© 2015 Nature America, Inc. All rights reserved. culture taneous transdifferentiation into other epithelial cell types cell epithelial other into transdifferentiation taneous spon can undergo cells these additionally, a few passages; within from from tumors ferentiation of human ESCs or iPSCs into cardiac into iPSCs or dif ESCs Todate, human of interests. ferentiation of types cell specific the into cells these fuelled extensive research has in the to of methods development differentiate tissues various from lineages cell generate to and iPSCs ESCs human both of potential The modeling. disease and discovery drug medicine, regenerative for cells patient-specific epithelial cells remains difficult remains cells epithelial characteristics of adult cells have been established in liver and and models liver neuronal and in endothelial established been have cells adult of functional characteristics some exhibiting of capable phenotypes cell mature protocols, differentiation in advances recent With fractionation. in efficiencies the or absence of selection with varying established icvrd n 98 hmn mroi se cls (ESCs) cells stem embryonic human 1998, in Discovered I occurs in <5 weeks. can be observed in all cultures as early as at 35 d of differentiation, and full maturation of the cells in air-liquid interface cultures previous lung differentiation protocol were able to generate substantial lung progenitor cell populations. then mature epithelia with apical cells from human pluripotent stem cells ( describes how to generate cystic fibrosis ( A 1 Amy P Wong stem cells airway epithelial cells from human pluripotent Efficient generation of functional CFTR-expressing for Sick Children, Toronto, Ontario, Canada. intestines, pancreatic ducts and reproductive organs. In and ducts reproductive CF,pancreatic intestines, there multiple organs the throughout body, including the airways, skin, lines tissue Epithelial tissue. epithelial the of function the affects talized primary epithelial cells epithelial primary talized Published online 5 February 2015; Gynaecology, University Toronto,of Toronto, Ontario, Canada. Correspondence should be addressed to A.P.W. ( ease with ease an with rate incidence 1 of in 3,500 in Canada dis fatal CF, is genetically a models cell of availability improved medicine. ized personal and discovery drug modeling, disease patient-specific for promise great hold iPSCs from generated cells tissue-specific ease mechanisms or regeneration. With the development of iPSCs, Takahashi and Yamanaka and by (iPSCs) Takahashi PSCs induced of discovery the With sci research. basic ence and regeneration tissue for opportunities great offer retinal crine production of transforming growth factor- growth transforming of production crine auto the to owing transition epithelial-mesenchymal undergo Program Program in Developmental and Stem Cell Biology, Hospital for Sick Children, Toronto, Ontario, Canada. NTRO irway epithelial cells are of great interest for research on lung development, regeneration and disease modeling. Despite these advances, isolation and expansion of primary primary of expansion and isolation advances, these Despite An example of a disease that could be better studied by by studied better be could that disease a of example An 6 D 18–2 , hepatic , UCT 0 . To have immor used this, many studies circumvent I 2 ON 3 or cells isolated from large animals from large or isolated cells 1 , Stephanie Chin 7 , intestinal , T his his protocol can be used for drug discovery, tissue regeneration or disease modeling. 2 in 2006, it became possible to use use to possible became it 2006, in doi:10.1038 8 , pancreatic , 21,2 14–1 7,11–1 2 C , established cell lines derived derived lines cell ,established 3 2 6 F Department of Molecular of Genetics,Department University Toronto,of Toronto, Ontario, Canada. , Sunny Xia . Most primary cells senesce senesce cells primary .Most TR /nprot.2015.02 3 activity is outlined. Human . 9 PSC and skin and C F) F) transmembrane conductance regulator protein ( s). s). T 1 2 2 2 he he stepwise approach from 3 , Jodi Garner β 5 4 ,neuronal . This disease 1 to dis study (TGF- 0 have been been have β 1 ) in in ) 7 or or 4, 5 ------1 ,

1 , E Christine Bear PSC C C (Sftpc) protein II cells alveolar that on express surfactant type producing Early attempts to generate lung cells from epithelial ESCs focused cells from human PSCs to epithelial methods derive previous pulmonary of Overview CF. treat to drugs therapeutic of development potential the for roadblock major a remains epithelium lung CF patient-specific cf-registry in in the of cause by mutations is caused defect main basic The in CF patients. the mortality is which airways, the in infections bacterial chronic for niche a creates This clearance. and mucociliary defective thickening mucus balance, fluid which airway epithelium, improper to airway leads the across transport ion of lack a is of the variation in CF lung disease lung CF in variation the of 54–86% for account may genes modifier genotype, CF same the with CF the F508del is present on both alleles. However, even with CF, with people is F508del present on at one least in allele, whereas of 50% people of 90% In sequence. peptide the of (F508del) 508 position at deletion phenylalanine a by caused is mutation Canada Canada patient data registry; in succeeded from 4 the have to mean life expectancy improving 50 age years of (CF strategies therapeutic current nutritional These improve status. and infection disease; reduce to the attempt of they symptoms i.e., the ameliorate to aim therapies CF To date, transport. chloride for membrane cell the to trafficked of instead degraded rapidly is it and properly, fold not does tein taining an Sftpc-driven neomycin selection cassette. Through Through cassette. selection neomycin Sftpc-driven an con taining ESCs human in selection antibiotic using cells alveolar II type ESC-derived human of homogeneity and yield improve to thelia epi lung mature to generate used be eventually would that tions condi culture the about knowledge important revealed studies early these lineages, cell epithelial lung in generating erogeneous s s that were inefficient at endoderm differentiation using our 31,32,35–3 CFTR 29–3 PSC / ). However, the limited availability of differentiated differentiated of availability limited the However, ). gene, which encodes CFTR culture to differentiation into progenitors and 4 . Although these methods were inefficient and het and were inefficient methods these . Although 7 2 . In 2007, Wang 2007, In . Program Program in Molecular and Structure Function, Hospital 2 [email protected] & Janet Rossant natureprotocols C F TR http://www.cy )-expressing airway epithelial et al. et 4 ) ) or J.R. ( Department of Obstetrics and Obstetrics of Department 27,2 3 8 8 A 1 demonstrated a method method a demonstrated 2 . The mutant CFTR pro CFTR mutant The . , ugmented ugmented 6 3 | . The most common CF , VOL.10 NO.3VOL.10 4 [email protected] sticfibrosis.ca/cf-c T protocol his his protocol C F

TR

| 2015 | activity |

are/ 363 ). - - - - -

© 2015 Nature America, Inc. All rights reserved. ever, the detection of function was often inconsistent with each each with inconsistent often was function of how detection CA1); ever,the than robust more (often able function were CFTR we detect to occasions rare on cultures, H9 the For sets. tion differentia each with cultures CA1 the of ~25% in detected be pnaeu ebyi bd–eitd ifrnito, Sfptc differentiation, body–mediated embryoid spontaneous Figure 1 364 in the efficiency variable often sets. display hESCs ­differentiation protocol. protocol. By protocol our using previous modified this using differentiated successfully were lines, iPSC CF- two as well as HES2), and H9 (CA1, lines ESC human three Figure proximal from expressing airway epithelia human ESCs or iPSCs. CFTR- of we generation for the protocol robust Here a modified describe cells. epithelial airway iPSC–derived patient CF regulation from CFTR on compounds small-molecule of effects the ways, ciliated cells and basal cells of the proximal airways proximal the of cells basal and cells ciliated ways, ciliated epithelial cells of the proximal airways that express express that airways proximal protein CFTR the functional of cells epithelial ciliated medicine. regenerative and studies preclinical in use future their for promise great holds cells epithelial lung specific the respiratory epithelium, Clara cells Clara epithelium, respiratory the to generate mature lung epithelial cells from human ESCs human from cells epithelial lung mature generate to II type fide cells. alveolar bona were these whether determine to performed these was cells in these of microscopy characterization functional However,no cells. electron transmission by observed were bodies in Lamellar the cultures. and enriched were cells observed regeneration models for drug screens, disease modeling modeling disease screens, drug for models iPSC–derived patient in proof-of-concept efficacy demonstrated have that cells generated have methods improved Furthermore, cells alveolar II type include cells These published. ously more yielded extensive lung epithelial than cell previ phenotypes to cells human haveof ESCs (hESCs) lung epithelial ferentiations dif stepwise studies, developmental lung mouse of basis the On protocol 1 8–6 –8 –10 We have previously shown the differentiation of hESCs into into hESCs of differentiation the shown previously have We Recently, there have been major breakthroughs in the ability ability the in breakthroughs major been have there Recently, Expansion andsingle-cell | VOL.10 NO.3VOL.10 Culture ofhPSCs adaptation hPSC

1 | Steps 1–6 illustrates an overview of the entire procedure. To procedure. entire date, the of overview an illustrates Timeline of the differentiation protocol procedure. Pass onto10-cm Matrigel-coated –4 Steps 7–19 39,41,4 dishes 2024681 21 61 02 22 62 03 436 34 32 30 28 26 24 22 21 20 18 16 14 12 10 8 6 4 2 0 –2

| 2015 | 2 . The robust and renewable source of patient- of source . and renewable The robust differentiation Steps 20–28 Monolayer endoderm definitive Stage 1 Endoderm StemDiff |

kit natureprotocols 3 9 Validate withassays, . These cells could be used to study study to used be could cells These . Box 1,stepsA–C Specification Steps 29–40 FGF2 (500ng/ml) SHH (50ng/ml) endoderm Stage 2 of lung Differentiation BMP4 (5ng/ml) FGF10 (50ng/ml) FGF7 (50ng/ml) Steps 41–44 progenitors into lung 3 7 3 of the conducting air conducting the of 9 Time (d) , CFTR function , could CFTR function Stage 3 Differentiation into immature in vitro in Steps 45–49 FGF18 (10ng/ml) FGF10 (10ng/ml) FGF7 (10ng/ml) lung cells assays, Box1, steps A–C Validate and tissue tissue and with FGF18 (10ng/ml) BEGM Expansion ofimmature 30,3 3 39–4 Steps 50–58 9 lung cells 3 Stage 4 – of of 4 B-ALI growthmedium 1 1 + - - - - - . .

cells rather than as a single-cell suspension. However, suspension. as than to a rather improve single-cell cells of clumps small as passaged traditionally are PSCs human ESCs, 1–19) (Steps culture of single-cell to PSCs adaptation human and expansion culture, stage: culture Routine characterization. a such forming per are you if stage each at doubled be cultures differentiation that WeRT-PCR.recommend or staining immunofluorescence Figure 2 as in culture, be can expanded that cells single viable to line yield time must treatment for be Optimal each determined trypsin). of form gentle more (a TrypLE use cells, the split to collagenase of and basic fibroblast growth factor 2 (FGF2; 10–20 ng/ml). In place (20%) replacement serum knockout containing DMEM medium knockout in conditions feeder-dependent in weekly 1:6 of ratio mouse on expanded to the culture method. Human PSCs and maintained are typically passaging by trypsin-mediated of achieved the slow introduction a to adapted be must hPSCs and efficiency differentiation DE DE treatment. Scale bar, 100 ALI induction:B-ALImedium in thebasolateralsurface Validate withassays, Maturation and Up to5weeksALI of epithelium Steps 59–61 polarization

| Stage 5 Photomicrograph image of stage 1 DE cells after 4 d of StemDiff steps A–E Box 1, 38

embryonic fibroblasts (MEFs) with a split split a with (MEFs) fibroblasts embryonic at each stage can be performed by FACS, by performed be can stage each at formed types cell the differentiation. of of Characterization day first the being 1 day with numbered, are days procedure, the of part differentiation the In tiation. differen of process entire the and tiation differen the for cells the the of preparation describes procedure following The design Experimental protocol. previous our with pared com augmented substantially is CA1 in function CFTR of level the sets. Furthermore, differentiation every with cultures hESC CA1 all be in can reproducibly measured function CFTR and hESCs, H9 with generated are cells described DE robust here, protocol modified cultures. the With observed differentiation we each that between functions CFTR of differences the for responsible partly was derm (DE). We feel that this DE variability establishment of robust definitive endo definitive robust of ­establishment µ m.

single-cell culture system. This is is This system. culture single-cell differentiate cells as a monolayer, monolayer, a as cells differentiate Unlike mouse mouse Unlike - - - - - © 2015 Nature America, Inc. All rights reserved. previously reported (old) method FOXA2 expression following our ± ± s.e.m. ( represents DE cells. Error bars, mean control RNA (black bar). Purple bar relative to respective tissue positive and expressed as fold change to the housekeeping gene AFE markers. Genes were normalized of our PSC lines. Furthermore, cell lines that were inconsistent at that our were cell lines of PSC lines. inconsistent Furthermore, Figure 3 progenitors DE of ( yield high A cells. DE of population pure a progenitors 20–28) DE (Steps into PSCs human of differentiation 1: Stage weeks. 8 to up take can passaging single-cell to adaptation and hiPSCs or hESCs of Expansion CA1. line ESC human the for optimized is protocol This passaging. mediated trypsin- to adapt to ability the in variability line-to-line is there efficient at generating >95% DE at (CXCR4 generating efficient highly was kit this that found and Technologies) Cell (Stem kit ( ( expressing NKX2.1 and SOX2. identifying AFE epithelial cells described here. ( versus the modified method (new) specialized endoderm derivatives. Since our previous publica tion previous our Since derivatives. endoderm specialized a c Fig. a hPSC ) ) Gene expression levels for ) ) FACS comparison of NKX2.1 and % of max 100 3 20 40 60 80 Activin A(100ng/ml) D0

9 0 2 Wnt3a (25ng/ml) , we have switched to using StemDiff definitive endoderm endoderm definitive StemDiff using to switched have ,we ) will improve the efficiency of later differentiation into into differentiation later of efficiency the improve will )

| n Stage 2 differentiation. = 3 experiments). 10 0 progenitors Original method Endoderm 55.7% 2 b The first stage of differentiation is to establish establish to is differentiation of stage first The D4 ) ) Flow plots 10 CA1 3 FGF2 (500ng/ml) SHH (50ng/ml) 79.5% 10 GAPDH 4

