Regulation of the Transcription Factor YY1 by Phosphorylation Ari Kassardjian

Florida State University Libraries

Electronic Theses, Treatises and Dissertations The Graduate School

2012 Regulation of the Transcription Factor YY1 by Phosphorylation Ari Kassardjian

Follow this and additional works at the FSU Digital Library. For more information, please contact [email protected]

FLORIDA STATE UNIVERSITY

COLLEGE OF ARTS AND SCIENCES

REGULATION OF THE TRANSCRIPTION FACTOR YY1 BY

PHOSPHORYLATION

ARI KASSARDJIAN

A Dissertation submitted to the Program of Molecular Biophysics in partial fulfillment of the requirements for the degree of Doctor of Philosophy

Degree Awarded: Summer Semester, 2012

Ari Kassardjian defended this dissertation on June 21, 2012.

The members of the supervisory committee were:

Myra M. Hurt Professor Directing Dissertation

Akash Gunjan University Representative

Lloyd Epstein Committee Member

Cathy Levenson Committee Member

Hank Bass Committee Member

The Graduate School has verified and approved the above-named committee members, and certifies that the dissertation has been approved in accordance with university requirements.

ACKNOWLEDGMENTS

I feel very lucky and privileged that I had the opportunity to work in the laboratory of Dr. Myra Hurt; I am forever grateful for the support and guidance that I have received from my advisor. I am honored to have worked under the supervision of a great mentor and I cannot thank her enough!

I would like to thank the members of my committee: Dr. Akash Gunjan, Dr. Lloyd Epstein, Dr. Hank Bass, and Dr. Cathy Levenson. Without their valuable feedback and accessibility, this work would not have been achieved.

This work would have not been possible without Beth Alexander, our lab director. She taught me many techniques and was always there to help me with all my work. I would also like to thank Dr. Raed Rizkallah, an amazing researcher who led by example. He was always present and available to help answer my questions and guide me in the right direction. I like to thank Dr. Sarah Riman for being a great friend and colleague in the lab. Beth, Raed and Sarah had major, direct and indirect, contributions to this study and I will never forget our experiences together.

Also, I would like to thank all the faculty members, staff, colleagues and friends in the Department of Biomedical Sciences and the Molecular Biophysics Graduate program at Florida State University.

Lastly, I would like to thank my parents, Chahe and Rosine, as well as my brother, Araz for their unwavering love, unending support and encouragement.

iii

TABLE OF CONTENTS

LIST OF TABLES………………………………………………………………………..v

LIST OF FIGURES……………………………………………………………………...vi

ABSTRACT…………………………………………………………………………….viii

CHAPTER 1 INTRODUCTION ...... 1 DISCOVERY AND CHARACTERIZATION OF YY1 ...... 2

YY1 AND CELL CYCLE REGULATION ...... 7

YY1 REGULATION ...... 9

POSTTRANSLATIONAL REGULATION OF YY1 ...... 11

KINASES THAT PHOSPHORYLATE YY1 ...... 24

GOALS OF THE PROJECT ...... 28

CHAPTER 2 AURORA B KINASE PHOSPHORYLATES THE TRANSCRIPTION FACTOR YY1 AT G2/M TRANSITION OF THE CELL CYCLE AND MODULATES ITS TRANSCRIPTIONAL ACTIVITY ...... 29 INTRODUCTION ...... 30

MATERIALS AND METHODS ...... 31

RESULTS ...... 39

DISCUSSION ...... 59

CHAPTER 3 IDENTIFICATION OF TYROSINE KINASES THAT PHOSPHORYLATE YY1 IN VITRO ...... 65 INTRODUCTION ...... 65

MATERIAL AND METHODS ...... 66

RESULTS ...... 72

DISCUSSION ...... 87

CHAPTER 4 CONCLUSIONS ...... 92 APPENDIX ...... 95 REFERENCES ...... 97 BIOGRAPHICAL SKETCH ...... 114

LIST OF TABLES

Table I. Known in vivo Posttranslational modifications of YY1...... 16

Table II. In vivo phosphorylation sites of YY1 ...... ……22

LIST OF FIGURES

Figure 1. Diagram of the different functional domains of human YY1 and the location of each phosphorylated amino acid residue...... 4

Figure 2. Structure of the YY1 cocrystal structure...... 7

Figure 3. Protein phosphorylation and protein dephosphorylation regulate the activities of transcription factors through multiple mechanisms...... 17

Figure 4. Phosphorylation of YY1 in nocodazole blocked extracts is detected by antiphospho-S184 antibody...... 42

Figure 5. Serine 184 phosphorylation on YY1 peaks at the G2/M stage of the cell cycle...... 45

Figure 6. Aurora B phosphorylates YY1 at serine 184 in vitro...... 47

Figure 7. PKA and ROCK1 phosphorylate YY1 at serine 184 in vitro...... 49

Figure 8. Aurora B phosphorylates YY1 at serine 184 in vivo...... 51

Figure 9. Cell cycle analysis and cellular localization of YY1 phospho-mutants in HEK293 cells...... 53

Figure 10. Phosphorylation of YY1 in its regulatory domain modulates transcriptional activity...... 55

Figure 11. YY1 S180,184D phospho-mutant exhibits an increased DNA binding affinity in vitro...... 56

Figure 12. The histone acetyltransferase p300 acetylates full length YY1 wild type in vitro...... 58

Figure 13. Schematic model of the regulation of YY1 by Aurora B at G2/M...... 64

Figure 14. YY1 is phosphorylated on tyrosine residue(s) in vitro and in vivo...... 73

Figure 15. YY1 is phosphorylated on tyrosine residues during mitosis...... 75

Figure 16. Structural and functional domains of YY1 showing the location of the six tyrosine residues in YY1...... 77

Figure 17. Phosphorylation of Y251 and Y254 by mitotic extracts...... 79

Figure 18. Tyrosine kinases included in the kinase profiling screen...... 81

Figure 19. Multiple tyrosine kinases phosphorylate YY1 in vitro ...... 82

Figure 20. Dot blot assay of non-phosphorylated and tyrosine phosphorylated synthetic peptides of YY1 probed with anti-pY251 or anti-pY254...... 83

Figure 21. FAK and SRC phosphorylate YY1 at Y251 and Y254 in vitro ...... 84

Figure 22. Protein expression and DNA binding activity of EGFP-YY1 Y251F and Y254F in HeLa extracts...... 85

Figure 23. Examples of zinc finger containing proteins with conserved tyrosine (Y) or phenylalanine (F) residues at the linker region ...... 86

Figure 24. Protein expression and DNA binding activity of EGFP-YY1 Y383F in HeLa extracts...... 87

vii

ABSTRACT

Reversible protein phosphorylation plays an integral role in the regulation of eukaryotic cellular signaling, especially for transcription factors. Yin Yang 1 (YY1) is a ubiquitously expressed and highly conserved multifunctional transcription factor that is involved in a variety of cellular processes. Many YY1-regulated genes have crucial roles in cell proliferation, differentiation, apoptosis, and cell cycle regulation. Numerous mechanisms have been shown to regulate the function of YY1, such as DNA binding affinity, subcellular localization, and posttranslational modification including phosphorylation. We have previously identified Polo-like kinase 1(Plk1) and Casein kinase 2α (CK2 α) as the tfirs two kinases proven to phosphorylate YY1. In this study, we identify a third kinase. We report that YY1 is a novel substrate of the Aurora B kinase both in vitro and in vivo. Serine 184 phosphorylation of YY1 by Aurora B is cell cycle regulated and peaks at G2/M and is rapidly dephosphorylated, likely by protein phosphatase 1 (PP1), as the cells enter G1. Aurora A and Aurora C can also phosphorylate YY1 in vitro, but at serine/threonine residues other than serine 184. Two other mitotically active kinases, protein kinase A (PKA) and Rho-associated, coiled-coil containing protein kinase 1 (ROCK1) also phosphorylate YY1 at serine 184 in vitro, which might suggest the presence of multiple signaling pathways and multiple kinases that can phosphorylate YY1 at the same residue. We present evidence that phosphorylation of YY1 at serine 180 and serine 184 located in the central glycine/alanine (G/A)-rich region is important for transcriptional regulation, with a potential phosphorylation/acetylation interplay regulating YY1 function. Given their importance in mitosis and overexpression in human cancers, Aurora kinases have been identified as promising therapeutic targets. Increasing our understanding of Aurora substrates will add to the understanding of their signaling pathways. The tyrosine kinase signaling pathway can also regulate YY1 by phosphorylation. YY1 is shown to be phosphorylated at tyrosine residue(s) during mitosis of the cell cycle. YY1 can be a substrate for several tyrosine kinases. Of the tyrosine kinases examined in vitro, Focal adhesion kinase (FAK) and Abelson kinase 1 (ABL1) showed the highest activity in phosphorylation of YY1. Both tyrosine kinases phosphorylate YY1

viii at tyrosine 251 and 254 located in the spacer region of the protein. Phosphorylation at these sites could play a role in protein/protein interactions. We also show the significance of tyrosine 383 located in the DNA binding domain of YY1. Even though tyrosine 383 does not have direct contact with DNA, we show that this residue is important for YY1 DNA sequence recognition and DNA binding ability.

CHAPTER 1 INTRODUCTION

Yin Yang 1 (YY1) is a ubiquitously expressed multifunctional transcription factor that belongs to the Polycomb Group zinc finger protein family. YY1 was identified in 1991 as a transcription factor that repressed the P5 promoter of the adeno-associated virus (Shi et al., 1991). The repression activity of YY1 was converted to an activating effect in the presence of the viral oncoprotein E1A, hence its name Yin Yang (Shi et al., 1991). YY1 has critical roles in many biological processes such as cellular proliferation, differentiation, embryogenesis, development and apoptosis (Gordon et al., 2006). Yy1 is an essential gene, therefore ablation of yy1 in mice results in their death at the peri- implantation stage during early embryogenesis, while the yy1+/- mice display severe developmental abnormalities (Donohoe et al., 1999). At the cellular level, knockdown of YY1 slows cell cycle progression and cell proliferation and causes an accumulation of multinucleated cells with defects in cytokinesis (Affar el et al., 2006b). In addition, genome-wide analysis of depleted YY1 mouse embryonic fibroblasts (MEFs) has identified over 500 putative YY1 target genes (Affar el et al., 2006b). YY1 has been shown to be a target of many post-translational modifications. Multiple residues on YY1 have been shown to be modified by S-nitrosation (Hongo et al., 2005), acetylation (Takasaki et al., 2007; Yao et al., 2001), O-linked glycosylation (Hiromura et al., 2003), sumoylation (Deng et al., 2007), and poly(ADP-ribosyl)ation (Oei et al., 1997a; Oei et al., 1998), all of which regulate the function and activity of YY1. Even though a wealth of data exists on the regulation of YY1 target genes and the role of YY1 throughout the cell cycle, the regulation of YY1 by phosphorylation is just starting to emerge. Little is known about how the YY1 protein itself is controlled or the upstream kinase signaling pathways that regulate its function.

Discovery and Characterization of YY1

The transcription factor YY1 was initially cloned and characterized by Shi et al., in 1991. During the same time, YY1 was also cloned by two other laboratories. Park and Atchison (1991) identified and cloned the zinc finger protein, which they termed NF-E1 (Park and Atchison, 1991) and Hariharan et al. (1991) identified and cloned the protein, which they termed δ (Hariharan et al., 1991b). Subsequently, YY1 has been identified in other species and has been given other names, including UCRBP (Flanagan et al., 1992), nuclear matrix protein NMP1 (Guo et al., 1995) and common factor 1 (CF1) (Thomas and Seto, 1999). In 1994, the mouse yy1 gene was mapped to chromosome 12 (Zhu et al., 1994). The gene’s sequence, between the transcriptional start site and the cleavage-poly(A) site spans about 23 kilo base pairs. The promoter contains a high GC rich region and several Sp1 consensus binding sites, but no TATA box (Safrany and Perry, 1993). In 1998, the human yy1 gene was mapped to the telomere region of chromosome 14 segment q32.2. The human yy1 promoter displayed a high percentage of similarity to the mouse YY1 promoter; three Sp1 binding sites were mapped, but neither a TATA box nor a CCAAT box was found in the proximal promoter region (Yao et al., 1998). The YY1 gene consists of five highly conserved exons encoding a protein of 414 amino acids and a predicted molecular weight of 44.5 kDa. However, due to the structure of the protein, its relative molecular weight on an SDS-PAGE gel is about 65- 68 KDa, but the exact reasons for this higher migration is still not clear (Shi et al., 1997). YY1 is ubiquitously expressed in all tissues and highly conserved among the different animal species. YY1 cDNA has already been cloned from many species including humans (Shi et al., 1991) and several of the model organisms studied in the laboratories such as, mice (Hariharan et al., 1991a; Safrany and Perry, 1993), rat (Chen et al., 1996), chicken (Bernard and Voisin, 2008), zebrafish (Song et al., 2004) and xenopus (Pisaneschi et al., 1994). Drosophila has two orthologs of YY1, pleiohomeotic (pho) and pho-like (phol) (Brown et al., 2003; Brown et al., 1998) which have high degrees of similarity in the zinc finger regions with those of human YY1. More recently, a YY1 orthologue called Iec1 was also identified in fission yeast (Schizosaccharomyces

pombe) (Hogan et al., 2010). Recent DNA and amino acid sequence database analyses show striking similarities in structure and function of YY1 to a newly discovered sister

protein, Yin Yang 2 (YY2) (Nguyen et al., 2004). YY2, reveals an overall 65% identity in the DNA sequence and a 56% identity in protein sequence compared with human YY1. The most pronounced similarity between YY1 and YY2 exists within the zinc finger regions of the two proteins. YY2 can bind to and regulate some promoters known to be controlled by YY1. Similar to YY1, YY2 contains both transcriptional activation and

repression functions (Nguyen et al., 2004). The structural and functional domains of the YY1 protein have been well characterized from multiple experiments (Austen et al., 1997a; Austen et al., 1997b; Bushmeyer et al., 1995). Figure 1 displays a diagram summarizing the conclusions drawn from these studies. The C-terminus of YY1 contains four zinc fingers of the C2H2 type which constitute the DNA binding domain. All four fingers have been shown to be required for proper binding to DNA. The co-crystal structure of the YY1 DNA binding domain bound to the adeno-associated virus (AAV) initiator element (TCCATTTTG) has been resolved (human YY1 residues 293 to 414). All four zinc fingers of YY1 were found to make contacts with the major groove of the DNA, with finger 1 making a single contact and finger 2, 3 and 4 making multiple contacts with the DNA phosphate backbone and the bases (Houbaviy et al., 1996). The majority of the contacts with DNA are by the positively charged amino acids lysine, arginine and histidine of YY1 and they contact both the template and non-template strands of DNA (Figure 2).

