Cofactor Engineering for Advancing Chemical Biotechnology. Yipeng
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0. -
Regulation of ATP Levels in Escherichia Coli Using CRISPR
Tao et al. Microb Cell Fact (2018) 17:147 https://doi.org/10.1186/s12934-018-0995-7 Microbial Cell Factories RESEARCH Open Access Regulation of ATP levels in Escherichia coli using CRISPR interference for enhanced pinocembrin production Sha Tao, Ying Qian, Xin Wang, Weijia Cao, Weichao Ma, Kequan Chen* and Pingkai Ouyang Abstract Background: Microbial biosynthesis of natural products holds promise for preclinical studies and treating diseases. For instance, pinocembrin is a natural favonoid with important pharmacologic characteristics and is widely used in preclinical studies. However, high yield of natural products production is often limited by the intracellular cofactor level, including adenosine triphosphate (ATP). To address this challenge, tailored modifcation of ATP concentration in Escherichia coli was applied in efcient pinocembrin production. Results: In the present study, a clustered regularly interspaced short palindromic repeats (CRISPR) interference sys- tem was performed for screening several ATP-related candidate genes, where metK and proB showed its potential to improve ATP level and increased pinocembrin production. Subsequently, the repression efciency of metK and proB were optimized to achieve the appropriate levels of ATP and enhancing the pinocembrin production, which allowed the pinocembrin titer increased to 102.02 mg/L. Coupled with the malonyl-CoA engineering and optimization of culture and induction condition, a fnal pinocembrin titer of 165.31 mg/L was achieved, which is 10.2-fold higher than control strains. Conclusions: Our results introduce a strategy to approach the efcient biosynthesis of pinocembrin via ATP level strengthen using CRISPR interference. Furthermore coupled with the malonyl-CoA engineering and induction condi- tion have been optimized for pinocembrin production. -
In Vivo Metabolism of [1,6-13C2]Glucose Reveals Distinct
H OH metabolites OH Article 13 In Vivo Metabolism of [1,6- C2]Glucose Reveals Distinct Neuroenergetic Functionality between Mouse Hippocampus and Hypothalamus Antoine Cherix 1,†, Rajesh Sonti 1,‡, Bernard Lanz 1 and Hongxia Lei 2,3,*,§ 1 Laboratory of Functional and Metabolic Imaging (LIFMET), Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne, Switzerland; [email protected] (A.C.); [email protected] (R.S.); bernard.lanz@epfl.ch (B.L.) 2 Animal Imaging and Technology (AIT), Center for Biomedical Imaging (CIBM), Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne, Switzerland 3 Faculty of Medicine, University of Geneva, CH-1206 Geneva, Switzerland * Correspondence: [email protected] † Current address: Wellcome Centre for Integrative Neuroimaging (WIN), Oxford Centre for Functional MRI of the Brain (FMRIB), Nuffield Department of Clinical Neurosciences, University of Oxford, Oxford OX3 9DU, UK. ‡ Current address: Department of Pharmaceutical analysis, National Institute of Pharmaceutical Education and Research (NIPER) Hyderabad- NH 65, Hyderabad 500037, India. § Current address: Wuhan United Imaging Life Science Instruments Ltd., Wuhan 430206, China. Abstract: Glucose is a major energy fuel for the brain, however, less is known about specificities of its metabolism in distinct cerebral areas. Here we examined the regional differences in glucose utilization between the hypothalamus and hippocampus using in vivo indirect 13C magnetic res- 1 13 13 onance spectroscopy ( H-[ C]-MRS) upon infusion of [1,6- C2]glucose. Using a metabolic flux analysis with a 1-compartment mathematical model of brain metabolism, we report that compared to hippocampus, hypothalamus shows higher levels of aerobic glycolysis associated with a marked Citation: Cherix, A.; Sonti, R.; Lanz, gamma-aminobutyric acid-ergic (GABAergic) and astrocytic metabolic dependence. -
Flavin-Containing Monooxygenases: Mutations, Disease and Drug Response Phillips, IR; Shephard, EA
Flavin-containing monooxygenases: mutations, disease and drug response Phillips, IR; Shephard, EA For additional information about this publication click this link. http://qmro.qmul.ac.uk/jspui/handle/123456789/1015 Information about this research object was correct at the time of download; we occasionally make corrections to records, please therefore check the published record when citing. For more information contact [email protected] Flavin-containing monooxygenases: mutations, disease and drug response Ian R. Phillips1 and Elizabeth A. Shephard2 1School of Biological and Chemical Sciences, Queen Mary, University of London, Mile End Road, London E1 4NS, UK 2Department of Biochemistry and Molecular Biology, University College