10 Embryonic lung

3 5 9 progenitors

D9 c Relative expression Relative expression Relative expression Isotype NKX2.1 FOXA2 (to thyroid) (to fetal lung) (to fetal lung) 0.5 1.0 1.5 0.5 1.0 1.5 10 15 20 25 + 0 0 0 5 FOXA2

DE (definitive thyroid) DE DE % of max hPSC (lung orthyroid) 100 (ciliated cell) 20 40 60 80 0 NKX2-1 SOX17 AFE AFE AFE D0 TG + StemDiff DE

Fetal lung Fetal lung Fetal lung ) cells in most 10 0 2 74.6% progenitors Modified method Endoderm 10 D4 CA1 Relative expression Relative expression Relative expression 3 FGF2 (500ng/ml) 96.8% (to thyroid) (to fetal lung) (to fetal lung) SHH (50ng/ml) 10 - 0.5 1.0 1.5 2.0 20 40 60 10 15 20 25 4 0 0 0 5 (DE ordistalepithelia) (proximal progenitor)

DE DE DE concentration on depending and FGF2, secretes mesoderm diac car that shown have Studies FGF2. of concentrations high and to form embryonic lung progenitors using sonic hedgehog (SHH) 29–40) (Steps progenitors lung embryonic to progenitors DE of differentiation 2: Stage hESCs. ferentiated undif with compared upregulation to DE for gene assay be used also can RT-PCR Real-time FOXA2. SOX17, and (cKit) CD117 CXCR4, of combination FACS the for performing by expression dishes). 10-cm (two differentiations two for used be can kit One kit. this using robustly and efficiently differentiate now can H9, line hESC the as such previously, endoderm generating 10 5 At the end of DE generation (Step 28), assay for DE protein protein DE for assay 28), (Step generation DE of end the At (foregut) Embryonic lung FOXA2 FOXG1 AFE AFE SOX2 AFE progenitors

Fetal lung Fetal lung D9 Thyroid Isotype NKX2.1 FOXA2

Relative expression (to thyroid, log10) Relative expression Relative expression b 0.001 (to fetal liver) (to fetal lung) 0.01 NKX2.1 NKX2.1 NKX2.1 0.5 1.0 1.5 0.1 10 10 10 10 10 10 10 10 10 10 10 10 0 1 2 3 4 0 1 0 0 0 natureprotocols 2 3 4 5 2 3 4 5 2 3 4 5 0.274 0.0392 0 0.127 1.81 0.242 DE DE DE (distal progenitor) 10 0 010 010 After DE cells are generation, directed hES2-derived AFE(usingStemDiff-generatedDE) H9-derived AFE(usingStemDiff-generatedDE) CA1-derived AFE(usingStemDiff-generatedDE) 2 2 2 (foregut) SOX9 HNF4 (liver) AFE PAX9 AFE AFE SOX2 SOX2 SOX2 10 10 10 3 3 Fetal liver Fetal lung 3 Thyroid 10 10 10 4 4 4 20.9 10 10 12.1 87.6 10 28.5 69.5 79 5 5 5 |

VOL.10 NO.3VOL.10 Relative expression Relative expression Relative expression (to fetal brain, log ) % Of max % Of max % Of max 0.001 10 100 100 (to pancreas) (to fetal lung) 100 0.01 20 40 60 80 20 40 60 80 20 40 60 80 0.1 0.5 1.0 1.5 0.5 1.0 1.5 0 0 0 1 0 0 protocol 10 0 010 010

DE DE DE (distal progenitor) 2 2 2 (forebrain) (pancreas)

EpCAM EpCAM EpCAM 10 | 2015 | FOXP2 10 10 PAX6 AFE AFE PDX1 AFE 3 3 3 71.9 97.5 Fetal brain 99.5 Pancreas Fetal lung 10 10 10 4 4 4 |

365 10 10 10 5 5 5 - - © 2015 Nature America, Inc. All rights reserved. gene statistical significance; intermediate concentrations promote pancreatic development promote pancreatic concentrations intermediate and fate liver drives FGF2 of concentration low a whereas fate, proximity to it drives specification of the foregut endoderm lineages endoderm the foregut of it specification drives Figure 4 366 FGF2 and SHH to induce anterior foregut and lung specification development, as it is highly expressed in the distal lung bud where Similarly, SHH has to shown been role have in lung an important protocol c a Relative expression Relative expression Relative expression Relative expression Relative expression (to thyroid) (to adult lung) (to adult lung) (to trachea) | GAPDH 0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.6 0.8 1.0 2.5 3.0 3.5 4.0 4.5 0.5 1.0 1.5 VOL.10 NO.3VOL.10 0 2 4 6 0 0 0

| et al.2012 et al.2012 et al.2012 SOX17 (ciliatedcell) et al.2012 MUC5 (gobletcell) Comparison of gene expression levels associated with lung, liver, pancreas and thyroid after 5 weeks of ALI using our previous protocol with Wong Wong Wong Wong FOXP2 (distal and expressed as fold change relative to respective tissue positive control RNA. Error bars, mean ± s.e.m. ( TG (thyroid) progenitor) e if Old diffn New diffn in vivo in Proximal phenotypes * et al.2011 et al.2011 * et al.2011 et al.2011 Green Green Green

Green | 2015 | P <0.05 P , a high concentration of FGF2 drives lung lung drives FGF2 of concentration high a , < 0.05. | P <0.05

natureprotocols Relative expression Relative expression Relative expression Relative expression (to thyroid) (to adult lung) (to trachea) (to trachea) 0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.6 0.8 1.0 0.5 1.0 1.5 2.0 2.5 10 15 0 5 0 0 0 et al.2012 et al.2012 et al.2012 et al.2012 FOXJ1 (ciliatedcell) ARG2 (gobletcell) Wong Wong Wong Wong PAX9 (thyroid) FOXA2 * et al.2011 et al.2011 et al.2011 CFTR MUC5 TP63 KRT5 FOXJ1 SOX17 Green et al.2011 Green Green Green b Relative expression Relative expression Relative expression Relative expression

Relative expression (to thyroid) (to trachea, log10) (to trachea) (to trachea) 0.001 0 1 2 3 4 0.01 100 200 300 0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.6 0.8 1.0 0 0 0 3 et al.2012 et al.2012 et al.2012 et al.2012 CCSP (claracells) 9 Wong KRT16 (tracheal versus TGF-β Wong Wong Wong TP63 (basalcell TSHR (thyroid) 3 New diffn 6 progenitors) epithelium) . Owing et al.2011 et al.2011 et al.2011 et al.2011 Distal phenotypes Green Green Green Green P <0.01 4 3 .

and BMP4 inhibition shown to suppress pancreatic lineage development lineage pancreatic suppress to shown Improving DE generation in stage 1 augments the number of of number the augments 1 stage in generation DE Improving development. and pancreatic suppresses motes lung specification pro FGF2 of concentrations high and SHH of combination the during branching morphogenesis branching during growth cell mesenchymal and proliferation epithelial controls it Relative expression Relative expression Relative expression Relative expression

Old diffn (to thyroid) (to trachea, log10) (to trachea) (to adult lung) 100 150 200 0.2 0.4 0.6 0.8 1.0 10 50 0 1 0 0 2 4 6 8 et al.2012 et al.2012 et al.2012 et al.2012 KRT5 (basalcells) MUC16 (tracheal Wong Wong Wong Wong SFTPC (typeII alveolar cells) epithelium) CCSP SFTPC FOXA2 NKX2-1 PAX1 et al.2011 et al.2011 et al.2011 et al.2011 Green 4 Green Green Green 6 . Genes were normalized to the housekeeping

Relative expression Relative expression Relative expression Relative expression to to the housekeeping gene differentiation methods. Genes were normalized level comparing new (left) and old (right) morphology. ( coated plastic culture plates to capture better 3b 3b cells ( experiments). Scale bars, 100 markers). Error bars, mean ± s.e.m. ( (lung for distal markers and trachea for proximal as fold change relative to control tissue RNA previous method previous that seen cells compared with our of using proportion lower a in although detected, and genes pancreas-specific continue to be 100% pure lung progenitors (Fig 3 protocol differentiation still does not yield this that note to important is However,it ( Figure 5 NKX2-1 contact (data not shown). not (data contact cell-to-cell tight forming cells 1 stage to similar be to appears cells of monolayer a (to pancreas) (to fetal liver) (to thyroid) (to trachea) , b 0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.6 0.8 1.0 0.5 1.0 1.5 2.0 10 12 14 16 18 20 ) ) Representative stage 3a cells ( 0 0 0 et al.2012 et al.2012 et al.2012 et al.2012 NGFR (basalcell PDX1 (pancreas) Wong Wong Wong SOX2 (proximal Wong

b | HNF4 (liver) progenitors) n progenitor) + Stage 3 differentiation. ). ). Cells were cultured on collagen- = 3 experiments). Asterisk (*) denotes el atr tg 2 ( 2 stage after cells 4 c et al.2011 4 et al.2011 et al.2011 et al.2011 ) ) Average gene expression . In addition, SHH has been been has SHH addition, In . Green Green Green Green 3 9 . Morphologically, the the Morphologically, . Relative expression Relative expression Relative expression Relative expression GAPDH (to pancreas) (to fetal liver) (to adult lung) (to adult lung) 0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.6 0.8 1.0 0.2 0.4 0.6 0.8 1.0 µ 0 0 0 0 1 2 3 4 m. et al.2012 et al.2012 et al.2012 et al.2012 and expressed NKX6-1 (pancreas) 4 Wong Wong Wong Wong 5

NKX2-1 (lung) . Therefore, . Therefore, n a AFP (liver) i. 3a Fig.

) ) and stage = 3 CFTR c et al.2011 ). Liver- et al.2011 et al.2011 et al.2011 Green

Green Green Green , b ). - © 2015 Nature America, Inc. All rights reserved. experiments). Scale bar, 100 to the housekeeping gene differentiation methods. Genes were normalized 4 cells comparing new (left) and old (right) positive positive control line for CFTR protein level. Asterisk denotes statistical significance; band C and immature band B form of CFTR protein. Calnexin was used as loading protein control. Human bronchial epithelial (HBE) cells were used as differentiation culture methods of hESC CA1 and F508del mutant line GM00997 CFiPS-derived cells treated with VX-809 (blue). ( staining of an ALI culture for ZO1 (red) and panCK (green) (bottom). Scale bars, 22 and CFTR (green) of 30-week ALI-differentiated hESCs (top) and immunofluorescence ( cells are epithelial CFTR-expressing cells. Pink histogram represents isotype staining. that a large proportion of the histograms) demonstrating CFTR and NKX2-1 (all blue cytometric analysis of panKRT, markers). Error bars, mean ± s.e.m. ( (lung for distal markers and trachea for proximal as fold change relative to control tissue RNA cells. ( Yellow arrowhead points to areas of stacked ( RNA. Error bars, mean ± s.e.m. to respective control tissue as fold change relative gene to the housekeeping Genes were normalized differentiation methods. new (left) and old (right) hESC lines comparing three independent stage 5 cells from expression level of ( differentiation. Figure 7 ( Figure 6 anterior anterior foregut endoderm genes ( of upregulation for assay to used be also RT-PCRcan Real-time combination of NKX2-1 and SOX2, as well as NKX2-1 and FOXA2. by endoderm, lung FACS specifically for the establishment, derm stage stage involves directing the cells toward an immature lung cell fate Stage 3: generation of immature lung cells (Steps 41–49) cells. DE in detectable lower/not comparatively be should DE cells should be used as ‘negative’ control. Lung endoderm genes expression. marker foregut primer of level to the and compare efficiency the test to used be should section) MATERIALS the in RNA human positive controls of list (see cDNA-positive controls a c n a a ) ) Representative cross-section of an immunofluorescence staining of panCK (red) ) Representative image of stage 4 cells. ) ) Average gene = 3 experiments). ( Relative expression Atendo 2 foregut 40), stage (Step the end of assay for anterior

GAPDH (to trachea, log10) b 0.001 0.01 ) Average gene expression level of stage 100

0.1 | | 10 Stage 4 differentiation. Stage 5 1 and expressed

New diffn 3-week ALI

Proximal epithelialmarkers

b

) ) Flow

GAPDH

P <0.05

µ

m.