Figure 1. Diagram of the different functional domains of human YY1 and the location of each phosphorylated amino acid residue. Red residues are sites identified by our lab. Black residues are sites identified by Cell Signaling Technology and by (Blattler et al., 2012). Modified from (Austen et al., 1997b)

The zinc finger domain is responsible for sequence-specific DNA binding (Austen et al., 1997b; Bushmeyer et al., 1995) to the most commonly used consensus DNA recognition site: 5’-(C/g/a)(G/t)(C/t/a)CATN(T/a)T/g/c)-3’ (Hyde-DeRuyscher et al., 1995). The upper case letters represent more preferred bases in this study and the (5’- CAT-3’) core region is conserved in all YY1 binding sites. It was also reported, that over 7% of vertebrate genes and 24% of viral genes studied contained YY1 binding elements. Their search did not reveal any particular class of genes with a prediction for YY1 binding sites, suggesting a wide range of genes and a ubiquitous regulation of YY1 in different biological processes (Hyde-DeRuyscher et al., 1995). YY1 also contains a repression domain that lies within the zinc finger region, specifically in zinc fingers 1 and 2 that mediates repression, independent of the proper folding and DNA binding ability of YY1 (Bushmeyer et al., 1995; Galvin and Shi, 1997). The presence of

another repression domain in the central glycine-rich region was also proposed by another group (Yang et al., 1996a). A bipartite transactivation domain lies at the N-terminus and is composed of two highly charged acidic regions separated by a stretch of eleven histidine residues between amino acid 70-80. There also includes a stretch of eleven glutamic/aspartic acid residues present between amino acids 43-53. Both stretches are well conserved in YY1 orthologs from rat, mouse and chicken. Although these stretches of amino acids have no known function to date, the electronic charge of histidine residues may be altered with slight pH changes in the microenvironment. Therefore, the N-terminal of YY1 may employ electrostatic force to interact with different proteins, especially those with positive charges, such as histones (Deng et al., 2010). The function of the spacer region (amino acid residues 198-295) is not fully understood. It lacks known domains, but seems to be needed for the full YY1 activity, possibly by aiding in the proper folding of the protein (Austen et al., 1997b). In one study, the first 201 amino acids of YY1 were shown to mediate repression; however, the inclusion of amino acids 201-331 (encompassing the spacer region) abrogated the observed repression (Lewis et al., 1995). The authors proposed that the spacer region might have a masking effect on the repression domain found in the N-terminal region (Lewis et al., 1995). In addition, the spacer region has been shown to be part of the regions mediating the interactions of YY1 with other proteins. However, the major domains that interact with different proteins have been shown to be the C-terminal DNA binding region and the central glycine/alanine (GA) and glycine/lysine (GK) rich regions, which are two domains critical for YY1 transcriptional regulation. Some of the proteins, including TATA-binding protein, CBP/p300, TFIIB, E1A and c-Myc, were found to interact with both domains (Austen et al., 1997a; Austen et al., 1998; Lee et al., 1995b; Lewis et al., 1995; Shrivastava et al., 1993). Even though YY1 is described as a transcription factor, it has been shown to have other functions, including as a scaffolding protein that can interact with dozens of different proteins either individually or as part of protein complexes (Deng et al., 2010). YY1 has also been shown to be a nuclear matrix protein that can functionally compartmentalize the eukaryotic nucleus to support regulation of gene expression (Guo

et al., 1995). The altered translocation between nucleus and cytoplasm at different stages of the cell cycle suggests that YY1 is involved biological processes other than mediating gene transcription (Palko et al., 2004; Rizkallah and Hurt, 2009). The rapid recruitment of YY1 to the decondensing chromosomes in telophase, before the formation of the nuclear envelope raises the possibility of a role for YY1 in marking active and repressed genes in newly formed daughter cells (Rizkallah and Hurt, 2009) and therefore could act as a genomic imprinting protein. YY1 controls several imprinted domains, including the Peg3, Gnas and Xist/Tsix regions. YY1 knockdown results in global expression changes in the Peg3, Gnas and Xist/Tsix imprinted domains due to changes in DNA methylation (Kim and Do Kim, 2008). YY1 is also a cofactor protein exhibiting activity independent of its DNA binding affinity (Deng et al., 2010). Many studies have suggested that YY1 uses an indirect mechanism to affect its target promoters (Thomas and Seto, 1999). YY1 can physically interact with and recruit several chromatin modifiers including histone acetyltransferases (Lee et al., 1995b; Yao et al., 2001), deacetylases (Yang et al., 1996, 1997; Ren et al., 2009), and methyltransferases (Rezai-Zadeh et al., 2003; Baumeister et al., 2005; Ko et al., 2008) to sequence specific regions of the genome. YY1 was initially identified as a DNA binding transcription factor mediating gene expression. Since its discovery, the function of YY1 independent of its DNA binding activity and the different regulatory domains of YY1 have been well documented. Posttranslational modifications such as phosphorylation of YY1 could play a role in many of YY1’s different functions.

Figure 2. Structure of the YY1 cocrystal structure. Stereoview of the YY1–DNA complex. The protein is shown as a ribbon representation, the DNA as a stick model, and the zinc ions as spheres. YY1 zinc fingers are colored red, yellow, green, and blue from N to C termini. The template strand of the DNA is colored grey, with the nucleotides corresponding to the two transcription start sites shown in purple, and the nontemplate strand is colored black. RNA synthesis proceeds downwards in this view. (Houbaviy et al., 1996)

YY1 and Cell Cycle Regulation

One of the functions attributed to YY1, is role in cell cycle control. YY1 interacts with several key regulators of the cell cycle signaling pathways such as c-Myc, retinoblastoma (Rb) protein, p53 and E2F. The c-Myc oncoprotein has been shown to associate with YY1 and inhibit its transcriptional activity (Shrivastava et al., 1993). This oncoprotein does not block the binding of YY1 to DNA, but rather interferes with the ability of YY1 to contact the basal transcription proteins TATA-binding protein (TBP) and

TFIIB, thereby inhibiting YY1's ability to regulate transcription (Shrivastava et al., 1996). Furthermore, YY1 has been shown to activate the c-Myc promoter. In murine erythroleukemia cells, overexpressed YY1 causes increased levels of c-myc mRNA (Riggs et al., 1993). A physical association of YY1 with the tumor suppressor Rb protein in growth arrested primary human coronary artery smooth muscle cells has been observed. The Rb-YY1 interaction is cell cycle-dependent with complex formation occurring at G1/G0. This interaction inhibits the DNA binding ability of YY1 and blocks YY1-dependent transcription in vitro (Petkova et al., 2001). In addition, YY1 represses the Rb gene expression in human cervical carcinoma HeLa cells and myoblast cells. Upon induction of myogenesis, YY1 translocates from the nucleus to the cytoplasm thereby relieving the inhibition of the Rb gene leading to Rb upregulation and myoblast differentiation (Delehouzee et al., 2005). The tumor suppressor protein p53 is another critical cell cycle regulator that YY1 has been shown to interact with. YY1 regulates the transcriptional activity, acetylation, ubiquitination, and stability of p53 by inhibiting its interaction with the coactivator p300 and by enhancing its interaction with the negative regulator mouse double minute 2 (Mdm2), a ubiquitin ligase (Gronroos et al., 2004; Sui et al., 2004). YY1 regulates p53 levels through stimulating Mdm2-mediated p53 polyubiquitination and degradation (Gronroos et al., 2004; Sui et al., 2004). These studies show a crucial role for YY1 in controlling p53 homeostasis. Transcriptional activation of the cyclin D1 gene (CCND1) plays a pivotal role in G1-phase progression, which is controlled by multiple regulatory factors. YY1 has been shown to be part of a transcriptional repressor complex along with HDAC1 present on the cyclin D1 gene promoter in breast cancer cells. YY1 is released from the gene promoter in response to estrogen treatment which leads to the assembly of the basal transcription machinery on the promoter resulting in an accumulation of cyclin D1 in the cells. Previous results from our lab also implicate YY1 in cell cycle regulation. YY1 is involved in the up regulation of the replication-dependent histone genes in normally cycling cells at the G1/S transition of the cell cycle. A seven base pair regulatory

element was identified in the coding region of all four classes of replication-dependent core histone genes (Kaludov et al., 1997) . This regulatory sequence, CATGGCG, called the alpha element, is a DNA binding site for YY1. Mutating four out of the seven base pairs disrupts YY1 binding and results in a significant decrease in histone gene expression (Eliassen et al., 1998). Another role for YY1 in the G1/S transition of the cell cycle is illustrated by its interaction with E2F on the Cdc6 promoter. The E2F transcription factors play a critical role in regulating transcription in response to the stimulation of cell proliferation. YY1 and E2F act synergistically in the expression of Cdc6 in rat embryonic fibroblast cells REF52 (Schlisio et al., 2002). YY1 is known for its functional interaction with multiple components of the cell cycle and its checkpoints. It also regulates multiple genes that are involved in cell cycle control. Since expression and function of YY1 are known to be critical for the progression through the phases of the cell cycle, deregulation of YY1 can result in tumorigenesis.

YY1 Regulation

YY1 is an essential gene that is ubiquitously expressed with a protein half-life of about 3.5 hours (Austen et al., 1997b). The expression of YY1 protein levels has been reported to be constant throughout the cell cycle (Palko et al., 2004; Rizkallah and Hurt, 2009). The function of YY1 is specifically essential in early development. The disruption of one allele results in significant growth retardation and developmental abnormalities and complete knock-out of the gene causes peri-implantation lethality in mice (Donohoe et al., 1999). YY1 has also been shown to be essential in Xenopus development (Morgan et al., 2004). Many genes involved in the cellular proliferation, differentiation, development and apoptosis have been shown to be regulated by YY1 (Affar el et al., 2006b). Under certain physiological conditions, YY1 protein levels can be up regulated by the addition of growth factors, such as insulin-like growth factor-1 (IGF-1), fibroblast growth factor-2 (FGF-2) (Flanagan, 1995; Santiago et al., 2001), and by the cytokine

TNF-α (Huerta-Yepez et al., 2006). YY1 expression is stimulated by the transcription factor NF-kappa B, which directly binds to the YY1 promoter (Wang et al., 2007). During skeletal myogenesis, YY1 can be down-regulated by miR-29, which targets the 3’-UTR of YY1 mRNA and blocks translation (Wang et al., 2008). Raf kinase inhibitor protein (RKIP), a metastasis suppressor gene can also down-regulate YY1 expression through inhibiting its transcription (Baritaki et al., 2007a). YY1 protein levels have been shown to be deregulated during tumorigenesis and elevated YY1 levels have been detected in many types of cancers (Gordon et al., 2006; Zaravinos and Spandidos, 2009, 2010). For example, high levels of YY1 were observed in many tumor types including cervical cancer (Baritaki et al., 2007b), ovarian cancer (Baritaki et al., 2007b), prostate cancer (Seligson et al., 2005), breast cancer (Begon et al., 2005), colon cancer (Chinnappan et al., 2009), osteosarcoma (de Nigris et al., 2006), acute myeloid leukemia (Erkeland et al., 2003), brain cancer (Baritaki et al., 2009), and large B-cell and follicular lymphoma (Sakhinia et al., 2007). In addition, elevated YY1 transcript and protein levels were found in cervical malignant transformed cells, and was associated with the presence of Human Papilloma Virus (HPV) infection (Baritaki et al., 2007b). The putative role of YY1 in tumorigenesis is also supported by its involvement in programmed cell death (apoptosis). YY1 was recently found to be involved in the apoptotic cell death mechanism (Krippner-Heidenreich et al., 2005). YY1 is cleaved by caspases both in vitro and in vivo in response to apoptotic stimuli. Two distinct caspase cleavage sites were identified in the transactivation domain of YY1. The two sites

IATD12G and DDSD119G are cleaved by caspase 6 and caspase 7, respectively. This process generates two N-terminally truncated fragments, YY1Δ12 and YY1Δ119, which have lost their first 12 and 119 amino acids (Krippner-Heidenreich et al., 2005). The C- terminal DNA binding domain remains intact in both fragments. However, the N-terminal caspase 7 cleavage fragment (YY1Δ119) is no longer able to stimulate gene transcription. Interestingly, YY1Δ119 enhances Fas-induced apoptosis, suggesting that cleaved YY1 plays a positive feedback role during later stages of apoptosis (Krippner- Heidenreich et al., 2005).

Walowitz et al analyzed gene expression and protein level of YY1 during the differentiation of rat skeletal and cardiac muscle cells. They found that although YY1 mRNA levels did not change significantly, the YY1 protein levels decreased sharply as myoblasts proceeded in myogenesis. YY1 protein levels were almost absent in fully differentiated myotubes, leading to the hypothesis that YY1 is degraded during this process. YY1 was found to be a cleavage substrate for Calpain II, in vitro and in vivo, and a degradation substrate for the 26S proteasome in vivo. Since degradation through the 26S proteasome pathway is usually preceded by ubiquitination, the possibility that YY1 can be a substrate for this kind of modification was investigated. In an in vitro assay YY1 was found to be a substrate for ubiquitination. The C-terminal region of YY1 was essential for this ubiquitination (Walowitz et al., 1998).

Posttranslational Regulation of YY1 Posttranslational modifications modulate the activity of most transcription factors. Such modifications can rapidly and reversibly regulate nearly all transcription factor functions, including subcellular localization, stability, interactions with cofactors, and transcriptional activities. Several types of posttranslational modifications have been shown to affect the function of YY1.

