRNA (Hannon, target Kcnq1ot1 at the proximal and distal ends at 7 and 463 kb 2002), it was expected that amplicons specific to Kcnq1ot1 would from the TSS (si7 and si463) (Fig. 3A). Owing to the ease of exhibit reduced RNA levels compared with controls, whereas those transfection and the availability of established protocols, mouse from another undefined transcript would be unaffected by RNA embryonic fibroblast (NIH 3T3) cells were transfected with a depletion. Real-time qPCR was performed using cDNA from scrambled, non-targeting control siRNA, si7 or si463, and were transgenic XEN cells containing a shRNA targeting Kcnq1ot1 at compared with non-transfected cells. Real-time RT-PCR analysis 43 kb from the TSS (K43), control XEN cells harboring an was performed with primers 3k, 94k, 118k, 392k and 470k along ineffectual shRNA (K82), and WT cells. XEN cells were chosen the length of the putative transcript. NIH 3T3 si7- and si463- because they are functionally relevant as preimplantation extra- targeted cells had significantly reduced transcript abundance (for embryonic cells, exhibit abundant expression of Kcnq1ot1, and are si7 and si463, respectively: 3k, 70% and 76%; 94k, 84% and 93%; effectively transduced with the shRNA targeting vectors (Golding 118k, 98% and 100%; 392k, 93% and 97%; 470k, 84% and 82%) et al., 2010). qPCR was performed with primers at intronic and compared with control cells (P<0.05) (Fig. 3D). As depletion of intergenic regions: 3k, 65k, 202k, 307k, 392k, 463K and 470k (Fig. Kcnq1ot1 at the proximal and distal ends of the transcript were not 3A). Amplification of Kcnq1ot1 was significantly decreased (88- statistically different for each primer set, and as distal amplicons 97%) in K43-transduced XEN cells compared with controls for all were no more reduced than proximal regions for si463, these primer pairs examined (P<0.05) (Fig. 3C), indicating that all results indicate that the majority of Kcnq1ot1 transcripts are full amplicons represent the Kcnq1ot1 ncRNA. As controls for off- length and extend at least 470 kb. target effects, the expression of two other ncRNAs, Airn and H19, As a final confirmation that the Kcnq1ot1 transcript extends 471 was examined. Expression of Airn and H19 was not statistically kb, a targeted deletion of the paternal Kcnq1ot1 ICR (Fitzpatrick et different among WT, K82 and K43 XEN cells (Fig. 3C). al., 2002) was employed (Fig. 3B). qPCR was performed using If a single full-length RNA is primarily produced, we would cDNA from E9.5 B6XCAST WT and paternal Kcnq1ot1 IC2 expect that targeting near the terminal region of the transcript placenta using primer sets 3k, 65k, 118k, 202k, 307k, 392k, 463k would yield a similar depletion of amplified regions as targeting and 470k (Fig. 3E). For all primer sets, paternal IC2 placenta the ncRNA near the TSS. If multiple transcripts are produced of failed to produce an amplification product, in contrast to control varying length, we would anticipate greater depletion for more placenta, verifying that Kcnq1ot1 transcript length is at least 470 terminal regions than for more proximal regions when the ncRNA kb and that the amplicons are specific to a transcript originating
is targeted at its distal end. To test this, siRNAs were designed to from the Kcnq1ot1 ICR/promoter. DEVELOPMENT 3672 RESEARCH ARTICLE Development 138 (17)
Fig. 2. Kcnq1ot1 transcript length is conserved in a variety of tissues and at various developmental time points. (A)Selected primers along the length of the Kcnq1ot1 transcript were used to amplify the transcript in mouse E9.5 placenta (9.5P), E12.5 embryo (12.5E) and placenta (12.5P), neonatal brain, embryonic stem (ES), trophoblast stem (TS) and extra-embryonic endoderm stem (XEN) cells, as well as genomic DNA (gDNA) as a control. In all tissues, signal from the transcript was detected up to and including 470k (470A1). No amplification was detected 14 and 23 bp downstream at 470A2 and 471B2, respectively, or at 474k, 475K, 479k and 492k (data not shown) in cDNA as compared with control gDNA. -actin and no RT (lacking reverse transcriptase) reactions were included as positive and negative controls, respectively. M, size marker. (B)To determine whether the Kcnq1ot1 ncRNA was essentially a single RNA moiety, qRT-PCR was performed along the length of the Kcnq1ot1 transcript and standardized to the 3k primer set. No statistical difference was observed in transcript abundance between the primer sets in E9.5 placenta or in XEN cells. In this analysis, primer set 65kB was used instead of 65k owing to its shorter amplicon and better PCR amplification efficiency. Error bars indicate s.e.m.
