A Novel Component of the Apical Barrier Formed Between Hair Cells and Supporting Cells in the Inner Ear Sensory Epithelia

Home , Audiology, Stereocilia, Tectorial membrane

PISP: A Novel Component of the Apical Barrier Formed Between Hair Cells and Supporting Cells in the Inner Ear Sensory Epithelia

By Harshita Gupta

Submitted in partial fulfillment of the requirements For the degree of Master of Science

Thesis Advisor: Dr. Brian McDermott

Department of Biology CASE WESTERN RESERVE UNIVERSITY

May, 2012

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

Harshita Gupta

candidate for the Master’s of Science degree *.

(signed) Robin Snyder (chair of the committee)

Heather Broihier

Brian M. McDermott

Emmitt R. Jolly

(date) February 1, 2012

*We also certify that written approval has been obtained for any proprietary material contained therein.

Table of Contents

Introduction ...... 5 Part 1. The Inner Ear...... 5 1.1.1 Sensory Epithelia...... 6 1.1.2 Auditory System: Organ of Corti...... 9 1.1.3 Mechanotransduction of Hair Cells...... 11 Part 2. Reticular Lamina...... 12 1.2.1 Molecular Components of TJs & AJs in the Reticular Lamina ...... 14 1.2.2 Specialized Junctional Adaptations in OHC-DC Region of the Reticular Lamina...... 14 1.2.3 Development of the Junctional Complex of the Reticular Lamina ...... 16 Part 3. Model Organisms...... 18 1.3.1 Mouse as a Model Organism...... 19 1.3.2 Chicken as a Model Organism...... 19 1.3.3 Zebrafish as a Model Organism...... 21 Part 4. PISP (plasma membrane calcium ATPase-interacting single-PDZ protein) Structure and Function...... 22 1.4.1 PMCAs and Hair Cells...... 23 Materials and Methods ...... 25 2.1 Reverse Transcription - Polymerase Chain Reaction (RT-PCR)...... 25 2.2 Protein Immunoblotting...... 25 2.3. Immunocytochemistry...... 26 2.4 Whole Mount Zebrafish Staining ...... 27 2.5 Interaction of Pisp and Pmca2b using the Yeast Two-Hybrid System ...... 28 2.6 Expression and Purification of Polyhistidine-Tagged PISP Protein ...... 30 2.7 Over-Expression of Pisp in Zebrafish...... 31 Results ...... 33 3.1 PISP is Expressed in the Inner Ear of Mouse and Zebrafish ...... 33 3.2 Zebrafish Pisp and Pmca2b Interact in vitro...... 35 3.3 Over-Expression Pattern of PISP in Hair Cells of Zebrafish...... 38 3.4 PISP Protein Localizes Towards the Apical Portion of the Mouse and Chicken Sensory Epithelium...... 40 3.5 Characterization of the Human Polyclonal Antibody Against PISP ...... 42 3.6 PISP is a Junctional Protein Candidate in Chicken Sensory Epithelium ...... 43 Discussion ...... 46 4.1 PISP is a Single PDZ Domain-Containing Protein Conserved Between Mouse, Chicken, and Zebrafish ...... 46 4.2 In vitro Interaction of PISP with the C-terminus of PMCA2b...... 47 4.3 Zebrafish PISP Localized Towards the Apical Portion of the Hair Cells ...... 48 4.4 PISP Localizes towards the Apical Portion of the Inner Ear Sensory Epithelium ...... 49 4.5 Possible Role of PISP...... 52 Bibliography...... 54

List of Figures

Figure 1...... 4 Figure 2...... 9 Figure 3 ...... 8 Figure 4 ...... 13 Figure 5 ...... 16 Figure 6 ...... 17 Figure 7...... 20 Figure 8 ...... 21 Figure 9 ...... 34 Figure 10...... 35 Figure 11 ...... 37 Figure 12 ...... 38 Figure 13 ...... 41 Figure 14 ...... 42 Figure 15 ...... 44 Figure 16 ...... 53

2 Acknowledgements

I would like to thank the people who made this research possible. Dr. Brian McDermott for having the confidence in me and allowing me to independently explore my research topic, having patience and always giving an encouraging word through the difficult phases of this study. The lab, all the lab members made the lab atmosphere an excellent environment to work in. It has always been fun to look forward to coming into lab, to work with this group. The lab is a testament of how people are the most important resource. Gustavo Gomez, Lana Pollock, Megan West, Victoria (Shih Chou), Carol Fernando, and Phil Hwang – thank you for maintaining a friendly and helpful work atmosphere. Dr. Heather Broihier and Dr. Emmitt Jolly, for being a supportive committee and guiding me through the process of my defense.

I have been fortunate to work with some amazing people around campus. I owe my deepest thanks to Dr. Mark Parker. He has been a constant source of support, helping me learn several techniques, getting in touch with other people having relevant areas of expertise and someone with whom I could talk about my research. I would also like to thank Summer Watterson, Dr. Polly Phillips, Dr. Suhasini Gopal for their help. No lab research is possible without thinking of safety. I would like to thank the Case Security Police who made it possible to work after- hours by providing a safe-ride when needed.

Without personal contentment, no professional goals can be achieved. I owe my deepest gratitude to my parents, without whom I would never have been the person I am. Who brought me up to be an honest person, to believe in myself and work hard without thoughts of success or failure. Vilina Jain, who has been a rock-solid support during my study, who I could rely on at all times, to share the successes or the failures of my work. A special thanks to Michael Caves, Asmita Singh, and Deviprasadh.

PISP: A Novel Component of the Apical Barrier Formed Between Hair Cells and Supporting Cells in the Inner Ear Sensory Epithelia

HARSHITA GUPTA

Abstract

Disturbances to ionic barrier formed at apical regions of the sensory epithelia, between hair cells and supporting cells, cause changes in electrical properties of the inner ear, resulting in severe hearing loss and vestibular dysfunction. PDZ domain proteins mediate barrier formation through their occluding and adhesive properties. PISP, a single PDZ- domain protein, was identified in a yeast two-hybrid screen using human brain cDNA library and in a microarray analysis of the zebrafish hair cell transcriptome. We here confirm expression of pisp mRNA in zebrafish and show PISP protein expression in mouse inner ear. Interaction of zebrafish Pisp and Pmca2b orthologs was observed in vitro. In vivo, PISP localized to areas of cell-cell contact between hair cells and supporting cells in chicken and mouse sensory epithelia. Our results thus identify PISP as a novel component of the barrier formed between hair cells and supporting cells in the inner ear sensory epithelia.

Chapter 1

Introduction

Hearing disorders are a major clinical concern in modern society. Major efforts focus on understanding the molecular and cellular mechanisms that originate in the auditory sensory epithelium, the organ of Corti. Unraveling the mysteries of the inner ear focus on understanding the molecular components of the hair bundle and neurotransmission. Recent studies have shown that vezatin, an adherens junction protein

(Bahloul et al. 2009), and tricellulin, a tight junction protein (Riazuddin et al. 2006), are involved in deafness. However, we do not have a complete understanding of the contribution of cell-cell junctions in hearing loss.

Part 1. The Inner Ear

The inner ear compromises two separate sensory systems: the auditory (hearing) and vestibular (balance). It contains a series of inter-connected membranous canals inside bony channels at the base of the skull. The perilymph is the extracellular fluid of the membranous canals, while bony channels are bathed in endolymph. Endolymph is a unique extracellular fluid with high potassium ion (K+) concentration and low sodium ions (Na+) concentration. In contrast, perilymph is closer to normal extracellular fluid

with a low K+/high Na+ ion concentration. Endolymph and perilymph are sealed apart by a permeability barrier. This barrier is formed at the level of junctions between the epithelial cells. Three types of epithelia surround this endolymphatic space: sensory epithelia, ion-transporting epithelia, and unspecialized epithelia (Forge and Wright 2002).

The following sections further detail a selective account of the sensory epithelia, in general, and the mammalian cochlea, more specifically.

1.1.1 Sensory Epithelia

The sensory epithelium of the auditory and vestibular system is composed of sensory hair cells and adjacent supporting cells, in such a way that no two hair cells come into contact with each other. At the cellular level, perception of sound and balance is carried forth by hair cells. Hair cells act as mechanotransducers that convert sound or pressure waves into electrical stimuli, which are eventually transmitted to the brain for processing (Forge and Wright 2002).

Hair Cells

The hair cell is characterized by three major regions of actin-rich cytoskeleton: the hair bundle, the cuticular plate, and an actin belt, termed the circumferential belt, associated with adherens junctions (Raphael and Altschuler 2003) (figure 1).

Figure 1. Morphology of the hair cell. Diagram showing a hair cell with ascending stereocilia and a long kinocilium protruding from the apical surface. Image source: Dr. Brian M. McDermott.

Hair bundle and cuticular plate: The stereociliary hair bundles are arranged in a

gradient of increasing height across the bundle, and most hair cells have a single

kinocilium adjacent to the longest stereocilia. This polarity is essential for hair cell

function, as deflection in the direction towards the longest stereocilia opens the ion

+ channels located at the stereociliary tips; K and Ca+2 ions enter the cell rapidly,

depolarizing the cell. Deflection of the hair bundle in the opposite direction closes the

transduction channels, which permits hyperpolarization of the hair cell. The stereocilia

are made of parallel actin filaments that are closely packed in a paracrystalline array

(Tilney et al. 1992) and cross-linked by espin (Flock et al. 1982), fimbrin (Flock et al.

1982) and fascin 2b (Chou et al. 2011, Shin et al. 2010). Actin filaments from the

stereocilia descend into an actin meshwork present in the apical cytoplasm called the

cuticular plate. This plate is hypothesized to support the stereocilia, acting as a rigid

platform to increase the sensitivity of the hair bundle to small displacement forces

(Tilney et al. 1992).

Circumferential Belt: Parallel to the apico-lateral margin of the hair cells is a ring of actin filaments at the level of the intermediate junctions. The circumferential belt could play a role in maintaining apical hair cell surface stiffness.

Lateral plasma membrane: A region of plasma membrane that is characterized by the presence of numerous ion channels. The rapid depolarization of the hair cell due to entry of K+ ions through the transduction channels found on the stereocilia is balanced by the exit of K+ ions via outwardly rectifying K+ channels. Additionally, the lateral plasma membrane contains voltage-gated calcium channels that open during hair cell depolarization. The entry of Ca+2 ions through the lateral hair cell wall stimulates neurotransmitter synapse release onto the primary afferent nerve endings. (Eatock and

Rusch 1997).

Supporting Cells

Supporting cells show morphological specializations in the organ of Corti, but have no defining morphological specializations in the vestibular apparatus. The supporting cells (SCs) providing mechanical support to hair cells remove excess K+ ions from intercellular spaces present within the sensory epithelium to ensure low K+ ionic concentration around the hair cell (Forge and Wright 2002). Supporting cells lie on the extracellular matrix underlying the sensory epithelia and are coupled with each other.

They have bundles of filamentous actin which run parallel to the luminal-cell surface and are anchored to the adjacent hair cells at the adherens junction region (Forge and Wright

2002). Supporting cells are in contact with each other through numerous gap junctions

making them a single functional unit, whereas hair cells are functionally independent.

Gap junction subunits are made of members of the connexin protein family, primarily connexin 26 and connexin 30 (Kikuchi et al. 1995). Mutation of the gap junction beta 2 gene, which encodes CX26, is the main factor resulting in non-syndromic hereditary deafness (Kelsell et al. 1997).