Acetylation. Acetylation of a protein is the reversible addition of an acetyl group to one or more of its lysine residues. This modification neutralizes the positively charged lysine side chain, possibly altering the conformation of the protein, and thus its function. Acetylation is being widely studied today in the context of epigenetics. Acetylation is best known for its involvement in regulating histones and the state of chromatin. Modification of histone proteins by acetylation affects their net positive charge and consequently their interaction with the negatively charged DNA, by loosening chromatin structure and facilitating the access of transcription factors to specific DNA sequences. Acetylation of histone proteins is mostly associated with activation of transcription (Durrin et al., 1991; Shahbazian and Grunstein, 2007; Strahl and Allis, 2000). YY1 recruits HATs (histone acetyl transferases) and HDACs (histone deacetylases) as part of its gene regulation activity (Shi et al., 1997). As discussed 11

earlier, YY1 has been shown to interact with p300 and this interaction possibly plays a role in the switch from repression to activation in YY1’s function (Lee et al., 1995a). Moreover, it was discovered that the YY1 protein itself can be modified by acetylation and deacetylation. YY1 is acetylated by the HATs, p300 and PCAF (p300-CBP associated factor). Both HATs acetylate YY1 at lysine sites in the central glycine-lysine-rich domain of residues 170 to 200, although the exact lysine residues were not mapped (Yao et al., 2001). PCAF also acetylates lysine residues at the C-terminal DNA-binding zinc finger domain. Acetylation of the central region is required for the full transcriptional repressor activity of YY1 and targets YY1 for active deacetylation by the histone deacetylases (HDACs), whereas acetylation of the C-terminal zinc finger domain decreases the DNA- binding activity of YY1 to the adeno-virus promoter region P5 in vitro (Yao et al., 2001). Regulation of YY1 activity by acetylation also plays a decisive role in the mouse homeobox gene Otx2 expression in vivo. Only the acetylated form of YY1 can recognize the sequence in the enhancer region, whereas both acetylated and non-acetylated YY1 can bind to the promoter region of the Otx2 gene (Takasaki et al., 2007). A company called Cell Signaling Technology (CST) uses a global proteomic approach and high-throughput studies to identify different types of posttranslational modifications present in the proteome. Many of the post translationally modified sites are discovered by using mass spectrometric base techniques. CST has identified multiple acetylated lysine residues on YY1 in vivo (Table1).

O-linked-glycosylation. O-linked N-acetylglucosaminylation (O-GlcNAc) or O- linked glycosylation is formed by the enzymatic addition of N-acetylglucosamine (GlcNAc) to serine or threonine residues by nucleo-cytoplasmic glycosyltransferase (Kreppel et al., 1997). This modification occurs at sites similar to those modified by protein kinases and might be as abundant as serine/threonine phosphorylations (Hart, 1997). This reversible posttranslational modification is present in a variety of proteins, including numerous chromatin-associated proteins and several transcription factors. It has been shown that nuclear YY1 gets O-GlcNAcylated in primary human coronary artery smooth muscle cells (CASMC) in response to glucose stimulation. Glycosylated

YY1 no longer binds the Rb protein and upon its dissociation, the glycosylated YY1 is free to bind DNA (Hiromura et al., 2003), suggesting that glycosylation is one way of regulating the activity of YY1. The amino acid residue(s) being glycosylated was not identified in this study.

S-nitrosation. S-nitrosation is the transfer of a nitric oxide group (NO) to a cysteine residue of a protein through the reaction of a NO free radical with the thiol group of a cysteine side chain. NO is produced in mammalian cells by the action of nitric-oxide synthase enzymes (NOS). Several isoforms of NOS have been reported in different tissues and cell types and shown to be involved in a wide range of cellular processes. As a water-soluble gas, NO can easily diffuse inside the cell, acting as a signaling molecule and exerting various effects on the structure of proteins, modulating

their functions (Stamler et al., 2001). C2H2 zinc finger proteins can be drastically affected by this modification. Nitrosation of cysteine residues in a zinc finger motif disrupts its proper folding coordinated by the zinc ion. S-nitrosation has important roles in many biological processes such as signal transduction, DNA repair, blood pressure control and ion channel regulation (Broillet, 1999). Recent work has revealed that YY1 is S-nitrosylated in prostate cancer cells. NO inhibits YY1 DNA-binding activity to its consensus site in the Fas ligand promoter through S-nitrosation and consequently results in up-regulation of Fas expression and tumor cell sensitization to Fas-induced apoptosis (Hongo et al., 2005).

Ubiquitination. The covalent conjugation of ubiquitin, a conserved 76-residue polypeptide to other cellular proteins targets it for proteolysis. This modification occurs through a three-step mechanism, executed by three enzymes: an activating enzyme (E1), a conjugating enzyme (E2), and a ligase (E3). It occurs on the ε-amino group of a lysine residue in a target protein. Degradation is not the only fate possible for ubiquitin- tagged proteins. These processes include ribosomal function, post replicational DNA repair, the initiation of the inflammatory response, and the function of certain transcription factors (Pickart, 2001).

YY1 has been shown to be a degradation substrate for the 26S proteasome in

vivo. Treating Sol8 myoblasts with MG132, an inhibitor of the 26S proteasome, increases YY1 protein levels. Since degradation through the 26S proteasome pathway is usually preceded by ubiquitination, the possibility that YY1 can be a substrate for this kind of modification was also investigated. In a in vitro assay, YY1 was found to be a substrate for ubiquitination. The C-terminal region of YY1 was essential for this ubiquitination (Walowitz et al., 1998), however the exact lysine residue being modified was not determined. YY1 also interacts with mouse double minute 2 protein (Mdm2, or Hdm2 for the human ortholog), an E3 ubiquitin ligase, and directs the ubiquitination and subsequent degradation of p53 (Gronroos et al., 2004; Sui et al., 2004). Ubiquitination of YY1 by Hdm2 was not observed. Kim et al identified lysine 258 of YY1 located in the spacer region of the protein to be ubiquitinated in vivo. They characterized the human ubiquitin-modified proteome (ubiquitinome), using a global approach (Kim et al., 2011), therefore the specific function of this modification in YY1 was not studied. Cell Signaling Technology has also identified multiple ubiquitinated lysine residues on YY1 in vivo (Table I).

Sumoylation. Covalent modification of cellular proteins by the small ubiquitin-like modifier (SUMO) regulates various cellular processes, such as nuclear transport, transcriptional activitiy, stress response and cell-cycle progression. But, in contrast to ubiquitylation, sumoylation does not tag proteins for degradation, but seems to enhance their stability (Muller et al., 2001). SUMO group conjugation (10 KDa), similar to ubiquitination, occurs through a three-step mechanism, executed by three enzymes: an activating enzyme (E1), a conjugating enzyme (E2), and a ligase (E3) and occurs on the ε-amino group of a lysine residue in a target protein. (Geiss-Friedlander and Melchior, 2007). PIASy, a SUMO E3 ligase, has been shown to SUMOylate exogenously expressed HA-YY1 on lysine 288 in COS-7 cells. In addition, PIASy colocalizes with YY1 in the nucleus, stabilizes YY1 in vivo by increasing its half life, and decreases its transcriptional activity on the cdc6, c-myc, and ezh2 promoters (Deng et al., 2007).

Poly(ADP-Ribosyl)ation. Poly(ADP-ribosyl) transferase (ADPRT) is a nuclear enzyme that gets activated during DNA damage. It attaches a poly(ADP-ribose) chain to lysine, arginine, aspartic acid and glutamic acid residues on proteins. This modification is involved in the regulation of several cellular processes but is usually associated with DNA damage and repair mechanisms. YY1 has been shown to be poly(ADP- ribosyl)ated in HeLa cells under genotoxic stress. This modification is correlated with a decreased affinity of YY1 to its DNA binding sites in vitro. Interestingly, if YY1 is already bound to DNA, ADPRT is not able to modify it (Oei et al., 1998).

Methylation. Methylation of a protein is the reversible addition of a methyl group to lysine or arginine residues by methyl-transferases. Protein and DNA methylation are being widely studied today in the context of epigenetics. Methylation is best known for its involvement in regulating histones and the state of chromatin. Methylation of histones is mechanistically linked to other types of histone modifications, such as acetylation, phosphorylation, and monoubiquitylation (Lee et al., 2005). YY1 has been shown to interact with and recruit multiple histone methyltransferases, including, PRMT1 (Protein arginine N-methyltransferase 1), Ezh1 (enhancer of zest homologue 1) and Ezh2 (enhancer of zest homologue 2) (Baumeister et al., 2005; Caretti et al., 2005; Rezai-Zadeh et al., 2003; Wang et al., 2004) to specific gene promoters, however, no direct methylation of YY1 has been observed so far.

Table I. Known in vivo posttranslational modifications of YY1.

Site Modification Function

K174, K203, K204, Acetylation DNA binding and K258, K339, K359 Cell Signaling transcriptional regulation Technology Unknown O-linked-glycosylation Inhibits Rb interaction with (serine/threonine) Hiromura et al., 2003 YY1

K288 Sumoylation Protein stability and Deng et al., 2007 transcriptional regulation

Unknown Poly(ADP- DNA binding Ribosyl)ation Oei et al., 1998

Unknown S-nitrosation DNA binding (cysteine) Hongo et al., 2005

K203, K258, K288, Ubiquitination Protein degradation K409 Kim et al., 2011 and Cell Signaling Technology

Phosphorylation. Protein phosphorylation is an important posttranslational modification that eukaryotic cells use in signaling pathways in response to changes in their extracellular or intracellular environment. It is the reversible addition of one or several phosphate groups to the hydroxyl group of serine (S), threonine (T), or tyrosine (Y) residues of a protein in an ATP-dependent fashion by enzymes known as kinases. The removal of the phosphate group from proteins is mediated by enzymes known as phosphatases (Hunter, 1995). The addition of the phosphate group introduces a high negative charge to the modified region, potentialy altering the protein’s 3-D structure and folding, and thereby regulating its functions (Cohen, 2000; Shen et al., 2005). These modifications either positively or negatively affect transcription factor activity by regulating distinct aspects of transcription factor function (Figure 3). Since all phosphate

groups look alike, to be useful in signaling, the phosphate groups must be attached in the proper place and at the proper time.

Figure 3. Protein phosphorylation and protein dephosphorylation regulate the activities of transcription factors through multiple mechanisms. (Whitmarsh and Davis, 2000)

YY1 has long been reported to be a phosphoprotein (Becker et al., 1994). Treatment of Jurkat T-cell nuclear extracts with PAP (potato acid phosphatase) led to the loss of YY1 binding activity to the UCR (upstream conserved region) present in the conserved murine leukemia virus long terminal repeat in an in vitro binding assay. The binding activity detected in these extracts was attributed to UCRBP (UCR Binding Protein, now an archaic name for YY1). The authors concluded that phosphorylation of YY1 was required for DNA binding activity (Becker et al., 1994). The possibility that the 17

phosphatase treatment had an indirect effect was not explored. Similar work in our lab reported that phosphorylation had an inhibitory effect on the DNA binding activity of YY1, unlike what was reported by Becker et al in 1994. Incubating mouse myeloma cell nuclear extracts at 37°C prior to the in vitro binding reactions completely abolished the binding of YY1 to the alpha element of the replication dependent histone gene H3.2α in vitro (Eliassen et al., 1998; Kaludov et al., 1996). Adding either PTP-1B, a tyrosine phosphatase or PP2A, a serine/threonine specific phosphatase to the extracts, restored the DNA binding activity of YY1 that was lost in the extracts incubated at 37°C (Kaludov et al., 1996). This result indicated a possible regulatory phosphorylation event which abolished the binding activity of YY1 to the H3.2α site. However, bothese th studies used only indirect methods. Furthermore, in 1997 Shi et al showed that phosphatase treatment did not have any effect on the binding of YY1 to the AAV p5 promoter (Shi et al., 1997). Therefore, early studies on phosphorylation of YY1 and its DNA binding activity were indirect and contradictory. These contradictory results could have been due to the use of different experimental systems involving different cell lines, different DNA binding elements in different genes and different phosphatases. The first direct evidence to show that YY1 is a phosphoprotein came in 1997 by Austen et al. Using lysates of [32P] orthophosphate-labeled cells, YY1 was immunoprecipitated and shown to be phosphorylated. YY1 phosphorylation levels were analyzed under different cellular conditions, but no differences in the phosphorylation pattern of YY1 were observed during growth or differentiation (Austen et al., 1997b). A similar type of experiment was done in 2000 by Patten et al. [32P] orthophosphate- labeled cells revealed an increase in phosphorylated YY1 in neonatal rat cardiac myocytes treated with IL-1β (Interleukin-1 beta), in correlation with a hypertrophic phenotype. In addition to an increase in the phosphorylation levels of YY1, its protein levels were also increased. The authors proposed that this phosphorylation was necessary for the repression activity of YY1 and for the hypertrophic phenotype of these cells. Phosphatase (PAP) treatment of nuclear extracts from these myocytes abolished the binding activity of YY1 to the α-actin promoter site in an in vitro binding assay (Patten et al., 2000).