P <0.01

c b and expressed

5-week ALI * Count Old diffn 100 150

50 n 0 –10 = 3 3 Fig. 3 0 panKRT 10 3 72.4% CFTR 10 ZO1 c 4 ). If available, fetal tissue 10 KRT16 CFTR KRT5 MUC16 SOX17 FOXJ1 TP63 MUC5 NGFR 5 Count 100 150 50 0 a –10 3

0 Relative expression (to lung) panCK/CFTRDAPI 10 CFTR 0.5 1.0 1.5 3 0 82.8% 10 The next 4 New diffn 10 3-week ALI Distal epithelialmarkers 5 Count 100 200 300 400 Merged 0 –10 - 3 0 10 NKX2-1 higher expressionhigher ciliated and of mucus-producing cells ( have compared the current protocol and that used in Green interphase (ALI), our previously published method published previously our (ALI), interphase levels in the final stage of differentiation after 5 weeks of air-liquid and found that, most genes although are expressed at comparable epithelial monolayer ( monolayer epithelial FGF10, FGF7, BMP and RA to generate embryonic lung cells endoderm, followed by treatment with ‘ventralizing’ factors WNT, induce to the ‘anteriorization’ molecules of small pathwaysusing inhibition of the bone morphogenetic protein (BMP)/TGF- BMP4 and FGF18 (ref.FGF10, FGF7, morphogens epithelial of combination the using 17.7% 5-weekOld ALI diffn 3

At the end of stage 3 (Step 49), cell morphology appears as an an as appears morphology cell 49), (Step 3 stage of end the At µ 10 P m. m. (

< 0.01. 4 P2X7 CCSP SFTPC NKX2-1 FOXA1 FOXA2 10 5 d b

) ) Iodide efflux function comparing old (green), new (red) Relative expression (kDa) e d 130 250

95 (to trachea, log ) gns ++ –+ – + – Agonist Peak iodide efflux 10 100 0.1 10

post agonist (µM) 1 0 1 2 3 4 Relative expression Previous protocol (to control tissue) Olddiffn New diffn Proximal phenotypes –0.2 SOX17 FOXJ1 MUC5 TP63 3 2 1 0.2 0.4 0.6 hES CA1 0 3 Fig. Fig. 5a natureprotocols 9 New diffn P <0.05 3-week ALI ). Previous methods have described a brief KRT16 SOX2 CFTR KRT5 Non-lung lineages , b ). Lung epithelial gene expression expression gene ). Lung epithelial

5-week ALI Improved protocol Old diffn Relative expression 3 2 1 (to lung, log )

hES CA1 10 e 0.001 0.01 ) ) Western blot for mature 100 | 0.1 10 VOL.10 NO.3VOL.10 1 hESC (newprotocol) hESC (oldprotocol) (new protocol) CF-iPSC +VX-809 e if Olddiffn New diffn SFTPC FOXA1 FOXA2 protocol Distal phenotypes TG (thyroid) HNF4 (liver) PAX9 (thyroid) CREB313 (liver) PAX6 (forebrain) PDX1 (pancreas) PITX1 (esophagus) P <0.01 3 HBE

9 | 2015 | generated generated NKX2-1 CCSP Fig. B andC B and Calnexin β CFTR et et al. 4 /Wnt 6 |

. We 4 367 ). 46

© 2015 Nature America, Inc. All rights reserved. REAGENTS M RT-PCR(qRT-PCR; quantitative real-time or FACS by determined be can 368 • • • • • • • • • • • • • • • • • • • • those used for stage 3. stage for used those ( qRT-PCR real-time or FACS by expression gene epithelial lung appear pseudostratified when they are cross-sectioned. Determine ( structures 3D-like forming another, one of top on layer. epithelial cuboidal a be should cells the of morphology The passages. three than more no for ratio split 1:2–1:3 a at cells the Expand protocol. this in described than frequent more be to need may changes medium and proliferative highly be can cells available medium to support lung epithelial cells. At this stage, the bronchial epithelial cell growth medium (BEGM), a commercially stage allows for the 50–58) expansion of lung epithelial progenitors,(Steps using cells lung immature of expansion 4: Stage process. differentiation entire the for control the as sample lot when variability obtaining the RNA. It is thus best to use the same lot-to-lot be could there samples, RNA the establish to resected were tissues the where unclear be can it As differentiations. the for achieve to level ‘standard’ the as set and controls positive as used be should samples tissue RNA from qRT-PCR,cDNA time For real- for FACS as controls be used or immunocytochemistry. can cells These conditions. ALI under differentiated and Lonza from purchased be can cells epithelial bronchial human primary Alternatively, obtain. to difficult be may these however, FACS; for control positive a as used be should tissue lung human from Fig. Human ESClinesHES2andH9(Wicell) andCA1! PBS +Ca Inactivated MEFs(E12.5embryos) DEkit(Stem Technologies, Cell StemDiff cat. no. 05110) Wnt3a (R&DSystems, cat. no. 5036-WN) FGF18 (Sigma-Aldrich, cat. no. F7301) FGF7 (R&DSystems, cat. no. 251-KG) FGF10 (R&DSystems, cat. no. 345-FG) BMP4 (R&DSystems, cat. no. 314-BP) SHH (Cedarlanes, cat. no. CLCYT676-2) FGF2 (Preprotech, cat. no. AF-100-18B) cabinet. inabiosafety handled precaution you when are human samples. working with shouldbe They a biological safety cabinet. safety a biological ! precaution human samples. working when with in handled shouldbe They KnockOut replacement serum (Gibco, cat. no. 10828-028) KnockOut DMEM(Gibco, cat. no. 10829-018) and order thesamebatch alarge stock for theexperiment. of pluripotent cells seems to sensitive be to mTESR1 batches. Test thebatch and GM04320Lineno. cell source 2(original from ! Coriell) Human induced pluripotent stem cell linesGM00997Lineno. 2(ref. 39) adhere to relevant institutional andgovernmental all regulations. mTESR1 (Stem Technologies, Cell cat. no. 05850) procedure.experimental Test batches thesamebatch andorder for the entirevials of sufficient protocol  Human IV(Sigma-Aldrich, placental cat. collagen type no. C7521) cat. no. 72302) Y-27632 (Rho-associatedkinase(ROCK) inhibitor, Stem Technologies, Cell IV(Life Technologies,Collagenase type cat. no. 17104-019) TrypLE (Life Technologies, cat. no. 12604013) PBS −Ca ATER At the end of stage 3 (Step 58), the cells may start to grow grow to start may cells the 58), (Step 3 stage of end the At CRITCAL | VOL.10 NO.3VOL.10

6 b I ). Positive controls used for this stage are the same as for for as same the are stage this for used controls ). Positive ALS 2+ 2+ −Mg +Mg Cell attachment Cell issensitive to batch-to-batch variability. Fig. 5 Fig. 2+ 2+

(Gibco, cat. no. 14190-144-250) (Life Technologies, cat. no. 14200075) | 2015 | c ). If available, isolated primary epithelial cell cell epithelial primary isolated available, If ). | natureprotocols CAUTION human cell workAll linesmust with CAUTION CRITCAL Fig. 6 Fig. CAUTION Take Growth of Growth of a ) that that ) This This Take for functional analysis as well. as analysis functional for control positive a as used be should Caco-2 function. CFTR line base determine to control) (unstimulated DMSO use function, abundant level of CFTR protein,an can be used as a expresses positive control. For CFTR therefore and CFTR expresses that line cell epithelial intestinal human a cells, Caco-2 analysis, blot ern qRT-PCR, use the same controls as in described Stage 3. For west real-time and FACS, immunofluorescence For blotting. western ( protein CFTR the of form glycosylated fully mature ( function CFTR our previous publication previous our in reported was than faster much polarize and mature to appear least cells the 1, at stage at kit for DE StemDiff ALI the of in use the With weeks. 5 maintained be can Cells cells. the of epithelia ration lung of and matu air.at polarization the the cells ALI induces Culturing polarization and 59–61) (Steps maturation 5: Stage • • • • • • • • • • • • • • • • • • • • • • • • • • • • ( qRT-PCR ( by real-time expressions gene nonlung earlier. observed be can cilia occasions, rare On ALI. of weeks 5 3 and between be observed should cilia Beating stage. at this well very do The cells not proliferate the epithelium. of side the apical from liquid and mucus the removing are you when careful extra be to crucial is it Therefore, membrane. the from epithelium the difficult, as removal of the mucus can often result in peeling off of the of on result, increasingly medium becomes cultures changing a As culture. ALI after week 1 as early as Transwell the of side cal Fig. 7 Fig. B-ALI bullet kit(Lonza,B-ALI bullet cat. no. 00193514) RNeasy minikit(Qiagen, cat. no. 74106) Nonessential (Gibco, aminoacid cat. no. 11140-050) Mono-thioglycerol (MTG, Sigma-Aldrich, cat. no. M6145) Glutamax (Gibco, cat. no. 35050-061) cabinetandfollowin abiosafety themanufacturers’ instructions. skincontact or hazardous ingestion.is very incaseof Pleaseusethisreagent Anti-ZO1 1:100(Abcam, cat. no. ab59720) Anti-ZO1 1:100(Invitrogen, cat. no. 33-9100) Anti-TRA1-81 1:100(Zymed, cat. no. 41-1100) Anti-TRA1-60 1:100(Zymed, cat. no. 41-1000) Anti-SOX2 1:200(GeneTex, cat. no. GTX101507) Anti-SOX17-APC 1:50(R&DSystems, cat. no. IC1924A) Anti-SOX17 1:100(R&DSystems, cat. no. MAB1924) Anti-MUC16 1:200 (Abcam, cat. no. ab1107) Anti-MUC5ac 1:200(Abcam, cat. no. ab3649) Anti-LHS28 1:200(Abcam, cat. no. ab14373) Anti-FOXJ1 1:100(Abcam, cat. no. ab40869) Anti-p63 1:100(Abcam, cat. no. ab32353) Anti–pan-cytokeratin 1:500(Abcam, cat. no. ab80826) Anti-EpCAM 1:100(Abcam, cat. no. ab20160) Anti-FOXA2 1:500(Abcam, cat. no. ab40874) 1:200(Cedarlanes,Anti-TTF1 cat. no. CLS3686905) 1:100(Abcam,Anti-TTF1 cat. no. ab76013) kit(Lonza,BEGM bullet cat. no. CC-3170) establishment. in theair-liquid interface. mostreproducible kithasbeen This for ALI cell epithelial anddifferentiation growth competing thatsupport media β Matrigel, factor growth reduced (BD, cat. no. 354277) Penicillin-streptomycin (Gibco, cat. no. 15140-122) DMEM (Gibco, cat. no. 11960-044) DMEM/F12 (Gibco, cat. no. 1130-032) At the end of stage 5 (Step 61), assay for lung epithelial and and epithelial lung for assay 61), (Step 5 stage of end the At -Mercaptoethanol (Gibco, cat. no. 21985-023) b ) or immunofluorescence staining ( staining immunofluorescence or ) This final stage involves exposing the cultures to to cultures the exposing involves stage final This Fig. 7 Fig. d ) and of the relative expression of the the of expression relative the of and ) 3 9 . Mucus can be observed on the api the on observed be can Mucus . CRITCAL !

CAUT I Fig. 7 Fig. ON There are

β -mercaptoethanol Fig. Fig. 7 c ), as well as as well as ), Fig. 7 Fig. a ), FACS e ) by by ) - - - -