1.1.2 Auditory System: Organ of Corti

Figure 2. A plastic cross-section of a rat’s cochlea. The organ of Corti is shown containing three rows of OHCs (1,2 ad 3) and one row of IHCs. Covering the sensory epithelia is the tectorial membrane. Image reprinted by permission from Brain Research Bulletin, Raphael and Altschuler, 2003. The organ of Corti (auditory apparatus) is constituted by polarized epithelial cells

(HCs and SCs), nerve endings, underlying basilar membrane and an overlying tectorial membrane. A systematic arrangement of three rows of outer hair cells (OHCs) and one row of inner hair cells (IHCs) is present along the cochlear spiral to form a gradient of

increasing stereociliary length from the inner to the outermost row (figure 2). OHCs show fast reversible length changes due to electrical induction by transduction currents

(Ashmore et al. 2002). This activity is responsible for sound amplification, which enhances cochlear sensitivity and frequency selectivity. This motile response is driven by prestin, a OHC specific motor protein (Oliver et al. 2001). The IHC functions primarily as a receptor cell. Supporting cells showing morphological specializations in the organ of

Corti are Deiter cells (DC), pillar cells, and Hensen’s cells. DCs are present between

OHCs having cell bodies that are in contact with each other and extend upwards such that they associate with the OHCs only at the apical surface of the junctional region. Pillar cells form the tunnel of Corti between OHCs and IHCs, while Hensens cells line the lateral wall of the organ of Corti (Raphael and Altschuler 2003). These supporting cells play a role in mechanical support and in motion of hair cells in response to sound stimuli

(Saha and Slepecky 2000).

Sound vibrations cause movement of the basilar membrane on which OHCs reside. This movement causes deflection of OHC hair bundles, which are coupled to the overlying tectorial membrane. Oscillation of the tectorial membrane causes a viscous fluid drag in the endolymph, which bathes the apical IHC region and in turn deflects the

IHC hair bundles, leading to subsequent mechanotransduction (figure 3) (Forge and

Wright 2002).

1.1.3 Mechanotransduction of Hair Cells

Figure 3. Mechanotransduction in hair cell stereocilia. (A) Schematic shows the opening of the mechanotransduction channel responding to the deflection of the hair bundles in the positive direction, and resulting in an inward current of calcium and potassium that depolarizes the hair cell. (B) Diagram shows the effect of mechanotransduction in a hair cell. Image source: Dr. Brian M. McDermott.

Mechanically-gated channels are located towards the tips of stereocilia. Tension

created due to deflection of the stereocilia causes the opening of a mechanotransduction

channel (Corey DP and Hudspeth 1983, Corey D. P. and Hudspeth 1979). This permits

entry of Ca+2 and K+ ions into the cell, from the unique endolymphatic fluid, rapidly

depolarizing it (Lumpkin E A and Hudspeth 1995) (figure 3A). Depolarization triggers

an influx of Ca+2 ions from the perilymphatic fluid into the basolateral hair cell surface

inducing the release of neurotransmitter. The Ca+2 ion influx required for

mechanotransduction must be rapidly expelled from the hair cell to prevent cell

cytotoxicity. The plasma membrane calcium-ATPase (PMCA) pumps (figure 3B)

perform this function (Crouch James J. and Schulte 1995, Gioglio et al. 1998). The

endolymph and perilymph having differential Ca+2 ion concentrations are sealed apart by

a permeability barrier formed at the apical surface of the sensory epithelium, the reticular lamina.

Part 2. Reticular Lamina

The hair cell membrane can be categorized into four regions: the apical surface, the apical part of the lateral membrane, the lateral membrane, and the basal membrane

(Souter 1995). The apical portion of the hair cell lateral membrane forms a barrier with the junctional region of the neighboring supporting; this is termed the reticular lamina

(figure 4). Disturbance to the reticular lamina would change the shape of the cell and subsequently affect its electrical and synaptic properties, leading to severe hearing loss

(Konishi and Kelsey 1973, Marcus et al. 1981). The reticular lamina is composed of tight junctions (TJs) and adherens junctions (AJs). TJs maintain the ionic barrier between endolymph and perilymph, preventing the leakage of solutions through paracellular pathways (Gulley and Reese 1976). The AJs connect actin filaments between the HC-SC network (Raphael 1994). This contact organizes the framework of the entire auditory epithelium, playing a central role in maintaining epithelial integrity (Gumbiner B. 1990).

Based on the distribution of adherens and tight junction proteins, the cellular organization of the reticular lamina can be divided into two horizontal layers (figure 4): a surface layer visualized by TJ proteins (figure 4A) and a deeper layer delineated by AJ

proteins (figure 4B). Lenova and Raphael (1997) have shown that these junctions are present between both homotypic and heterotypic junctions, that is between SCs and between HCs and SCs, respectively.

Figure 4. A schematic of the surface (A) and deep layers (B) of the reticular lamina showing the complex checker-board like three-dimensional arrangement of this region. (A) Each Deiter cell has a dumbbell shape, and each outer pillar cell has an oval shape. (B) The Deiter cells are wider in the deep layers than the surface layer. Outer pillar cells have a complex shape with three concavities. (C) A combined view of the surface and deep layers. (D) A schematic of a cross section of the reticular lamina demonstrates the position of the surface and deep layers in the reticular lamina. Light gray tone shows areas of overlap. Image reprinted by permission from Hearing Research, Leonova and Raphael 1997. Additionally, outer pillar cells overlap the surface border of Deiters cells at the level of their adherens junctions (figure 4D) to increase the contact area. This increase in contact area could play a vital role in the mechanical organization of the organ of Corti

(Leonova and Raphael 1997). The absence of desmosomes, patch-like junctions that

strengthen the tissue, in the apical contact region between OHCs-SCs, makes the entire intercellular mechanical attachment and support dependent on the AJs (Gulley and Reese

1976).

1.2.1 Molecular Components of TJs & AJs in the Reticular Lamina

Tight junctions (TJs) create hair cell polarity by separating the apical and basolateral domains (Tsukita et al. 2001). The TJs are constituted by several members of the claudin family together with occludin and zona occludin (ZO) family members

(Kitajiri et al. 2004). A defect in the claudin 14 gene causes a disturbance in the reticular lamina that is responsible for profound congenital deafness (Wilcox Edward R. et al.

2001b). It is possible that mutations in other TJ proteins could also cause deafness.

The homophilic and heterophilic interactions due to AJs between adjacent cells generate the structural framework for the entire cell sheet (Gumbiner Barry M. 2005). All proteins that constitute the AJs in the reticular lamina have not been characterized.

Cadherins constitute the major adhesive component of AJs and recruit p120ctn, cytoskeleton, α- and β-catenins to the plasma membrane at the level of the circumferential actin belt in hair cells (Gumbiner B et al. 1988).

1.2.2 Specialized Junctional Adaptations in OHC-DC Region of the

Reticular Lamina

Traditionally, TJs and AJs form distinct non-overlapping junctions called the adherens junctional complex (AJC) (figure 5A). In the AJC, the TJs comprise a claudin- rich contact between adjacent cells with an underlying ZO-1 scaffold. The AJs consist of a cadherin-rich transmembrane region with underlying catenin molecules. Additional features can be used to distinguish TJs vs. AJs. TJs have a smaller cytoplasmic plaque

than AJs, and the extracellular distance between apposing cells is smaller in TJs (Nunes et al. 2006).

Recent studies have shown the existence of canonical AJCs in the sensory epithelia of the mouse inner ear (Aijaz et al. 2006, Farquhar and Palade 1963, Jahnke

1975) with the exception of the junctional region between OHCs-DCs in the organ of

Corti (Nunes et al. 2006). Nunes et. al have characterized this region to have specialized hybrid junctions, the tight-adherens junction (TAJ) (figure 5B). The extreme physiology of the organ of Corti due to sound induced movement of the basilar membrane, electromotility of the OHCs, and movement of the overlying tectorial membrane must be withstood by the OHCs through the AJs at the apical junctional region (Ospeck et al.

2003, Wilcox E. R. et al. 2001a). To prevent AJ collapse, the AJC is modified to form the

TAJ complex that combines TJs and AJs into a single, hybrid junction, which provides strong mechanical support. The plasma membrane spacing is typical of TJs (small) and the cytoplasmic plaque distribution is typical of AJs (extensive). The apical most region of the TAJ is a claudin-14 rich subdomain of parallel TJ strands with an underlying ZO-1 scaffold assembling a small, actin cytoskeleton. A second domain rich in TJ proteins, claudin-9/6, and AJ proteins, cadherins, with an underlying ZO-1/catenin complex, assembles the dense cytoplasmic plaque that localizes exactly to the same domain region as AJs in the AJC (figure 5B). This novel TAJ junction is present only between the heterotypic OHC-DC junction and not the DC-DC contact in the reticular lamina (Nunes et al. 2006).

Figure 5. Morphology, sub-domain architecture, and molecular components of AJCs and TAJs. (A) AJCs form the canonical junctions where the TJs and AJs form non-overlapping regions of claudins and cadherins. (B) TAJs at DC-OHCs interface where the TJs and AJs form a unitary hybrid junction with overlapping regions of claudins and cadherins. Image reprinted by permission from Journal of Cell Science, Nunes et al., 2006.

1.2.3 Development of the Junctional Complex of the Reticular Lamina

Development of the inner ear begins during late gastrulation when a portion of the ectoderm shows competence to develop into the future otic region. In mice, the vestibular epithelium is fully functional at birth and cochlear maturation is complete at postnatal day 10 (P10). By P1 the hair bundles of IHCs are fully developed whereas the maturation of OHCs is complete by P7 (Anniko 1983). The tight and adherens junction area of the reticular lamina is recognizable at P2 with TJs and AJs maturing at different rates (figure 6) (Souter 1995).

Figure 6. Development of OHC apical junctional region. (A) Junctions are recognizable at the apical surface of the hair cell at P2. (B) The junctions increase in size by P6. (C) Cuticular plate (cp) extends almost to the junctions by P8. (D) The apical most regions (a) appear to be more tightly sealed than the basal most regions (b) by P10. (E) Junctions have a mature configuration by P16. Image reprinted by permission from Hearing Research, Souter, 1995.

Tight Junction Development

At P2, there is one complete and an additional incomplete strand at the apical junctional region (figure 6A). By P6, the endocochlear potential (EP) is first generated across the reticular lamina, paralleling maturation of the tight junction (figure 6B). This

timing is crucial to allow the EP to develop fully (Souter 1995). TJ development is also important for separating apical and lateral plasma membrane domains, establishing polarity in epithelial cells and allowing domain-specific targeting of proteins (Gumbiner

B. 1990). The maturation of TJs in hair cells parallels the expression profile of claudins, a

TJ specific protein (Ben-Yosef et al. 2003).

Adherens Junction Development

At P2, the AJ is made of strands extending about 40% of the mature junction

(figure 6A). From P10 (figure 6D), the AJ begins developing its mature configuration and reaches maturity by P16 as perpendicular strands branch out to form a complex network (figure 6E), performing its structural and stabilizing role of attaching HCs to surrounding SCs (Souter 1995).