A comparable experiment using radioactive orthophosphate to confirm YY1 phosphorylation was also performed by our lab. Moreover, we were able to show an increase in the phosphorylation levels of YY1 in nocodazole-blocked mitotic cells versus YY1 in asynchronously growing cells. During prophase of mitosis, YY1 was excluded from the nucleus and distributed in the cytoplasm until early telophase when YY1 returned to the DNA. The distribution of YY1 to the cytoplasm correlates with the increase in YY1 phosphorylation and loss of YY1 DNA-binding activity in mitosis (Rizkallah and Hurt, 2009). This study also confirmed the inhibitory effect of phosphorylation on YY1 DNA-binding activity in vitro in an electrophoretic mobility shift assay (EMSA) using three different YY1 consensus binding sites (H3.2α, p5-60, and Cdc6 promoter), further supporting the previous observations of the Hurt lab (Eliassen et al., 1998; Kaludov et al., 1996). The Hurt Lab was also the first to directly report phosphorylated amino acid residues in YY1. To identify the specific phosphorylation site(s) causing the loss of DNA binding activity, mass spectrometric analysis was performed using Flag-YY1 purified from mitotic HeLa cells. Three phosphorylation sites were identified: serine 247, threonine 348, and threonine 378. To examine if phosphorylation at these sites can cause the loss of YY1 DNA-binding activity, phosphomimetic mutants were generated at the identified sites. Phosphomimetic substitution at serine 247 located in the spacer region of YY1 protein did not have a substantial effect on the DNA-binding activity of YY1. On the other hand, phosphomimetic, as well as, alanine substitutions at threonines 348 and 378 abolished YY1 DNA-binding activity (Rizkallah and Hurt, 2009). Threonines 348 and 378 are not located in any of YY1’s four zinc finger domains, all of which are required for full DNA-binding activity (Austen et al., 1997b). In fact, these threonines are located within linker peptides joining zinc fingers 2 and 3 (threonine 348), and fingers 3 and 4 (threonine 378) and are critical for DNA-binding activity (Rizkallah et al., 2011a; Rizkallah and Hurt, 2009). The kinase(s) responsible for these modifications is yet to be determined. In addition, we have identified the first two kinases proven to phosphorylate YY1. We identified Plk1 (Polo-like kinase 1) as the kinase that phosphorylates YY1 in vitro as well as in vivo on threonine 39, an amino acid located in the N-terminus in the activation

domain of YY1 (Figure 3)(Rizkallah et al., 2011b). This phosphorylation is cell cycle regulated and takes place at the G2/M transition. In a recent study, we identified serine 118 in the transactivation domain of YY1 as the site of CK2α (Casein kinase 2 α) phosphorylation, proximal to a caspase 7 cleavage site (Krippner-Heidenreich et al., 2005). CK2α inhibitors, as well as knockdown of CK2α by small interferingRNA, reduce S118 phosphorylation in vivo and enhance YY1 cleavage under apoptotic conditions. A serine-to-alanine substitution at serine 118 increases the cleavage of YY1 during apoptosis compared to wild-type YY1. This study identified a regulatory link between YY1 phosphorylation at serine 118 and regulation of its cleavage during programmed cell death (Riman et al., 2012). Recently, YY1 was shown to be an important modulator of peripheral nervous system (PNS) myelination downstream of neuregulin1 (NRG1) signaling. YY1 regulates Egr2, an important regulator of peripheral myelination in response to NRG1 (He et al., 2010). Protein extracts from Schwann cells treated with NRG1 show an increase in phosphorylated serine on YY1 in a Western blot analysis using a general anti-phospho- serine antibody. To identify the kinase phosphorylating YY1 in response to NRG1, multiple inhibitors were used against the three main pathways downstream of NRG1. The inhibitors used were against Akt activity (LY294002), MEK kinase (U0126 and PD98059) and the phospholipase C (PLC)γ-calcineurin pathway (cyclosporin A (CsA). Of these compounds, only the MEK inhibitors impaired the NRG1-mediated increase in Egr2 expression and blocked YY1 phosphorylation; however, this block on YY1 phosphorylation was not shown. To determine the function of the phosphorylation of YY1, three serine residues that had been previously shown to be phosphorylated were mutated to alanine (S118, S184, S247)(Rizkallah and Hurt, 2009). The triple alanine mutant of YY1 affected the ability of YY1 to transactivate luciferase reporters driven by the Egr2 regulatory elements (He et al., 2010). The MEK kinase signaling cascade contains multiple kinases in its pathway and despite showing the significance of phosphorylation of YY1 as a key regulator of Egr2 expression, the exact kinase in the signaling cascade that was responsible for this phosphorylation was not directly identified.

The phosphorylation of YY1 by the MEK/ERK signaling pathway was also implicated in another study by Zheng et al. Fentanyl-induced ERK activation led to the phosphorylation of YY1. The site of phosphorylation was not identified, rather an increase in phospho-signal was observed when using a general phospho-antibody in a Western blot analysis from cell lysates of primary mice hippocampal cultures treated with fentanyl. The phosphorylation of YY1 led to a decrease in transcription of the talin2 gene locus and subsequently the cellular content of the microRNA miR-190 (Zheng et al., 2010). MiR-190 is conserved and located in the intronic regions of the talin2 gene in the mouse, rat, and human genomes and has important central nervous functions. In addition, YY1 phosphorylation impaired the association of YY1 to the talin2 promoter in an in vitro binding assay. YY1 association to the promoter is essential for the stimulation of talin2. Thus, fentanyl decreased the transcription of talin2 and subsequently the cellular level of miR-190 by inducing YY1 phosphorylation (Zheng et al., 2010). Similar to the previous study, the direct phosphorylation of YY1 by ERK was not shown nor was the phosphorylated site identified. In unpublished results from our lab, we have shown in an in vitro kinase assay that purified ERK can phosphorylate YY1 at serine 247 in the spacer region of YY1. In a recent article by Blattler et al.,YY1 was shown to play a pivotal role in the suppression of insulin/IGF signaling genes, such as Igf1-2, Irs1-2, and Akt1-3 in response to rapamycin, an mTOR inhihbitor (Blattler et al., 2012). The mTOR protein is part of two protein complexes, named mTORC1 and mTORC2. YY1 protein was shown to constitutively bind to mTORC1 through the REPO domain (spacer region). Rapamycin treatment led to the suppression of YY1 target gene expression, suggesting that YY1 phosphorylation might be involved in this transcriptional regulatory mechanism. Mass spectrometry was used to identify two novel phosphorylation sites in YY1, phospho-T30 and phosho-S365. These two sites were not detected in YY1 immunoprecipitated from rapamycin treated cells. It was shown that by blocking the mTOR pathway with rapaymycin treatment, YY1 dephosphorylation at T30 and S365 is induced. Moreover, mTOR regulated the interaction between YY1 and polycomb protein-2 corepressor (Pc2) through YY1 phosphorylation at T30 and S365. Non- phosphorylated YY1 recruits Pc2 to the promoters of insulin/IGF signaling genes,

increasing the level of H3K27 trimethylation and suppressing these genes (Blattler et al., 2012). Although YY1 phosphorylation depends on mTOR activity, it is unclear if mTOR directly phosphorylates YY1 at T30 and S365 or if other kinases are involved. Multiple phosphorylated residues have been mapped on YY1 (Figure 3 and Table II) by several large-scale phospho-proteomic studies from many different human cell lines (S118, S184, S247, Y251, Y254, T348, T378) (Beausoleil et al., 2004; Dephoure et al., 2008; Molina et al., 2007; Nousiainen et al., 2006). Cell Science Technology has also identified two novel phosphorylated sites by high-throughput studies (S185, Y187). Three conserved amino acid residues located in C-terminus of YY1 (S397, T398, S402) were also found to be phosphorylated in mice; phosphorylation of these residues in human cells has still not been shown (Huttlin et al., 2010). The amino acid residues in YY1 shown to be phosphorylated are summarized in table II. The kinases identified to be phosphorylating each site, the timing of the phosphorylation and the possible function of each phosphorylation are also listed.

Table II. In vivo phosphorylation sites of YY1

Site Kinase Timing Function

T30 mTOR signaling Unknown Protein/protein pathway Blattler et al., 2012 interaction and transcriptional regulation

T39 Plk1 G2/M Unknown (possible Rizkallah et al., transcriptional 2011b regulation)

S118 CK2α Constitutive YY1 cleavage protection Riman et al., 2012 during apoptosis

S180 Unknown Unknown Transcriptional Hurt Lab, regulation unpublished

Table II. In vivo phosphorylation sites of YY1 (Continued)

Site Kinase Timing Function

S184 Aurora B G2/M Transcriptional (in vivo) Hurt Lab, regulation PKA and ROCK1 unpublished and (in vitro) Molina et al., 2007

Y185 Unknown Unknown Unknown Cell Signaling Technology

S187 Unknown Unknown Unknown Cell Signaling Technology

S247 ERK1 Constitutive Unknown (in vitro) Rizkallah and Hurt 2009

Y251 FAK and ABL1 (Possibly in Unknown (in vitro) mitosis) Hurt Lab, unpublished and Cell Signaling Technology

Y254 FAK and ABL1 (Possibly in Unknown (in vitro) mitosis) Hurt Lab, unpublished and Cell Signaling Technology

T348 Unknown Mitosis DNA binding Rizkallah and Hurt 2009

Table II. In vivo phosphorylation sites of YY1 (Continued)

Site Kinase Timing Function

S365 mTOR signaling Unknown Protein/protein pathway (in vivo) interaction and Blattler et al., 2012 transcriptional regulation T378 Unknown Mitosis DNA binding Rizkallah and Hurt 2009 S397 Unknown Unknown Unknown (mouse) Huttlin et al., 2010

T398 Unknown Unknown Unknown (mouse) Huttlin et al., 2010

S402 Unknown Unknown Unknown (mouse) Huttlin et al., 2010

Kinases that Phosphorylate YY1 So far, multiple kinases have been identified to phosphorylate YY1 on serine, threonine and tyrosine residues, both in vitro and in vivo. The kinases are described below:

Polo-like kinase 1 (Plk1). Plk1 is a serine/threonine kinase, initially identified in Drosophila as Polo, and shown to play pivotal roles in proper spindle pole formation (Sunkel and Glover, 1988). In mammalian cells, Plk1 is a critical regulator of several important cell cycle events (Takaki et al., 2008a). Primarily, it is part of the intricate network orchestrating the accurate entry into mitosis and timely execution of cytokinesis (Brennan et al., 2007; Petronczki et al., 2008; van Vugt and Medema, 2005). Given

Plk1's multiple essential roles in cell division, the enzyme has emerged as an attractive target in anti-proliferative cancer therapy (Taylor and Peters, 2008). However, the reach of Plk1 extends well beyond mitosis. Plk1 has emerged as an important player in maintaining genomic stability during DNA replication and in modulating a checkpoint that responds to DNA damage (Takaki et al., 2008b). YY1 is phosphorylated by Plk1 at threonine 39 during the G2/M stage of the cell cycle (Rizkallah et al., 2011b).

Casein kinase 2α (Ck2α). Ck2α is a serine/threonine protein kinase, which phosphorylates and regulates many cellular substrates involved in cell growth, proliferation, differentiation, and tumorigenesis (Ahmad et al., 2008; Canton and Litchfield, 2006; Duncan and Litchfield, 2008; Duncan et al., 2010; Litchfield, 2003a; Meggio and Pinna, 2003). CK2 is ubiquitously present in all eukaryotic cells and highly conserved from yeast to humans, and is constitutively active in cells. Recent evidence suggests that CK2 can exert an anti-apoptotic role by protecting regulatory proteins from caspase-mediated degradation (Litchfield, 2003b). This type of regulation was also observed for YY1. Ck2α phosphorylation of YY1 at serine 118 protects its cleavage from caspase 7 cleavage during apoptosis (Riman et al., 2012).

Aurora B. The Aurora kinases constitute a family of conserved serine/threonine kinases that are involved in cell cycle regulation and play critical roles in mitosis (Vader and Lens, 2008). They were first discovered in a screen to identify genes involved in mitotic spindle function in Drosophila (Glover et al., 1995). Aurora B mRNA and protein expression levels peak at G2/M stage of the cell cycle and maximal kinase activity is reached during metaphase (Bischoff et al., 1998; Terada et al., 1998). Aurora B plays a critical role in the regulation of spindle assembly checkpoint pathway, chromosome condensation and biorientation, microtubule dynamics and cytokinesis (reviewed in (Katayama et al., 2003; Vader and Lens, 2008)). An array of Aurora B substrates have been identified so far, including histone proteins, spindle check point proteins, cytoskeletal proteins and enzymes (Goto et al., 2003; Hayama et al., 2007; Hergeth et al., 2011; Honda et al., 2003; Kawajiri et al., 2003; Oh et al., 2010; Sakita-Suto et al., 2007; Yang et al., 2011). More recently, the transcription factor p53 (Wu et al., 2011)

and the tumor suppressor Retinoblastoma protein (Nair et al., 2009) were also identified to be targets of Aurora B. In this study, we show that Aurora B phosphorylates YY1 at serine 184 during the G2/M stage of the cell cycle. This modification is important for YY1 transcriptional regulation (Hurt Lab, unpublished).

Protein kinase A (PKA). PKA or the cAMP-dependent protein kinase is a serine/threonine kinase that was characterized initially as mediating the effects of elevated cAMP levels (Walsh et al., 1968). The cAMP-PKA signaling was the first mammalian second messenger system to be characterized. PKA is ubiquitously present in all eukaryotic cells and highly conserved from yeast to humans. The PKA holoenzyme is comprised of four subunits, two of which are catalytically active (PKAC subunits), and two of each serve to regulate enzyme activity (PKAR subunits). PKA studies over the past forty years have identified hundreds (if not thousands) of PKA substrates, both in the nucleus and in the cytoplasm. They function in almost every aspect of cellular physiology (reviewed in (Kirschner et al., 2009)). YY1 was shown in this dissertation research project to be a target of PKA in vitro. It phosphorylates YY1 at serine 184 in the central regulatory domain of the protein (Hurt Lab, unpublished).

Rho-associated kinase 1 (ROCK1). ROCK1 is a serine/threonine protein kinase. In the mammalian system, it consists of two isoforms, ROCK1 and ROCK2, which were found to be among the first downstream targets of RhoA GTPase signaling cascade (Ishizaki et al., 1996). ROCK1 is an important regulator of cell growth, migration, motility and apoptosis via control of actin cytoskeletal assembly. Recent experiments have defined new functions of ROCKs in cells, including centrosome positioning and cell-size regulation (Riento and Ridley, 2003). YY1 was shown in this dissertation research project to be a target of ROCK1 in vitro. It phosphorylates YY1 at serine 184 in the central regulatory domain of the protein (Hurt Lab, unpublished).

Extracellular signal-regulated kinase 1 (ERK1). ERK1 is a mitogen activated serine/threonine protein (MAP) kinase. The signaling via the ERK cascade is mediated by sequential phosphorylation and activation of protein kinases in the different tiers of

the cascade. The main core phosphorylation chain of the cascade includes Raf kinases, MEK1/2, ERK1/2 (ERKs) and ribosomal s6 kinase (RSK). ERK1/2 regulate cellular processes such as proliferation, differentiation and cell cycle progression (Yoon and Seger, 2006). Dozens of ERK substrates have been identified, including transcription factors, protein kinases and phosphatases, cytoskeletal elements, regulators of apoptosis, and a variety of other related signaling molecules. YY1 was shown to be a target of ERK1 in vitro. It phosphorylates YY1 at serine 247 in the spacer region of the protein (Hurt Lab, unpublished). In another study, Fentanyl-induced ERK activation was shown to increase the phosphorylation of YY1, however the direct phosphorylation of YY1 by ERK was not shown (Zheng et al., 2010).