Imprinted status of Th there was no delineation between transcription of Kcnq1ot1 and Th is located between the Kcnq1ot1 and H19 imprinting domains, a functional role for the transcript itself (Fitzpatrick et al., 2002; but is not recognized as a member of either domain as targeted Mancini-DiNardo et al., 2006; Shin et al., 2008). If the transcript disruption of Th failed to demonstrate any parental origin effects has a function in silencing genes in this region, its depletion (Zhou et al., 1995). However, another study using microarray would be expected to result in activation of maternally technology to identify imprinted genes found that Th is maternally transcribed genes from the paternal chromosome. To determine expressed in placenta (Schulz et al., 2006). As we found that whether Kcnq1ot1 depletion results in loss of imprinting within Kcnq1ot1 was transcribed through Th, this warranted further the Kcnq1ot1 domain, imprinted methylation and expression analysis of its imprinted status. RT-PCR was performed on were assayed in ES, TS and XEN cells. The DNA methylation B6XCAST E7.5, E8.5, E9.5 and CAST7XB6 E12.5 embryonic and status of the Kcnq1ot1 ICR was determined by the bisulfite placental cDNA. The relative maternal and paternal transcript mutagenesis and sequencing assay. Results showed no change in abundance was determined by BsrI allelic restriction digestion (Fig. Kcnq1ot1 ICR methylation patterns in B6XCAST K43- 4). Th displayed maternal expression in E7.5 embryo and placenta transduced cells as compared with B6XCAST WT and K82- and E8.5 placenta, and preferential maternal expression in E9.5 and transduced control cells. Maternal DNA strands were E12.5 placenta, but was biallelically expressed in the corresponding hypermethylated, whereas paternal DNA strands remained embryonic tissues. These results demonstrate that Th shares a hypomethylated (Fig. 5), indicating that depletion of the similar expression pattern with the neighboring genes Tssc4 and Kcnq1ot1 transcript in stem cells had little effect on ICR Cd81, with maternal expression in extra-embryonic lineages but methylation. progressive biallelic expression in the embryo (Caspary et al., To assess the effects of Kcnq1ot1 depletion on imprinted 1998; Lewis et al., 2004; Umlauf et al., 2004). expression, allelic expression analysis was performed for the control genes H19 and Airn and for five imprinted genes in K43- Imprinting is maintained upon Kcnq1ot1 RNA transduced cells, as well as WT, K82-transduced and LUC- depletion transduced control ES, TS and XEN cells (Fig. 6). Depletion of Previous studies have shown that truncation of Kcnq1ot1 or Kcnq1ot1 by shRNA K43 had no effect on H19 or Airn imprinted deletion of the Kcnq1ot1 promoter results in derepression of expression. As bidirectional silencing of imprinted genes occurs
imprinted genes within the domain. However, in these studies within the Kcnq1ot1 imprinted domain, two genes upstream DEVELOPMENT Kcnq1ot1 ncRNA depletion in stem cells RESEARCH ARTICLE 3673
Fig. 3. Kcnq1ot1 RNA depletion and paternal IC2 deletion lead to a significant reduction in Kcnq1ot1 transcript abundance up to 470 kb. (A,B)The mouse Kcnq1ot1 imprinted domain. (A)RNAi analysis using shRNA K43 (dark-blue X) and siRNA si7 and si463 (light-blue Xs). (B)Paternal IC2 deletion () analysis. Dashed line, putative Kcnq1ot1 ncRNA. See Fig. 1 for symbol details. qRT-PCR analysis was performed using primer sets that mapped to intronic and intergenic regions (arrowheads). (C)XEN cells transduced with shRNA K43. Kcnq1ot1 was significantly depleted in K43-transduced cells at 3, 65, 202, 307, 392, 463 and 470 kb (dark-blue text in A) as compared with control cells. (D)NIH 3T3 cells transfected with si7, si463 or a non-targeting siRNA (NT). Reduced amplification of the transcript was seen with both si7 and si463 siRNAs versus NT and wild-type (WT) control NIH 3T3 cells at 3, 94, 118, 392 and 470 kb (light-blue text in A). (E)Paternal IC2 deletion analysis in E9.5 placenta. All regions examined showed significant loss of Kcnq1ot1 expression. Error bars, s.e.m.; *, P<0.05.