© 2015 Nature America, Inc. All rights reserved. • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Methanol (Fischer Scientific, cat. no. BPA412-1) ! Normal (Life Technologies, serum goat cat. no. PCN5000) overexposure. are thissubstance, handling cabinet. andopen itinabiosafety Minimize mycin Cisacarcinogenic andmutagenic substance. Use gloves you when Amiloride (Sigma-Aldrich, cat. no. A7410) ! dNTPs (Invitrogen, cat. no. 10297-018) Oligo dT(Invitrogen, cat. no. 18418-012) II(Invitrogen,Superscript cat. no. 18064-014) Anhydrous alcohol (VWR, cat. no. CA48218-640) use itinthefumehood. Minimize overexposure. potentially teratogenic substance. Use gloves you when are it, handling and Forskolin (Sigma-Aldrich, cat. no. F6886)! and gloves. Minimize overexposure. skin, irritations. eye andrespiratory Wear protective eye shields, dust mask Genistein (Sigma-Aldrich, cat. no. G6649)! irritations. Minimizeand respiratory overexposure. SDS (Wisent, cat. no. 800-100-EG) ! Protease Kinhibitor (Amresco, cat. no. M221) VX-770 (Selleckchem, cat. no. S1144) VX-809 (Selleckchem, cat. no. S1565) overexposure. reproductive defects. Weigh thepowder andminimize inthefumehood IBMX (Sigma-Aldrich, cat. no. I5879)! skin, irritations. eye Minimize andrespiratory overexposure. rich, (Sigma-Ald DTT cat. no. D0632) Trizma (Bioshop, cat. no. TRS001) Glucose (Sigma-Aldrich, cat. no. G7528) Potassium (Sigma-Aldrich, nitrate cat. no. P6030) Calcium (Sigma-Aldrich, nitrate cat. no. C2786) HEPES (Sigma-Aldrich, cat. no. H3375) iodide (Sigma-Aldrich,Sodium cat. no. 217638) Tween 20(Sigma-Aldrich, cat. no. P2287) 10× Tris-glycine-SDS buffer (Wisent, cat. no. 880-570-LL) Use andminimize itinthefumehood overexposure. Mitomycin C(MMC; Sigma-Aldrich, cat. no. M0503)! BD Cytofix/Cytoperm solutions (10×, BDBiosciences, cat. no. 554714) SYBR Green Imaster (Roche, cat. no. 04997352001) Gentle cell reagent dissociation (Stem Technologies, Cell cat. no. 07174) Trypsin, (Gibco, 0.25%(wt/vol) cat. no. 25200-072) fromGelatin porcine skin,A (Sigma-Aldrich, type cat. no. G1890) chemical, inafumehood. work performed shouldbe potential hazardous indirect when effects contact. When you are usingthis Paraformaldehyde (PFA; Merck, cat. no. 1.04005.1000)! DAPI (Molecular Probes, cat. no. D3571) Triton X-100(Sigma-Aldrich, cat. no. T8787) DMSO (Sigma-Aldrich, cat. no. D2650) FBS (Gibco, cat. no. 12483-020) BSA (Sigma-Aldrich, cat. no. A1470) waterUltrapure distilled (In Fluorescence medium (Dako, mounting cat. no. S3023) cat. no. A-21071) IgG anti-rabbit Goat (H+L) Alexa Fluor 6331:500(Invitrogen, cat. no. A-21052) IgG anti-mouse Goat (H+L) Alexa Fluor 6331:500(Invitrogen, cat. no. A-11009) IgG anti-rabbit Goat (H+L) Alexa Fluor 5321:500(Invitrogen, cat. no. A-11002) IgG anti-mouse Goat (H+L) Alexa Fluor 5321:500(Invitrogen, cat. no. A-11008) IgG anti-rabbit Goat (H+L) Alexa Fluor 4881:500(Invitrogen, cat. no. A-11001) IgG anti-mouse Goat (H+L) Alexa Fluor 4881:500(Invitrogen, Anti-cytokeratin-16 1:200(Novus Biologicals, cat. no. NB110-62105) J.R.Anti-CFTR 1:500(courtesy of Riordan, no. 660) J.R.Anti-CFTR 1:1,000(courtesy of Riordan, no. 596) J.R.Anti-CFTR 1:500(courtesy of Riordan, no. 450) Anti-CFTR 1:50(R&DSystems, cat. no. MAB1660) Anti-CFTR 1:100(Millipore, cat. no. MAB3484) Anti-CD117-FITC 1:100(BD, cat. no. 553354) Anti-CD184-PECy7 1:200(BD, cat. no. 560669) Anti- βIV-tubulin 1:200(Abcam, cat. no. ab15568) vitrogen, cat. no. 10977-015) CAUTION CAUTION CAUTION CAUTION CAUTION SDS is slightly hazardous. SDSisslightly IBMXmay causeskin, eye CAUTION Forskolin may cause Genistein may cause Amiloride may cause CAUTION CAUTION Mutagenic and Mito- PFA has PFA, 1%(vol/vol) • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • ! PFA PBS. 45 mlof solution This stored canbe with at4°Cfor upto 2weeks. ! PFA PBS. 30mlof solution This stored canbe with at4°Cfor upto 2weeks. PFA, 4%(vol/vol) 4 weeks. solution by filter, usinga0.22-µmmembrane andstore itat4°C for up to BSA, inPBS 1%(wt/vol) a Stericup filter (0.22µm), andstore itat4°Cfor upto 3months. (+Ca  Prepare 1-ml aliquots and freeze them at –20 °C for up to 6 months. ~15–20 min. Filter-sterilize the solution a with 0.2- temperature (22–25 °C) until the collagen is dissolved, which takes Cover the holding beaker Parafilmwith and stir it moderately at room 25 with ml deionized of water and 50 Gelatin solution,Gelatin 0.1%(wt/vol) to cells. Lots in can terms vary potency cell of of attachment and possible toxicity EQUIPMENT FACS buffer Store thesolution at4°Cfor upto 3months. Collagen Collagen stock solution (600 REAGENT SETUP CO (Sarstedt, scraper Cell cat. no. 83.1830) Culture plates, sixwells (Nunc, cat. no. 140685) Filters, 0.2mm(Nalgene, cat. no. 73520-994) Transwells, phosphateSodium dibasic(Bioshop, cat. no. SPD307) chlorideSodium (Bioshop, cat. no. SOD004) Beckman Spinchron (Beckman Coulter) DLXcentrifuge pCLAMP, Clampex 8software (Molecular Devices) 1230A) no. cat. Devices, (Molecular system acquisition data Digidata Axon cat. no. ISM-1461C) Iodide sensitive combination microelectrode (LazarResearch Laboratories, PCR plate, 96well(Sarstedt, cat. no. 72.1982.202) PCR plate (Sarstedt, sealingtape cat. no. 95.1994) PCR t CyclerThermal (MJResearch PTC-2000) Nano Scientific) Drop 2000c(Thermo Scientific,Chamber slides, well(Thermo cat. eight no. 154534) CyclerLight LC480 (Roche) Parafilm(VWR, cat. no. 52858-000) Freezer boxes (Nalgene, cat. no. CS509X10) Square-bottom bottle, plastic 125ml(Nalgene, cat. no. 2019-0125) Square-bottom bottle, plastic 250ml(Nalgene, cat. no. 2019-0250) Cryovials, 1.2ml(Nalgene, cat. no. 66008-706) tubes,Eppendorf 1.2ml(Axygen, cat. no. MCT-150-C) confocal SpinningDisk Quorum microscope IX81) (Olympus Becton Dickinson (BD)analyzer (BDLSRII) Hemocytometer (Haussen Scientific, cat. no. 3200) Glass microscope slides (Superfrost Plus, VWR, cat. no. 48311-703) Glass coverslips (VWR, cat. no. 48393.060) (BeckmanCoulter) X-22Rcentrifuge Allegra cat. no. 352235) 5-ml Polystyrene (BDBiosciences, round-bottom acell strainer with tube Tissue culture Petri dish, 10cm(Nunc, cat. no. 172958) Virox (Accel) intervention wipes Pipette-aid XL(Drummond, cat. no. 4-000-085) kit(P20, starter Pipetman P200, P1000; VWR) and 1,000µl, cat. no. 83007-386) Filter (Corning; tips 20µl, cat. no. 4821; VWR; 200 µl, cat. no. 89174-526; 10 ml, cat. no. 86.1254.001; and25ml, cat. no. 86.1685.001) Sterile serological pipettes (Sarstedt; plastic 5ml, cat. no. 86.1253.001; Tubes, 15-mlpolypropylene (Sarstedt, tube cat. no. 62.554.205) Tubes, 50-mlpolypropylene (BDFalcon, tube cat. no. 352070) Leica microscope system (Leica, DFC340FX) cabinet(LabconcoSterile biosafety Cabinet, Class IIBiosafety Logic) CAUTION CAUTION

CR 2 2+ I cell culture incubator (Hera 150, Cell Scientific) Thermo T +Mg ubes, 0.5ml(Axygen, cat. no. 321-10-061) I CAL This should be performed ina fume hood. performed shouldbe This inafumehood. performed should be This 2+ It is best to prescreen a lot before buying a large quantity. sixwells(Costar, cat. no. 3460)

Dissolve 5 g of BSA in 250 ml of PBS. BSA in250mlof SterilizeDissolve thebuffer using 5gof ). Filter-sterilize thesolution filter. usinga0.22-µmmembrane

Dilute 10% (vol/vol) PFA 10% inPBSby mixing 5mlof Dilute 10% (vol/vol) PFA 10% inPBSby mixing 20mlof

Dissolve 1 g of BSA in 100 ml of PBS. BSAin100mlof SterilizeDissolve the 1gof natureprotocols m g/ml)

Dissolve 100 mg of gelatin in 100 ml of PBS in100mlof gelatin Dissolve 100mgof

µ Dissolve 15 IV mg collagen of type l of glacial acidic acid l glacial in of a beaker. | VOL.10 NO.3VOL.10 µ m-pore filter. protocol

| 2015 |

|

369 © 2015 Nature America, Inc. All rights reserved. and store itatroom temperature for upto 1year.  EDTA0.15 gof double-deionized water. in500mlof Adjust thepHto 7.4 Genistein (13.5 mg/ml stock solution) DMSO.1 mlof Store thesolution inaliquots at−20°Cfor upto 1year. IBMX (22.2mg/mlstock solution) up to 1year. powder DMSO. in1mlof Store thesolution inaliquots at−20°Cfor cAMP agonist solution solution. nitrate use, stock solution amiloride to 100mlof 100µlof add Forskolin (4.1mg/mlstock solution) up to 1year. powder DMSO. in1mlof Store thesolution inaliquots at−20°Cfor Amiloride (30mg/mlstockAmiloride solution) solution into aliquots andstore them at−20°Cfor upto 6months. lot no.). stored medium canbe The at4°Cfor upto 2weeks, or the divide that thebasalmediumsameletter andsupplement (i.e., end with same mTSER1 basalmedium. 400mlof supplement vRITICALMake with sure Laemmli bufferLaemmli (5× stock solution) Tritonof lysis buffer. X-100to 4.8ml of cells, protease Kinhibitor, 50µlof add SDSand50µl 10%(wt/vol) 100µlof Lysis buffer room temperature. solution. nitrate of Freshly prepare andkeep itfor nomore than1hat genistein IBMXstock stock solution and10µlof solutionof in10ml Filter thesolution andstore itat4°Cfor upto 1year.  Nitrate solution Filter thesolution andstore itat4°Cfor upto 1year. Running buffer at 4°Cfor upto 6months. adjust thefinal with volumedouble deionizedto 50ml water. Store the buffer bromophenol andafew drops glycerol; DTT of blue in25mlof 1.0 gof  double deionized water. Adjust sodiumhydroxide. thepHto 7.2with in1liter potassiumnitrate of glucose, and 0.3gof calcium nitrate 0.5gof  double deionized water. Adjust sodiumhydroxide. thepHto 7.2with in1liter potassiumnitrate of glucose, and0.3gof calcium nitrate 0.5gof Iodide solution DMSO.in 1mlof Store thesolution inaliquots at−20°Cfor upto 1year. mTESR1 Prepare aliquots andstore them at−80°Cfor upto 1year. 200µg/mlinsterileto PBScontaining aconcentration BSA. 1%(wt/vol) of WNT3a (200mg/mlstock solution) them at−80°Cfor upto 1year. water. 25µg/mlinsterile distilled concentration of Prepare aliquots andstore SHH (25µg/mlstock solution) Prepare aliquots andstore them at−80°Cfor upto 1year. 25µg/mlinsterile PBScontaininga concentration BSA. 1%(wt/vol) of FGF18 (25mg/mlstock solution) Prepare aliquots andstore them at−80°Cfor upto 1year. 10µg/mlinsterile PBScontainingconcentration BSA. 1%(wt/vol) of FGF7 (10mg/mlstock solution) Prepare aliquots andstore them at−80°Cfor upto 1year. 100µg/mlinsterile PBScontaininga concentration BSA. 1%(wt/vol) of FGF10 (100mg/mlstock solution) Prepare aliquots andstore them at−80°Cfor upto 1year. 25µg/mlinsterileto PBScontaining aconcentration BSA. 1%(wt/vol) of Activin A (25mg/mlstock solution) aliquots andstore them at−80°Cfor upto 1year. 50µg/mlinPBScontaininga concentration BSA. 1%(wt/vol) of Prepare FGF2 (50mg/mlstock solution) BSA. Prepare aliquots andstore them at−80°Cfor upto 1year. 25µg/mlinsterile 4mMHCl containinga concentration 0.1%(wt/vol) of BMP4 (25mg/mlstock solution) and store itatroom temperature for upto 1year. PBS.of Sterilize thesolution filter, usinga0.22-µmmembrane by filtrating 0.25% (vol/vol) Triton X-100inPBS 370 deionized water. Store thebuffer at4°Cfor upto 6months. protocol CRITCAL CRITCAL | VOL.10 NO.3VOL.10

Prepare mTSER1 mTESR medium by mixing 100mlof

Make sure that the osmolarity of thesolution Make is300mOsm. of sure thattheosmolarity thesolution Make is300mOsm. of sure thattheosmolarity Dissolve 4.0 g of TrisDissolve 4.0gof chloride, sodiumchloride and 4.4gof

Dissolve 20.4 g of sodiumiodide, HEPES,Dissolve 20.4gof 4.8gof 2.0gof Add 100 ml of Tris-glycine-SDSAdd 100 mlof double buffer to 900mlof Dissolve 11.6 g of sodium nitrate, 4.8 g of HEPES, sodium nitrate,Dissolve 4.8gof 11.6gof 2.0gof

| 2015 |

Dissolve 10 | natureprotocols

Reconstitute to a thecontents thevial of

Reconstitute to a thecontents thevial of Reconstitute to thecontents thevial of Reconstitute to thecontents thevial of

Reconstitute to thecontents thevial of

Reconstitute to thecontents thevial of

Dissolve 22.2 mg of IBMXpowderDissolve 22.2mgof in l of forskolinµl of stock solution, 10µl

Dissolve 1.9 g of Trizma,Dissolve 1.9gof SDS, 5.0gof Reconstitute thecontents thevial of

Reconstitute thecontents thevial of

Add 1.25 ml of TritonAdd 1.25mlof X-100to 500ml

Dissolve 4.1 mg of forskolinDissolve 4.1mgof Dissolve 30 mg of amiloride amiloride Dissolve 30mgof Dissolve 13.5 mg of Dissolvegenistein powder 13.5 mg of CRITCAL CRITCAL Before lysis of Before lysis of Before

BEGM additional FGF2 can be performed after 2 weeks (maximum storage is 4 weeks). The medium should be used within 2 weeks; however, supplementation with for upto 1month. the medium at4°Covernight before preparing themedium. Store itat4°C tion (from kit). BEGMbullet Thaw thefrozen supplements provided with PBS (10×stock solution) Add just methanol before use; do notstore thissolution for thelong term. Blocking buffer, 5%(wt/vol) TweenAdd 1mlof 20andstore itatroom temperature for 1year. Differentiation basalmedium hESC/iPSC growth medium hESC/iPSC growth Store thebuffer at4°Cfor 1week. PBST to 7.2andstore itatroom temperature for 1year. double deionized sodiumchloride in1liter water. of 87.7 gof Adjust thepH double deionized water. to methanol Add thesolution. 200mlof  differentiation process. Store themedium at4°Cfor upto 2months. medium. Growth factors are supplemented to thismedium for thestepwise Transfer buffer Non-essential amino acid MTG Glutamax Penicillin-streptomycin KnockOut serum replacement KnockOut DMEM FGF2 MTG Non-essential amino acid Glutamax Penicillin-streptomycin KnockOut serum replacement KnockOut DMEM Composition Human epidermal growth factor (hEGF) Retinoic acid Epinephrine Tri-iodothyronine Transferrin GA-1000 Hydrocortisone Insulin BPE BEBM basal medium Composition Composition

Add 100 ml of PBS (10×) to 900 ml of double deionized PBS(10×)to water.Add 900mlof 100mlof Prepare themedium according to themanufacturer’s recommenda

Dissolve 14.4 g of glycine and 3.0 g of Tris glycine and3.0gof Dissolve 14.4gof basein800mlof

Dissolve 14.2 g of sodiumphosphateDissolve dibasicand 14.2gof

Prepare medium. thegrowth ~500mlof Dissolve 5 g of skim milk in 100 ml of PBST. skimmilkin100mlof Dissolve 5gof