Focal adhesion kinase (FAK). FAK is a non-receptor tyrosine kinase that is activated by cellular interactions (intergrins) with the extra cellular matrix (ECM). The activated FAK undergoes autophosphorylation which allows it to bind to Src family kinases and other intracellular signaling molecules. This triggers the activation of multiple downstream pathways that regulate cell survival, apoptosis, cell cycle progression and proliferation, focal adhesion dynamics and cell migration. Changes in these functions are involved in epithelial to mesenchymal transition, tumor angiogenesis, and ECM remodeling during both normal embryonic development and tumor initiation, progression and metastasis (Zhao and Guan, 2009). YY1 was shown in this dissertation research project to be a target of FAK in vitro. It phosphorylates YY1 at tyrosines 251 and 254 in the spacer region of the protein (Hurt Lab, unpublished)

Abelson kinase (ABL1). ABL1, also known as c-Abl, is a ubiquitously expressed highly conserved non-receptor tyrosine kinase. It is located at the cell membrane, the actin cytoskeleton, cytosol and in the nucleus. The ABL1 kinase has many homeostatic roles that regulate cell survival, apoptosis, cell cycle progression and proliferation. It also modulates the cellular response to DNA damage. ABL1 has many oncogenic forms which include the retroviral oncoprotein v-Abl of the Abelson murine- leukemia virus and the human Bcr–Abl fusion oncoprotein that is implicated in human chronic myeloid leukemia (Sirvent et al., 2008). YY1 was shown in this dissertation

research project to be a target of ABL1 in vitro. Similar to FAK, It phosphorylates YY1 at tyrosines 251 and 254 in the spacer region of the protein (Hurt Lab,unpublished).

About a third of all eukaryotic proteins are controlled by phosphorylation of specific serine, threonine, and/or tyrosine residues. Phosphorylation modifications are reversible, and the phosphorylation level of a protein is determined by the balance between the activities of the protein kinases and phosphatases involved. So far, the only phosphatase that we have identified to directly dephosphorylate YY1 is protein phosphatase 1 (PP1). PP1 is a highly conserved serine/threonine phosphatase made up of a catalytic subunit that associates with dozens of different regulatory (R) polypeptides. PP1 has diverse functions ranging from cell cycle control, metabolism, ion channel regulation and actin reorganization (Ceulemans and Bollen, 2004). Increasing evidence suggests that PP1 reverses the action of the Aurora B kinase, specifically during mitosis. PP1 is known as an Aurora B antagonist, therefore, it is not surprising that PP1 dephosphorylates serine 184 of YY1 after Aurora B phosphorylation in vitro (Hurt Lab, unpublished).

Goals of the Project

Phosphorylation is one of the most important posttranslational modifications affecting transcription factor activity. Phosphorylation plays a pivotal role in a variety of important signaling pathways involved in cell cycle regulation. Kinase signaling pathways are now a major focus for biomedical research. Even though a significant amount of data concerning phosphorylated sites on YY1 has been discovered, the function and consequence of these phosphorylations are not yet known. Due to the critical role that YY1 plays in cell life and death, a better understanding of its regulation by phosphorylation is of great importance to human health and disease. The goal of this project was to study the phosphorylation of YY1 at serine 184 and its role in regulating YY1’s function and to identify and characterize novel tyrosine phosphorylation sites on YY1. Our studies are described here.

CHAPTER 2

AURORA B KINASE PHOSPHORYLATES THE TRANSCRIPTION FACTOR YY1 AT G2/M TRANSITION OF THE CELL CYCLE AND MODULATES ITS TRANSCRIPTIONAL ACTIVITY

Introduction

The zinc finger-containing transcription factor YY1 is a ubiquitously expressed multifunctional protein that is highly conserved among animal species. It has been shown to be the vertebrate homolog of the Drosophila melanogaster polycomb group protein Pleiohomeotic (Pho) (Brown et al., 1998). As a transcription factor, YY1 regulates the expression of many genes that are critical for embryogenesis, differentiation, replication, cellular proliferation and apoptosis (reviewed in (Gordon et al., 2006; Shi et al., 1997)). Total ablation of the YY1 gene in mice causes embryonic lethality at the peri-implantation stage, while disruption of one allele caused significant growth retardation and developmental abnormalities, reflecting the essential role of YY1 (Donohoe et al., 1999). At the cellular level, knockdown of YY1 slows cell cycle progression and cell proliferation and causes an accumulation of multinucleated cells with defects in cytokinesis (Affar el et al., 2006b). Depletion of YY1 has also been shown to reduce the expression of critical kinases that regulate mitosis and cytokinesis, such as Aurora A, Aurora B and Polo-like kinase 1 (Plk1) (Affar el et al., 2006b). In addition, genome-wide analysis of depleted YY1 mouse embryonic fibroblasts (MEFs) identified over 500 putative YY1 target genes (Affar el et al., 2006b). Even though a wealth of data exists on the regulation of YY1 target genes and the role of YY1 throughout the cell cycle, little is known on how the YY1 protein itself is controlled or the upstream signaling pathways that regulate its function. YY1 has been shown to be a target of many post-translational modifications. Multiple residues on YY1 have been shown to be modified by S-nitrosation (Hongo et

al., 2005), acetylation (Takasaki et al., 2007; Yao et al., 2001), O-linked glycosylation (Hiromura et al., 2003), sumoylation (Deng et al., 2007), and poly(ADP-ribosyl)ation (Oei et al., 1997a; Oei et al., 1998), all of which regulate the function and activity of YY1. More recently, we identified and mapped multiple phosphorylation sites in YY1, including, threonine 39, serine 118, serine 247, threonine 348 and threonine 378 (Riman et al., 2012; Rizkallah et al., 2011a; Rizkallah et al., 2011b; Rizkallah and Hurt, 2009). The first kinase proven to phosphorylate YY1 in vivo was Plk1, which phosphorylates threonine 39 during G2/M stage of the cell cycle (Rizkallah et al., 2011b). CK2α is another kinase identifiedas constitutively phosphorylating YY1 at serine 118. This modification protects YY1 cleavage by caspase 7 during apoptosis (Riman et al., 2012). Our lab also reported that phosphorylation of YY1 in the DNA binding domain (threonine 348 and threonine 378) during mitosis abolishes its DNA binding activity (Rizkallah and Hurt, 2009). We provide evidence here that a third kinase, the Aurora B kinase of the Aurora kinase family, also phosphorylates YY1 in vitro and in vivo. The Aurora kinases constitute a family of conserved serine/threonine kinases that are involved in cell cycle regulation and play critical roles in mitosis (Vader and Lens, 2008). They were first discovered in a screen to identify genes involved in mitotic spindle function in Drosophila (Glover et al., 1995). The mammalian genome contains three members of the Aurora kinase family, Aurora A, B, and C. Aurora B mRNA and protein expression levels, as well as Aurora A levels, peak at G2/M stage of the cell cycle and maximal kinase activity is reached during metaphase (Bischoff et al., 1998; Terada et al., 1998). Aurora B plays a critical role in the regulation of spindle assembly checkpoint pathway, chromosome condensation and biorientation, microtubule dynamics and cytokinesis (reviewed in (Katayama et al., 2003; Vader and Lens, 2008)). Aberrant expression of the Aurora kinases has been shown to cause cellular transformation and genetic instability. Given their importance in mitosis and overexpression in human cancers (Giet and Prigent, 1999), Aurora kinases have been identified as promising therapeutic targets, and extensive effort has been devoted to developing inhibitors of these kinases and understanding their signaling pathways (Carpinelli and Moll, 2008; Taylor and Peters, 2008).

An array of Aurora B substrates has been identified so far, including, histone proteins, spindle check point proteins, cytoskeletal proteins and enzymes (Goto et al., 2003; Hayama et al., 2007; Hergeth et al., 2011; Honda et al., 2003; Kawajiri et al., 2003; Oh et al., 2010; Sakita-Suto et al., 2007; Yang et al., 2011). More recently, the transcription factor p53 and the tumor suppressor Retinoblastoma protein (Rb) were shown to be targets of Aurora B. By directly phosphorylating Rb, Aurora B was shown to regulate the post-mitotic checkpoint (Nair et al., 2009). Aurora B was also found to phosphorylate multiple sites in the DNA binding domain of p53, which significantly impaired p53 transcriptional activity (Wu et al., 2011). These studies show a wide range of Aurora B substrates, including important cell cycle regulators and transcription factors such as YY1.

Materials and Methods

Cell Culture and Reagents HEK293 and HeLa S3 cells were grown in DMEM (Cellgro, Herndon,VA) supplemented with 10% fetal bovine serum (FBS; Sigma, St. Louis, MO), 1% nonessential amino acids (Sigma, St. Louis, MO), and 1% Penicillin-Streptomycin (Mediatech). U2OS cells were cultured in McCoy’s 5A medium (Cellgro, Herndon,VA) supplemented with 10% FBS and 1% Penicillin-Streptomycin. All cells were grown at 37°C in 5% CO2. Cells were trypsinized and split into new plates at subconfluency. The Aurora kinase inhibitor, VX-680 (T-2304 Tozasertib, MK-0457), was purchased from LC Laboratories (Woburn, MA) and dissolved in DMSO at 10mM stock concentration.

Whole Cell Extract Preparation After washing cells three times with cold PBS on ice, cells were scraped in freshly prepared ice-cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% NP-40, and 2mM EDTA, 1mM DTT, 10 mM NaF, 25 mM β-glycerophosphate and a cocktail of protease inhibitors (Sigma). Cells were lysed on ice for 15 minutes. Lysates were

pipetted up and down several times to shear DNA followed by centrifugation at 18,000 x g for 15 minutes at 4ºC.

Western Blotting Protein samples were separated on sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE) and then transferred by electroblotting onto a Trans-Blot Transfer Membrane (Bio-Rad Laboratories). After blotting, the transfer of proteins was inspected by quickly staining and destaining the membrane with Ponceau S solution (Sigma). Afterwards, the membrane was blocked for 30 minutes at RT in blocking solution (TBS, 0.5% Tween-20, 8% non-fat dry milk), and then incubated with primary antibodies in blocking solution overnight at 4ºC. The membrane was washed 3 times for 10 minutes with PBST (PBS with 0.5 % Tween-20). Horseradish peroxidase (HRP)-conjugated anti- mouse or anti-rabbit (GE Healthcare, Waukesha, WI) were added to the membrane in blocking solution and incubated for an hour at RT, after which it was washed as above. Specific protein bands were detected by the addition of SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL) for 5 minutes and exposure to X- Ray film (Fuji Medical Systems, Stamford, CT). Three anti-YY1 antibodies from Santa Cruz Biotechnology were used for Western blot analyses. Anti-YY1 (C20), a rabbit polyclonal antibody, recognizes the last 20 amino acids at the C-terminal end of YY1. Anti-YY1 (H10) is a mouse monoclonal antibody raised against the full-length protein, while anti-YY1 (H414) is a rabbit polyclonal antibody raised against the full-length protein. Other antibodies used for Western blotting were anti-Flag, anti-Cyclin B1, anti- GAPDH, and anti-acetyl-lysine (all Santa Cruz Biotechnology, Santa Cruz, CA). The rabbit polyclonal anti-pS184 was generated by New England Peptide using a synthesized phospho-peptide corresponding to amino acids 177-189 (Ac- GKKSGKK(p)SYLSGG-amide).

with antibody for 3 hours, rotating at 4ºC. Protein A-agarose beads were then added to the mixture and incubated for an additional hour. Immune complexes bound to the beads were collected by centrifugation at 500xg, 4ºC, for 2 minutes, and then washed 3 times with lysis buffer. SDS-PAGE buffer was added to the beads and boiled for 3-5 minutes. Samples collected from the beads were separated on a 10% SDS-PAGE gel, and stained with Coomassie blue. For IP of Flag-YY1 and Flag-Aurora B with anti-Flag antibody, the same procedure was followed, except that anti-Flag mouse monoclonal antibody cross-linked to resin beads (Resin M2, Sigma) was used. Resin M2-anti-Flag was added to the lysates and the mixture was incubated for 4 hours at 4ºC with rotation. For IP of HA-Aurora A, anti-HA anitbody ( Covance, Princeton, NJ) was used.

Electrophoretic Mobility Shift Assays (EMSA) Double stranded DNA oligonucleotides were end-labeled using T4-polynucleotide kinase (New England Biolabs) and P32 gamma-ATP or by fill-in reactions using the Klenow fragment of Polymerase I (Pol I) (New England Biolabs) and 32P labeled alpha- ATP. Whole cell extracts, nuclear extracts, or purified YY1 were incubated with the 32P labeled oligonucleotides (probe) on ice for 25 minutes, in binding buffer (10mM Tris pH 7.5, 50mM NaCl, 1mM DTT, 5% glycerol). The protein-DNA complexes were then separated on 6% (or 8%) native polyacrylamide gels, fixed briefly (10-15 minutes) in 10% acetic acid, 10% methanol, and dried for one hour before exposure to phosphorimager screens. Exposure varied from 1 hour to overnight. Then the screen was then scanned using a Typhoon 9410 Imager (Amersham Biosciences).