(Slc22a18 and Cdkn1c) and three genes downstream (Kcnq1, Ascl2 substantial decrease in Kcnq1ot1 ncRNA, we next determined and Th) of the Kcnq1ot1 ICR were analyzed. Similar to control ES, whether Kcnq1ot1 ncRNA localization was abrogated by K43 RNAi TS and XEN cells, K43-transduced cells displayed primarily depletion. RNA FISH was performed using probes for Kcnq1ot1 monoallelic expression from the maternal Kcnq1 and Cdkn1c and, as a control, Airn. Cells were analyzed by confocal microscopy, alleles, as previously observed for WT ES and TS cells (Umlauf et and volumetric measurements were taken (Fig. 7). For the purposes al., 2004; Lewis et al., 2006). For Slc22a18 and Th, K43- of comparison, signal volumes were classified according to Redrup transduced and control TS and XEN cells were found to have et al. (Redrup et al., 2009). Airn showed similar volume distributions monoallelic expression, whereas ES cells exhibited biallelic for WT and K43-transduced XEN cells: 47.9% and 50.4% for 0-0.4 expression. Ascl2 expression was monoallelic in TS cells but m3, 21.4% and 20.9% for 0.4-0.8 m3, 16.3% and 12.5% for 0.8- biallelic in ES and XEN cells, with little difference between K43- 1.2 m3, 8.3% and 5.1% for 1.2-1.6 m3, 3.3% and 5.1% for 1.6-2.0 transduced and control cells. Thus, imprinted gene expression was m3 and 2.6% and 6.0% for >2.0 m3, respectively (Fig. 7). No maintained in K43-transduced stem cells despite a ≥82% reduction significant difference was found for mean Airn volume in WT and in the Kcnq1ot1 ncRNA. Thus, depletion of Kcnq1ot1 RNA in K43-transduced cells, at 0.58 and 0.61 m3, respectively. This embryonic and extra-embryonic stem cells does not result in contrasts with Kcnq1ot1, where volume size was significantly domain-wide loss of imprinting. decreased in K43-transduced cells compared with WT XEN cells: The Kcnq1ot1 ncRNA localizes to the nuclear compartment as a 68.8% versus 53.1% for 0-0.4 m3, 19.9% versus 24.9% for 0.4-0.8 strong signal that overlaps the paternal Kcnq1ot1 domain (Pandey et m3, 8.4% versus 11.8% for 0.8-1.2 m3, 2.3% versus 6.1% for 1.2- al., 2008; Terranova et al., 2008; Redrup et al., 2009). Given that 1.6 m3, 0.3% versus 2.4% for 1.6-2.0 m3 and 0.3% versus 1.7% 3 imprinted expression and methylation were maintained despite a for >2.0 m , respectively (Fig. 7). Overall, mean Kcnq1ot1 volume DEVELOPMENT 3674 RESEARCH ARTICLE Development 138 (17)
Bartolomei, 2007). However, notable differences also exist. In mouse, the region between Th and Ins2 is over 200 kb and contains an extraordinarily high concentration of tandem repeats, long interspersed nuclear element (LINE) retrotransposons and endogenous retroelements (Shirohzu et al., 2004). This repeat-rich region also exhibits asynchronous replication, similar to the rest of the domain, and contains 18 matrix attachment regions (Yatsuki et al., 2000; Purbowasito et al., 2004). In human, the distance between TH and INS is considerably shorter (~10 kb). However, a highly repetitive region that is enriched for LINEs and SINEs (short interspersed elements) and retroelements is found between ASCL2 and TH (a ~115 kb region) in humans (Shirohzu et al., 2004) and in the marsupial tammar wallaby (Ager et al., 2008). If repetitive Fig. 4. Th is expressed primarily from the maternal allele in regions play a role in boundary function, this might indicate that placenta and becomes biallelic within the embryo during the boundary between the KCNQ1OT1 and H19 domains in postimplantation development. Th amplicons were subjected to BsrI humans is within the ASCL2 and TH repetitive region. Current digestion to discriminate between B6 and CAST alleles and evidence argues against this, however, as ASCL2 apparently densitometry was performed to determine relative maternal and escapes genomic imprinting in humans (Miyamoto et al., 2002). paternal transcript abundance. Multiple mouse embryos (n3-5) were Alternatively, if repetitive elements are unrelated to boundary analyzed and means were calculated for each sample. E, embryo; P, function, the boundary might lie within the conserved region placenta. Error bars indicate s.e.m. upstream of INS/Ins2. A recent investigation of a maternally expressed GFP reporter located more than 600 kb downstream of the Kcnq1ot1 ICR and 2.6 kb upstream of Ins2 (Jones et al., 2011) was significantly decreased in K43-transduced XEN cells: 0.30 m3, found that the reporter was regulated in the same manner as other as compared with 0.49 m3 for WT cells (P<6ϫ10–7). Thus, we maternally expressed genes within the Kcnq1ot1 imprinted domain, conclude that imprinted methylation and expression are maintained possibly placing the boundary within 2.6 kb of Ins2. even though the majority (69%) of K43-transduced cells exhibit very little or no RNA accumulation. Imprinted Kcnq1ot1 domain regulation Precedent exists for macro ncRNAs residing within imprinted DISCUSSION domains (Koerner et al., 2009), ranging from Xist as a 17 kb In this study, we found that the Kcnq1ot1 macro ncRNA extends to ncRNA to Ube3a-ats (Snrpnlt, Lncat), which possibly extends 471 kb from the TSS, exists predominantly as a full-length more than 1000 kb (Koerner et al., 2009). If the Kcnq1ot1 ncRNA transcript, and