Part 3. Model Organisms

16,000 hair cells in the mammalian cochlea in comparison to over 100 million photoreceptors in the eye make traditional biochemical approach for the identification of hair cell components challenging. This makes genetics a preferable approach in the study of hearing research. Mouse, chicken, and zebrafish are well suited to both forward and reverse genetics, and their use as models for human deafness is based on identification and cloning of hair cell components that are crucial for hair cell function.

1.3.1 Mouse as a Model Organism

Mice are advantageous in the field of hearing research. Being a mammal, its auditory and vestibular systems are remarkably similar to that of humans. There are several methods of identifying deaf mice, including analyses of the auditory brainstem response, distortion-product otoacoustic emissions, head bobbing, or circular phenotypes.

Complications due to variable genetic backgrounds can be avoided with the availability of inbred strains making this model favorable.

1.3.2 Chicken as a Model Organism

Possessing a different morphology but nearly identical physiology, the basilar papilla (BP), the chicken equivalent of a mammalian cochlea is easily accessible, making this animal an excellent model for hearing research. For over 20 years, this model has gained interest due to the chicks capacity to functionally replace damaged hair cells, an ability the mammalian organ of Corti lacks. The chicken basilar papilla (BP) contain around 10,500 hair cells (Saunders 2010). Most importantly the avian cochlea has a large number of cells, more than 50 hair cells in a single cross section, when compared to four in mammals.

Chicken Cochlea (Basilar Papilla)

The avian cochlear duct (figure 7A) consists of the basilar papilla (BP), the auditory apparatus, and the lagenar macula, the vestibular apparatus (Manley et al. 1991).

The overall structure of the avian auditory system (figure 7B) is similar to that of the mammalian auditory system, with an endolymphatic tube (cochlear duct or scala media) restricted by perilympatic spaces of scala vestibuli and scala tympani (Manley 1990). The

hair bundles in the sensory epithelia are firmly bound to the overlying tectorial membrane

(figure 7C).

Figure 7. Models representing organization of the chick inner ear (Manley 1990). (A) Chick inner ear with the auditory apparatus the basilar papilla (BP) and the vestibular apparatus, lagenar macula (L) and sacculus (S). (B) Transverse section of the chick inner ear (arrow from A). Images reprinted by permission from Springer, Manley, 1990. (C) The sensory epithelium resting on the basilar membrane (BM) with the tectorial membrane (TM) lying above the hair bundles. Short hair cells (S) are located near the inferior margin (inf) and those located near the superior margin (sup) are the tall hair cells (T). Image reprinted by permission from Journal of Cell Biology, Tilney and Saunders, 1983. (D) Shape of hair for different positions along and across the BP. Image reprinted by permission from Springer, Manley, 1990.

The side of the papilla where the underlying basilar membrane contains the cochlear ganglion with afferent nerve fibers is the neural side and the other side is the abneural side (figure 7D) (Runhaar 1989). The HC shape systematically changes along and across the BP with a reduction in HC height both towards the base and across towards the abneural end. Hair cells at the abneural basal end of the BP do not have afferent nerve fibers and are termed short hair cells (SHCs) whilst hair cells at the neural end have afferent nerve endings and are tall hair cells (THCs). THCs and SHCs represent

extreme forms. Additional hair cells are considered ‘intermediate’ based on their location in the papillae (figure 7D) across the epithelium (Fischer 1994).

1.3.3 Zebrafish as a Model Organism

Figure 8. A schematic diagram of the zebrafish acousticolateralis system. (A) The zebrafish showing the ear (pink) and lateral line. The neuromasts (orange dots) of the lateral line systems surround the eye, ear and are present along the length of the body. (B) Organization of the neuromast organ containing hair cells (orange), supporting cells (blue) and neurons (purple). The cupula (pink) is exposed to the exterior environment. (C) The ear of a zebrafish containing cristae (green), maculae (light blue) with the red box representing the anterior macula, and otolith (gray). (D) Organization of the anterior macula with hair cells (orange) and supporting cells (blue). Image source: Dr. Brian M. McDermott. Zebrafish (Danio rerio) are rapidly becoming a widely used model system to study hair cells. The significant advantages of this model over chicken and mouse are the number of embryos produced during fertilization, optical transparency of embryos, rapid development, and genes known to cause deafness are conserved from human to zebrafish.

The zebrafish inner ear, with semicircular canals and sensory patches (figure 8 A, C), is morphologically similar to the mammalian ear despite the lack of outer and middle ears.

Sensory patches contain hair cells and supporting cells (Figure 8D). In addition to sensory patches, neuromasts of the anterior and posterior lateral line systems have hair

cells (figure 8A), which are involved in detection of water movement. These hair cells are directly exposed to the environment making them easier to manipulate. Hearing and balance defects can be easily detected in zebrafish through swimming behaviors.

Part 4. PISP (plasma membrane calcium ATPase-interacting single-PDZ protein) Structure and Function

PISP is a ubiquitously expressed single PDZ domain protein that was identified in two independent studies (Goellner et al. 2003, Stephenson et al. 2005). In both studies,

PISP was identified in human brain cDNA libraries in yeast two hybrid screens using b- splice forms of plasma membrane calcium ATPase pumps (PMCAs) (Goellner et al.

2003), involved in maintenance of calcium homeostasis, and copper ATPase ATP7A, involved in copper homeostasis (Stephenson et al. 2005). PISP is highly conserved in mammals with human and mouse showing 97% amino acid sequence similarity, suggesting a conserved function. It is a small 140 amino acid protein with a calculated mass of 16,131 Da. This protein is abundant in kidney and liver with ubiquitous expression in lung, brain, testes, ovary, heart, and spleen (Goellner et al. 2003).

PISP has short N- and C-terminal extensions with a putative class 1 PDZ binding motif (X (S/T) X, that is expected for a PDZ domain binding the C-terminal ETSL/V

sequence of PMCAs. The PDZ domain itself shows highest similarity (40-45% identity) to the single PDZ domain of C. elegans Lin-7 and its mammalian homologues, as well as to PDZ domains of several members of the MAGUK family (Goellner et al. 2003). The ubiquitous expression of PISP is consistent with ubiquitous expression of both ATP7A

(Stephenson et al. 2005) and PMCAs (Goellner et al. 2003). PISP could be involved in targeting of PMCAs and stabilization of ATP7A at the basolateral surface (Goellner et al.

2003, Stephenson et al. 2005). Based on its interaction with two different ATPases, it is likely that PISP has multiple roles in the cell and could interact with a range of other proteins to mediate transport, targeting, or retention of its interacting partners

(Stephenson et al. 2005). Functions of class 1 PDZ domain proteins include clustering and localizing membrane proteins to specific subcellular domains, assembly of supramolecular complexes by creating scaffolds, serving as adaptor proteins that link transmembrane receptors and channels, asymmetric cell division, polarized cell growth, formation and regulation of tight and adherens junctions at epithelial cell-cell contact

(Nourry et al. 2003).

1.4.1 PMCAs and Hair Cells

PMCAs expel Ca+2 ions from the hair cell following mechanotransduction

(Lumpkin Ellen A. et al. 1997, Ricci et al. 1998, Yamoah et al. 1998). If this function were not performed, the cell would die because of the prolonged presence of Ca+2 ions in the cytosol. In the mammalian cochlea, all isoforms and splice variants of PMCAs are expressed (Crouch James J. and Schulte 1995). There are four PMCA isoforms encoded by different genes (PMCA 1-4) that have additional diversity due to alternative splicing of mRNA. The major products of this alternative splicing are a and b forms which differ

in their carboxyl terminus (Keeton et al. 1993). The functional significance of multiple

PMCA genes remains unknown except for PMCA2, a known deafness gene, required for hearing and balance (Kozel et al. 1998, Takahashi and Kitamura 1999). PMCA isozymes are targeted exclusively to the apical or basolateral domain of hair cells (Dumont et al.

2001). Dumont et. al. (2001) showed that b-splice forms of the pump have strong basolateral expression in hair cells and supporting cells. b-splice forms of all PMCAs contain the same carboxyl terminal sequence -ETSL* or –ETSV*, which fits the broad consensus sequence for class I PDZ ligands (Strehler and Zacharias 2001). How these isozymes are differentially targeted to the apical and basolateral compartment is not fully understood.

Our research group’s microarray analysis of the zebrafish hair cell transcriptome identified the presence of PISP gene in hair cells (McDermott et al., 2007). PISP interacts with all b-splice forms of PMCAs. As PMCAs are highly expressed in sensory hair cells with PMCA2 being a known deafness gene, this project was developed to verify and characterize PISP expression in the inner ear sensory epithelium.

Chapter 2

Materials and Methods

2.1 Reverse Transcription - Polymerase Chain Reaction (RT-

PCR)

To identify the zebrafish pisp gene, human PISP (ENSG00000120509) identified by Goellner et. al (2003) was used as a template in blastn on the Basic Local Alignment

Search Tool (BLAST®) website. This resulted in identification of the corresponding zebrafish pisp (ENSDARG00000053194) on chromosome 14. Polymerase chain reaction

(PCR) experiments were performed to isolate the entire PISP cDNA from zebrafish maculae and hair cell cDNA, with whole fish cDNA as a positive control (primers listed in table 1. PCR conditions were modified from the protocol of ExTaq polymerase

(TaKaRa): 94ºC, 1 minute (min); 94ºC, 30 sec; 65ºC (PISP), 1 min; 72ºC, 1 min; 40 cycles (steps 2-4), and a final extension for 1 min at 72ºC. Sequencing was performed on the resulting PCR product or the cloned PCR product.

Table 1. Primer sets for verification of pisp in zebrafish Name Sequence 5’→ 3’ 5’ PDZD11 ATGGACCAGAAGATTCCGTATGAT 3’ PDZD11 CTAGTGGACAGTCCTCTCCTTCT

2.2 Protein Immunoblotting

Liver, kidney, lung, and inner ear tissues from adult mice were dissected, and homogenized in lysis buffer (400mM NaCl, 20mM Tris pH8.0, 20% v/v glycerol, 2mM

DTT, 1% protease inhibitor cocktail) by sonication and quantified using a Nanodrop. 100

µg of protein was diluted in Laemmli buffer (Bio-Rad) and boiled for 10 min. The samples were run on a 4–20% precast linear gradient polyacrylamide gel (Bio-Rad) and transferred onto a poly-vinylidine difluoride (PVDF) membrane (Bio-Rad) for 1 hour at room temperature using a semi-dry electrophoretic transfer cell (15 V; Bio-Rad). ECL

Plex Fluorescent Rainbow marker (GE Healthcare) was used as a molecular weight marker. For blocking, the membrane was saturated with 3% non-fat milk/TBST (20 mM

Tris/HCl, 500 mM NaCl, 0.05% Tween20, 0.2% Triton-X-100) for 1 hour at room temperature (RT) and then incubated with primary polyclonal rabbit anti-PISP antibody

(1:500 in 3% non-fat milt/ TBST) and primary monoclonal mouse anti-actin antibody

(1:200 in 3% non-fat milk/ TBST) at 4ºC overnight. Detection was done using HRP- conjugated goat anti-rabbit and goat anti-mouse antibodies and enhanced chemiluminescence (Amersham Corp.). Between all steps, the membrane was washed with TBST (20 mM Tris/HCl, 500 mM NaCl, 0.05% Tween20, 0.2% Triton-X-100).