Prepare thedifferentiation basal ~500ml of Volume 100 100 ml 400 ml 100 100 µl 15 15 µl 3 3 ml 6 ml 3 ml Volume 450 450 ml 50 50 ml 15 15 µl 3 3 ml 6 ml 3 ml Final concentration Final concentration Volume (ml) 0.15 0.15 mM 20 20 ng/ml 500 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.15 0.15 mM 1 1 mM 2 mM 2 20% 1 1 mM 2 mM 1% 10% 1% CRITCAL

-

© 2015 Nature America, Inc. All rights reserved. Primers for qRT-PCRPrimers real-time characterization B-ALI medium 4 °Cfor upto 1month. themedium at4°Covernight beforewith preparing themedium. Store itat mendation (from kit). B-ALIbullet Thaw thefrozen supplements supplied SFTPC FOXJ1 NKX2-1 MUC5AC KRT5 Gene TP63 NANOG CFTR AFP PDX1 NKX6-1 TG SOX17 BACT FOXA2 CCSP hEGF Epinephrine Tri-iodothyronine Transferrin Retinoic acid GA-1000 Hydrocortisone Insulin (BPE) extract Bovine pituitary Basal medium Composition CACCTGAAACGCCTTCTTATCG GAGCGGCGCTTTCAAGAAG ACCAGGACACCATGAGGAAC CCATTGCTATTATGCCCTGTGT GGAGTTGGACCAGTCAACATC (5′->3) Forward primer ACTTCACGGTGTGCCACCCT TGATTTGTGGGCCTGAAGAAA CTATGACCCGGATAACAAGGAGG TGGGACCCGAACTTTCCA CCCATGGATGAAGTCTACC ATTCGTTGGGGATGACAGAG AGAAGAGCCTGTCGCTGAAA AAGGGCGAGTCCCGTATC CTGGAACGGTGAAGGTGACA AGGAGGAAAACGGGAAAGAA TTCAGCGTGTCATCGAAACCCC

Prepare the medium according to the manufacturer’s recom B-ALI differentiation medium (ml) 500 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 2 TGGCTCATGTGGAG CCGTC GGCCTCGGTATTCA TCTGTT CGCCGACAGGTACT TCACT TGGTGGACGGACAG CCACTGC TGGAGTAGTAGCTT Reverse (5′->3) primer GCTATTTTT ACCCAT ACGAAACGCT GAGCTGGGGTTTCT GAAGACA GAGGCATCTCAGCA TGTAGGA CAAAAATGGCTGGG CTAGTTTC GGCCACATCCAGGA TCCAC GTCCTCCTCCTTTT TCTTGG CGAGTCCTGCTTCT GCAGTC TTGGACCAGAAGGA GTCCTG TTGTAGTTGGGGTG ACAATGCA AAGGGACTTCCTGTA GAGGAG CAACAACAGCAATG ACAGTGAGCTTTGG B-ALI growth B-ALI growth medium (ml) 0.25 0.25 0.25 0.25 0.25 0.25 0.25 0.25 250 1

- Positive control human RNA for qRT-PCR used real-time TBX1 MUC2 DLX3 PITX1 FOXE1 FOXP2 FOXA1 P2X7 PDPN MUC16 KRT16 KRT15 OTX2 PAX6 SOX9 PAX9 FOXG1 SOX2 CDX2 Brain Skin Trachea Liver Pancreas Esophagus Thyroid Lung Tissue name CGGCTCCTACGACTATTGCCC AGGATGACACCATCTACCTCAC CTCGCCCAAGTCGGAATATAC CTAGAGGCCACGTTCCAGAG CACGGTGGACTTCTACGGG AATCTGCGACAGAGACAATAAGC CTCGCCTTACGGCTCTACG TATGAGACGAACAAAGTCACTCG GTCCACGCGCAAGAACAAAG CCAGTCCTACATCTTCGGTTGT GACCGGCGGAGATGTGAAC GGCTGGAGAACTCACTGGC GTGGGCTACCCGGCCACCC TCTTTGCTTGGGAAATCCG GAGGAAGTCGGTGAAGAACG GTG TGGTTATGTTGCTGGACATGG CTCCGTCAACCTGCTCGCGGF TTA GCACATGAAGGAGCACCCGGA CTGGAGCTGGAGAAGGAGTTTC natureprotocols Tissue type Fetal Adult Adult Fetal Adult Adult Fetal Fetal

| VOL.10 NO.3VOL.10 GCTTGCCCT GGAACGTATTCCTT ATGAGCA CATCGCTCTTCTCA AGATCGT CTGGTAGCTGGAGT CTTAC TGGTTACGCTCGCG CTATCCC GGACACGAACCGAT GCTGTAAA TCCACTTGTTTGCT GTACGCC TACACACCTTGGTA GGAAAAGAT GCAAAGCAAACGTA AACCATCT GGTCACTGTTGACA AGGGAGTT AGGGTAGTTCCTAG CACGC CTGCTCGTACTGGT TAGCG CAGGCTGCGGTAAG GGCAAG GCACCCTCGACTCG TCCTTAG CTGCCCGTTCAACA TTCGAT CCAACATCGAGACC AATGACTACCT GGAAGCCGTGACAG CGTGCT CTGGCGCTCATGGA TTATCCTTCTT CGGGCAGCGTGTAC CTCAGAGAGC ATTTTAACCTGCCT Biochain no. catalog protocol R1244035-50 R1234218-50 R1234160-50 R1244149-50 R1234188-50 R1234106-60 R1244265-10 R1244152-50

| 2015 | |

371

© 2015 Nature America, Inc. All rights reserved. 1|  rounded, like the colonies are abouttopeeloff butare not yetdetached from the plate. each wellof asix-wellculture plate, and then incubate the plateat37°Cfor 5min.The borders of the colonies should look 5| the platebytriturating upand down to obtainsingle cells. 10| Carefully remove TrypLE and add 5mlof growth medium. Byusing aP1000pipette, gently dissociate the colonies from plate. Incubate itat37°Cfor 5minorattreatment time asdetermined previously for individual lines. 8| ? viable when plated as single cells onto feeders. ? that can be expanded in culture. 9|  overnight at4°C.Followthe instructions inEquipment Setupcarefully. P 6| ? six-well platecontaining MEFs. 4| ? the platebytriturating gently upand down abouttentimes toachieve asingle-cell suspension. 3| 2| A PROCEDURE temperature before use. Parafilm andstore itat4°C for up to 1 week. thedish for 1hat Warm room the surface. Leave itatroom temperature for 2hto coat. thedishwith Seal thesix-well-plate androck thedishtoof evenly dispersetheMatrigel across to Matrigel well per Matrigel the10-cmPetri 3mlof dishor 1mlof transfer mix wellby inverting five thetube times.or six By usinga pipette,cooled to theMatrigel then transfer theDMEM/F12on ice. Cap and the50-mltube bycolda pipette tip pipetting DMEM/F12upanddown several times, and ontube ice. on Matrigel ice; Thaw a250-µlaliquotonce of itisthawed, cool Matrigel-coated Petri dish gelatin before use. area the of wells, and leave the plate at 37 °C for 1 h before use. Remove excess the of six-well culture plate. Ensure that the gelatin coats the entire surface plate Gelatin-coated EQUIPMENT SETUP 372 7|  cultures canbeachieved. Cells should bepassaged weeklyata1:6splitratio and maintained inhESC/iPSCgrowth medium onMEFsuntil stable protocol assaging assaging of h daptation of hESCsorhiPSC s tosingle-cellpassaging TROUBLESHOOTING TROUBLESHOOTING TROUBLESHOOTING TROUBLESHOOTING

CR CR CR | VOL.10 NO.3VOL.10 Passage the cellsbywashing them twice withPBS –Ca Before passaging the cells, bring the Matrigel platetoroom temperature for atleast1h. Precoat Matrigel plateswhen hESCsorhiPSCsare ready for differentiation. Prepare 10-cmdishes coatedwithMatrigel Continue topassage the cellsasdescribed above(Steps1–5)byusing TrypLE toobtainasingle-cell suspension. Resuspend the cellpelletinhESC/iPSCgrowth medium bygentle trituration, and passage itata1:6splitratio toanew Transfer the cellstoa15-ml tubeand centrifuge at200 Carefully remove TrypLE and add 5mlof growth medium. Byusing aP1000pipette, gently dissociate the colonies from To adapt cellstosingle-cell culture conditions, washconfluent cellswithPBS–Ca Before thisstep,cellsshould bemaintained under normal PSCconditions onMEFsinhESC/iPSCgrowth medium. I I I T T T I I I CAL CAL CAL

STEP STEP STEP ESC

| 2015 |

Add 2 ml 0.1% (wt/vol) gelatin of solution to each well Handle the Matrigel on ice, as the gel will solidify at room temperature. It is essential to have cells fully adapted to single-cell culture conditions before proceeding. Cells will be Optimal treatment time with TrypLE must be determined for individual cell lines to yield viable single cells s s or hi

|

Transfer cold DMEM/F12to a50-ml 20mlof natureprotocols PSC s s to Matrigel ●

T IMI N G 2 h ● 2+ g for 5minatroom temperature toobtainacellpellet. −Mg TIMING  acidic; it can reduce the efficiency of cell attachment and cause cell death. wash the Transwells carefully before use, as the remaining collagen solution is collagen, and it can result in inadequate coating theof membrane.  vary in terms potencyof cellof attachment and possible toxicity to cells. allow it to air-dry for 1 h at room temperature. from the surface and wash the membrane three times with DMEM/F12, and ronment at room temperature for up to 3 d. Before use, remove excess collagen a minimum 18of h. Collagen-coated Transwells can be stored in a sterile envi is evenly covered with collagen solution, and leave it at room temperature for per Transwell directly onto the membrane, by making sure that the membrane collagen stock can be stored at 4 °C for up to 4 weeks. Addworking stock150–200 concentration 60of Collagen-coated Transwells 2+

CR CR and add 1mlof TrypLE toeachwellof asix-wellculture 2h I I T T I I CAL CAL Too much collagen solution can reduce polymerization theof It is best to prescreen a lot before buying a large quantity. Lots can 2+

Thaw 1 ml collagenof stock and dilute 1:10 to a −Mg µ 2+ g/ml with deionized water. The working twice. Add 1mlof TrypLE to 

CR I T I CAL It is important to µ l of collagen

-

© 2015 Nature America, Inc. All rights reserved.  37 °Covernight. ? Equipment Setupcarefully. 28| Prepare collagen-coated Transwells and leavethem inthe biosafety cabinet overnight tocoat.Followthe instructions in should beasshown inFigure 2. 27| Day5.Assess morphological changes and assayfor DEmarkers byFACS and/or RT-PCR (Box 1).Morphology of cells 26| Day4,morning.RepeatSteps23and 24. 25| Day3,morning.RepeatSteps23and 24. incubator at37°Covernight. 24| Aspirate medium 1from the cellsand add 10mlof medium 2tothe cells. Incubate the medium in the cellculture  per 10-cmdish. 23| Day2,morning.Prepare medium 2byadding 100µlof supplement Bto9.9ml of differentiation basal medium 22| Add 10mlof medium 1per10-cmdishof cells, and incubate inthe cellculture incubator at37°Covernight. 21| Aspirate the medium from the dishand washthe cellsonce withwarmed DMEM/F12. ? proper differentiation. 19| Platecellsonto aprecoated 10-cmdishatadensity of 2.5×10 the hemocytometer. 18| Aspirate the supernatant and resuspend the cellpelletin1mlof DMEM/F12.Take 10µlfor cellcount using for 5minatroom temperature. 17| Transfer the cellstoa15-ml conical tubeand add anequal volume of warmed DMEM/F12.Centrifuge the tubeat200 they are inasingle-cell suspension. 16| Pipettethe cellsupand down fivetimes using aP1000tiptoensure thatcells are detached from the plateand that S ? mTESR1 medium. mTESR1 medium bygentle trituration. Passage one wellof asix-wellplateonto a1×10cmdishprecoated withMatrigel in P  as described inSteps7–11, for anadditional twopassages. 12| Grow the cellsinmTESR1until they are confluent, and passage them ata1:3 ratio onto afresh 10-cmplate, 11|  StemDiff medium (asperthe manufacturer’s protocol). 20| Day1,morning.Prepare medium 1byadding 100µlof supplement Aandµl of 100 supplement Bto9.8mlof 15| Wash the hESCsorhiPSCswithPBS–Ca 14| Day0.Before passaging cells, bring the Matrigel platetoroom temperature for atleast1h. 13| Day–1.Freshly prepare a10-cmMatrigel platebycoating itwithMatrigel overnight at4°C. tage tage 1, differentiation to D assaging assaging cells for differentiation TROUBLESHOOT ING TROUBLESHOOTING TROUBLESHOOTING

CR CR CR CR Centrifuge the mixture at200gfor 5minatroom temperature topelletthe cells, and then resuspend the cellpelletin I I I I T T T T I I I I CAL CAL CAL CAL

STEP STEP STEP STEP Medium 2 will be used for the next 3 d, but it should be freshly made every day. Supplements should be thawed and kept on ice. Store at 4 °C until use. The cells should be >90% confluent the next day. This is to reduce the amount of MEF cell transfer to the differentiation cultures; excess MEFs can inhibit E