originates from the Kcnq1ot1 ICR. Kcnq1ot1 length functioned similarly to Xist, a ncRNA involved in X chromosome was conserved in embryonic and placental tissues, as well as in inactivation (Pauler et al., 2007), then an excessively long RNA embryo-derived stem cells and postnatal brain. The extensive would be unnecessary as the 17 kb Xist ncRNA is more than length of Kcnq1ot1 is significant as it suggests that transcription sufficient to coat and effectively silence an entire chromosome through downstream genes might play a role in their silencing. (Brockdorff et al., 1992). In addition, if transcript length is a Post-transcriptional shRNA-mediated Kcnq1ot1 RNA depletion in determining factor in imprinted gene regulation, we would expect embryonic and extra-embryonic stem cells had no effect on the that differential regulation of the Kcnq1ot1 domain in embryonic imprinted expression of genes within the domain, nor on DNA and extra-embryonic tissues would correlate with shorter and methylation at the Kcnq1ot1 ICR, although a significant decrease longer transcript lengths, respectively. Instead, we observed that the in Kcnq1ot1 signal volume was observed. These data support the Kcnq1ot1 transcript length remained the same in embryonic and argument that it is the act of transcription that plays a role in extra-embryonic lineages and at all developmental stages imprint maintenance during early development, rather than there examined, indicating that Kcnq1ot1 mRNA length does not being a post-transcriptional role for the RNA itself. contribute to differential silencing. Various models have been proposed for Kcnq1ot1 imprinted Kcnq1ot1 length and function domain regulation, including a role for the ncRNA itself and a role Original estimates placed Kcnq1ot1 at ~60 kb based on sequence for Kcnq1ot1 transcription in initiating chromatin silencing homology between mouse and human (Horike et al., 2000; Yatsuki (Mancini-DiNardo et al., 2003; Lewis et al., 2004; Lewis et al., et al., 2000), 91.5 kb from the TSS (Pandey et al., 2008), or 2006; Pauler et al., 2007; Shin et al., 2008; Koerner et al., 2009; between 80 kb and 120 kb with a polyadenylation site located 121 Nagano and Fraser, 2009). To differentiate between functions of the kb downstream (Redrup et al., 2009). In these studies, the Kcnq1ot transcript and of transcription, we employed RNAi technology that putative stop site falls short of the Kcnq1 TSS. Here, we preserves transcription but degrades the macro ncRNA post- demonstrate using RNAi technology as well as a paternal IC2 transcriptionally. Kcnq1ot1 transcripts were depleted in both deletion that the Kcnq1ot1 ncRNA extends through downstream embryonic and extra-embryonic stem cells, in case the Kcnq1ot1 imprinted genes to 471 kb from the TSS. transcript or its transcription had different regulatory roles in these The mouse and human Kcnq1ot1/KCNQ1OT1 domains possess cell types. Despite significant depletion (>80%), the imprinted a high degree of synteny (Paulsen et al., 1998; Engemann et al., expression of genes within the domain and the imprinted DNA 2000; Onyango et al., 2000; Paulsen et al., 2000; Yatsuki et al., methylation of the Kcnq1ot1 ICR were maintained in all three 2000). Both domains are ~1 Mb and the maternal ICR is lineages of the early embryo. These results suggest that it is the act methylated and the Kcnq1ot1/KCNQ1OT1 ncRNA is expressed of transcription that plays a role in imprinted gene regulation rather
from the paternal allele (Verona et al., 2003; Barlow and than there being a post-transcriptional role for the RNA itself. If the DEVELOPMENT Kcnq1ot1 ncRNA depletion in stem cells RESEARCH ARTICLE 3675
Fig. 5. Imprinted methylation is preserved in Kcnq1ot1-depleted stem cells. Methylation status of the Kcnq1ot1 ICR in B6XCAST K43-transduced and control ES, TS and XEN mouse cells. Black circles, methylated CpGs; white circles, unmethylated CpGs. Each line denotes an individual DNA strand. Percentage of hypermethylation is indicated above each set of DNA strands. Twenty CpG dinucleotides within the Kcnq1ot1 ICR (nucleotide position 141392-141598, accession number AJ271885) were analyzed (Market-Velker et al., 2010). Mat, maternal; Pat, paternal.
ncRNA had played a post-transcriptional role in imprinted gene One caveat of these RNA-depletion experiments is that they regulation, we would have anticipated the activation of the represent a snapshot in time. Thus, the Kcnq1ot1 ncRNA might normally silent paternal alleles of protein-coding genes in these be required later in development to maintain domain imprinting, cells, which would have been detected in the allelic expression similar to the Xist ncRNA, which stably silences paternal X- assays. linked genes in postimplantation extra-embryonic tissues RNA-depletion studies have also been performed for the Gtl2 (Kalantry et al., 2009). As Slc22a18 has still to acquire imprinted (Meg3 – Mouse Genome Informatics) and Xist ncRNAs. Depletion expression in ES cells, this indicates that imprinting within the of Gtl2 results in a ~50% reduction in histone H3 lysine 27 Kcnq1ot1 domain has not yet been completely established. trimethylation (H3K27me3) and in the overexpression of Consistent with