H3.2α oligonucleotide:

5’-gatcCTCGGCCGTCATGGCGCTGCAGGAGGCA-3’ 3’-GAGCCGGCAGTACCGCGACGTCCTCCGTctag-5’

Adeno-associated virus (AAV) (p5-60):

5’-gatcCGTTTTGCGACATTTTGCGACACA-3’ 3’-GCAAAACGCTGTAAAACGCTGTGTctag-5’

Plasmid Construction and Bacterial Expression of GST-YY1 GST-YY1 (1-200a.a.) deletion mutant was constructed by digesting pGEX-2T- YY1 full length (Rizkallah et al., 2011b) with EcoRI/SmaI and religated after blunting the EcoRI site. Rosetta (DE3) cells (Novagen) were transformed with the pGEX-2T-YY1 constructs and grown overnight in LB Miller broth medium (EMD) with ampicillin (100µg/ml final concentration). The overnight culture was diluted 1:10 in the same medium (with ampicillin) and grown to a density of 0.6 O.D. (about 1 hour), then induced with isopropyl β-D-1-thiogalactopyranoside (IPTG-Sigma-Aldrich) at a final concentration of 0.5 mM for about 4 hours. The volume of the culture never exceeded 25 % of the volume of the flask to allow proper aeration of the cells. Cells were pelleted by centrifugation at 3000xg for 15 minutes at 4ºC, and then resuspended in lysis buffer (ice-cold phosphate-buffered saline (PBS) pH 8.0 or 50 mM Tris pH 8.0, 150 mM NaCl) supplemented with a cocktail of protease inhibitors (Sigma). The suspension was sonicated on ice (three bursts, 15 second each, with 2 minutes intervals between sonication bursts to allow cooling). Lysates were cleared by centrifugation at 18,000xg for 30 minutes at 4ºC in a microcentrifuge, then incubated with immobilized glutathione beads (Pierce) (prewashed 3 times with lysis buffer, 10 volumes each wash) with rocking for 2-4 hours at 4ºC. The slurry of beads and lysates was then centrifuged at 500xg for 2 minutes at 4ºC. After aspirating the supernatant, the beads were washed 3 times, 10 volumes each time, with lysis buffer and the purified GST-YY1 attached with the beads was used in in vitro kinase assays.

Cold in Vitro Kinase Assay Non-tagged YY1, produced as previously described (Rizkallah et al., 2011b) or GST-YY1 attached to glutathione beads were used in cold in vitro kinase assays with purified Protein Kinase A (α and γ) catalytic domain, ROCK1, Plk1, PAK1 or Aurora (A ,B and C) which were purchased from SignalChem (British Columbia, Canada). Kinase reactions were performed in kinase buffer (50 mM Tris pH 7.5, 150 mM NaCl, 10 mM

MgCl2, 3 mM cold ATP) for 30 minutes at 30° C, with shaking. Reactions were then stopped by the addition of SDS-PAGE buffer and loaded for separation on a 10% SDS- PAGE gel.

For the kinase assays using HeLa and HEK293 whole cell extracts as the kinase source, 50μg extracts were added to GST-YY1 attached to glutathione beads in kinase buffer supplemented with phosphatase inhibitors. After incubation, the GST-YY1 bead complexes were pelleted by centrifugation, and cell extracts were aspirated. Beads were washed 2X with kinase buffer, and then boiled in 4X SDS-PAGE loading buffer, prior to loading on the gel and subsequent Western blotting.

Radioactive In Vitro Kinase Assay Kinase reactions were performed in kinase buffer (50 mM Tris pH 7.5, 150 mM 32 NaCl, 10 mM MgCl2, 50 µM ATP, 0.25 µM P-γ-ATP, 5 mM beta-glycerophosphate, 10 mM NaF, 1 mM DTT) for 30 minutes at 30°C, with shaking. GST-YY1 attached to glutathione beads were incubated with Aurora B, Protein Kinase A (γ) catalytic domain or ROCK1. Reactions were then stopped by the addition of 4X SDS-PAGE loading buffer and loaded for separation on a 10% SDS-PAGE gel. After staining with Coomassie Brilliant Blue R-250, to visualize the protein bands, gels were dried and exposed overnight to a Phosphorimager screen at room temperature. The screen was then scanned on a Typhoon 9410 imager (GE Healthcare, Waukesha, WI) for analysis.

In Vitro Acetylation Assay Acetylation reactions were performed in acetylation buffer (50 mM Tris pH 7.5, 50 mM KCl, 10 mM Na-Butyrate, 5% glycerol, 1 mM DTT and 1mM Acetyl-CoA) for 1 hour at 30°C, with shaking. Non-tagged YY1 or GST-YY1 attached to glutathione beads were incubated with purified p300-HAT domain (Active Motif, Carlsbad, CA). Reactions were then stopped by the addition of SDS-PAGE buffer and loaded for separation on a 10% SDS-PAGE gel.

In Vitro Phosphatase Assay Immunoprecipitation (IP) of Flag-YY1 from HEK293 cells transiently overexpressing Flag-YY1 was performed using the anti-Flag mouse mAb cross-linked to resin beads (Resin M2, Sigma). WCEs were prepared and incubated with the antibody overnight, rotating at 4°C. Resin M2-Flag-YY1 complex was collected by centrifugation

at 500 x g at 4°C for 2 min and then washed three times with lysis buffer and one additional time with lysis buffer without phosphatase inhibitors. Equal aliquots of the immuno-complex beads were then resuspended in phosphatase buffer (New England

BioLabs, Beverly, MA) in the presence of 2 mM MnCl2, and incubated at 30°C, with or without λ-phosphatase (New England BioLabs, Beverly, MA) for 30 min. Reactions were then stopped by the addition of 4 X SDS-PAGE buffer, and loaded for separation on a 10% SDS-PAGE gel. GST-YY1 beads phosphorylated by Aurora B were resuspended in phosphatase buffer in the presence of 2 mM MnCl2, and incubated at 30°C, with PP1 (New England BioLabs, Beverly, MA), PP2A (Millipore, Billerica, MA) or λ-phosphatase for 1 hour. Reactions were then stopped by the addition of 4 X SDS-PAGE buffer, and loaded for separation on a 10% SDS-PAGE gel.

Plasmid Transfections The pHM6-HA-Aurora A was a gift from Dr. Jin Cheng (Department of Molecular Oncology, Moffitt Cancer Center) (Yang et al., 2004); pcDNA3-Flag-Aurora B was a gift from Dr. Mong-Hong Lee ( Department of Molecular and Cellular Oncology, MD Anderson Cancer Center) (Gully et al., 2010). HA-Aurora A, Flag-Aurora B and Flag- YY1 (Rizkallah and Hurt, 2009) were transiently overexpressed into HEK293 cells using Lipofectamine transfection reagent (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions. Briefly, after equilibration with DMEM for 5 minutes, Lipofectamine was mixed with DNA in DMEM and incubated for 30 minutes prior to addition to HEK293 cells. After 6 hours, the medium/DNA/Lipofectamine mixture was replaced with fresh normal growth medium as described above.

Fluorescence-Activated Cell Sorter Analysis HEK293 cells were trypsinized, washed two times with PBS, and then fixed in 70% ethanol on ice for at least 2 hours. After washing off the ethanol, cells were resuspended in propidium iodide (PI) solution (50 μg/ml PI, 200 μg/mlase RN A, 0.1% Triton-X 100 in PBS) and incubated for 30 min at 30°C. The cell suspension was then passed through a 50 μm nylon mesh to remove clumps. Cells were then analyzed

based on DNA content on a fluorescence-activated cell sorter (FACS; FACS Canto; Becton Dickinson, San Jose, CA), and images were generated using BD FACS Diva software.

Cell Synchronization To synchronize HEK293 cells at G1/S, a double-thymidine arrest was performed as previously described (Whitfield et al., 2000). For the double thymidine arrest/release experiment, cells were synchronized with 2.5mM thymidine (Sigma) as described above, the cells were washed three times with PBS, one time with growth medium, and then released into fresh media. Samples were collected at the indicated time points. To synchronize cells at prometaphase, nocodazole (Sigma) was added to the medium at a final concentration of 100 ng/ml for 18 hours. For the nocodazole arrest/release experiment, cells were synchronized with nocodazole as described, then mitotic cells were detached from the plate surface by tapping the plate and collected by aspiration. Cells were washed two times with PBS and then one time with medium and replated in fresh growth medium. Samples were collected at indicated times for preparation of whole-cell extracts (WCEs).

Luciferase Assay Three different YY1 DNA binding sites (H3.2α, Cdc6p and P5-60) (Rizkallah and Hurt, 2009) were inserted upstream of the thymidine kinase promoter in the pGL4.17 luciferase vector from Promega. HEK293 cells were seeded at 2.5x10^5 cells/well in 6- well plates (35 mm). The next day, cells were co-transfected with 1.4 μg ofpCS2(+) Flag vector or pCS2(+) Flag-YY1 as indicated with 40ng of H3.2α-luciferase, Cdc6p- luciferase or P5-60-luciferase plasmids for 24 hours. Each sample was analyzed in triplicate. Flag-vector transfection was used as a control. Results were presented as percent change from Flag-vector. Luciferase assays were performed with the Dual- Luciferase reporter assay kit (Promega, Madison, WI) following the manufacturer’s instructions.

Mutagenesis Point mutants of YY1 at serine 180 and serine 184 residues to aspartic acid and alanine were generated using QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (La Jolla, CA). Mutagenesis was performed according to manufacturer’s instructions, using the human YY1 open reading frame in pET-20b(+)- YY1 plasmid (Rizkallah and Hurt, 2009) as a template. Primers were designed using the QuikChange Primer Design Program on the Agilent Technologies web site. All mutations were confirmed by sequencing. The mutated YY1 sequences were then subcloned into the pCS2(+) and pGEX-2T vectors as described previously (Rizkallah et al., 2011b; Rizkallah and Hurt, 2009).

Indirect Immunofluorescence For indirect immunofluorescence, cells grown on coverslips were washed three times with PBS, fixed with 3.7% formaldehyde for 10 min RT, and then washed three times with PBS. Cells were permeabilized for 10 min at room temperature with PBS containing 0.2% Triton-X-100 and subsequently were washed three times with PBS. Immunostaining was performed by overlaying the coverslips with blocking solution (PBST, 1% IgG-free BSA) for 30 min at 37°C. Primary antibody was then added to the coverslips, in blocking solution, and incubated for 1 h at 37°C. Anti-Flag antibody (Sigma) was added at a final concentration of 1 μg/ml. Coverslipse thenwer washed three times with PBST, and anti-rabbit Alexa-Fluor 546 (Molecular Probes, Eugene, OR) was then applied to the coverslips and incubated for 1 h at 37°C. After washing three times with PBST, cells were overlaid with DAPI solution (2 μg/mlin PBS) for 5 min, washed briefly, and mounted in Vectashield (Vector Laboratories, Burlingame, CA). Images were captured using a confocal microscope (Leica Microsystems, Exton, PA), taking 1μm sections of the cells. The overlay images were generated usingLeic a LCS Lite Software.

Results

Characterizing the anti-phospho-serine184 antibody YY1 is a ubiquitously expressed multifunctional transcription factor that belongs to the Polycomb Group protein family. It is involved in the transcriptional control of a large number of mammalian genes; therefore, understanding the phosphorylation signaling pathway that regulates YY1 function is crucial. Previously, we identified multiple phosphorylation sites in YY1 (Riman et al., 2012; Rizkallah et al., 2011a; Rizkallah et al., 2011b; Rizkallah and Hurt, 2009). However another novel phosphorylation site (Serine 184) was identified by a global mass spectrometry-based identification technique (Molina et al., 2007). Serine 184 of YY1 is a residue located in the central regulatory domain of the protein (glycine/alanine rich region) (Figure 4C). To better understand and characterize the phosphorylation of YY1 at serine 184, a rabbit polyclonal phospho-specific antibody (α-pS184) was developed against a synthetic peptide encompassing YY1 residues 177- 189 and containing a phosphorylation on serine 184. To test the phospho-specificity of the anti-pS184 antibody, we performed a dot blot assay spotting synthetic non- phosphorylated and phosphorylated forms of the peptide onto a nitrocellulose membrane. The anti-pS184 antibody efficiently recognized only the phosphorylated form of the peptide (Figure 4A). To investigate the presence of this phosphorylation in vivo, we prepared cell lysates from HEK293 cells growing asynchronously, treated with nocodazole, to arrest cells in mitosis, or treated with thymidine, blocking DNA replication and arresting cells at S stage of the cell cycle. The proteins in the extract were separated on an SDS-PAGE gel and transferred to a nitrocellulose membrane. The anti-pS184 antibody detected YY1 protein at the correct molecular weight in extracts from nocodazole-treated mitotic HEK293 cells and significantly less in both asynchronously growing and the thymidine- treated cells (Figure 4B, left panel). The phospho-band was confirmed to be YY1 by reprobing the blot with anti-YY1 antibody (Figure 4B, left panel). Transiently overexpressed Flag-YY1 in HEK293 cells further confirmed the presence of the phospho-signal as being that of phosphorylated YY1 protein, present at higher levels in mitotic cells compared to asynchronously growing cells (Figure 4B, middle panel). To

39 further validate the specificity of the anti-pS184 antibody and to verify that the phospho- antibody does not recognize non-phosphorylated YY1, Flag-YY1 was immunoprecipitated from transiently transfected HEK293 cells treated with nocodazole. Immunoprecipitated Flag-YY1 protein was then incubated with or without λ-phosphatase at 30°C for 30 minutes, followed by Western blot analysis with anti-pS184 antibody. We show that this signal is phospho-specific, since phosphatase treatment of the immunoprecipitated Flag-YY1 from nocodazole extracts abolished the signal (Figure 4B, right panel).