London, Gower Street, London WC1E 6BT, UK Corresponding author: Shephard, E.A. ([email protected]). and, thus, contribute to drug development. This review Flavin-containing monooxygenases (FMOs) metabolize considers the role of FMOs and their genetic variants in numerous foreign chemicals, including drugs, pesticides disease and drug response. and dietary components and, thus, mediate interactions between humans and their chemical environment. We Mechanism and structure describe the mechanism of action of FMOs and insights For catalysis FMOs require flavin adenine dinucleotide gained from the structure of yeast FMO. We then (FAD) as a prosthetic group, NADPH as a cofactor and concentrate on the three FMOs (FMOs 1, 2 and 3) that are molecular oxygen as a cosubstrate [5,6]. In contrast to most important for metabolism of foreign chemicals in CYPs FMOs accept reducing equivalents directly from humans, focusing on the role of the FMOs and their genetic NADPH and, thus, do not require accessory proteins. -
Quantitative Analysis of Amino Acid Metabolism in Liver Cancer Links Glutamate Excretion to Nucleotide Synthesis
Quantitative analysis of amino acid metabolism in liver cancer links glutamate excretion to nucleotide synthesis Avlant Nilssona,1, Jurgen R. Haanstrab,1, Martin Engqvista, Albert Gerdingc,d, Barbara M. Bakkerb,c, Ursula Klingmüllere, Bas Teusinkb, and Jens Nielsena,f,2 aDepartment of Biology and Biological Engineering, Chalmers University of Technology, SE41296 Gothenburg, Sweden; bSystems Biology Lab, Amsterdam Institute of Molecular and Life Sciences (AIMMS), Vrije Universiteit Amsterdam, NL1081HZ Amsterdam, The Netherlands; cLaboratory of Pediatrics, Systems Medicine of Metabolism and Signaling, University of Groningen, University Medical Center Groningen, NL-9713AV Groningen, The Netherlands dDepartment of Laboratory Medicine, University of Groningen, University Medical Center Groningen, NL-9713AV Groningen, The Netherlands; eDivision of Systems Biology and Signal Transduction, German Cancer Research Center, D-69120 Heidelberg, Germany; and fNovo Nordisk Foundation Center for Biosustainability, Technical University of Denmark, Kongens Lyngby, DK2800, Denmark Contributed by Jens Nielsen, March 9, 2020 (sent for review November 4, 2019; reviewed by Eytan Ruppin and Matthew G. Vander Heiden) Many cancer cells consume glutamine at high rates; counterintu- the excretion of lactate, glutamate, alanine, and glycine (5). How- itively, they simultaneously excrete glutamate, the first interme- ever, a full genome-wide modeling approach is required to expand diate in glutamine metabolism. Glutamine consumption has been our knowledge of how metabolism functions beyond the canonical linked to replenishment of tricarboxylic acid cycle (TCA) interme- pathways and, in particular, to understand the intricate effects of diates and synthesis of adenosine triphosphate (ATP), but the metabolic compartmentalization and the interplay between ex- reason for glutamate excretion is unclear. Here, we dynamically change fluxes and synthesis of biomass. -
Ribonucleotides Incorporated by the Yeast Mitochondrial DNA Polymerase Are Not Repaired
Ribonucleotides incorporated by the yeast mitochondrial DNA polymerase are not repaired Paulina H. Wanrooija,1, Martin K. M. Engqvistb,c,2, Josefin M. E. Forslunda,2, Clara Navarreteb, Anna Karin Nilssona, Juhan Sedmand, Sjoerd Wanrooija, Anders R. Clausenb, and Andrei Chabesa,e,1 aDepartment of Medical Biochemistry and Biophysics, Umeå University, SE-901 87 Umeå, Sweden; bInstitute of Biomedicine, University of Gothenburg, SE-405 30 Gothenburg, Sweden; cDepartment of Biology and Biological Engineering, Chalmers University of Technology, SE-412 96 Gothenburg, Sweden; dDepartment of Biochemistry, Institute of Molecular and Cell Biology, University of Tartu, Tartu 51010, Estonia; and eLaboratory for Molecular Infection Medicine Sweden, Umeå University, SE-901 87 Umeå, Sweden Edited by Philip C. Hanawalt, Stanford University, Stanford, CA, and approved October 17, 2017 (received for review July 25, 2017) Incorporation of ribonucleotides into DNA during genome replica- Mec1/Rad53 genome integrity checkpoint regulates yeast RNR tion is a significant source of genomic instability. The frequency activity through several different mechanisms (14). of ribonucleotides in DNA is determined by deoxyribonucleoside The incorporation of ribonucleotides (rNMPs) into the genome triphosphate/ribonucleoside triphosphate (dNTP/rNTP) ratios, by the during DNA replication has become recognized as a significant ability of DNA polymerases to discriminate against ribonucleotides, source of genomic instability. Given that the physiological con- and by the capacity of repair mechanisms to remove incorporated centrations of ribonucleoside triphosphates (rNTPs), the building ribonucleotides. To simultaneously compare how the nuclear and blocks of RNA, are one to two orders-of-magnitude higher than mitochondrial genomes incorporate and remove ribonucleotides, those of dNTPs, rNMPs are frequently incorporated into DNA we challenged these processes by changing the balance of cellular during replication (15, 16). -