this, parental-specific histone modifications have neighboring imprinted genes (Zhao et al., 2010); this study also not yet been acquired in ES and TS cells at imprinted genes that demonstrates that 50-70% ncRNA depletion is sufficient to produce exhibit postimplantation placenta-specific imprinted expression a change in imprinted gene regulation. Depletion of the 1.6 kb (Lewis et al., 2006). Thus, further studies are required during RepA ncRNA within the Xist locus in female ES cells abolishes late embryogenesis to delineate the role of the Kcnq1ot1 ncRNA Xist localization and H3K27me3 (Zhao et al., 2008). This contrasts in imprinted gene regulation. Alternatively, the Kcnq1ot1 with female ES cells transduced with a shRNA targeting Xist exon ncRNA might function in imprinted domain establishment. As 1, where a 70-80% depletion of Xist reduced the number of cells depletion occurred after fertilization in late preimplantation stem exhibiting Xist localization but had no perceptible effect on cells (i.e. not in germline-inherited cells), imprinting of the H3K27me3. Furthermore, compacted preimplantation embryos Kcnq1ot1 domain may have already been largely established, lacking Xist were proficient at silencing X-linked genes on the after which point the Kcnq1ot1 ncRNA might have little or no paternal chromosome, indicating that initiation of X inactivation role to play in imprint maintenance. This would argue for an can occur in the absence of the Xist ncRNA (Kalantry et al., 2009). examination of Kcnq1ot1 function by RNAi-based methods prior Together, these studies suggest a limited post-transcriptional role to the two-cell stage, when the RNA is first transcribed. Either
for the long ncRNAs Xist and Kcnq1ot1. way, our data, produced by shRNA-targeted depletion of the DEVELOPMENT 3676 RESEARCH ARTICLE Development 138 (17)
Fig. 6. Imprinted expression is preserved in Kcnq1ot1-depleted stem cells. Imprinted expression analysis of the control genes H19 and Airn and of the imprinted genes Scl22a18, Cdkn1c, Kcnq1, Ascl2 and Th within the Kcnq1ot1 domain was performed on K43- transduced and control ES, XEN and TS mouse cells. Multiple biological replicates (n3-6) were analyzed. For each sample, allelic expression was calculated as the percentage expression of the B6 or CAST allele relative to the total expression of both alleles. Mean allelic expression was then determined. As controls, allelic expression analysis was also performed on cDNA from B6XCAST E9.5 placenta (BXC Pl) and CASTXB6 IC E9.5 placenta (CXBIC Pl) and on cDNA from mixed B6 (B) and CAST (C) parental RNA (e.g. 75B:25C is 75% B6 and 25% CAST). Error bars indicate s.e.m.
Kcnq1ot1 ncRNA, suggest that any post-transcriptional role for transcriptionally but is instead needed during the act of the ncRNA in imprint maintenance during early development is transcription, with the ncRNA acting as a tether or a cis-guide limited. for recruiting repressive complexes (Lee, 2009; Tsai et al., One can envisage three transcription-based regulatory models 2010). However, the transcriptional interference and RNA- for the Kcnq1ot1 imprinted domain. First, transcription of tethering mechanisms fail to explain how genes on the opposite Kcnq1ot1 might cause interference with RNA polymerase II side of the Kcnq1ot1 promoter are silenced and thus cannot be access to other promoters, thereby preventing paternal protein- the sole mechanism of imprinted gene regulation. Third, coding gene transcription (Pauler et al., 2007; Koerner et al., transcription through one or more cis-regulatory elements might 2009). A 471 kb macro ncRNA could effectively silence genes be necessary to evoke domain-wide silencing. In this case, as it is transcribed through them. However, we found that the ncRNA transcription might function to set up a repressive Kcnq1ot1 ncRNA is of invariant length. This means that the nuclear compartment (Shin et al., 2008; Nagano and Fraser, Kcnq1ot1 ncRNA would be transcribed through all promoters in 2009), possibly via retroelement transcription and Argonaut1 both embryonic and extra-embryonic tissues, including those in repressive remodeling complex recruitment (Golding et al., the embryo/embryonic stem cells that are not silenced, such as 2010) or by chromatin looping (Koerner et al., 2009). The fact
Ascl2 and Th. Second, the ncRNA might not be required post- that Kcnq1 and Th displayed imprinted expression in XEN DEVELOPMENT Kcnq1ot1 ncRNA depletion in stem cells RESEARCH ARTICLE 3677
Fig. 7. Kcnq1ot1 signal volume is significantly reduced in Kcnq1ot1-depleted stem cells. RNA FISH was performed on K43-transduced and WT XEN mouse cells using RNA probes for Airn and Kcnq1ot1. Nuclei were counterstained with DAPI (blue) and imaged by confocal microscopy (Airn, n193 cells; Kcnq1ot1, n298). Representative images are shown. Arrows point to very small signal volumes. Volumetric measurements of signal were rendered using Volocity. The mean volume of the Kcnq1ot1 signal was significantly decreased in K43-transduced XEN cells as compared with WT cells (P<6ϫ10–7). No significant difference was found for the Airn mean signal volume in WT and K43-transduced XEN cells (P<0.7). Error bars indicate s.e.m. Scale bars: 1m.