2.3. Immunocytochemistry

The inner ear was collected from adult mice and auditory organs were dissected in

1× phosphate buffered saline (PBS). The inner ear sensory epithelia were dissected from the chick. Tissues were fixed in 4% paraformaldehyde (PFA) for 30 min and washed three times for 5 min in 1×PBS. Tissues were permeabilized in 3% triton for 15 min followed by blocking in 20% goat serum (GS) containing 3% triton for 1 hour at RT.

They were then incubated with relevant primary antibodies (table 2) overnight at 4ºC followed by three 5 min washes in 1×PBS the next day. The tissue were then incubated for 2 hours with Alexa phalloidin and corresponding Alexa Fluor conjugated secondary antibody (table 3) at RT and again rinsed. Labeled tissues were mounted directly in

fluorescence mounting medium (Vector Laboratories) and imaged on a confocal microscope.

Table 2. List of primary antibodies used in this study

Antibody Source Dilution Reference

PISP Rabbit 1:300 Goellner et al., 2003 ZO-1 Mouse IgG1 1:200 Invitrogen (339100)

Chick N-Cadherin (6B3) Mouse IgG1 1:50 Developmental Studies Hybridoma Bank

Table 3. List of secondary antibodies used Alexa Fluor® 488 goat anti-rabbit IgG (H+L) Alexa Fluor® 546 rabbit anti-mouse IgG (H+L) Alexa Fluor® 568 phalloidin Alexa Fluor® 633 phalloidin

2.4 Whole Mount Zebrafish Staining

Fish embryos were collected at 3 or 4 days post fertilization (dpf) and fixed with

4% PFA overnight at 4ºC. The embryos were washed 3 times for 10 min each in 1× PBS and permeabilized overnight at 4ºC with 3% triton. Samples were blocked in 5% GS for 6 hours at RT and incubated overnight at 4ºC with relevant primary antibody. Embryos were then rinsed with 5% GS once for 5 min and then again for 30 min. Corresponding

Alexa Fluor conjugated secondary antibodies and Alexa phalloidin was added and samples incubated at 4ºC overnight. Following two 1 hour washes in 5% GS, stained embryos were mounted in fluorescence mounting media (Vectashield Laboratories) and stored at 4ºC in the dark until imaged.

2.5 Interaction of Pisp and Pmca2b using the Yeast Two-

Hybrid System

Preparation of plasmid vectors and transformation of yeast by electroporation: To generate bait and prey plasmids, pGBKT7: pmca2b and pACT2: pisp, PCR was used to amplify full-length pisp and the carboxyl tail of pmca2b with the primer sets listed in table 4. The products of these reactions were separately cloned into pCRII-Topo

(Invitrogen) and subcloned into the final vectors pGBKT7 and pACT2 to generate cDNAs that encode in-frame fusion proteins with DNA-binding domains (BD) or activating domains (AD) according to the manufacturer’s protocol (Clontech). All constructs were confirmed by DNA sequencing. Yeast cultures, AH109 (MATα) and

Y187 (MATα) (Clontech) were grown and used as hosts in the two-hybrid assay (a kind gift from Dr. Mark Parker, Boron Lab, Case Western Reserve University). The yeast was cultured in 50 ml of yeast peptone dextrose agar (YPD) overnight until the expansion culture was in log-phase growth (OD600 between 0.4 and 0.6). Cells were spun at 3000 rpm for 5 min and resuspended in ice-cold sorbitol to osmostabilize the cells. To integrate plasmids into the yeast genome, 40 µl of suspended cells was mixed with 2 µl of plasmid and transferred into a pre-chilled 0.2 cm cuvette, pulse charged at 1.5 kV (pulse time of 5 ms), and immediately suspended in 500 µl of sorbitol. Electroporated pGBKT7: Y187 and pACT2: AH109 cells were plated on synthetically defined yeast medium SD/ -Leu and SD/-Trp plates, respectively, and incubated at 30ºC for 3-4 days until colonies appeared. Yeast cells transformed with pGBKT7-P53 (murine p53 fused to GAL4 DNA

BD) and pGADT7-T Ag (SV40 large T-antigen fused to GAL4 DNA AD), which had previously been reported to interact in a yeast two-hybrid assay (Li and Fields 1993),

were used as positive controls in these experiments. Empty bait and prey vectors were used as negative controls.

Table 4. List of primers used in the yeast two-hybrid screen

Name Sequence 5’→3’ 5’ PDZD11 (act2) ATGGACCAGAAGATTCCGTATGA T 3’ PDZD11 (act2) CTAGTGGACAGTCCTCTCCTTCT 5‘ PMCA2b (kt7) GAGTTCAGAATAGAGGACTCCAC A 3’ PMCA2b (kt7) CTAAAGCGATGTCTCCAGACTAT G

Mating of transformed yeast cells: AH109 and Y187 transformed cells were mixed and placed on a shaker overnight at 30ºC in 2×YPD media. Experimental samples were mated with each other and with negative controls to test the reliability of the mating process.

The following day the samples were plated onto selective media (SD /-Leu/-Trp and SD

/-Leu-/-Trp/-Arg/-His) for 3-4 days until colonies appeared.

Plate Assay using X-gal in the medium: Colonies from the co-transformed plates were picked and grown overnight in SD/-Leu/-Trp medium. The cell density was optimized to

OD600 of 0.1 and then plated onto SD agar plates containing X-gal (80 mg/L). The plates were checked every 12 hours up to 96 hours for development of a blue color.

α-Gal quantitative assay: To determine the strength of protein-protein interactions, α-galactosidase solution assays were conducted to identify and measure catalytic activity using p-nitrophenyl-α-d-galactoside (PNP-α-Gal), a colorless compound that yields a yellow product (p-nitrophenol) upon hydrolysis. Mated colonies were grown in SD/-Leu/-Trp selective media for approximately 16 hours at 30ºC with intensive shaking until cells reached OD600 between 0.5-1.0. For each experiment, three colonies

were picked from each set of co-transformants, and positive and negative controls were included. When cells reached an optimal density, they were harvested, washed, and resuspended in 48 µl of assay buffer (2:1 of sodium acetate: 100 mM PNP α-gal) and incubated at 30ºC for 1 hour. The reaction was then stopped by adding 136 µl of stop solution (1 M sodium carbonate) and optical density measured at 410 nm. Protein-protein interaction was expressed as α-galactosidase units per minute. Specific enzyme activity was determined using the following formula:

α-galactosidase [milliunits/(ml × cell)] = OD410 x Vf × 1,000/[(ε × b) × t × Vi ×

OD600]

Where, t = elapsed time (in min) of incubation; Vf = final volume of assay (200 µl); Vi = volume of culture medium supernatant added (16 µl); OD600 = optical density of overnight culture; and ε × b =16.9 (ml/µmol) for 1 ml format; OD420 = optical density of the samples relative to the blank.

2.6 Expression and Purification of Polyhistidine-Tagged PISP

Protein

pET15b: PISP (human) plasmid was constructed with the recombinant protein fused to a 6xHis-tag at its amino terminus. Human PISP fragment was subcloned from the pCMV Tag2: PISP vector (a gift from Dr. Strehler). Insert-containing plasmid was purified from E.coli DH5α competent cells and transformed into BL21 (DE3) cells. For preliminary screening, three colonies were selected to determine their efficiency in inducing expression of recombinant protein in the presence of 3 mM isopropyl β-d-1- thiogalactopyranoside (IPTG). After 3-4 hours of induction, cells were spun down and solubilized in 2×Laemmli sample buffer and protein separation was carried out on a 15%

acrylamide gel infused with SDS. After positive clones were identified, bacteria were stored in glycerol medium at -80ºC.

Recombinant proteins fused to a 6xHis-tag were purified by affinity chromatography using nickel-chelating beads (Qiagen). Briefly, E.coli BL21 (DE3) cells were harvested by centrifugation at 5000 × g for 20 min. Cells were resuspended in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 5mM immidazole), sonicated, centrifuged at

10,000 rpm for 30 min at 4ºC and the supernatant saved. To 1 ml of the supernatant, 200

µl of Ni-NTA beads was added and incubated on an end-over-end rotator at 4ºC for 1 hour. The beads were rinsed thrice using wash buffer (50 mM NaH2PO4, 300 mM NaCl,

20 mM immidazole) and bound recombinant protein was eluted with the same solution as the wash step, but containing 250 mM immidazole. Human PISP-fusion protein was dialyzed in a Slide-A-Lyzer cassette (Thermo Scientific) against 1×PBS and the purified protein was stored at -80ºC.

An antigen-blocking assay was performed to confirm antibody specificity. PISP antibody was pre-incubated with five times the concentration of purified PISP protein or binding buffer 1×PBS (as control) for 3 hours at 4ºC. Immunohistochemistry was carried out following the same procedure as described above.

2.7 Over-Expression of Pisp in Zebrafish

N-terminal and C-terminal fusion constructs pv3b: pisp-mCherry or pvalb3b: mCherry-pisp were made for conducting over-expression studies in zebrafish. pisp fragments were amplified using PCR from pET15b: pisp with primer sets listed in table 5 and cloned into a dual promoter TA cloning vector (Invitrogen). DNA fragments digested from the TA cloning vectors were ligated into Xma1 and Pac1 or Xcm1 and Asc1 sites of

pMT/PV/SV vector containing zebrafish the parvalbumin 3b promoter, which drives

expression in hair cells (Heller et al. 2002, McDermott et al. 2010), within the miniTol2

transposon system (Balciunas et al. 2006). Fish transposon, Tol2, is a nonviral cargo for

delivering foreign DNA fragments into the Danio rerio genome (Balciunas et al. 2006).

To increase the efficiency of the Minitol vector system, Tol2 transransposase RNA (25

ng/ µl) was co-injected with the vector (250 ng/ µl) into the embryos at the one-cell stage

to drive Pisp expression specifically in hair cells. To visually monitor injections, phenol

red was added to each injection solution to make the final concentration of the tracer

0.05%. Zebrafish injected with plasmid DNA exhibiting transgene expression in hair

cells, were screened using a Leica fluorescence stereomicroscope at 4 dpf. Embryos

successfully expressing reporter gene mCherry were fixed in 4% PFA in 1× PBS at 4°C

overnight. Immunolabeling to identify hair bundles using phalloidin was done following

the same procedure as in whole mount staining.

Table 5. Primers for generating pisp-mCherry or mCherry-pisp DNA constructs Name Sequence 5'-->3' 3’ PISP-mCherry CAGTTAATTAAGTGGACAGTCCTCTCCTTCTG 5’ PISP-mCherry CATGCCCGGGCCATGGACCAGAAGATTCCGTATG 3‘mCherry-PISP CATGGGCGCGCCCTAGTGGACAGTCCTCTCCTTC

CATGCCACCGGCGGCATGGACGAGCTGTACAAGATGG 5’ mCherry-PISP ACCAGAAGATTCCGTATGAT

Chapter 3 Results 3.1 PISP is Expressed in the Inner Ear of Mouse and Zebrafish

In 2003, a yeast two-

hybrid study conducted by Goellner et. al, (2003), identified a novel single PDZ domain protein PISP, using the carboxyl tail of PMCA2b. Since

PMCA2 is a known deafness gene, we searched the zebrafish hair cell transcriptome (McDermott et al. 2007) for expression of PISP. The pisp gene was found in the dataset and we decided to characterize this protein in hair cells. To verify the presence of pisp mRNA in zebrafish hair cells, reverse transcription-polymerase chain reactions (RT-PCR) were performed using cDNA produced exclusively from adult zebrafish hair cell RNA as template. The oligonucleotide primers for these reactions were interexonic and designed to amplify zebrafish cDNA sequences (table 1), not genomic

DNA of pisp. These amplification experiments readily produced product from macula and hair cell cDNA (figure 9A), indicating, that, pisp mRNA are present within adult zebrafish maculae and hair cells. DNA products of the amplifications were sequenced, confirming the identity of pisp mRNA (data not shown).