Anti-phospho-serine184 antibody specifically recognizes phosphorylation of YY1 We next mutated both serine 180 and 184 of YY1 individually or together into alanine, a non-phosphorylatable residue. We were also interested in studying phosphorylation at serine 180 because of the similarity of its surrounding amino acids (- 3 to-1 positions) to that of serine 184 (Figure 4C, left panel). To examine the specificity of the antibody to its target sequence in YY1, nocodazole treated HEK293 cells were transiently overexpressed with Flag- vector, Flag-YY1 wild type, Flag-YY1 S180A, Flag- YY1 S184A and Flag-YY1 S180,184A. Cell lysates were prepared and analyzed by Western blotting. Anti-pS184 antibody was able to detect phosphorylation at serine 184 in Flag-YY1 wild type protein as seen previously, however the single mutants of serine 180 and 184 showed significantly less phosphorylation compared to wild type. In addition, phosphorylation was completely abrogated in Flag-YY1 S180,184A double mutant protein (Figure 4D), suggesting that both serine 180 and serine 184 are phosphorylated in vivo. YY1 is ubiquitously expressed in all human tissues (Austen et al., 1997b). The presence of phosphorylation at serine 184 was observed in mitosis in three different cell lines derived from different tissues: HEK293, HeLa and U2OS (Figure 4E), suggesting a common regulatory mechanism for YY1. YY1 is also a highly conserved protein among animal species. Protein sequence alignment shows that serine 184 and the flanking amino acid region are evolutionarily conserved, particularly the positively charged lysine (K) residues at -1, -2, -5 and -6 positions relative to serine 184 (Figure 4C). These lysine

residues are likely a critical part of a sequence motif which may govern kinase-substrate recognition. We next performed a cold in vitro kinase assay using both HeLa and HEK293 asynchronous and mitotic extracts supplemented with 3mM ATP used as our kinase source. Bacterially expressed GST-YY1 wild type bound to glutathione beads were used as substrate. The results show that GST-YY1 wild type protein is phosphorylated at serine 184 to a greater extent when incubated with mitotic extracts compared to asynchronous extracts (Figure 4F). These results confirm that serine 184 is phosphorylated both in vitro and in vivo by a kinase present or highly active in mitosis.

Figure 4. Phosphorylation of YY1 in nocodazole blocked extracts is detected by anti-phospho-S184 antibody. (A) Dot blot assay of non-phosphorylated and serine 184 phosphorylated synthetic peptides of YY1 amino acid sequence 177 to 189 probed with anti-pS184. (B) Asynchronous, nocodazole treated (100ng/ml for 18 hours) and thymidine treated (2.5mM for 18 hours) HEK293 cell lysates were prepared, followed by Western blot. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody (left panel). Western blot analysis of asynchronous and

nocodazole treated HEK293 cells transiently transfected with Flag-YY1, probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody (middle panel). Flag-YY1 was immunoprecipitated from transiently transfected HEK293 cells treated with nocodazole. Flag-YY1 bound to anti-Flag mouse MAb cross-linked to resin beads was resuspended in phosphatase buffer, and incubated with (+) or without (-) λ- phosphatase at 30°C for 30 minutes, followed by a Western blot of the samples. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 (right panel). (C) Diagram showing the different domains of the YY1 protein. Amino acid residues 177-191 are shown, which include serine 180 and 184, as indicated (left panel). Amino acid sequence alignment of residues 177-191 of human YY1 with different animal species, as indicated (right panel). (D) Western blot analysis of nocodazole treated HEK293 cells transiently transfected with Flag- vector, Flag-YY1 wild type, Flag-YY1 S180A, Flag-YY1 S184A and Flag-YY1 S180,184A was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody. (E) Asynchronous and nocodazole treated (Asy or Noc) HeLa, HEK293 and U2OS cell lysates were prepared, followed by Western blot analysis. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody followed by anti-cyclin B1 antibody to show proper mitotic synchrony (left panel). (F) Cold in vitro kinase assay reactions using Hela and HEK293 whole cell extracts (50μg) as the kinase source. Both asynchronous (Asy) and nocodazole treated (Noc) extracts were used. Bacterially expressed GST-YY1 wild type bound to glutathione beads were used as substrate. The reactions were performed at 30°C for 45 minutes followed by Western blot analysis. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody to show equal GST-YY1 levels.

Phosphorylation of YY1 at S184 peaks at G2/M stage of the cell cycle We have shown that phosphorylation on serine 184 is present in mitosis, but to have a better understanding of the timing of this modification in the cell cycle, we synchronized HEK293 cells using double thymidine block as described in the methods section. After the second thymidine block, cells were released into fresh media and samples were collected at the indicated time points for cell cycle analysis using propidium iodide staining followed by Fluorescence Activated Cell Sorting (FACS) analysis or for cell lysate preparation. Figure 5A shows the cell cycle distribution of cells as they start to progress from the thymidine block. Cells blocked with double-thymidine show early S-phase DNA content. Two and four hours after release, cells progressed into S-phase. At six hours, cells appear to have G2 level of DNA content, and at eight hours, they appear to be at late G2 and moving through G2/M into mitosis. At ten hours, most cells had exited mitosis and entered G1. Twelve hours after release, all cells were in G1 of the new cell cycle (Figure 5A). Expression of cyclin B1 protein increases at the

43 end of S-phase and accumulates at the G2/M boundary. In anaphase, cyclin B1 levels drop dramatically through rapid degradation, therefore cyclin B levels can be used as a cell cycle marker (Sullivan and Morgan, 2007). As observed in figure 5B, cyclin B1 levels increase and reach their highest point eight hours post release and then decrease dramatically, indicating that the cells proceeded from S phase to G2 and into mitosis. Western blot analysis using anti-pS184 antibody indicate that serine 184 is phosphorylated mainly at the eight hour time point in correlation with the peak of cyclin B1 levels and G2/M transition by FACS analysis (Figure 5B). HEK293 cells were also synchronized in mitosis by nocodazole block for 18 hours and then released into fresh media. Western blot analysis was performed on HEK293 cell lysates collected at the indicated time points after nocodazole block and release. At the zero hour time point when all the cells are arrested in mitosis, cyclin B1 levels are at its highest and decrease dramatically as the cells are released into fresh media (Figure 5C, right panel), indicating that the cells proceeded from mitosis and into G1. Western blot analysis using anti-pS184 antibody indicate that serine 184 is rapidly dephosphorylated as the cells leave mitosis and enter into G1, indicating the presence of a highly active phosphatase and an inactivation and/or degradation of the kinase responsible for serine 184 phosphorylation.

Figure 5. Serine 184 phosphorylation on YY1 peaks at the G2/M stage of the cell cycle. (A) Cell cycle progression of HEK293 cells released after double-thymidine (2.5mM) block was analyzed by fluorescence-activated cell sorting. Cells were stained with propidium iodide to analyze DNA content. (B) HEK293 cells were synchronized at early S phase by double-thymidine block and then released into fresh media. Western blot was performed on HEK293 cell lysates collected at the indicated time points. The blot was probed with anti-pS184 antibody, then anti-YY1 antibody, followed by anti- cyclin B1 antibody. (C) HEK293 cells were also synchronized in mitosis by nocodazole block (100ng/ml) for 18 hours and then released into fresh media. Western blot was performed on HEK293 cell lysates collected at the indicated time points after nocodazole block and release. The blot was probed with anti-pS184 antibody, then anti- YY1 antibody followed by anti-cyclin B1.

YY1 is a substrate for the Aurora kinases Next, we were interested in identifying the kinase responsible for phosphorylation of YY1 at serine 184. Timing of the phosphorylation, which peaks at the G2/M stage of the cell cycle as well as the consensus phosphorylation site surrounding serine 184 directed us to the Aurora kinase family. The Aurora kinases are known to be highly active at G2/M (Nigg, 2001). Based on previously reported phosphorylation sites on Aurora substrates, a consensus phosphorylation motif has been established. In general, Aurora kinases phosphorylate target substrates that have basic amino acid residues from -1 to -3 positions relative to the phosphorylation site (Kettenbach et al., 2011b). To test if YY1 is a good substrate for the Aurora kinases, we performed a radioactive in vitro kinase assay using bacterially expressed GST-YY1 as substrate and purified Aurora A, Aurora B and Aurora C kinases (SignalChem). As shown in Figure 6A, all three isoforms of the Aurora kinases were able to efficiently phosphorylate GST- YY1 in vitro (lanes 5-7). GST-YY1 alone did not show any autophosphorylation (lane 1), however all three Aurora isoforms displayed autophosphorylation (lanes 2-4), as has been reported previously (Pascreau et al., 2008; Yasui et al., 2004).

Aurora B phosphorylates YY1 at serine 184 in vitro To identify the Aurora isoform that was specifically phosphorylating YY1 at serine 184, we performed a cold in vitro kinase assay using bacterially expressed non-tagged YY1 (Rizkallah et al., 2011b) as substrate and purified Aurora A, Aurora B and Aurora C. Also as control, we included the Polo like kinase1 (Plk1) and p21 activated kinase (PAK1) in the reactions, both of which are highly expressed and active during mitosis (Petronczki et al., 2008; Vadlamudi et al., 2000). The kinase reactions were then separated on a SDS-PAGE gel and transferred to a nitrocellulose membrane. The blot was probed with anti-pS184 antibody and only one band was detected, specifically in the lane where YY1 was incubated with Aurora B kinase. The blot was stripped and reprobed with anti-YY1 antibody to show equal YY1 levels. No other phospho-band was detected when YY1 was incubated with the other kinases (Figure 6B), indicating that only Aurora B was able to phosphorylate YY1 at serine 184 and both Aurora A and Aurora C were phosphorylating at another serine/threonine residue on YY1. To further

confirm these results, a radioactive in vitro kinase assay (Figure 6C) and a cold in vitro kinase assay (Figure 6D) were performed using the point mutants. Both kinase reactions included GST-YY1, GST-YY1 S180A, GST-YY1 S184A and GST-YY1 S180,184A incubated with Aurora B. Both results show that Aurora B specifically phosphorylates serine 184 and not serine 180 of YY1 (Figure 6C and 6D). The main antagonist of Aurora B phosphorylation is PP1 (Liu et al., 2010; Murnion et al., 2001; Sugiyama et al., 2002). After YY1 phosphorylation at serine 184 by Aurora B, the addition of purified PP1 can efficiently dephosphorylate serine 184, but not PP2A (Figure 6E).

Figure 6. Aurora B phosphorylates YY1 at serine 184 in vitro. (A) Radioactive in vitro kinase assay using purified Aurora kinase isoforms and GST-YY1 as substrate. The kinase reactions include GST-YY1 only (no kinase), Aurora A, Aurora B and Aurora C only (no substrate) and GST-YY1 with each Aurora isoform. The reactions were performed at 30°C for 30 minutes. The reaction mixture was separated on a 10% SDS-

PAGE gel and stained with Coomassie blue to visualize the protein bands and exposed to a phosphorimager screen. (B) Cold in vitro kinase assay reactions using purified Aurora A, Aurora B, Aurora C, Plk1 and PAK1 kinases and purified non-tagged YY1 as substrate. The reactions were performed at 30°C for 30 minutes followed by Western blot. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody. (C) Radioactive in vitro kinase assay using purified Aurora B kinase and GST-YY1 as substrate. The kinase reactions include GST-YY1 only (no kinase), Aurora B only (no substrate) and GSTY-YY1, GST-YY1 S180A, GST-YY1 S184A or GST-YY1 S180,184A with Aurora B. The reactions were performed as described for panel A. (D) Cold in vitro kinase assay reactions using purified Aurora B and GST-YY1 as substrate. The kinase reactions include GST-YY1 only (no kinase), Aurora B only (no substrate) and GST-YY1, GST-YY1 S180A, GST-YY1 S184A or GST-YY1 S180,184A with Aurora B. The reactions were performed at 30°C for 30 minutes followed by Western blot. The blot was probed with anti-pS184 antibody, then anti-YY1 antibody. (E) Cold in vitro kinase assay reactions using purified Aurora B and GST-YY1 as substrate. The kinase reactions were performed at 30°C for 30 minutes. After the reaction, GST-YY1 was washed with lysis buffer and resuspended in phosphatase buffer, and incubated with protein phosphatase 1 (PP1), protein phosphatase 2A (PP2A) or λ-phosphatase at 30°C for 30 minutes, followed by Western blot. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1.

Based on the consensus phosphorylation site at serine 184 of YY1, two other mitotic kinases showed high probability for phosphorylating serine 184. We show that protein kinase A (PKA) and Rho-associated, coiled-coil containing protein kinase 1 (ROCK1) can also phosphorylate YY1 at serine 184 in vitro (Figure 7A and 7B). This might suggest the presence of multiple signaling pathways and multiple kinases that can phosphorylate YY1 at the same residue in vivo.

Figure 7. PKA and ROCK1 phosphorylate YY1 at serine 184 in vitro. (A) Cold in vitro kinase assay reactions using purified PKA alpha, PKA gamma and ROCK1 kinases and purified non-tagged YY1 as substrate. The reactions were performed at 30°C for 30 minutes followed by Western blot. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody. (B) Radioactive in vitro kinase assay using purified PKA gamma and ROCK1 with GST-YY1 as substrate. The kinase reactions include GST-YY1 only (no kinase), kinase only (no substrate) and GSTY-YY1, GST-YY1 S180A, GST-YY1 S184A or GST-YY1 S180,184A with kinase. The reactions were performed as described in figure 6.

Aurora B interacts and phosphorylates YY1 in vivo To provide in vivo evidence that YY1 is a substrate for Aurora B, HEK293 cells were synchronized in mitosis with nocodazole block for 17 hours. After the block, cells were treated with VX-680, a potent and highly specific Aurora kinase inhibitor, at three different concentrations (100nM, 250nM and 500nM) for 15 minutes. Cell lysates were prepared, followed by Western blot analysis. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody. The blot was also probed with anti-cyclin B1 antibody to show the cells were still in mitosis after drug treatment. Total YY1 protein levels were shown to be equal; however, the level of serine 184 phosphorylation significantly decreased upon addition of the Aurora kinase inhibitor (Figure 8A). To further show evidence of YY1 as a substrate for Aurora B in vivo, we performed a co-immunoprecipitation experiment using HEK293 cells transiently transfected with Flag-Aurora B and no transfection (control) followed by nocodazole block. We observed that endogenous YY1 was able to interact with Flag-Aurora B when pulling down the kinase using anti-Flag mouse MAb cross-linked to sepharose beads (Figure 8B left panel). Similar results were also seen with Aurora A. Endogenous YY1 was able to interact with HA-Aurora A (Figure 8B right panel). This was direct evidence for an in vivo physical interaction between YY1 and both Aurora A and Aurora B in mitosis, however only Aurora B was shown to phosphorylate YY1 at serine 184 (Figure 6B). The amino acid residue(s) being phosphorylated by Aurora A and Aurora C on YY1 (Figure 6A) will be investigated further in the future.