Nicotinamide Adenine Dinucleotide Is Transported Into Mammalian
RESEARCH ARTICLE Nicotinamide adenine dinucleotide is transported into mammalian mitochondria Antonio Davila1,2†, Ling Liu3†, Karthikeyani Chellappa1, Philip Redpath4, Eiko Nakamaru-Ogiso5, Lauren M Paolella1, Zhigang Zhang6, Marie E Migaud4,7, Joshua D Rabinowitz3, Joseph A Baur1* 1Department of Physiology, Institute for Diabetes, Obesity, and Metabolism, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 2PARC, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 3Lewis-Sigler Institute for Integrative Genomics, Department of Chemistry, Princeton University, Princeton, United States; 4School of Pharmacy, Queen’s University Belfast, Belfast, United Kingdom; 5Department of Biochemistry and Biophysics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, United States; 6College of Veterinary Medicine, Northeast Agricultural University, Harbin, China; 7Mitchell Cancer Institute, University of South Alabama, Mobile, United States Abstract Mitochondrial NAD levels influence fuel selection, circadian rhythms, and cell survival under stress. It has alternately been argued that NAD in mammalian mitochondria arises from import of cytosolic nicotinamide (NAM), nicotinamide mononucleotide (NMN), or NAD itself. We provide evidence that murine and human mitochondria take up intact NAD. Isolated mitochondria preparations cannot make NAD from NAM, and while NAD is synthesized from NMN, it does not localize to the mitochondrial matrix or effectively support oxidative phosphorylation. Treating cells *For correspondence: with nicotinamide riboside that is isotopically labeled on the nicotinamide and ribose moieties [email protected] results in the appearance of doubly labeled NAD within mitochondria. Analogous experiments with †These authors contributed doubly labeled nicotinic acid riboside (labeling cytosolic NAD without labeling NMN) demonstrate equally to this work that NAD(H) is the imported species. -
Citric Acid Cycle
CHEM464 / Medh, J.D. The Citric Acid Cycle Citric Acid Cycle: Central Role in Catabolism • Stage II of catabolism involves the conversion of carbohydrates, fats and aminoacids into acetylCoA • In aerobic organisms, citric acid cycle makes up the final stage of catabolism when acetyl CoA is completely oxidized to CO2. • Also called Krebs cycle or tricarboxylic acid (TCA) cycle. • It is a central integrative pathway that harvests chemical energy from biological fuel in the form of electrons in NADH and FADH2 (oxidation is loss of electrons). • NADH and FADH2 transfer electrons via the electron transport chain to final electron acceptor, O2, to form H2O. Entry of Pyruvate into the TCA cycle • Pyruvate is formed in the cytosol as a product of glycolysis • For entry into the TCA cycle, it has to be converted to Acetyl CoA. • Oxidation of pyruvate to acetyl CoA is catalyzed by the pyruvate dehydrogenase complex in the mitochondria • Mitochondria consist of inner and outer membranes and the matrix • Enzymes of the PDH complex and the TCA cycle (except succinate dehydrogenase) are in the matrix • Pyruvate translocase is an antiporter present in the inner mitochondrial membrane that allows entry of a molecule of pyruvate in exchange for a hydroxide ion. 1 CHEM464 / Medh, J.D. The Citric Acid Cycle The Pyruvate Dehydrogenase (PDH) complex • The PDH complex consists of 3 enzymes. They are: pyruvate dehydrogenase (E1), Dihydrolipoyl transacetylase (E2) and dihydrolipoyl dehydrogenase (E3). • It has 5 cofactors: CoASH, NAD+, lipoamide, TPP and FAD. CoASH and NAD+ participate stoichiometrically in the reaction, the other 3 cofactors have catalytic functions. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Expressing a Cytosolic Pyruvate Dehydrogenase Complex To