●

T IMI ●

N T IMI G 5 d 2+ N G −Mg 30 min 2+ 2×.Add 3mlof TrypLE and incubate at37°Cfor 5min. 5 percm 2 and incubate inthe cellculture incubator at natureprotocols | VOL.10 NO.3VOL.10 protocol

| 2015 |

| g

373 © 2015 Nature America, Inc. All rights reserved. ? 31| Add 2mlof TrypLE and incubate the cellsat37°Cfor <5min(until the cellsstarttodetach).  confluent DEcellscan generate twoplates of 12-well Transwell cultures. Ensure thatcollagen-coated wellsare washed withPBSbefore usetoremove residual collagen solution. A10-cmdishof In In addition, remove any medium that has leaked to the basal side of the Transwell.  the apical side). Incubate the cellsinthe cellculture incubator at37°Cfor 48 h. 42| Day11,afternoon.Aspirate AFEmedium from the cellsand add freshly made stage 3amedium (0.5mlperTranswell to phenotype that will take over the culture.   Transwell for subsequent medium changes (Steps38–49). the apical side of the Transwell and replacing itwith0.5mlof fresh AFEmedium. Onlyadd medium tothe apical side of the 37| Day7,morning.Check the cellsunder the microscope. Change the medium oncellsbyremoving the AFEmedium from 36| Incubate the cellsinthe cellculture incubator at37°C. ? 30| Day6,morning.Aspirate medium 2from the cellsand washwithPBS(−Ca  medium. 41| Prepare stage 3amedium byadding FGF7(50ng/ml), FGF10(50ng/ml) and BMP4 (5ng/ml) todifferentiation basal  ferentiation basalmedium. 29| Prepare anterior foregut endoderm (AFE)medium byadding FGF2(500ng/ml) and SHH(50ng/ml) toprewarmed dif- S is performed onasubsetof the cultures. Results obtained should beasshown inFigure3. Proceed tothe next stepwithparallel cultures whilethe characterization 40| Day11,morning.Take asubsetof the cultures and assayfor AFEmarkers byimmunofluorescence orRT-PCR ( Transwell. Incubate the medium inthe cellculture incubator at37°Cfor 24h. 39| Day10,morning.Carefully aspirate oldAFEmedium from the cellsand add 0.5mlof freshly made AFEmedium per ? medium perTranswell. Incubate inthe cellculture incubator at37°Cfor 48h. 38| Day8,morning.Carefully aspirate oldAFEmedium from the apical side of the cellsand add 0.5mlof freshly made AFE 35| Gently transfer 250µlof the cellsuspension (~5×10  2,000 cellsperµl. 34| Pipette10µland loaditonto the hemocytometer tocount the cells. Dilutethe cellsuspension withAFEmedium to 33| Aspirate the supernatant and resuspend in1mlof AFEmedium. for 5minatroom temperature. 32| Add 8mlof basaldifferentiation medium and transfer the cellstoa15-mlconical tube. Centrifuge the cellsat400 S 374 ? problems may arise that prevent or limit cell attachment to the membrane. protocol tage tage 3a, differentiation to lung progenitors tage tage 2, differentiation to the anterior foregut endoderm TROUBLESHOOTING TROUBLESHOOTING TROUBLESHOOTING TROUBLESHOOTING

CR CR CR CR CR CR CR | VOL.10 NO.3VOL.10 I I I I I I I T T T T T T T I I I I I I I CAL CAL CAL CAL CAL CAL CAL

STEP STEP STEP STEP STEP STEP STEP

| 2015 | When changing the medium, be very careful to not aspirate the layer of cells on the membrane. Medium must be made freshly with every use. Note that high levels of FGF7 appear to induce a mesenchyme On this day, the cells should be attached to the membrane. Unfortunately, many technically sensitive Adding medium to the basolateral side may reduce cell attachment to the membrane. Make sure that the cell volume coats the entire membrane. Be very gentle when triturating the cells, as excess cell death can occur. AFE medium must be freshly made with every use. | natureprotocols ●

T IMI N G 5 5 d cells)tothe apical side of the collagen-coated Transwells. ●

T IMI N G 10 d 2+ −Mg 2+ ) twice. Box 1).

g

© 2015 Nature America, Inc. All rights reserved.  3 minperwash. of the Transwell and 1mlof PFA tothe basolateral side of the Transwell. Afterincubation, remove PFA and washtwice withPBSfor (ii) Fixthe membrane containing the cellswith4%(vol/vol)PFA for 10minatroom temperature. Add 500  listed inthe Reagents section. (x) Incubate the aliquots of cellsuspension withprimary antibodies inthe dark at4°Cfor 30min.Use the antibody concentrations (ix) Divide the cellsuspension into aliquots inFACS tubesataconcentration of upto1×10 (viii) Pipette10µlof the cellsuspension and count the cellnumber using ahemocytometer. (vii) Resuspend the cellpelletin1mlof FACS buffer. (vi) Centrifuge the cellsat400gfor 5minatroom temperature. and toensure asingle-cell suspension. (v) Wash the cellsonce with3mlof FACS buffer, and then transfer them toanFACS tubecontaining afiltertopto remove cellclumps (iv) Transfer the cellstoa15-mlconical tubeand centrifuge the cellsat400gfor 5minatroom temperature. (iii) Stopthe enzymatic activitybyadding 5×(vol/vol)FACS buffer. at 37°C. (ii) Remove PBSand add 0.5–2mlof TrypLE toeachculture (depending onculture platesize).Incubate the cellswithTrypLE for 5min (i) Remove the medium from the membrane and washthe cellsonce withPBS(−Ca (i) Aspirate the differentiation medium and washthe cellstwice withPBS(−Ca  and incubating them atroom temperature for 15min. (iii) Permeabilize cells with0.25%(vol/vol)Triton X-100solution (dilutedinPBS)byadding 200µlof solution toeachwellof cells (B) Immunofluorescence staining ● APC/A633 660/20BP. Dataanalysis wasperformed using FlowJo software. A488/FITC 505LP-515/20BP, PE550LP-575/25BP;Green/532 nm,PE-Texas Red/PI600LP-610/20BP, PE-Gr575/26BP;Red/639nm, (xvii) Perform flowcytometric analysis. We usedthe BDBiosciences LSRIIanalyzer withthe following lasersetup:Blue/488nm, at 4°Cinthe dark.  (xvi) Resuspend the cellsin500µlof 1%(vol/vol)PFA. (xv) Wash the cellsagainwith500µlof FACS buffer, and centrifuge the cellsat400 g for 5minatroom temperature. temperature. (xiv) At the end of the secondary antibody staining, add 500µlof FACS bufferand centrifuge theg for cellsat400 5minatroom listed inReagents section at4°Cinthe dark for 30minina100-µlvolume. (xiii) Ifprimary antibodies are not directly conjugatedtoafluorophore, perform secondary antibody staining using the concentrations (xii) Wash the cellsagainwith500µlof FACS buffer, and centrifuge the cellsat400 g for 5minatroom temperature. (xi) At the end of the primary antibody stain, add 500 (if possible). that wouldminimizecompensation needs. To avoid false positive results, useantibodies thatare directly conjugatedtoafluorophore performed). Formultiplex staining, consult anexpert FACS operator tosetupthe most ideal multicolor fluorescence combination stage. (x) Wash the cellsonce withPBSfor 3min at room temperature. (ix) Counterstain withnuclear stainDAPI (1:1000inPBS)for 10mincovered atroom temperature. (viii) Wash the cellstwice withPBSfor 3min atroom temperature. (vii) Add secondary antibodies in200µlof PBSand incubate atroom temperature for 1h. (vi) Wash the cellstwice withPBSfor 3min atroom temperature.  overnight at4°C. (v) Add primary antibodies atthe concentrations listedinReagents section tothe wells. Incubate the cellsinprimary antibody 30 minatroom temperature. (iv) Blockwith200µlof blocking buffercontaining 5%(vol/vol)normal goat serumin0.25%(vol/vol)Triton X-100solution for  methanol (100%)tofixinstead of PFA, fix for10minin−20°C,washtwice withPBS for3minperwash. (A) Flow cytometric analysis  function canbesubsequently lysedfor westernblotting. (step 1D)orassayfor the presence of mature CFTRprotein bywesternblotting (step1E).Note thatcellshavebeentestedfor (step 1B)and/or real-time qRT-PCR (step1C).At the final stage of differentiation, test for CFTRfunction by iodide efflux measurement 1. Aftereachstage, collectasetof cellsfor characterization byflowcytometry (step1A)and/or immunofluorescence staining Box 1 CRITCAL STEP CRITCAL STEP PAUSE POINT CRITCAL STEP PAUSE POINT CRITCAL STEP CRITCAL STEP | Characterization ofdifferentiated cellsateachstage The cellscanbestored inPBSfor upto1weekat4°C. Flowcytometric analysis canbeperformed immediately, orthe cellscanbeanalyzed later(upto24h).Store the cells Include appropriate nonstained, isotypeand single-antibody compensation controls (ifmultiplex staining is Ensure thatsufficient cultures are setupatthe start of stage 1toallow for characterization atthe end of each Include appropriate isotypecontrols for eachprimary antibody. Thissteponlyapplies toPFA-fixed cells, and not to methanol-treated cells, as methanol alsopermeabilizes the cells. Make sure thatPFA hasequilibrated toroom temperature before adding tothe cells. ForCFTRstaining, useice-cold ● TIMING TIMING 3h 2d µ l of FACS buffer and centrifuge the cells at 400 2+ −Mg 2+ −Mg 2+ ). 2+ ). 6 cellsper100µlinto eachtube. natureprotocols g for 5 min at room temperature. µl of PFA onthe apical side | VOL.10 NO.3VOL.10 protocol (continued)

| 2015 |

|

375 © 2015 Nature America, Inc. All rights reserved. 376 protocol Box 1 (xi) Add the following mixture tothe tubeof chilledRNA. (x) Heat the mixture to65°Cfor 5minand quickly chillitonice.  pipetting upand down fivetimes. (v) Remove the supernatant and resuspend the cellsin350µlof RLT lysisbuffer(inthe RNeasy kit).Mixthe lysedcellsthoroughly by (iv) Transfer the cellstoa15-mlconical tubeand centrifuge the cellsat400gfor 5minatroom temperature. (iii) Stopthe enzymatic activitybythe addition of culture medium. for 5minat37°C. (ii) Remove the PBSand add 0.5–2mlof TrypLE toeachculture (depending onculture platesize).Incubate the cellswithTrypLE (i) Collectcellsbywashing the cellstwice withPBS(−Ca (xiii) Transfer PCRtubestoThermal Cyclerand perform the reverse-transcription reaction asfollows: gene expression inthe PCR. To athin-walledPCRtube, add the following: (ix) To generate cDNAfrom RNA,calculatethe volume of RNAfor 1µgpersampleof reverse transcription using SuperscriptIIenzyme.  (viii) Once RNAhasbeeneluted, determine the RNAconcentration using aNanoDrop 2000c. (vii) Add equal volumes of 70%(vol/vol)ethanol and follow the manufacturer’s protocol for RNAisolation. (vi) To ensure that cells are lysed and that DNA/RNA is released into the solution, pipette the solution up and down an additional ten times. (xiv) Image the cellswithaconfocal microscope using the Velocity software. Store the slides at4°Cuntil imaging.  not tointroduce airpockets betweenthe membrane and the glasscoverslip. (xiii) Add another 100µlof immunofluorescence mounting medium ontop of the membrane and coverwithaglasscoverslip.Besure (xii) Mount the membrane onto aglassslide byplacing cell-side uponto 100µl(~2drops) of immunofluorescence mounting medium. Total volume RNA/DNase-free distilled water Forward and reverse primer mix Roche 2×SYBR Green mix Component  (xvii) Prepare areal-time PCRmaster mixasfollows: positive controls inyourcalculation for eachprimer pairreaction (gene). Runduplicate ortriplicate reactions persample. (xvi) Prepare amap of the PCRplateand calculatethe totalnumber of samplesincluding no-template control, no-RT control and (xv) DilutecDNAto50ng/µl and keep itonice until itisready touse. (xiv) Pipette1µlof cDNAand determine the concentration using aNanoDrop 2000c. 3 2 1 Cycle number  (xii) Mixgently. Superscript II DTT 5× First-strand buffer Component Total volume Sterile ddH dNTP mix RNA Component (C) Real-timeqRT ! (xi) Cutthe membrane outof the Transwell insert using ascalpelblade and cutthe edge of the membrane, being careful not toripit. Oligo(dT)

CAUTION | CRITCAL STEP CRITCAL STEP CRITCAL STEP PAUSE POINT PAUSE POINT VOL.10 NO.3VOL.10 12–18 | Becareful whileworking withthe scalpeltoremove the membrane. 2 (continued) O

| 2015 | Temperature (°C) Lysedcellscanbestored at−20°Cfor upto6months. Capture images of the cellswithinthe next 3dtoavoid degradation and lossof signal of the fluorophore overtime. Alwaysprepare extra master mix,asitoften sticks tothe tube/pipettes. Formulation persampleisasfollows: Besure toinclude positivecontrol RNA inthisreverse-transcription (RT)reaction. Thiswillserveasyourcontrol for The ratio of absorbance 260/280should be2.0for RNA. -PCR assessment Amount persample | 70 42 natureprotocols Up to12 1 13 1 X 4 Amount persample µ µ µ µl l l l 1 2 4 µl Amount persample µ µ µ Duration Forever 15 min 50 min ● l l l TIMING 7 0.4 0.6 6 µl µ 1 10 mMeach 500 l µl µ µg l 2d Final 200 units 0.1 M 1× µg/ml Final 2+ −Mg 20 1× 2+ Final µM each ). (continued)