cells but Ascl2 was biallelically expressed might support this Competing interests statement model, with Ascl2 excluded from the repressive compartment The authors declare no competing financial interests. or loop. Interestingly, each of these models is congruent with the fact that the majority of WT XEN cells possessed very low Supplementary material Supplementary material for this article is available at to no Kcnq1ot1 nuclear signal, an observation that might be http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.057778/-/DC1 reflective of a more transient role for the ncRNA or for its transcription. References Much further investigation will be required to unravel the Ager, E. I., Pask, A. J., Gehring, H. M., Shaw, G. and Renfree, M. B. (2008). functional complexities of ncRNAs and their transcription in Evolution of the CDKN1C-KCNQ1 imprinted domain. BMC Evol. Biol. 8, 163. imprinted gene regulation. Novel technologies in transcription Barlow, D. P. and Bartolomei, M. S. (2007). Genomic imprinting in mammals. In Epigenetics (ed. C. D. Allis, T. Jenuwein, D. Reinberg and M.-L. Caparros), pp. biology, such as the use of synthetic pyrrole-imidazole polyamide 357-375. Cold Spring Harbor: Cold Spring Harbor Laboratory Press. gene silencers, as well as the identification of a larger number of Brockdorff, N., Ashworth, A., Kay, G. F., McCabe, V. M., Norris, D. P., Cooper, chromatin remodelers/modifiers involved in imprinted gene P. J., Swift, S. and Rastan, S. (1992). The product of the mouse Xist gene is a regulation, will lead to advances in our understanding of these 15 kb inactive X-specific transcript containing no conserved ORF and located in mechanisms. the nucleus. Cell 71, 515-526. Caspary, T., Cleary, M. A., Baker, C. C., Guan, X.-J. and Tilghman, S. M. (1998). Multiple mechanisms regulate imprinting of the mouse distal Acknowledgements chromosome 7 gene cluster. Mol. Cell. Biol. 18, 3466-3474. We thank Rosemary Oh and Louis Lefebvre for IC placenta; Andy Fedoriw and Terry Magnuson for FISH reagents, protocols and advice; Liana Kaufman, Dao, D., Frank, D., Qian, N., O’Keefe, D., Vosatka, R. J., Walsh, C. P. and Morgan McWilliam and Malaika Roussouw-Miles for technical assistance. The Tycko, B. (1998). IMPT1, an imprinted gene similar to polyspecific transporter authors acknowledge the late Galina V. Fitzpatrick, who generated the and multi-drug resistance genes. Hum. Mol. Genet. 7, 597-608. Kcnq1ot1 ICR deletion mice. She will be sorely missed. This work was Doherty, A. S., Mann, M. R. W., Tremblay, K. D., Bartolomei, M. S. and supported by research grants from NSERC 326876-06, Lawson Health Schultz, R. M. (2000). Differential effects of culture on imprinted H19 Research Institute and Department of Obstetrics and Gynecology, University of expression in the preimplantation mouse embryo. Biol. Reprod. 62, 1526-1535. Western Ontario to M.R.W.M., and by NCI/NIH grant 2RO1 CA089426 to Engemann, S., Strodicke, M., Paulsen, M., Franck, O., Reinhardt, R., Lane, M.J.H. M.R.W.M. was supported by the Ontario Women’s Health Council/CIHR N., Reik, W. and Walter, J. (2000). Sequence and functional comparison in the Institute of Gender and Health New Investigator Award. M.C.G. was Beckwith-Wiedemann region: implications for a novel imprinting centre and supported by the Ontario Women’s Health Council/CIHR Institute of Gender extended imprinting. Hum. Mol. Genet. 9, 2691-2706. and Health Fellowship Award and the Dr David Whaley Postdoctoral Fitzpatrick, G. V., Soloway, P. D. and Higgins, M. J. (2002). Regional loss of Fellowship in Maternal/Fetal and Neonatal Research. Deposited in PMC for imprinting and growth deficiency in mice with a targeted deletion of KvDMR1.
release after 12 months. Nat. Genet. 32, 426-431. DEVELOPMENT 3678 RESEARCH ARTICLE Development 138 (17)
Golding, M. C., Zhang, L. and Mann, M. R. (2010). Multiple epigenetic Panning, B. and Jaenisch, R. (1996). DNA hypomethylation can activate Xist modifiers induce aggressive viral extinction in extraembryonic endoderm stem expression and silence X-linked genes. Genes Dev. 10, 1991-2002. cells. Cell Stem Cell 6, 457-467. Pauler, F. M., Koerner, M. V. and Barlow, D. P. (2007). Silencing by imprinted Gould, T. D. and Pfeifer, K. (1998). Imprinting of mouse Kvlqt1 is noncoding RNAs: is transcription the answer? Trends Genet. 23, 284-292. developmentally regulated. Hum. Mol. Genet. 7, 483-487. Paulsen, M., Davies, K. R., Bowden, L. M., Villar, A. J., Franck, O., Dean, W. Hannon, G. J. (2002). RNA interference. Nature 418, 244-251. L., Moore, T. F., Rodrigues, N., Davies, K. E., Hu, R.