Zhang et al. Microb Cell Fact (2020) 19:226 https://doi.org/10.1186/s12934-020-01493-z Microbial Cell Factories RESEARCH Open Access Expressing a cytosolic pyruvate dehydrogenase complex to increase free fatty acid production in Saccharomyces cerevisiae Yiming Zhang1†, Mo Su1†, Ning Qin1, Jens Nielsen1,2,3 and Zihe Liu1* Abstract Background: Saccharomyces cerevisiae is being exploited as a cell factory to produce fatty acids and their derivatives as biofuels. Previous studies found that both precursor supply and fatty acid metabolism deregulation are essential for enhanced fatty acid synthesis. A bacterial pyruvate dehydrogenase (PDH) complex expressed in the yeast cytosol was reported to enable production of cytosolic acetyl-CoA with lower energy cost and no toxic intermediate. Results: Overexpression of the PDH complex signifcantly increased cell growth, ethanol consumption and reduced glycerol accumulation. Furthermore, to optimize the redox imbalance in production of fatty acids from glucose, two endogenous NAD+-dependent glycerol-3-phosphate dehydrogenases were deleted, and a heterologous NADP+-dependent glyceraldehyde-3-phosphate dehydrogenase was introduced. The best fatty acid producing strain PDH7 with engineering of precursor and co-factor metabolism could produce 840.5 mg/L free fatty acids (FFAs) in shake fask, which was 83.2% higher than the control strain YJZ08. Profle analysis of free fatty acid suggested the cyto- solic PDH complex mainly resulted in the increases of unsaturated fatty acids (C16:1 and C18:1). Conclusions: We demonstrated that cytosolic PDH pathway enabled more efcient acetyl-CoA provision with the lower ATP cost, and improved FFA production. Together with engineering of the redox factor rebalance, the cyto- solic PDH pathway could achieve high level of FFA production at similar levels of other best acetyl-CoA producing pathways. -
Metabolic Flux Analysis—Linking Isotope Labeling and Metabolic Fluxes
H OH metabolites OH Review Metabolic Flux Analysis—Linking Isotope Labeling and Metabolic Fluxes Yujue Wang 1,2, Fredric E. Wondisford 1, Chi Song 3, Teng Zhang 4 and Xiaoyang Su 1,2,* 1 Department of Medicine, Rutgers-Robert Wood Johnson Medical School, New Brunswick, NJ 08901, USA; [email protected] (Y.W.); [email protected] (F.E.W.) 2 Metabolomics Shared Resource, Rutgers Cancer Institute of New Jersey, New Brunswick, NJ 08903, USA 3 Division of Biostatistics, College of Public Health, The Ohio State University, Columbus, OH 43210, USA; [email protected] 4 Department of Mathematics, University of Central Florida, Orlando, FL 32816, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-732-235-5447 Received: 14 September 2020; Accepted: 4 November 2020; Published: 6 November 2020 Abstract: Metabolic flux analysis (MFA) is an increasingly important tool to study metabolism quantitatively. Unlike the concentrations of metabolites, the fluxes, which are the rates at which intracellular metabolites interconvert, are not directly measurable. MFA uses stable isotope labeled tracers to reveal information related to the fluxes. The conceptual idea of MFA is that in tracer experiments the isotope labeling patterns of intracellular metabolites are determined by the fluxes, therefore by measuring the labeling patterns we can infer the fluxes in the network. In this review, we will discuss the basic concept of MFA using a simplified upper glycolysis network as an example. We will show how the fluxes are reflected in the isotope labeling patterns. The central idea we wish to deliver is that under metabolic and isotopic steady-state the labeling pattern of a metabolite is the flux-weighted average of the substrates’ labeling patterns. -
Cofactor Strap Regulates Oxidative Phosphorylation and Mitochondrial P53 Activity Through ATP Synthase
Cell Death and Differentiation (2015) 22, 156–163 & 2015 Macmillan Publishers Limited All rights reserved 1350-9047/15 www.nature.com/cdd Cofactor Strap regulates oxidative phosphorylation and mitochondrial p53 activity through ATP synthase S Maniam1,4, AS Coutts1,4, MR Stratford2, J McGouran3, B Kessler3 and NB La Thangue*,1 Metabolic reprogramming is a hallmark of cancer cells. Strap (stress-responsive activator of p300) is a novel TPR motif OB-fold protein that contributes to p53 transcriptional activation. We show here that, in addition to its established transcriptional role, Strap is localised at mitochondria where one of its key interaction partners is ATP synthase. Significantly, the interaction between Strap and ATP synthase downregulates mitochondrial ATP production. Under glucose-limiting conditions, cancer cells are sensitised by mitochondrial Strap to apoptosis, which is rescued by supplementing cells with an extracellular source of ATP. Furthermore, Strap augments the apoptotic effects of mitochondrial p53. These findings define Strap as a dual regulator of cellular reprogramming: first as a nuclear transcription cofactor and second in the direct regulation of mitochondrial respiration. Cell Death and Differentiation (2015) 22, 156–163; doi:10.1038/cdd.2014.135; published online 29 August 2014 An established characteristic of tumour cells is their under- model whereby Strap unfolds to become more accessible lying metabolic changes.1 Early observations that during the DNA-damage response.12 tumour cells had persistently high