© 2015 Nature America, Inc. All rights reserved. Incubate the cellsinthe cellculture incubator at37 °Cfor 24h. 44| Day15,morning.Aspirate stage 3amedium from the cellsand add freshly made stage 3a medium (0.5mlperTranswell). Incubate the cellsinthe cellculture incubator at37 °Cfor 48h. 43| (i) Wash apical and basolateral surfaces of cultures with4mlof 1×PBS(−Ca  Digidata 1320Adata acquisition systemwiththe Clampex 8.1program. (v) Readthe iodide concentration of the collectedsamplesolutions using the iodide-sensitive combination microelectrode and the Part 2:add 350µlof cAMPagonist solution and collectthe solution into individual wellsof a96-wellplateateachminute for 5min. Part 1:add 350µlof nitrate solution and collectthe solution into individual wellsof a96-wellplateateachminute for 3min. (iv) Startthe discontinuous iodide efflux experiment time courseas follows: (iii) After1hof incubation, washthe apical and basolateral surfaces with4mlof nitrate solution 10times. (ii) Loadthe basolateral side of cultures with850µlof iodide solution for 1hat37°C.  (i) Remove the medium from the membrane and washthe cellsonce withPBS(−Ca  (v) Remove 40µlof the supernatant and add 10 µl of Laemmlibuffertothe supernatant. (iv) Spindown the insoluble fraction at10,000gfor 10minatroom temperature. (iii) Pipettethe solution upand down and transfer the supernatant tomicrocentrifuge tubes. (ii) Add 200µlof lysisbufferatthe apical surface of eachculture. Shake at4°Cfor 20min. ? (xiii) Exposethe blotwithenhanced chemiluminescence onthe film. (xii) Wash the membrane withPBSTfor 10minatroom temperature three times. (xi) Incubate the membrane withsecondary goat anti-mouse Ig HRPfor atleast1hroom temperature withshaking. (x) Wash the membrane three times withPBSTfor 10min at room temperature, withshaking. Incubate overnight at 4°Cwithgentle shaking. (ix) Incubate the membrane withCFTRantibody no. 596atthe concentrations listedinReagents section dilutedinblocking solution. (viii) Blockthe membrane with10mlof blocking solution for atleast1hroom temperature, withshaking. (vii) Transfer the proteins onanitrocellulose membrane intransfer bufferfor 1hat100V. (vi) Runthe samplesona6% (wt/vol)SDS-PAGE gel inrunning buffer. of the cultures with4mlof 1×PBS(−Ca ?  (E) Western blottingfor CFTRprotein (D) Iodideeffluxmeasurement for CFTRactivity melting temperature. no-template control) and no amplification in no-RT controls. Dissociation curve should show one single peakatthe appropriate (xxii) At the end of the PCR,check the dissociation curvefor eachsampletoensure thatthere are no primer dimers (seeninthe END Cooling Melt curve Amplification Preincubation Program name (xxi) Transfer the platetothe LightCycler 480. (xx) Coverthe platewithsealing tapeand centrifuging briefly at1,000 r.p.m. for 1min. (xix) Add 5µlof cDNA(50ng/µl) tothe allocatedwellsasperyourmap. (xviii) Mixand add 7µlof master mixtoeachwellof a96-wellPCRplate. Box 1 TROUBLESHOOTING TROUBLESHOOTING Day13,morning.Aspirate stage 3amedium from cellsand add freshly made stage 3amedium (0.5mlperTranswell). PAUSE POINT CRITCAL STEP CRITCAL STEP CRITCAL STEP | (continued) Store the resulting supernatant at−20 °Cfor upto1year. Ifyouare using samplesthatwere previously usedfor iodide effluxassay, washthe apical and basolateral surfaces Make astandard curvefor iodide concentration toconvertreadout toiodide concentration. Wash the iodide-sensitive combination microelectrode withdouble deionized waterthoroughly betweenreadings. Cycle(s) 45 1 1 1 Temperature (°C) 40 95 65 95 72 60 95 95 ● 2+ −Mg TIMING 2+ ) twotimes. Duration (00:00,min:s) 2d ● TIMING 00:10 Continuous 01:00 00:05 00:05 00:05 00:10 05:00 3h Ramp rate (°C/s) 2+ −Mg 1.5 0.11 2.2 4.4 4.4 2.2 4.4 4.4 2+ 2+ ) twice. −Mg 2+ ). natureprotocols | VOL.10 NO.3VOL.10 protocol

| 2015 |

|

377 © 2015 Nature America, Inc. All rights reserved. to the basolateral side of the Transwell. Incubate the cellsin the cellculture incubator at37°Cfor 48h. 59| Aspirate old B-ALIgrowth medium from the cellsand add fresh B-ALIdifferentiation medium (1.5mlperTranswell) only  50| ? Incubate the cellsinthe cell culture incubator at37°Cfor 48h. 56| Day28,morning.Aspirate oldB-ALIgrowth medium from the cellsand add fresh medium (0.5mlperTranswell). Incubate the cellsinthe cell culture incubator at37°Cfor 48h. old BEGMgrowth medium from the cellsand add fresh B-ALIgrowth medium (0.5 mltothe apical side of the Transwell). 55| Day26,morning.Prepare B-ALIgrowth and differentiation medium according tothe manufacturer’s protocol. Aspirate Incubate the cellsinthe cellculture incubator at37°Cfor 24h. 54| Day25,afternoon.Aspirate oldBEGM+FGF18from the cellsand add freshly made medium (0.5mlperTranswell). the cellsinthe cellculture incubator at37°Cfor 48h. 53| Day23,morning.Aspirate oldBEGM+FGF18from cellsand add freshly made medium (0.5mlperTranswell). Incubate apical side of the Transwells. In addition, remove any medium that has leaked to the basal side of the Transwell. The medium should only be added to the  Transwell). Incubate the cellsinthe cellculture incubator at37°Cfor 48h. 52| Day21,afternoon.Aspirate oldstage 3bmedium from cellsand add freshly prepared BEGM+FGF18(0.5mlper 51| result in the degradation of growth components. characterization isperformed onasubsetof the cultures. (Box 1).Resultsobtained should beasshown inFigure 5.Proceed tothe next stepwithparallel cultures while the 49| Day21,morning.Take asubsetof the cellsand assayfor lung epithelial markers byimmunofluorescence and/or RT-PCR Incubate the cellsinthe cellculture incubator at37°Cfor 24h. 48| Day20,morning.Aspirate oldstage 3bmedium from the cellsand add fresh stage 3bmedium (0.5mlperTranswell). Incubate the cellsinthe cellculture incubator at37°Cfor 48h. 47| Day18,morning.Aspirate stage 3bmedium from the cellsand add fresh stage 3bmedium (0.5mlperTranswell). In addition, remove any medium that has leaked to the basal side of the Transwell.  the apical side). Incubate the cellsinthe cellculture incubator at37°Cfor 48h. 46| Day16,morning.Aspirate oldstage 3amedium from the cellsand add fresh stage 3bmedium (0.5mlperTranswell to S Results should beasdescribed inFigure6. 58| Day30.Assay for lung epithelial markers byimmunofluorescence and/or RT-PCR onasubset of the cultures (Box 1). Incubate the cellsinthe cell culture incubator at37°Cfor 24h. 57| Day30,morning.Aspirate oldB-ALIgrowth medium from the cellsand add fresh medium (0.5mlperTranswell). S S 378  basal medium. 45| Prepare stage 3bmedium byadding FGF7(10ng/ml), FGF10(10ng/ml) and FGF18(10ng/ml) tothe differentiation protocol tage tage 5, maturation and polarization of the epithelium tage 4, expansion of immature lung cells tage 3b, differentiation to immature lung cells TROUBLESHOOTING

CR CR CR CR Add FGF18 (10 ng/ml) to the BEGM medium and warm it in a water bath before use. Freshly prepare the medium with every use. Prepare BEGM medium by thawing the supplements at 4 °C overnight. Add thawed supplements to the BEGM basal medium. | VOL.10 NO.3VOL.10 I I I I T T T T I I I I CAL CAL CAL CAL

STEP STEP STEP STEP

| 2015 | When changing the medium, be very careful to not aspirate the layer of cells on the membrane. Only prewarm the required volume of complete BEGM before use. Excess warming of this medium could When changing the medium, be very careful to not aspirate the layer of cells on the membrane. The medium must be made freshly with every use. | natureprotocols ●

T IMI ● N

G T IMI 10 d N ● G

T 5 d IMI N G up to 5 weeks

© 2015 Nature America, Inc. All rights reserved. ? these cells.  Incubate the cellsinthe cellculture incubator at37°Cfor 48h. side of cells. Add fresh B-ALIdifferentiation medium (1.5mlperTranswell) onlytothe basolateral side of the Transwell. T Troubleshooting advice canbefound in ? ? be detected after5weeksof ALI(Fig.7a)provided thatthe epithelium does not ripoff the membrane (Box 1). 61| RepeatStep60for upto5 weeks. High expression of genes associated withCFTR-expressing ciliated epithelium should 60| a 5 3 2 Step 37 31 28 19, 34 11 6 TROUBLESHOOTING TROUBLESHOOTING TROUBLESHOOTING

b CR le le Day31,morning.Carefully remove B-ALIfrom the basolateral side of the Transwell, aswellany medium onthe apical I 1 1 T I | CAL

Troubleshooting table.

STEP Excessive cell death hESCs/hiPSCs do not detach MEFs Detachment of colonies from no cell attachment Lots of floating cells and/or from enzyme treatment there is too much cell death DE cells do not detach, or Ineffective collagen coating confluency Cultures do not achieve coated plate attachment to Matrigel- Insufficient cell number single-cell culture conditions Inability to adapt cells to Problem The epithelium peels from the membrane very easily, so take extra caution when changing the medium on

T able Ineffective Ineffective collagen coating initially trying to adapt to This is normal when the cells are Insufficient treatment with TrypLE Excessive treatment with TrypLE ity ity of collagen to polymerize trypsin-mediated passaging the cells on the membrane, which killed Leftover acidic collagen solution be too short or too long Timing of TrypLE incubation may the well, as this reduces the abil collagen solution is used to coat It is important that not too much death Inaccurate cell counting or cell achieve single-cell suspension too vigorous trituration of cells to Poor Matrigel coating of plate or mediated passaging ability to adapt to trypsin- Line-to-line variability in the P ossible reason 1.

- as as this may be a collagen batch issue Order a bulk batch of the optimal collagen solution, Test collagen coating before starting the protocol washes as required collagen solution still remains, and perform extra Use medium with phenol red to test whether acidic before seeding cells Ensure that the membrane is thoroughly washed Solution Increase the length of treatment to up to 10 min 10 min Ensure that the length of treatment does not exceed the well Reduce the volume of collagen solution used to coat after passaging Add ROCK inhibitor to improve the survival of cells detached). At this point, continue with Step 32 borders appear to be detaching (but cells have not Every minute, check to determine whether the cell after passaging Add ROCK inhibitor to improve the survival of cells ensure that plating density is based on viable cells Addition of live/dead stain during cell counting to TrypLE again to break cell-to-cell adhesion suspension, briefly incubate the cell suspension with Optimize the Matrigel coating. To ensure single-cell line Optimize the timing of TypLE incubation for each cell passaging Add ROCK inhibitor to improve survival of cells after natureprotocols

| VOL.10 NO.3VOL.10 protocol

(continued) | 2015 | |

379

© 2015 Nature America, Inc. All rights reserved. Compared withourpreviously published differentiation method in the upregulation of lung epithelial cellgenes, although atlowerlevelsrelative totracheal and lung tissues( that promote epithelial differentiation during embryonic lung development, such asFGF7,FGF10,BMP4and FGF18,results suggest contamination withectoderm-derived forebrain lineage inthe culture. Addition of ventralizing factors and factors FOXG1 and PAX9). No expression of the forebrain marker PAX6 should bedetected. Upregulation ofPAX6 and NKX2-1may FOXP2 are upregulated (Fig.3c),whereas lowlevelsof other anterior foregut genes may stillbeexpressed ( compared withourhiPSClines. on the cellline. Inourexperience, the efficiency of DE generation generally ishighest withhESClines CA1>HES2>H9>CA2 glycosylated form of the protein comparable toourprevious differentiation protocol (Fig.7 c). To determine whether CFTR measured by iodide effluxassay(Fig.7 b), withcellsfrom the CA1hESCline abundantly expressing the mature wild-type should bethe aimof future studies. Despitethe lowlevelsof contaminating nonlung cells, robust CFTRactivitycanstillbe of nonlung endoderm-derived cellssuch asthe pancreas, liverand thyroid. Methods topurify the cellsare needed and expression levelof CFTR-expressing epithelia isgenerated, thismodified protocol does not eliminate possiblecontamination genes isslightly greater; however, CFTR isgreater bytenfold (Fig.7a). previous protocol (Fig.6b ). Bythe final stage of differentiation, after3weeks inALI,the expression of proximal epithelial By stage 4,the levelof upregulated gene expression for many of the proximal epithelial celltypesiscomparable toour Expansion of the immature lung cells may result in multilayer cell growth (resembling a pseudostratified epithelium, is alsoobservedinthese cultures. Morphologically, the cellsappearcuboidal, resembling anepithelium (Fig.5a,b ). differentiation augments the expression of genes associated with mucus-producing cells. Importantly, greater CFTR expression of monolayer differentiation should yield anywhere from 75to>95%DEinduction (CXCR4 occurs. Evidence of morphological changes canbeobservedasearlyday 3during DEdifferentiation (Fig.2).Thismethod small nucleus and large cytoplasmcuboidal morphology shapeasthe celltransition from hESCs/hiPSCstoepithelial cells the chance of successful differentiation. Morphologically, cellsconvertfrom small high nuclear-to-cytoplasm content toa Careful monitoring of morphological and phenotypic changes incultures whileperforming thisprotocol cangreatly increase ANTICPATED RESULTS See Figure 1for timing details for the PROCEDURE. ● T 380 a step step 1E(xiii) Box step 1D(v) Box 61 60 56 38 Step protocol

As the cellsdifferentiate into lung endoderm (stage 2),earlylung endoderm markers such asNKX2-1,SOX2,SOX9and Most genes associated with distalepithelia are not detectable atany stage of the differentiation. Although agreater b T le le IMI | VOL.10 NO.3VOL.10 1 1 , , 1 1 N

| G

Troubleshooting table (continued). No CFTR signal on film saturated Iodide baseline is too high or the membrane Cells appear to be peeling off out the liquid making it difficult to aspirate apical side of the membrane, Thick mucus layer on the another to be growing on top of one Cells are confluent and appear Lots of floating dead cells Problem

| 2015 | | natureprotocols

samples Very small amount of CFTR in iodide Inefficient washing of extraneous there is line-to-line variability It is hard to control cell growth as culture continues this may worsen. production by the cells; as ALI This is common due to mucus carefully membrane if aspiration is done which can peel the cells off the making the apical liquid viscous, Too much mucus production, Rapid cell growth cells death can also be toxic for live This is normal, but too much cell P ossible reason 39 , improving DEgeneration and consequently lung endoderm

Solution monoclonal no. 596 and secondary antibody goat anti-mouse Increase the concentration of primary antibody Increase the number of washes after iodide loading at Step 35 Determine the optimal cell density to seed the cells carefully remove the apical liquid Instead of vacuum suction, use a manual pipette to maturation of the cells Change to ALI cultures to induce differentiation and Add ROCK inhibitor to improve survival of cells + CD117 + ; SOX17 + FOXA2 HNF4, PDX1, Fig. 5c). + ) depending Fig. 6

a

).