Bioinformatics analysis revealed that PISP is highly conserved among all vertebrates. Human and mouse orthologous proteins are 97% identical. Human and zebrafish orthologous proteins are 89.5% identical, and human and chick orthologous

proteins are 89.3% identical (figure 10). Since the human polyclonal PISP antibody obtained from Dr. Stehler did not recognize zebrafish Pisp in vivo (see below), protein expression of PISP was tested in the mouse model. Using the affinity purified anti-PISP antibody, a single band of approximately 17 kDa was detected in the inner ear, liver and kidney of adult mice. Anti-α-Actin, used as a control, was detected in the predicted 42 kDa region (figure 9B). A

Figure 9. mRNA and protein expression of PISP in zebrafish and mouse. (A) RT-PCR amplified pisp cDNA from adult zebrafish macula and hair cells analyzed on a 1% agarose gel. Whole fish RNA was used as a positive control. The PCR product for pisp cDNA was 450 bp. The negative controls, which did not contain the template, did not have any cDNA amplification. (B) Expression of PISP in adult mouse tissues. Multiple mouse tissues were probed with the affinity purified polyclonal antibody against PISP and α-actin (42 kDa) as control by western blot. The position of the molecular mass standards is on the left, tissues are

identified at the bottom of each lane. An approximately 17-kDa band corresponding to the predicted size of PISP (left blot) is present in all tissues.

Figure 10. Amino acid sequence alignment of human (PISP H. sapiens), mouse (PISP M. musculus), chick (PISP G. gallus) and zebrafish PISP (PISP D. rerio). Sequence identity is boxed. Residues are numbered above each line. The PDZ domain is indicated by a red line.

3.2 Zebrafish Pisp and Pmca2b Interact in vitro

Since previously published data showed PISP interaction with the carboxyl tail of

PMCA2b using a human brain cDNA library, we decided to test whether the zebrafish orthologs interact in vitro using the yeast two-hybrid system. Diploid yeast transformed

with plasmids encoding zebrafish pisp cDNA and pmca2b cDNA were able to propagate on selective media indicating an interaction between them. Positive controls, having yeast co-transformed with p53 and SV40 large T-antigen grew vigorously, whilst negative controls did not propagate on the selective media validating the yeast two-hybrid set-up.

A second indicator of positive protein interaction between Pisp and Pmca2b was tested, namely β-galactosidase-driven blue-color colony formation. Mating pairs of PISP:

PMCA2b (PISP*PMCA2b, figure 11A) and p53:SV40 (positive*positive, figure 11A) gave blue color colonies indicating positive protein interaction. As expected, negative controls did not give blue color colonies (negative*negative, negative*PMCA2b, and

PISP*negative, figure 11A). Additionally, the extent of protein interaction in mated yeast was quantified using a β-galactosidase assay (figure 11C). The interaction between PISP and PMCA2b was greater when compared to negative controls. The interaction between positive controls was very strong (data not shown). These results were confirmed by switching the bait and the prey plasmids (figure 11 B, C).

Figure 11. Zebrafish Pisp interacts with the carboxyl tail of Pmca2b in vitro. (A, B) Colonies from co- transformed plates were picked and grown overnight in SD/-Leu/-Trp medium. The cell density was optimized to OD600 of 0.1 (S) or with a further dilution factor of 100 (1/100) and then plated onto SD agar plates containing X-gal (80 mg/L). Yeast cells transformed with pGBKT7-P53 and pGADT7-T were used as a positive control (Pos*Pos). Empty bait and prey vectors were used as negative controls (Neg*Neg). (A) GAL4BD-Pmca2b and GAL4AD-Pisp gave blue color colonies, negative controls did not give any blue color colonies. (B) GAL4BD-Pisp and GAL4AD-Pmca2b gave blue color colonies, negative controls did not give any blue colonies. (C) Quantification of Pisp-Pmca2b interaction using the ß-galactosidase assay.

3.3 Over-Expression Pattern of PISP in Hair Cells of Zebrafish

As PISP mRNA expression was seen in zebrafish macula and hair cells (figure

9A) and Pisp showed strong interaction with Pmca2b in vitro (figure 11), we wished to test the in vivo interaction of Pisp and Pmca2b in zebrafish hair cells by studying the immunolocalization pattern of the two antibodies. However, the PISP antibody did not detect Pisp protein in zebrafish hair cells (figure 12A). This was surprising as PISP is conserved from humans to zebrafish (figure 10). To overcome this problem and label zebrafish hair cells with Pisp, we designed a construct driven by a hair cell specific promoter to specifically over-express Pisp in zebrafish hair cells (figure 12 B, C).

Figure 12. Expression of Pisp in zebrafish hair cells. (A) PISP antibody (green) did not show any specific localization pattern in the anterior macula of 4-dpf zebrafish using indirect immunofluorescence. In red, fluorophore-coupled phalloidin labels F-actin of stereocilia and indicates positions of hair cell soma. (B, C)

A zebrafish over-expressing the PISP fusion protein (red), in a stable transgenic zebrafish that has GFP expressed in its hair cells (green), is displayed. (B) PISP-mCherry expression in a neuromast showed a random pattern of distribution. (C) mCherry-PISP expression pattern showed strong localization towards the apico-lateral surface and some scattered puncta throughout the cytosol in hair cells of the posterior macula. The embryos of Ppv3b-4 transgenic line, with GFP labeled hair cells (McDermott et al., 2010), were injected with pv3b: pisp-mCherry construct, which encodes a fusion protein with Pisp at the N-terminus of mCherry fluorescent protein. The use of GFP labeled hair cells allowed ease in identification of hair cells during imaging. These doubly transgenic fish were able to respond to agitation and showed regular swimming behavior, showing the lack of hearing or balance dysfunctions as a result of Pisp fusion protein expression (data not shown). Hair cells of 4 dpf larvae that expressed Pisp- mCherry were imaged using confocal laser-scanning microscopy. The fusion protein did not show a specific localization pattern. Cells that expressed the fusion proteins showed random, often punctate protein expression within GFP-labeled hair cells or around it

(figure 12B). To circumvent the problem of improper folding of the fusion protein, mCherry-Pisp construct that encodes a fusion protein at the C-terminal of mCherry fluorescent protein was made and subsequently injected into the Ppv3b-4 transgenic line.

Hair cells expressed this fusion protein towards the apico-lateral membrane and some scattered puncta throughout the cytosol in hair cells (figure 12C).

3.4 PISP Protein Localizes Towards the Apical Portion of the

Mouse and Chicken Sensory Epithelium

Since the PISP antibody did not recognize zebrafish Pisp in vivo (figure 12A), we decided to take advantage of the highly conserved homology of the protein from human to mouse, chicken and zebrafish. Mouse and chick sensory epithelium were immunolabeled with anti-PISP antibody and its localization determined. Two views were used to study the localization of the protein. (1) A transverse view showing the plane of the apical portion of the sensory epithelium compromising the cell-cell junctional contact region where mechanosensory hair cells are interdigitated with various supporting cells

(figure 13F) (2) a longitudinal view (figure 13A) showing hair cell bundle and lateral plasma membrane wall.

In the transverse view (figure 13F) F-actin labeling revealed the hair cell bundles and PISP labeling revealed the apical cell-cell contact region of the sensory epithelium.

PISP was distributed at the homotypic and heterotypic cell-cell contact boundaries between SC-SC or HC-SC respectively (figure 13 C, D, E). There was no PISP localization in hair bundles (figure 13 B, C, D, E).

Figure 13. Expression of PISP in the inner ear sensory epithelium. Double labeling of the tissue with anti- PISP antibody (green) and phalloidin (red) to visualize hair bundle and apical portion of the inner ear sensory epithelium. (A) A schematic of a longitudinal section of the hair cell. (B-D) Immunolocalization of PISP in the chicken sensory epithelium. (B) Longitudinal view of a single hair cell showing that PISP is localized towards the apico-lateral portion of its plasma membrane. (C, D) Transverse section through the sensory epithelium showing PISP localization at cell-cell contacts between both HC-SC and SC-SC in chicken. (E) Immunolocalization of PISP in the adult mouse sensory epithelium. PISP localizes to the cell- cell contact region in the reticular lamina between HC-SC and SC-SC in the mouse organ of Corti. (F) A schematic (Burns et al. 2008) of a transverse section through the sensory epithelium of the chicken made up of HCs (white) and SCs (grey) that have the usual intercellular junctions at the apical surface where green labels F-actin at the cell-cell contact between HC-SC and SC-SC. To confirm the apico-lateral localization of the protein in the sensory epithelium, a longitudinal view of the hair cells was required to visualize the apical part of their lateral plasma membrane. The ease of viewing the lateral surface of hair cells in chicken whole-mount samples made them the logical choice as the animal model for this experiment. The longitudinal view of chick hair cells (figure 13B) confirmed the pattern observed in the transverse view, where PISP localized towards the apico-lateral portion of the HC plasma membrane (figure 13B).

3.5 Characterization of the Human Polyclonal Antibody

Against PISP

Figure 14. Specificity of PISP antibody. Double labeling of tissue with PISP (green) with phalloidin (red) to visualize the hair bundle and apical portion of the chicken inner ear sensory epithelium. (A) A schematic of a longitudinal section of the hair cell. (B-D) Immunolocalization pattern in dissociated chicken hair cells following antigen-blocking assay. (B) Hair cells showing PISP localization towards the apico-lateral portion of its plasma membrane. (C) No specific staining was observed along the hair cell plasma membrane when PISP was pre-incubated with a 5-fold excess of PISP protein. (D) Rabbit IgG control antibody did not show any immunolocalization in the tissue. (E) A schematic of a transverse section through the inner ear sensory epithelium (Burns et al. 2008). (F-H) Immunolocalization pattern towards the apical portion of the chicken inner ear sensory epithelium following antigen-blocking assay. (F) Transverse section showing PISP localization at the apical cell-cell contact region of the sensory epithelium at both HC-SC and SC-SC regions of contact. (G) No specific staining observed along the hair cell plasma membrane when PISP was pre-incubated with a 5-fold excess of protein. (H) Rabbit IgG control antibody.

As the localization pattern of PISP had not been studied previously, the antigen- blocking assay was performed to ensure that the anti-PISP antibody was recognizing

PISP protein alone and not any other protein in the sensory epithelium. Antigen blocking followed by subsequent immunohistochemistry showed no specific staining along the chicken hair cell plasma membrane (figure 14C) or the apical cell-cell contact region of

the chicken sensory epithelium (figure 14G) when PISP was pre-incubated with 5-fold excess of protein. Pre-incubation of the antibody with the binding buffer, 1× PBS as a positive control showed the expected staining of PISP along the HC-SC and SC-SC region of the chick sensory epithelium (figure 14F) and towards the apico-lateral portion of the hair cell plasma membrane (figure 14A) as predicted. No specific staining was observed in the rabbit IgG control experiment (figure 14 D, H), confirming the specificity of the rabbit polyclonal anti-PISP antibody against PISP protein in vivo.