-J. et al. (1998). Syntenic Horike, S., Mitsuya, K., Meguro, M., Kotobuki, N., Kashiwagi, A., Notsu, T., organization of the mouse distal chromosome 7 imprinting cluster and the Schulz, T. C., Shirayoshi, Y. and Oshimura, M. (2000). Targeted disruption of Beckwith-Wiedemann syndrome region in chromosome 11p15.5. Hum. Mol. the human LIT1 locus defines a putative imprinting control element playing an Genet. 7, 1149-1159. essential role in Beckwith-Wiedemann syndrome. Hum. Mol. Genet. 9, 2075- Paulsen, M., El-Maarri, O., Engemann, S., Strodicke, M., Franck, O., Davies, 2083. K., Reinhardt, R., Reik, W. and Walter, J. (2000). Sequence conservation and Jiang, S., Hemann, M. A., Lee, M. P. and Feinberg, A. P. (1998). Strain- variability of imprinting in the Beckwith-Wiedemann syndrome gene cluster in dependent developmental relaxation of imprinting of an endogenous mouse human and mouse. Hum. Mol. Genet. 9, 1829-1841. gene, Kvlqt1. Genomics 53, 395-399. Purbowasito, W., Suda, C., Yokomine, T., Zubair, M., Sado, T., Tsutsui, K. and Jones, M. J., Bogutz, A. B. and Lefebvre, L. (2011). An extended domain of Sasaki, H. (2004). Large-scale identification and mapping of nuclear matrix- Kcnq1ot1 silencing revealed by an imprinted fluorescent reporter. Mol. Cell. Biol. attachment regions in the distal imprinted domain of mouse chromosome 7. 31, 2827-2837. DNA Res. 11, 391-407. Kalantry, S., Purushothaman, S., Bowen, R. B., Starmer, J. and Magnuson, T. Redrup, L., Branco, M. R., Perdeaux, E. R., Krueger, C., Lewis, A., Santos, F., (2009). Evidence of Xist RNA-independent initiation of mouse imprinted X- Nagano, T., Cobb, B. S., Fraser, P. and Reik, W. (2009). The long noncoding chromosome inactivation. Nature 460, 647-651. RNA Kcnq1ot1 organises a lineage-specific nuclear domain for epigenetic gene Koerner, M. V., Pauler, F. M., Huang, R. and Barlow, D. P. (2009). The function silencing. Development 136, 525-530. of non-coding RNAs in genomic imprinting. Development 136, 1771-1783. Rivera, R. M., Stein, P., Weaver, J. R., Mager, J., Schultz, R. M. and Lee, J. T. (2009). Lessons from X-chromosome inactivation: long ncRNA as guides Bartolomei, M. S. (2008). Manipulations of mouse embryos prior to and tethers to the epigenome. Genes Dev. 23, 1831-1842. implantation result in aberrant expression of imprinted genes on day 9.5 of Lee, M. P., DeBaun, M. R., Mitsuya, K., Galonek, H. L., Brandenburg, S., development. Hum. Mol. Genet. 17, 1-14. Oshimura, M. and Feinberg, A. P. (1999). Loss of imprinting of a paternally Robb, G. B., Brown, K. M., Khurana, J. and Rana, T. M. (2005). Specific and expressed transcript, with antisense orientation to KVLQT1, occurs frequently in potent RNAi in the nucleus of human cells. Nat. Struct. Mol. Biol. 12, 133-137. Beckwith-Wiedemann syndrome and is independent of insulin-like growth factor Schulz, R., Menheniott, T. R., Woodfine, K., Wood, A. J., Choi, J. D. and II imprinting. Proc. Natl. Acad. Sci. USA 96, 5203-5208. Oakey, R. J. (2006). Chromosome-wide identification of novel imprinted genes Lewis, A., Mitsuya, K., Umlauf, D., Smith, P., Dean, W., Walter, J., Higgins, using microarrays and uniparental disomies. Nucleic Acids Res. 34, e88. M., Feil, R. and Reik, W. (2004). Imprinting on distal chromosome 7 in the Shin, J. Y., Fitzpatrick, G. V. and Higgins, M. J. (2008). Two distinct mechanisms placenta involves repressive histone methylation independent of DNA of silencing by the KvDMR1 imprinting control region. EMBO J. 27, 168-178. Shirohzu, H., Yokomine, T., Sato, C., Kato, R., Toyoda, A., Purbowasito, W., methylation. Nat. Genet. 36, 1291-1295. Suda, C., Mukai, T., Hattori, M., Okumura, K. et al. (2004). A 210-kb Lewis, A., Green, K., Dawson, C., Redrup, L., Huynh, K. D., Lee, J. T., segment of tandem repeats and retroelements located between imprinted Hemberger, M. and Reik, W. (2006). Epigenetic dynamics of the Kcnq1 subdomains of mouse distal chromosome 7. DNA Res. 11, 325-334. imprinted domain in the early embryo. Development 133, 4203-4210. Smilinich, N. J., Day, C. D., Fitzpatrick, G. V., Caldwell, G. M., Lossie, A. C., Mancini-DiNardo, D., Steele, S. J., Ingram, R. S. and Tilghman, S. M. (2003). Cooper, P. R., Smallwood, A. C., Joyce, J. A., Schofield, P. N., Reik, W. et al. A differentially methylated region within the gene Kcnq1 functions as an (1999). A maternally methylated CpG island in KvLQT1 is associated with an imprinted promoter and silencer. Hum. Mol. Genet. 