© 2015 Nature America, Inc. All rights reserved. iodide effluxassay(Fig.7b).We plantousethisprotocol tostudy the CFTRfunction of more CFmutant celllines. 37 °C.One CFline (GM00997)withF508del showed functional CFTRrescue compared withnontreated cells, asmeasured by c at online available is information permissions and Reprints interests. 19. 18. 17. 16. 15. 14. 13. 12. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. CO AUT A function couldbefunctionally rescued inCFiPSC-derived epithelial cells, the cellswere treated with3 manuscript figu manuscript. J.G., S.C. and S.X. performed the experiments and helped in preparing experimental design. A.P.W. performed and analyzed the experiments and wrote the and GM04320 were obtained from J. Ellis (Hospital for Sick Children). H9 hESCs were obtained from The WiCell Research Institute. CF iPSC line GM00997 fellowship. The CA1 hESC line was obtained from A. Nagy (Mount Sinai Hospital). C.E.B. and J.R. A.P.W. was the recipient of the Cystic Fibrosis Canada postdoctoral work was funded by the Canadian Institutes of Healthproviding Research the monoclonal (GPG-102171) antibodies to specific to CFTR (nos. 450, 596 and 660). This om/reprints/index.htm ckno M

H PET cells:TNF- expressionprimarybymouse bronchiolar-alveolar epithelial mesenchymaland Nat. Protoc. Nat. cells. stem pluripotent human from derived pericytes and cells endothelial cells. stem pluripotent human of specification pancreatic and patterning regulates WNT and blastocysts. cells into intestinal tissue intestinal into cells cells. stem functional hepatic cells. hepaticfunctional factors.reprogramming viral of free cells stem existing diabetes in mice. in diabetes existing pre- treating of capable islets functional into progenitorspancreatic Am. J. Physiol. Lung Cell. Mol. Physiol. Mol. Cell. Lung Physiol. J. Am. TGF- opposing by controlled is cells I type to II type biopsies. from derived cells epithelialbronchial human of culturing Serial M. Ponec, grownexplants.from Methods conditions.defined under cells stem pluripotent human from cells epidermal and epithelialfunctional ofgeneration injury.cord spinal after locomotion restore and remyelinatetransplants cell progenitor (2006). 663–676 126, factors. defined by cultures fibroblast adult and embryonic mouse Kasai, H., Allen, J.T., Mason, R.M., Kamimura, T. & Zhang, Z. TGF- Z. Zhang, & T.Kamimura, R.M., Mason,J.T., Allen, H., Kasai, epithelial alveolar Transdifferentiationof M.A. O’Reilly, & Yee,M. L., Zhao, I.A. Forrest, & J.H. Dijkman, Kempenaar,J.A., M.A., Sterkenburg, P.M.,van Jong, de Dolovich,PrimaryYaghi,&Zaman,humanM. bronchialA., A. epithelial cells V.V.Orlova, A. Rezania, S.P.Efficient Palecek, & J.M. Kolz, N.J., Grundl, J.A., Selekman, M.C. Nostro, J.R. Spence, J. Cai, M.J. Phillips, Soldner,F. oligodendrocytecell–derived stem embryonic Human H.S. Keirstead, L. Zwi, from cells stem pluripotent ofInduction Yamanaka, S. & K. Takahashi, J.A. Thomson, Warshamana,Brody,&G.S., Corti,M.TNF- A.R. Shcheglovitov,A. Resp. Res. Resp. (EMT). transition cell mesenchymal to epithelial alveolar humaninduces transplant recipients.transplant 2. homeobox system visual for roles multiple reveals cells stem pluripotent induced specific from22q13deletion syndrome patients. OR w I

N le CONTR G G FI dgm Directed differentiation of human embryonic stem cells into cells stem embryonic human ofdifferentiation Directed al. et Cardiomyocyte differentiation of human induced pluripotent inducedhuman ofdifferentiation Cardiomyocyte al. et , 949–960 (2013). 949–960 19, In vitro Cell. Dev. Biol. Anim. Biol. Dev. Cell. vitro In NANC α res. IB , 56 (2005). 56 6, ents Parkinson’s disease patient-derived induced pluripotent inducedpatient-derived disease Parkinson’s al. et induces TGF- Circulation Generation, expansion and functional analysis of analysis functional and expansionGeneration, al. et Maturation of human embryonic stem cell-derived stem embryonic human of Maturation al. et J. Neurosci. J. Science , 1514–1531 (2014). 1514–1531 9, Primary airway epithelial cell culture from lung from culture cell epithelial airway Primary al. et UT Stage-specific signaling through TGF family members family TGF through signaling Stage-specific al. et Directed differentiation of human pluripotent stem pluripotent human ofdifferentiation Directed al. et Modeling human retinal development with patient- with developmentretinal humanModeling al. et All authors edited and approved the final manuscript. Embryonic stem cell lines derived from human from derived lines cell stem Embryonic al. et I I

AL ONS We thank J.R. Riordan (University of North Carolina) for et al.et l I . , 1145–1147 (1998). 1145–1147 282,

NTERESTS A.P.W., J.R. and C.E.B. conceived the study and the J. Vis. Exp.Vis.J. Stem Cells Stem Eur. Resp. J. Resp. Eur. SHANK3andIGF1restore synaptic deficits neuronsin , 1513–1523 (2009). 1513–1523 120, Development β , 4694–4705 (2005). 4694–4705 25, Hepatology 1. Diabetes in vitro. in Exp. Mol. Pathol.Mol.Exp.

The authors declare no competing financial

, 1480–1492 (2014). 1480–1492 32, doi.org/10.3791/178

, 1080–1085 (2005). 1080–1085 26, Nature , 2016–2029 (2012). 2016–2029 61, , 1229–1239 (2007). 1229–1239 45, , 861–871 (2011). 861–871 138,

Nature 29A , L409–L418 (2013). L409–L418 305, , 105–109 (2010). 105–109 470, , 379–387 (1993). 379–387 ,

71 α 503 , PDGF,, TGF-and Cell , 13–33(2001)., Tissue Eng. Part C Part Eng. Tissue , 267–271,(2013). , 964–977 (2009). 964–977 136, 9 and BMP signaling. BMP and β (2010). http://www.nature. β 1 β1 Cell 29. 28. 27. 26. 25. 24. 23. 22. 21. 20. 46. 45. 44. 43. 42. 41. 34. 33. 32. 31. 30. 40. 39. 38. 37. 36. 35.

, 407–416 (2007). 407–416 9, USA cells. stem pluripotent inducedhuman from epithelia bioartificial lung. bioartificial embryonic stem cells. stem embryonic 267–272 cells. stem pluripotent induced and embryonic epithelium Stem Cells Stem concentration-dependentmanner.a in lineages cell foregut/midgut DNA. complementary of characterization lung extracellular matrix. extracellular lung patients with cystic fibrosis. cystic with patients lung growth and morphogenesis.andgrowthlung epithelial cells. epithelial Biotechnol. protein. CFTR functionalexpressing epithelia airway mature into Respir. Cell Mol. Biol. Mol. Cell Respir. J. Pediatr.J. testing. genetic of onset the since trenddecreasing a Canada: in rates virulence. and tropism adenovirus humanstudying for model culture cell epithelialbronchial porcine , 13036–13041 (1998). 13036–13041 95, inhibitor.signalinghedgehog a cyclopamine, lung. and liver into foregut ventral the pattern factors growth fibroblast of thresholds Different pneumocytes. II type into ESC murine ofdifferentiation embryonic stem cells. stem embryonic human from derived cells II type epithelial alveolar lung of population Res. Resp. cells. stem embryonic human from tissue epithelial-like lung of Generation Samadikuchaksaraei, A. & Bishop, A.E. Effects of growth factors on the on factors growth of Effects A.E. Bishop, & A. Samadikuchaksaraei, W.Li, Vanscoy,L.L. J.R. Riordan, birth fibrosis Cystic Corey,M. & D.E.C. Cole, D., Hamilton, A., Dupuis, differentiated A A. Heim, & Warnecke,G. S., Groos, M., Ramke, E., Lam, H.C. Ott, O. Delgado, J.W.Shay, & J.D. W.E.,Minna, Wright, R.D., Ramirez, M.B., Vaughan, Tanjore,H. Green, M.D. Green, by promoted is developmentPancreas D.A. Melton, & S.K. Kim, Bellusci,S. G.H. Deutsch, & J.M. Parvatiyar,P.,Wells, Doherty,S., A.E., Serls, M. Ghaedi, A.L. Firth, H.J. Rippon, B. Roszell, N.N. Ali, B.E. Vranken, Van A. Samadikuchaksaraei, Huang, S.X.L. S.X.L. Huang, A.P.Wong, pure A R.A. Wetsel, & E. Zsigmond, A.R., Burns, D.L., Haviland, D., Wang, M. Rycke, De & K. Sermon, I., Liebaers, G., Block, De L., Haute,Van J. Ameri, tissue. epithelial airway generate cells stem Embryonic C. Coraux, pulmonary epithelium. pulmonary ofdifferentiation promotes microenvironmentthat a mesenchyme: bronchial epithelial cells. epithelialbronchial human immortalized ofdifferentiation of three-dimensionalmodel A human embryonic stem cells. stem embryonic human Am. J. Respir. Crit. Care Med. Care Crit. Respir. J. Am. (2014). cells from human pluripotent stem cells. cells. stem pluripotent human from cells embryonic stem cells for cells stem embryonic J. Biol. Chem. Biol. J. stress. reticulumendoplasmic to response in transitionmesenchymal 3351–3365 (2009). 3351–3365 , E1723–E1730 (2014). E1723–E1730 111, Understanding the population structure of North American North of structure population Understandingthe al. et (2011). Derivation of type II alveolar epithelial cells from murine from cells epithelial alveolar II type of Derivation al. et Regeneration and orthotopic transplantation of a oftransplantation orthotopic andRegeneration al. et FGF2 specifies hESC-derived definitive endoderm into endoderm definitive hESC-derived specifies FGF2 al. et , 105 (2009). 105 10, , 45–56 (2009). 45–56 28, , 312–315 (2005). 312–315 147, Generation of multiciliated cells in functional airway functional in cells multiciliated of Generation al. et et al. et and vitro in Human iPS cell-derived alveolar epithelium repopulates epithelium alveolar cell-derived iPS Human al. et Directed differentiation of human pluripotent stem cells stem pluripotent human ofdifferentiation Directed al. et et al. et et , 876–882 (2012). 876–882 30, Multipotent capacity of immortalized human bronchialhuman immortalized of capacity Multipotent al. et Generation of anterior foregut endoderm from human from endodermforegut anterior of Generation al. et Embryonic stem cells as a source of pulmonary of source a as cells stem Embryonic al. et Heritability of lung disease severity in cystic fibrosis. cystic in severity disease lung of Heritability al. et Identification of the cystic fibrosis gene: cloning and cloning gene: fibrosis cystic the Identification of al. et

Alveolar epithelial cells undergo epithelial-to-undergo cells epithelial Alveolar al. , 30972–30980 (2011). 30972–30980 286, et al. et PLoS ONE PLoS Efficient derivation of alveolar type II cells from cells II type alveolar of Efficient derivation Involvement of Sonic hedgehog (Shh) in mouse embryonicInvolvementmousehedgehogSonicinof (Shh) Nat. Med. Nat. Coculture of embryonic stem cells with pulmonary with cells stem embryonic of Coculture al. et Efficient generation of lung and airway epithelial epithelial airway and lung of generation Efficient

, 87–92 (2004). 87–92 32, Tissue Eng. Tissue Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. Tissue Eng. Tissue natureprotocols in vivo. in Derivation of distal airway epithelium from epithelium airway distal of Derivation al. et in vivo in J. Clin. Invest. Clin. J. Differentiation , e22023 (2011). e22023 6, , 927–933 (2010). 927–933 16, Development

Clin. Genet. Clin. , 1036–1043 (2007). 1036–1043 175, Tissue Eng. Tissue application. Proc. Am. Thorac. Soc. Thorac. Am. Proc. Development , 541–550 (2002). 541–550 8, J. Virol. Methods Virol. J. , 1177–1187 (2005). 1177–1187 11,

, 141–148 (2006). 141–148 74, Science , 4950–4962 (2013). 4950–4962 123, , 136–146 (2011). 136–146 79, , 35–47 (2005). 35–47 132, , 867–875 (2006). 867–875 12, Nat. Biotechnol. Nat.

Tissue Eng. Part A Part Eng. Tissue 124 µM VX-809for 48hat Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. | VOL.10 NO.3VOL.10 Nat. Biotechnol. Nat.

, 1066–1073 (1989). 1066–1073 245, , 4449–4454 (2007). 4449–4454 104, , 53–63 (1997).53–63 ,

, 117–123 (2011). 117–123 178,

Proc. Natl. Acad. Sci. Acad. Natl. Proc. protocol , 717–722 (2008). 717–722 5, Cloning Stem Cells Stem Cloning

32

| 2015 |

, 84–91 84–91 , 15 29, Nat. , Am. J. Am.

|

381