3.6 PISP is a Junctional Protein Candidate in Chicken Sensory

Epithelium

Immunofluorescence analysis of mouse and chicken sensory epithelium showed the presence of PISP in the apical portion of the sensory epithelia: the bulk of the immunoreactivity was present at all cell-cell contacts (figure 13D). The cell-cell contact regions of the sensory epithelium are compromised by tight and adherens junctions. This led us to study in more detail the localization of PISP with respect to these junctions.

Figure 15. Double labeling of anti-PISP with anti-ZO-1 and anti-N-cadherin antibodies. (A-D) PISP shows partial co-localization with ZO-1 where hair bundles are labeled with phalloidin. (E-H) PISP shows the same pattern of expression as N-cadherin where hair bundles are labeled with phalloidin. To visualize the junctional region at the apico-lateral surface of the hair cells, a longitudinal view was required. The ease of viewing the lateral hair cell plasma membrane in chick whole-mount samples made them the logical choice as the animal model for this experiment. To locate tight junctions, whole mount samples were labeled with antibodies against ZO-1. Double immunolabeling with PISP showed partial co- localization with ZO-1 in chicken hair cells (figure 15 A-D). The AJs are present below the TJs. As PISP localization extended below that of TJ marker, ZO-1, the hair cells were co-labeled with adherens junction marker, N-cadherin. The double-immunolabeling experiments showed co-localization of PISP and N-cadherin (figure 15 E-H). These results provide preliminary evidence to identify PISP as a new junctional protein.

However, further testing using additional tight and adherens junction markers such as claudins, nectins, vezatin, catenins with subsequent immunogold labeling would be required to confirm this novel localization pattern of localization of PISP.

Chapter 4

Discussion

“The role of junctions between hair cells and their supporting cells in the auditory epithelium resilience to sound trauma is often overlooked” - (Bahloul et al. 2009)

The above statement summarizes the importance of this study. We have identified a new component of the apical surface of the inner ear sensory epithelium and a likely adherens junction protein candidate. Previously PISP was identified as a ubiquitously expressed protein in humans with localization throughout the cytosol and at the lateral membrane in cultured madin-darby canine kidney (MDCK) epithelial cells (Goellner et al. 2003). However, no information was available on the localization and distribution of

PISP in tissues, in general, or within the inner ear sensory epithelia, more specifically.

This study, for the first time, characterizes the expression and localization profile of PISP in the inner ear sensory epithelia of mammalian and avian animal models.

4.1 PISP is a Single PDZ Domain-Containing Protein

Conserved Between Mouse, Chicken, and Zebrafish

The PISP gene encodes a small 140 amino acid protein consisting of a single

PDZ domain (residues 45–126) with short N- and C-terminal extensions (Goellner et al.

2003, Stephenson et al. 2005). PISP is highly conserved (figure 10) across vertebrates, with mouse and human orthologous proteins being 97% identical, human and zebrafish orthologous proteins being 89.5% identical, and, human and chick orthologous proteins being 89.3% identical.

In this study, PISP expression is shown in the mouse (figure 9B, 13E), chicken

(figure 13 B,C,D), and zebrafish (figure 9A) inner ear sensory epithelia. Reverse- transcription PCR revealed expression of PISP in zebrafish macula and hair cells at the mRNA level (figure 9A). An affinity purified rabbit polyclonal antibody raised against full-length human PISP detected PISP protein expression in the inner ear (figure 9B, lane

3), liver (figure 9B, lane 1), and kidney (figure 9B, lane 2) of mice. This ubiquitous pattern of expression that we detected in mice (figure 9B) is similar to the multiple tissues that express this protein reported in humans (Goellner et al. 2003).

4.2 In vitro Interaction of PISP with the C-terminus of

PMCA2b

The interaction between the C-terminus of human PMCA2b and PISP (Goellner et al. 2003) was confirmed in vitro with fragments of the zebrafish orthologs (figure 11).

The results were validated by reversing the orientation of GAL4BD-PISP and GAL4AD-

PMCAb (figure 11 B, C) in the yeast two-hybrid system. Additionally, the direction of the orientation was important for strong binding between Pisp and Pmca2b, with

GAL4BD–PMCA2b and GAL4AD-PISP activating transcription more efficiently than the reverse orientation of GAL4AD-PISP and GAL4BD-PMCA2b (figure 11C).

Whether these differences are due to changes in protein structure after fusion or differential stability of the hybrids containing the C-terminus of Pmca2b and Pisp in a favorable orientation remains unclear. All PMCA isoforms and many of their splice variants are expressed in the mammalian cochlea (Crouch J. J. and Schulte 1996, Furuta et al. 1998). Interaction studies to test if PISP is a binding partner to all the b-splice variants of the PMCA pump in hair cells can be performed. This system can be used in

future studies to identify the functionally significant amino acids of PISP by deleting different regions of the protein and testing the interaction strength with its binding partner.

4.3 Zebrafish PISP Localized Towards the Apico-lateral

Portion of the Hair Cell Plasma Membrane

We wished to test the potential in vivo interaction of Pisp and Pmca2b in zebrafish hair cells by studying the co-localization patterns of the two antibodies. However, the

PISP antibody did not detect Pisp protein in zebrafish hair cells (figure 12A). This was surprising since pisp mRNA was detected in whole zebrafish, macula, and hair cell tissue

(figure 9) and PISP is conserved from humans to zebrafish (figure 10). One possible explanation could be the modification of epitopes recognized by the antibody during zebrafish immunolabeling.

In order to label zebrafish hair cells with PISP, we designed a construct that encodes a fusion protein with Pisp at the N-terminus of mCherry fluorescent protein. This construct was driven by a hair cell-specific promoter to restrict expression to hair cells.

The construct was injected at the one-cell stage of zebrafish embryos and over-expression viewed at 4 dpf. Unfortunately, the over expression pattern appeared random (figure

12B). We theorized this could be due to improper folding of the fusion protein. To circumvent this issue, a construct encoding PISP fusion protein at the C-terminus of mCherry was made. This fusion protein localized towards the apico-lateral portion in hair cells and showed some punctate staining in the cytosol (figure 12C). Further studies using the later construct need to be done to characterize the localization pattern of PISP in zebrafish and further use these doubly-transgenic fish to characterize the co-

localization of Pisp with Pmca2b in zebrafish hair cells. Additionally, studies can be conducted by generating a zebrafish-specific PISP antibody.

4.4 PISP Localizes towards the Apical Portion of the Inner Ear

Sensory Epithelium

Previous studies have not described the localization of PISP in any tissue. The initial focus on using zebrafish as the model organism proved challenging as the zebrafish protein was not recognized by the antibody. Taking advantage of the highly conserved homology between mouse and chicken with human PISP (figure 10), we hoped to study its localization pattern in these two animal models. We were able to detect the expression pattern in the inner ear of mouse and chicken by antibody staining (figure

13). Goellner et. al (2003) were unable to visualize PISP immunoreactivity without over- expressing the protein in cells that contain a basal level of PISP. This contrast could lie in the use of cell culture versus tissue samples. MDCK cells might have a lower level of endogenous PISP expression when compared to tissue.

The b-splice forms of PMCAs are abundant throughout the basolateral membrane of hair cells and supporting cells (Dumont et al. 2001). We predicted a similar localization pattern of PISP along the hair cell basolateral membrane. Surprisingly, PISP localized towards the apical plasma membrane of hair cells and supporting cells (figure

13B), at the level of ionic junctional barrier of both mouse and chicken inner ear sensory epithelia. Though Dumont et al. (2001) have suggested that b-splice forms are mainly localized at the basolateral surface, there could be low expression levels of PMCA b- splice forms at the apical plasma membrane. Immunolabeling with PMCA markers can be done to test the co-localization. As localization of the PISP protein had never been

determined, the specificity of the PISP antibody was confirmed by performing the antigen-blocking assay (figure 14). Though the initial focus of this research was to study the interaction of PISP with PMCA2b isoforms in hair cells, the unexpected localization of PISP towards the apical portion of the inner ear sensory epithelium constituted by the ionic junctional barrier led us to focus on characterizing this pattern.

The next step in characterizing a junctional molecules physiology and pathology is to systematically analyze its expression, sub-cellular localization, and tissue distribution pattern. To determine whether the PISP antibody labeling is associated with

TJs or AJs in the inner ear sensory epithelium, a longitudinal view of the hair cells was required to visualize their sub-cellular organization along the apico-lateral portion of the plasma membrane. PISP showed partial co-localization with the TJ marker, ZO-1 (figure

15 A-D), and completely co-localized with the AJ marker, N-cadherin (figure 15 E-F) in chicken hair cells. These results identify PISP as a new junctional protein and further indicate the possibility of PISP being a novel adherens junction protein. Given the high degree of homology of PISP across species (figure 10) and ubiquitous expression of

PISP in mouse (figure 9B) and humans (Goellner et al. 2003), this research has identified a potential ubiquitous junctional protein candidate. It would be interesting to study if

PISP is expressed during the early or the late phase of junction development in the inner ear sensory epithelium. This would help understand whether PISP is involved in junction formation or maintenance. Further confirmation experiments using additional TJ and AJ markers, immunogold labeling, and over-expression studies would be required to confirm the likelihood of PISP being a novel junctional protein.

Figure 16. Hypothetical models on how PISP localizes towards the apico-lateral hair cell surface. (A) PISP (green) could interact with PMCA b-splice forms as it is being processed through the endoplasmic reticulum (blue) and golgi (orange) to regulate access of their C-terminal to other PDZ domain proteins. Following this, PISP maybe transported to the apico-lateral hair cell surface. (B) Alternatively, PISP could localize directly to the proteins near the apico-lateral hair cell surface.

PDZ domain proteins regulate the surface densities of channels and receptors by binding to their PDZ binding domains during transport from the endoplasmic reticulum to golgi (Ma and Jan 2002). PISP acts as a transient binding partner to the b-splice forms of the PMCAs (Goellner et al. 2003). Our data shows PISP localization towards the apico- lateral surface, whereas the b-splice forms of PMCAs are predominantly basolateral in hair cells (Dumont et al. 2001). Taken together these two results, we hypothesize two possible mechanisms by which PISP localizes towards the apico-lateral hair cell surface.

PISP could regulate the access of the C-terminal of PMCA b-splice forms to PDZ domain proteins during protein trafficking and then localize towards the apico-lateral surface

(figure 16A). Alternatively, there could be direct localization of PISP towards proteins near the apico-lateral portion of the hair cell (figure 16B).

4.5 Possible Role of PISP

PISP showed a high degree of similarity with the PDZ domain of mammalian

LIN-7 (MALS) family of proteins (Stephenson et al. 2005). Being an adherens junction protein and having a binding preference for C-terminal peptides with the sequence

E(T/S)(R/X)(V/ L/F) (Jo et al. 1999), LIN-7 could be of particular relevance in providing insight into the role of PISP. If PISP functions similarly to MALS (Straight et al. 2001), then it is likely to interact with several proteins in the cell to mediate transport, targeting, or retention of its interacting partners at the apical surface. Similar to LIN-7 (Irie et al.