12, 283-294. antisense paternal transcript and loss of imprinting in Beckwith-Wiedemann Mancini-DiNardo, D., Steele, S. J., Levorse, J. M., Ingram, R. S. and syndrome. Proc. Natl. Acad. Sci. USA 96, 8064-8069. Tilghman, S. M. (2006). Elongation of the transcript is required for Kcnq1ot1 Terranova, R., Yokobayashi, S., Stadler, M. B., Otte, A. P., van Lohuizen, M., genomic imprinting of neighboring genes. 20, 1268-1282. Genes Dev. Orkin, S. H. and Peters, A. H. (2008). Polycomb group proteins Ezh2 and Rnf2 Mann, M. R., Chung, Y. G., Nolen, L. D., Verona, R. I., Latham, K. E. and direct genomic contraction and imprinted repression in early mouse embryos. Bartolomei, M. S. (2003). Disruption of imprinted gene methylation and Dev. Cell 15, 668-679. expression in cloned preimplantation stage mouse embryos. Biol. Reprod. 69, Tsai, M. C., Manor, O., Wan, Y., Mosammaparast, N., Wang, J. K., Lan, F., Shi, 902-914. Y., Segal, E. and Chang, H. Y. (2010). Long noncoding RNA as modular Mann, M. R., Lee, S. S., Doherty, A. S., Verona, R. I., Nolen, L. D., Schultz, R. scaffold of histone modification complexes. Science 329, 689-693. M. and Bartolomei, M. S. (2004). Selective loss of imprinting in the placenta Umlauf, D., Goto, Y., Cao, R., Cerqueira, F., Wagschal, A., Zhang, Y. and Feil, following preimplantation development in culture. Development 131, 3727- R. (2004). Imprinting along the Kcnq1 domain on mouse chromosome 7 3735. involves repressive histone methylation and recruitment of Polycomb group Market-Velker, B. A., Zhang, L., Magri, L. S., Bonvissuto, A. C. and Mann, M. complexes. Nat. Genet. 36, 1296-1300. R. W. (2010). Dual effects of superovulation: loss of maternal and paternal Verona, R. I., Mann, M. R. W. and Bartolomei, M. S. (2003). Genomic imprinted methylation in a dose-dependent manner. Hum. Mol. Genet. 19, 36- imprinting: intricacies of epigenetic regulation in clusters. Annu. Rev. Cell Dev. 51. Biol. 19, 237-259. Mitsuya, K., Meguro, M., Lee, M. P., Katoh, M., Schulz, T. C., Kugoh, H., Weaver, J. R., Sarkisian, G., Krapp, C., Mager, J., Mann, M. R. and Yoshida, M. A., Niikawa, N., Feinberg, A. P. and Oshimura, M. (1999). LIT1, Bartolomei, M. S. (2010). Domain-specific response of imprinted genes to an imprinted antisense RNA in the human KvLQT1 locus identified by screening reduced DNMT1. Mol. Cell. Biol. 30, 3916-3928. for differentially expressed transcripts using monochromosomal hybrids. Hum. Willingham, A. T., Orth, A. P., Batalov, S., Peters, E. C., Wen, B. G., Aza- Mol. Genet. 8, 1209-1217. Blanc, P., Hogenesch, J. B. and Schultz, P. G. (2005). A strategy for probing Miyamoto, T., Hasuike, S., Jinno, Y., Soejima, H., Yun, K., Miura, K., the function of noncoding RNAs finds a repressor of NFAT. Science 309, 1570- Ishikawa, M. and Niikawa, N. (2002). The human ASCL2 gene escaping 1573. genomic imprinting and its expression pattern. J. Assist. Reprod. Genet. 19, 240- Yatsuki, H., Watanabe, H., Hattori, M., Joh, K., Soejima, H., Komoda, H., 244. Xin, Z., Zhu, X., Higashimoto, K., Nishimura, M. et al. (2000). Sequence- Murakami, K., Oshimura, M. and Kugoh, H. (2007). Suggestive evidence for based structural features between Kvlqt1 and Tapa1 on mouse chromosome chromosomal localization of non-coding RNA from imprinted LIT1. J. Hum. 7F4/F5 corresponding to the Beckwith-Wiedemann syndrome region on human Genet. 52, 926-933. 11p15.5: long-stretches of unusually well conserved intronic sequences of kvlqt1 Nagano, T. and Fraser, P. (2009). Emerging similarities in epigenetic gene between mouse and human. DNA Res. 7, 195-206. silencing by long noncoding RNAs. Mamm. Genome 20, 557-562. Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J. and Lee, J. T. (2008). Polycomb Onyango, P., Miller, W., Lehoczky, J., Leung, C. T., Birren, B., Wheelan, S., proteins targeted by a short repeat RNA to the mouse X chromosome. Science Dewar, K. and Feinberg, A. P. (2000). Sequence and comparative analysis of 322, 750-756. the mouse 1-megabase region orthologous to the human 11p15 imprinted Zhao, J., Ohsumi, T. K., Kung, J. T., Ogawa, Y., Grau, D. J., Sarma, K., Song, J. domain. Genome Res. 10, 1697-1710. J., Kingston, R. E., Borowsky, M. and Lee, J. T. (2010). Genome-wide Pandey, R. R., Mondal, T., Mohammad, F., Enroth, S., Redrup, L., identification of polycomb-associated RNAs by RIP-seq. Mol. Cell 40, 939-953. Komorowski, J., Nagano, T., Mancini-DiNardo, D. and Kanduri, C. (2008). Zhou, Q. Y., Quaife, C. J. and Palmiter, R. D. (1995). Targeted disruption of the Kcnq1ot1 antisense noncoding RNA mediates lineage-specific transcriptional tyrosine hydroxylase gene reveals that catecholamines are required for mouse silencing through chromatin-level regulation. Mol. Cell 32, 232-246. fetal development. Nature 374, 640-643. DEVELOPMENT