1999, Perego et al. 2000), PISP could organize the TJ and AJ domains by accumulating its binding partners to play a role in the assembly and polarization of hair cells in the sensory epithelium. Deletion of LIN-7 causes decreased expression of its binding partners and defects in tight junction formation (Straight et al. 2001).

In the apical contact area between OHCs and SCs, the intercellular mechanical attachment and support is entirely dependent on the AJ belt (Gulley and Reese 1976).

AJs in the reticular lamina are involved in orientation and communication (Geiger et al.

1985), apart from their canonical support functions (Raphael and Altschuler 1991). PISP could play an important role in strengthening hair cell electromotility, formation of tight junctions, and surface polarization in inner ear sensory epithelia. Another possible role of

PISP to investigate would be whether it serves as the adherens junction molecule that stabilizes the cuticular plate by providing tension across the apical hair cell surface

(Muller and Littlewood-Evans 2001). Understanding the different roles of PISP and its binding partners would take us a step closer towards figuring out various adhesion

systems, and generating a road map on how the complex intracellular signaling occurs at the adherens junction. A recent study (Bahloul et al. 2009) has shown that vezatin, an adherens junction protein, plays a role in noise induced hearing loss. Our results showing

PISP localization towards the apical portion of the inner ear sensory epithelium could make PISP a probable candidate for deafness as the lack of PISP could cause a collapse in the ionic junctional barrier leading to loss of mechanical integrity, leakage of solutes between the endolymph and perilymph, and eventual hearing loss.

Chapter 5

Bibliography

1. Aijaz S, Balda MS, Matter K. 2006. Tight junctions: molecular architecture and function. Int Rev Cytol 248: 261-298.

2. Anniko M. 1983. Postnatal maturation of cochlear sensory hairs in the mouse. Anatomy and Embryology 166: 355-368.

3. Ashmore JF, Chambard JM, Richmond S. 2002. Cochlear Transduction: From Models to Molecules and Back Again. Audiology and Neurotology 7: 6-8.

4. Bahloul A, et al. 2009. Vezatin, an integral membrane protein of adherens junctions, is required for the sound resilience of cochlear hair cells. EMBO Mol Med 1: 125-138.

5. Balciunas D, et al. 2006. Harnessing a high cargo-capacity transposon for genetic applications in vertebrates. PLoS Genet 2: e169.

6. Ben-Yosef T, et al. 2003. Claudin 14 knockout mice, a model for autosomal recessive deafness DFNB29, are deaf due to cochlear hair cell degeneration. Human Molecular Genetics 12: 2049-2061.

7. Burns JC, Christophel JJ, Collado MS, Magnus C, Carfrae M, Corwin JT. 2008. Reinforcement of cell junctions correlates with the absence of hair cell regeneration in mammals and its occurrence in birds. J Comp Neurol 511: 396- 414.

8. Chou SW, Hwang P, Gomez G, Fernando CA, West MC, Pollock LM, Lin-Jones J, Burnside B, McDermott BM, Jr. 2011. Fascin 2b is a component of stereocilia that lengthens actin-based protrusions. PLoS One 6: e14807.

9. Corey D, Hudspeth A. 1983. Kinetics of the receptor current in bullfrog saccular hair cells. The Journal of Neuroscience 3: 962-976.

10. Corey DP, Hudspeth AJ. 1979. Ionic basis of the receptor potential in a vertebrate hair cell. Nature 281: 675-677.

11. Crouch JJ, Schulte BA. 1995. Expression of plasma membrane Ca-ATPase in the adult and developing gerbil cochlea. Hearing Research 92: 112-119.

12. Dumont RA, Lins U, Filoteo AG, Penniston JT, Kachar B, Gillespie PG. 2001. Plasma Membrane Ca2+-ATPase Isoform 2a Is the PMCA of Hair Bundles. The Journal of Neuroscience 21: 5066-5078.

13. Eatock RA, Rusch A. 1997. Developmental changes in the physiology of hair cells. Semin Cell Dev Biol 8: 265-275.

14. Farquhar MG, Palade GE. 1963. Junctional complexes in various epithelia. J Cell Biol 17: 375-412.

15. Fischer FP. 1994. General pattern and morphological specializations of the avian cochlea. Scanning Microsc 8: 351-363; discussion 363-354.

16. Flock Ö, Bretscher A, Weber K. 1982. Immunohistochemical localization of several cytoskeletal proteins in inner ear sensory and supporting cells. Hearing Research 7: 75-89.

17. Forge A, Wright T. 2002. The molecular architecture of the inner ear. British Medical Bulletin 63: 5-24.

18. Furuta H, Luo L, Hepler K, Ryan AF. 1998. Evidence for differential regulation of calcium by outer versus inner hair cells: plasma membrane Ca-ATPase gene expression. Hear Res 123: 10-26.

19. Geiger B, Volk T, Volberg T. 1985. Molecular heterogeneity of adherens junctions. J Cell Biol 101: 1523-1531.

20. Gioglio L, Russo G, Marcotti W, Prigioni I. 1998. Localization of Ca-ATPase in frog crista ampullaris. Neuroreport 9: 1309-1312.

21. Goellner GM, DeMarco SJ, Strehler EE. 2003. Characterization of PISP, a novel single-PDZ protein that binds to all plasma membrane Ca2+-ATPase b-splice variants. Ann N Y Acad Sci 986: 461-471.

22. Gulley RL, Reese TS. 1976. Intercellular junctions in the reticular lamina of the organ of Corti. Journal of Neurocytology 5: 617-618.

23. Gumbiner B. 1990. Generation and maintenance of epithelial cell polarity. Current opinion in cell biology 2: 881-887.

24. Gumbiner B, Stevenson B, Grimaldi A. 1988. The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the epithelial junctional complex. The Journal of Cell Biology 107: 1575-1587.

25. Gumbiner BM. 2005. Regulation of cadherin-mediated adhesion in morphogenesis. Nat Rev Mol Cell Biol 6: 622-634.

26. Heller S, Bell AM, Denis CS, Choe Y, Hudspeth AJ. 2002. Parvalbumin 3 is an abundant Ca2+ buffer in hair cells. J Assoc Res Otolaryngol 3: 488-498.

27. Irie M, Hata Y, Deguchi M, Ide N, Hirao K, Yao I, Nishioka H, Takai Y. 1999. Isolation and characterization of mammalian homologues of Caenorhabditis elegans lin-7: localization at cell-cell junctions. Oncogene 18: 2811-2817.

28. Jahnke K. 1975. The fine structure of freeze-fractured intercellular junctions in the guinea pig inner ear. Acta Otolaryngol Suppl 336: 1-40.

29. Jo K, Derin R, Li M, Bredt DS. 1999. Characterization of MALS/Velis-1, -2, and -3: a Family of Mammalian LIN-7 Homologs Enriched at Brain Synapses in Association with the Postsynaptic Density-95/NMDA Receptor Postsynaptic Complex. The Journal of Neuroscience 19: 4189-4199.

30. Kandel ER, Schwartz, J., Jessell, T. 2000. Principles of Neural Science. New York: McGraw-Hill.

31. Keeton TP, Burk SE, Shull GE. 1993. Alternative splicing of exons encoding the calmodulin-binding domains and C termini of plasma membrane Ca(2+)-ATPase isoforms 1, 2, 3, and 4. Journal of Biological Chemistry 268: 2740-2748.

32. Kelsell DP, Dunlop J, Stevens HP, Lench NJ, Liang JN, Parry G, Mueller RF, Leigh IM. 1997. Connexin 26 mutations in hereditary non-syndromic sensorineural deafness. Nature 387: 80-83.

33. Kikuchi T, Kimura RS, Paul DL, Adams JC. 1995. Gap junctions in the rat cochlea: immunohistochemical and ultrastructural analysis. Anatomy and Embryology 191: 101-118.

34. Kitajiri S-i, Furuse M, Morita K, Saishin-Kiuchi Y, Kido H, Ito J, Tsukita S. 2004. Expression patterns of claudins, tight junction adhesion molecules, in the inner ear. Hearing Research 187: 25-34.

35. Konishi T, Kelsey E. 1973. Effect Of Potassium Deficiency On Cochlear Potentials And Cation Contents Of The Endolymph. Acta Oto-laryngologica 76: 410-418.

36. Kozel PJ, et al. 1998. Balance and Hearing Deficits in Mice with a Null Mutation in the Gene Encoding Plasma Membrane Ca2+-ATPase Isoform 2. Journal of Biological Chemistry 273: 18693-18696.

37. Leonova EV, Raphael Y. 1997. Organization of cell junctions and cytoskeleton in the reticular lamina in normal and ototoxically damaged organ of Corti. Hearing Research 113: 14-28.

38. Li B, Fields S. 1993. Identification of mutations in p53 that affect its binding to SV40 large T antigen by using the yeast two-hybrid system. FASEB J 7: 957-963.

39. Lumpkin EA, Hudspeth AJ. 1995. Detection of Ca2+ entry through mechanosensitive channels localizes the site of mechanoelectrical transduction in hair cells. Proceedings of the National Academy of Sciences 92: 10297-10301.

40. Lumpkin EA, Marquis RE, Hudspeth AJ. 1997. The selectivity of the hair cell‚Äôs mechanoelectrical-transduction channel promotes Ca2+ flux at low Ca2+ concentrations. Proceedings of the National Academy of Sciences 94: 10997- 11002.

41. Ma D, Jan LY. 2002. ER transport signals and trafficking of potassium channels and receptors. Curr Opin Neurobiol 12: 287-292.

42. Manley GA. 1990. Peripheral hearing mechanisms in reptiles and birds. Berlin ; New York: Springer-Verlag.

43. Manley GA, Haeseler C, Brix J. 1991. Innervation patterns and spontaneous activity of afferent fibres to the lagenar macula and apical basilar papilla of the chick's cochlea. Hearing Research 56: 211-226.

44. Marcus DC, Marcus NY, Thalmann R. 1981. Changes in cation contents of stria vascularis with ouabain and potassium-free perfusion. Hearing Research 4: 149- 160.

45. McDermott BM, Jr., Baucom JM, Hudspeth AJ. 2007. Analysis and functional evaluation of the hair-cell transcriptome. Proc Natl Acad Sci U S A 104: 11820- 11825.

46. McDermott BM, Jr., Asai Y, Baucom JM, Jani SD, Castellanos Y, Gomez G, McClintock JM, Starr CJ, Hudspeth AJ. 2010. Transgenic labeling of hair cells in the zebrafish acousticolateralis system. Gene Expr Patterns 10: 113-118.

47. Muller U, Littlewood-Evans A. 2001. Mechanisms that regulate mechanosensory hair cell differentiation. Trends in cell biology 11: 334-342.

48. Nourry C, Grant SG, Borg JP. 2003. PDZ domain proteins: plug and play! Sci STKE 2003: RE7.

49. Nunes FD, Lopez LN, Lin HW, Davies C, Azevedo RB, Gow A, Kachar B. 2006. Distinct subdomain organization and molecular composition of a tight junction with adherens junction features. Journal of Cell Science 119: 4819-4827.

50. Oliver D, He DZZ, Klacker N, Ludwig J, Schulte U, Waldegger S, Ruppersberg JP, Dallos P, Fakler B. 2001. Intracellular Anions as the Voltage Sensor of Prestin, the Outer Hair Cell Motor Protein. Science 292: 2340-2343.

51. Ospeck M, Dong XX, Iwasa KH. 2003. Limiting frequency of the cochlear amplifier based on electromotility of outer hair cells. Biophys J 84: 739-749.

52. Perego C, Vanoni C, Massari S, Longhi R, Pietrini G. 2000. Mammalian LIN-7 PDZ proteins associate with beta-catenin at the cell-cell junctions of epithelia and neurons. EMBO J 19: 3978-3989.

53. Raphael Y. 1994. F-actin, tubulin and spectrin in the organ of Corti: comparative distribution in different cell types and mammalian species. Hearing Research 76: 173-187.

54. Raphael Y, Altschuler RA. 1991. Reorganization of cytoskeletal and junctional proteins during cochlear hair cell degeneration. Cell Motil Cytoskeleton 18: 215- 227.

55. Riazuddin S, et al. 2006. Tricellulin is a tight-junction protein necessary for hearing. Am J Hum Genet 79: 1040-1051.

56. Ricci AJ, Wu Y-C, Fettiplace R. 1998. The Endogenous Calcium Buffer and the Time Course of Transducer Adaptation in Auditory Hair Cells. The Journal of Neuroscience 18: 8261-8277.

57. Runhaar G. 1989. The surface morphology of the avian tectorial membrane. Hear Res 37: 179-187.

58. Saha S, Slepecky NB. 2000. Age-related changes in microtubules in the guinea pig organ of Corti. Cell and Tissue Research 300: 29-46.

59. Saunders JC. 2010. The role of hair cell regeneration in an avian model of inner ear injury and repair from acoustic trauma. ILAR J 51: 326-337.

60. Shin JB, et al. 2010. The R109H variant of fascin-2, a developmentally regulated actin crosslinker in hair-cell stereocilia, underlies early-onset hearing loss of DBA/2J mice. J Neurosci 30: 9683-9694.

61. Souter M. 1995. Postnatal development of membrane specialisations of gerbil outer hair cells. Hearing Research 91: 43-62.

62. Stephenson SEM, Dubach D, Lim CM, Mercer JFB, La Fontaine S. 2005. A Single PDZ Domain Protein Interacts with the Menkes Copper ATPase, ATP7A: A NEW PROTEIN IMPLICATED IN COPPER HOMEOSTASIS. J. Biol. Chem. 280: 33270-33279.

63. Straight SW, Chen L, Karnak D, Margolis B. 2001. Interaction with mLin-7 Alters the Targeting of Endocytosed Transmembrane Proteins in Mammalian Epithelial Cells. Molecular Biology of the Cell 12: 1329-1340.

64. Strehler EE, Zacharias DA. 2001. Role of alternative splicing in generating isoform diversity among plasma membrane calcium pumps. Physiol Rev 81: 21- 50.

65. Takahashi K, Kitamura K. 1999. A Point Mutation in a Plasma Membrane Ca2+- ATPase Gene Causes Deafness in Wriggle Mouse Sagami. Biochemical and Biophysical Research Communications 261: 773-778.

66. Tilney LG, Tilney MS, DeRosier DJ. 1992. Actin filaments, stereocilia, and hair cells: how cells count and measure. Annu Rev Cell Biol 8: 257-274.

67. Tsukita S, Furuse M, Itoh M. 2001. Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol 2: 285-293.

68. Wilcox ER, et al. 2001a. Mutations in the gene encoding tight junction claudin-14 cause autosomal recessive deafness DFNB29. Cell 104: 165-172.

69. Yamoah EN, Lumpkin EA, Dumont RA, Smith PJS, Hudspeth AJ, Gillespie PG. 1998. Plasma Membrane Ca2+-ATPase Extrudes Ca2+from Hair Cell Stereocilia. The Journal of Neuroscience 18: 610-624.

Advise for Students taking over the Project

1. The PISP antibody can sometimes be tricky – I had started with staining in the

mouse vestibular, however, the staining did not work in there after a few repeats.

Could re-try it. Staining works very well in both mouse cochlea and chicken

cristae.

2. Chick staining of PISP:

a. Staining that has so far is in the CRISTAE whole mount.

b. I was unable to get any phalloidin labeled bundles in the chick basilar

papilla. It could be because the tectorial membrane is covering it.

Additionally, I was unable to get the PISP staining to work in the whole

mount of chick. Some way of removing the tectorial membrane and then

repeating could work.

3. Sectioning

a. PISP antibody seemed to work in the mouse cochlea after treatment with

SDS for antigen retrieval. However, the PISP staining was seen in the

reticular lamina only when my sections were very thick (20um) and there

were two rows of OHCs/IHCs.

i. This was not usable as what we want is thin sections and the

junction staining seen along the lateral plasma membrane NOT

reticular lamina.

b. Chick sectioning – get a nice clean row of HCs. However, the PISP

antibody did not work.

4. General advise for different methodologies I used/ developed

a. Whole mount staining –

i. The fixing time can affect your staining quality. ZO-1 a standard

marker did not stain in chick cristae when I fixed overnight.

However, it stains beautifully after fixing for 20-30 mins. Now I

do all my whole mount fixes for 20-30 mins.

ii. Make sure to dissociate the cells when mounting.

iii. Use the regular vectashield.

iv. I prefer 20% GS over 5% BSA.

b. Staining sections:

i. First dip the slides a few times in dd. Water. I generally take a 50

ml tube with water and dip it 2-3 seconds each for 2-3 mins and

then dry it under the hood before staining. This is to prevent the

PAP pen mark from getting messy.

ii. Be careful while using the PAP pen. It can get messy. I like the

thin tip MINI PAP pen from Invitrogen. It is more expensive than

the EMS version. However, its less messy and allows you to draw

cleaner circles.

iii. You need only 30-50 ul per section sample once you draw a circle

with the PAP pen.

iv. Read papers online and see different ways of fixation and antigen

retrieval if your antibody is giving trouble.

v. Use the humidifying chamber.

c. Cell culture for junction study:

i. It’s complicated. I did not go into it. However, you need to speak

to experts who study junctions for this.

d. Purified PISP protein

i. We have purified PISP protein with a HIS tag, dialyzed in 1 X

PBS.

ii. I use proteases while doing my protein expression.

iii. The protein expression was pretty straightforward once I cloned

the vector. Just followed the standard protocols from the book.

e. Western Blotting

i. I prefer using the ECL Plus over the immunofluorescence. Get

better signal and bands. However you need to have the HRP

conjugated antibodies to this.

ii. I used the semi-dry transfer apparatus, did not have any issues.

iii. I dissect about 5-6 mouse ears and then put it in lysis buffer,

sonicate, spin, check protein concentration using nano-drop and

then move on with the SDS-PAGE.

iv. If your planning on just dissecting out the utricle – you’d need

atleast 12-14 utricles. Also don’t sonicate in this case. Just use a

syringe and then heat the sample up after adding Lamaelli buffer.

f. Vector designing / cloning

i. Always make sure that you have the START/STOP codons

appropriately.

ii. Make sure its in frame

iii. Check the restriction sites your using – make sure that it does not

cut either your final vector or your insert.

iv. If your doing protein expression make sure the RBS (ribosome

binding site) sequence is intact and is not cut-off when you choose

your restriction sites.

v. Try making both N- and C terminal fusion vectors at the same time

– it will save you a lot of steps.

5. What can be done next (these are just immediate follow-ups not long term

goals like KO):

a. Whole mount cristae staining of chick. With TJ and AJ markers. ZO1,

Claudin 9 can be used for TJ, N-Cadherin, E-Cadhern, and b-catenin for

AJ marker. The chick hair cell can be identified using phalloidin.

b. Repeat the zebrafish over-expression studies using the PISP-mCherry

construct. This one showed an apical localization. Co-stain with PMCA

antibody (the MOUSE monoclonal – which is a general PMCA marker).

List of Antibodies Used

Antibody Source Dilution Localization Reference

PISP rabbit 1:300 Reticular Goellner et al., 2003 lamina/ junction

ZO-1 mouse IgG1 1:200 Tight Invitrogen (339100) Junction

β-Catenin mouse IgG1 1:200 Adherens BD Transduction Junction Laboratories (610153) p120 Catenin Mouse IgG1 1:100 Adherens BD Transduction Junction Laboratories (612536)

Anti-PMCA mouse/ 1:250 Hair bundle, Thermo Scientific (MA3- ATPase IgG2a basolateral 914) membrane

Calcium pump Rabbit IgG 1:200 Hair bundle abcam (ab3529) PMCA2 ATPase

Hair Cell mouse 10-20 ul Hair Cell Developmental Studies Soma-1 (HCS- IgG2a in 200ul Soma Hybridoma Bank 1) blocking solution mouse N- rat IgG 10-20 ul Adherens Developmental Studies Cadherin in 200ul Junction Hybridoma Bank (MNCD2) blocking solution chick N- mouse IgG1 10-20 ul Adherens Developmental Studies Cadherin (6B3) in 200ul Junction Hybridoma Bank blocking solution

E-Cadherin mouse IgG1 10-20 ul Adherens Developmental Studies (8C2) in 200ul Junction Hybridoma Bank blocking solution

Tropomyosin mouse IgG1 1:100 Did not work Sigma-Aldrich ( T2780)

Antibody Source Dilution Localization Reference

Claudin 1 mouse IgG1 1:50 Tight Invitrogen (37-4900) Junction

Myosin 7a goat IgG 1:50 Supposed to Santa Cruz Biotechnology, be hair cell Inc. (sc-26709) soma. Did not work

Prestin Rabbit IgG1 1:200 OHC Kachar Lab membrane

Claudin 9 Rabbit IgG1 1:200 Tight Kachar Lab Junction

Claudin 14 Rabbit IgG1 1:200 Tight Kachar Lab Junction

Mouse Cochlea Section Staining

These should just be used as a guide. If it does not match, then please make sure to try out the alternative approaches.

ANTIBODY PFA SDS (Antigen Retrieval) + PFA

FIXATION fixation

PISP NO YES

HCS-1 NO YES

N-Cadherin NO YES

E-Cadherin YES Not Sure

Claudin 9 YES YES

ZO-1 NO YES

Claudin 14 YES YES

Claudin 1 NO YES

Myosin 6a YES YES

β-Catenin NO YES

Phalloidin YES NO

Prestin YES NO

Chick BP Immunostaining- sections

These should just be used as a guide. If it does not match, then please make sure to try out the alternative approaches.

Antibody NO PFA PFA SDS+PFA Methanol SDS+Methanol

PISP NO NO NO NO NO

Claudin 9 NO NO YES NO YES

ZO-1 YES YES NO YES NO

HCS-1 YES NO NO NO YES

B-Catenin YES YES YES YES Dint check

PMCA YES YES Dint check Dint check Dint check

List of Vectors

The maps for all the vectors will be saved on the lab computer under the folder

HARSHITA à Vectors

1. pACT2 (Yeast two hybrid)

2. pACT2+ PISP (Yeast two hybrid)

3. pACT2+PMCA2b (Yeast two hybrid)

4. pGBKT7 + PISP (Yeast two hybrid)

5. pGBKT7+ PMCA2b (Yeast two hybrid)

6. pET15b (HIS tag)

7. pET15b+PISP (HIS tag)

8. pET15b+PMCA2b (HIS tag)

9. pv3b: pisp-mCherry (zebrafish overexpression)

10. pv3b: mCherry-PISP (zebrafish overexpression)

11. pCMV/Tag2/PISP

12. eGFP-C2 with myo 15a

13. pGEX-KG