Figure 8. Aurora B phosphorylates YY1 at serine 184 in vivo. (A) HEK293 cells were synchronized in mitosis with nocodazole block for 17 hours. After the block, the cells were treated with the Aurora inhibitor VX-680, with the indicated concentrations for 15 minutes. Cell lysates were prepared, followed by Western blot. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody followed by anti-cyclin B1antibody to show proper mitotic synchrony. (B) Co-immunoprecipitation of YY1 with Aurora A and Aurora B from HEK293 cells transiently transfected with HA- Aurora A, Flag-Aurora B and no transfection (control) followed by nocodazole block. Aurora A was immunoprecipitated using anti-HA antibody and Aurora B was immunoprecipitated using anti-Flag mouse MAb cross-linked to resin beads. Non- transfected cells were also immunprecipitated using anti-HA antibody and anti-Flag mouse MAb cross-linked to sepharose beads, which were used as a control for the specificity of the immunoprecipitation. Western blot analysis was performed on the immunoprecipitated samples and probed with anti-YY1 antibody. Input samples were probed with anti-YY1 antibody, anti-HA antibody and anti-Flag antibody.

Phosphorylation of YY1 in the regulatory domain modulates its transcriptional activity

The addition of a phosphate group on a serine, threonine or tyrosine residue by a protein kinase can have a profound effect on the DNA binding ability, localization, protein/protein interaction and other activities of a transcription factor. In order to study the functional importance of serine 180 and serine 184 phosphorylation, we constructed a double mutant form of YY1 where both serines were changed to alanine, which is not phosphorylatable (Flag-YY1 S180,184A). In addition, we also constructed a mutant in which both serines were changed to aspartic acid, an attempt to mimic the negatively charged, phosphorylated state. HEK293 cells were transiently transfected with Flag- vector, Flag-YY1 wild type, Flag-YY1 S180,184A and Flag-YY1 S180,184D followed by nocodazole block. The cell lysates were analyzed by Western blot and probed with anti- pS184 antibody, then stripped and reprobed with anti-YY1 antibody. The double alanine mutant form of YY1 was not recognized by the p-S184 antibody (Figure 10A), as seen previously (Figure 4D); however the p-S184 antibody had partial affinity towards the double aspartic acid phospho-mutant of YY1 (Figure 10A), indicating that the negatively charged aspartic acid was able to somewhat mimic the negative charge introduced by phosphorylation. The first functional analysis we performed was a cell cycle progression assay. HEK293 cells were transiently overexpressed with Flag-vector, Flag-YY1 wild type, Flag-YY1 S180,184A and Flag-YY1 S180,184D for 48 hours, followed by propidium iodide staining and FACS analysis. However, no significant changes in the cell cycle were observed in cells overexpressing these mutant plasmids (Figure 9A). We have previously reported that YY1 is mainly a nuclear protein during interphase of the cell cycle; as cells proceed into mitosis, YY1 becomes dispersed into the cytoplasm (Rizkallah and Hurt, 2009). Monitoring the cellular localization of the phospho-mutant YY1 proteins by immuno-staining did not show any differences between mutant and wild type YY1 which were mainly confined to the nucleus in interphase cells (Figure 9B).

Figure 9. Cell cycle analysis and cellular localization of YY1 phospho-mutants in HEK293 cells. (A) HEK293 cells were transiently transfected with Flag-vector, Flag- YY1 wild type, Flag-YY1 S180,184A and Flag-YY1 S180,184D for 48 hours. Cell cycle analysis of HEK293 cells after transfection was analyzed by fluorescence-activated cell sorting. Cells were stained with propidium iodide to analyze DNA content. Bar graphs show the percentage of HEK 293 cells in G1, S and G2/M with respect to total cell number. (B) HEK293 cells were transiently transfected with Flag-vector, Flag-YY1 wild type, Flag-YY1 S180,184A and Flag-YY1 S180,184D for 24 hours. Following transfection, cells were fixed and stained with anti-Flag antibody (red) followed by DAPI staining of DNA (blue).

We then examined how phosphorylation at both serine 180 and serine 184 of YY1 would affect its transcriptional activity in HEK293 cells. We used three different luciferase reporters driven by YY1-binding elements (H3.2α, p5-60 and cdc6p) (Eliassen

et al., 1998; Schlisio et al., 2002; Shi et al., 1991). The H3.2α YY1 DNA binding site is located within the protein-encoding sequence of the histone 3.2 gene. The p5-60 YY1 DNA binding site is located in adeno-associated virus promoter. The cdc6p YY1 DNA binding site is located in the cell division cycle 6 (cdc6) promoter. HEK293 cells were co-transfected with the luciferase reporter constructs (H3.2-luc, p5-60-luc and cdc6p- luc) along with pCS2(+)Flag-vector, pCS2(+)Flag-YY1 wild type, pCS2(+)Flag-YY1 S180,184A, pCS2(+)Flag-YY1 S180,184D and pCS2(+)Flag-YY1 ∆ 153-199. Twenty four hours later, cell lysates were prepared and tested in a luciferase activity assay (Figure 10B) and Western blot analysis to show equal transfection efficiency (Figure 10B, lower panel). The results were reported as percent change from Flag-vector control. As shown in Figure 10B, Flag-YY1 wild type induced an activation compared to Flag vector control in all three luciferase reporters, as expected. Further activation was observed with the non-phosphorylatable mutant (Flag-YY1 S180,184A). This finding suggests the existence of an inhibitory effect of phosphorylation at serine 180 and serine 184 on YY1 transactivation. This was supported by the fact that an opposite effect was seen with the phosophomimetic mutant (Flag-YY1 S180,184D); a significant reduction in transcriptional activation, indicating that phosphorylation on serine 180 and serine 184 residues plays an important role and negatively regulates YY1 transcriptional function. Completely removing the regulatory domain, which includes both serines (Flag-YY1 ∆ 154-199), showed a similar result as the phosphomimetic mutant, confirming the significance of this domain in YY1 transcriptional regulation.

Figure 10. Phosphorylation of YY1 in its regulatory domain modulates transcriptional activity. (A) Whole cell lysates were prepared from nococdazole treated HEK293 cells transiently transfected with Flag-vector, Flag-YY1 wild type, Flag- YY1 S180,184A and Flag-YY1 S180,184D followed by Western blot. The blot was probed with anti-pS184 antibody, then stripped and reprobed with anti-YY1 antibody. (B) HEK293 cells were co-transfected with three different YY1 luciferase reporter constructs (H3.2, p5-60 and cdc6p) along with Flag-vector, Flag-YY1 wild type, Flag- YY1 S180,184A, Flag-YY1 S180,184D and Flag-YY1 ∆ 154-199. Reporter activation was determined as described in methods section. The same cell lysates used in the luciferase reporter assay were also used in a Western blot probed with anti-YY1 antibody and anti-GAPDH antibody to show equal Flag-YY1 transfection levels (upper panel) and equal protein loading (lower panel).

Interestingly, the YY1 S180,184D phospho-mutant exhibits an increased DNA 32 binding affinity in an electrophoretic mobility shift assay (EMSA) using P-labeled H3.2α and P5-60 DNA double stranded oligonucleotides as probes (Figure 11A). It is possible

that phosphorylation on serine 180 and serine 184 might cause interference with the function of other transcription factors by competitively occupying the DNA binding sites.

Figure 11. YY1 S180,184D phospho-mutant exhibits an increased DNA binding affinity in vitro. (A) Whole cell lysates were prepared from asynchronous HEK293 cells transiently transfected with Flag-vector, Flag-YY1 wild type, Flag-YY1 S180,184A and Flag-YY1 S180,184D. Cell lysates were used in an electrophoretic mobility shift assay 32 (EMSA) using P-labeled H3.2 α and P5-60 as probes. (B) The same lysates used in the EMSA were also used in a Western blot probed with anti-YY1 antibody to show equal Flag-YY1 levels.

Phosphorylation/acetylation interplay in the regulatory domain of YY1 It has been reported that the histone acetyltransferase p300 acetylates the lysine residues adjacent to both serine 180 and serine 184 (Figure 4C). However, it was shown that only the truncated form of YY1 was able to be acetylated by p300, whereas, full length YY1 was not, possibly due to the conformation of YY1 protein (Yao et al., 2001). Acetylation of YY1 has also been shown to play a critical role for YY1 transcriptional regulation (Yao et al., 2001). In this study, we show that purified p300- HAT domain (Active Motif) can in fact efficiently acetylate both GST-tagged and non- tagged full length YY1 (Figure 12A). More importantly, it also appears that phosphorylation of serine 180 and serine 184 interferes with p300 interaction and subsequent acetylation of the adjacent lysine residues in vitro, as seen in figure 12B. The phosphomimetic mutant of YY1 (GST-S180,184D) exhibited significantly less acetylation compared to both wild type YY1 and the double alanine mutant. Acetylation of the lysine residues adjacent to serine 184 by p300-HAT first, followed by phosphorylation by Aurora B did not show any effect in phosphorylation of serine 184 in vitro (data not shown), however acetylating the lysine residues by p300-HAT, followed by phosphorylation by PKA, showed a significant decrease in phosphorylation by PKA (Figure 12C). This suggests that the phosphorylation/acetylation regulation of YY1 might be kinase dependent.

Figure 12. The histone acetyltransferase p300 acetylates full length YY1 wild type in vitro. (A) Cold in vitro acetylation assay reactions using purified p300-HAT domain and purified GST-YY1 (left panel) and non-tagged YY1 (right panel) as substrate. The reactions were performed at 30°C for 30 minutes followed by Western blot. The blot was probed with anti-acetyl-lysine antibody, then stripped and reprobed with anti-YY1 antibody. (B) Cold in vitro acetylation assay reactions using purified p300-HAT domain and purified GST-YY1 (1-200a.a.) wild type, S180,184A and S180,184D deletion mutants. The reactions were performed at 30°C for 1 hour, followed by Western blot. The blot was probed with anti-acetyl-lysine antibody, then stripped and reprobed with anti-YY1 antibody. (C) Cold in vitro acetylation assay reactions using purified p300-HAT domain and purified non-tagged YY1 as substrate performed at 30°C for 2 hours, followed by cold in vitro phosphorylation assay reactions using purified PKA performed at 30°C for 30 minutes on the same substrate.

Discussion

Mammalian cells undergo profound reorganization during the G2/M stage of the cell cycle as they start to enter mitosis. The initiation of mitosis in eukaryotic cells is governed by a spatially and temporally complex phosphorylation cascade that causes a surge in the phosphorylation of hundreds of proteins that are critical for the proper execution of mitosis. A large number of kinases in the human genome are devoted to mitotic control and progression, including CDK1 (cyclin-dependent kinase) and its upstream regulators (Lindqvist et al., 2009), as well as kinases from the families of Aurora kinases, and Plks (Polo-like kinase) (Takaki et al., 2008a). Disruption and deregulation of many of these kinases and signaling pathways contribute to genome instability and cancer. The transcription factor YY1 has been shown to be a critical regulator in development and cell proliferation. A role in cell cycle control is one of the functions attributed to YY1 and it is involved in the transitions through the different phases of the cell cycle (Eliassen et al., 1998; Gordon et al., 2006; Shi et al., 1997). YY1 interacts with several key regulators of the cell cycle signaling pathways such as c-Myc, Retinoblastoma (Rb) protein and p53 (Delehouzee et al., 2005; Petkova et al., 2001; Riggs et al., 1993; Shrivastava et al., 1993; Shrivastava et al., 1996; Sui et al., 2004). Phosphorylation has been shown to occur on many transcription factors, including YY1. We have previously mapped multiple phosphorylation sites on YY1 (T39, S118, S247, T348, T378) (Riman et al., 2012; Rizkallah et al., 2011a; Rizkallah et al., 2011b; Rizkallah and Hurt, 2009). Polo like kinase 1 was identified as the first kinase for which YY1 was a substrate. It phosphorylates threonine 39 in the activation domain of YY1 at the G2/M stage of the cell cycle (Rizkallah et al., 2011b). Casein kinase II α is another kinase identified to constitutively phosphorylate YY1 at serine 118. This modification prevents YY1 cleavage by caspase 7 during apoptosis (Riman et al., 2012). In this study, we identified the kinase responsible for phosphorylating YY1 at serine 184, a novel phosphorylation site identified by a global mass spectrometry-based identification technique (Molina et al., 2007). Based on the amino acid sequence of YY1 surrounding serine 184, the Aurora kinase family was one of the first candidates to show high probability for phosphorylation of YY1 at this site. To test this prediction, we

performed a radioactive in vitro kinase assay with the different Aurora kinase isoforms. YY1 was phosphorylated by all three Aurora kinase (A, B and C) isoforms (Figure 6A). A phospho-specific antibody that can recognize phosphorylated serine 184 on YY1 showed that only Aurora B was able to phosphorylate serine 184 in vitro (Figure 6B and 6C), whereas, phosphorylation of YY1 by Aurora A and Aurora C occurs at other serine/threonine residues that are yet to be identified. It was not surprising that Aurora B but not Aurora A phosphorylated serine 184. In a recent article by Kettenbach et al. (Kettenbach et al., 2011a), the difference between Aurora A and Aurora B kinase recognition motifs was analyzed. They showed that Aurora B exhibits a strong preference (55%) for basic amino acids immediately upstream and adjacent to the phosphorylation site ([R/K]p[S/T]). This was in contrast to potential Aurora A substrates that infrequently (9%) displayed a basic residue in this −1 position. Moreover, basic residues, and more frequently lysine rather than arginine, were found further upstream (positions −4 through −6) in the motifs present in the Aurora B clusterhan t were present in the motifs in the cluster for Aurora A (Kettenbach et al., 2011a). It is striking that the amino acid residues surrounding serine 184, match almost perfectly to a consensus Aurora B phosphorylation motif (Figure 4C). We also identified two other kinases active in mitosis, PKA and ROCK1, that can phosphorylate YY1 at serine 184 in vitro (Figure 7A and 7B). This might suggest the presence of multiple signaling pathways and multiple kinases that can phosphorylate YY1 at the same site. A similar pattern has also been observed with another Aurora B substrate, serine 10 in the tail of histone H3 (H3S10). This site in the histone tail has the sequence ([R][K]p[S]), which is comparable to the phosphorylation motif of serine 184 of YY1 ([K][K]p[S]). Phosphorylation of H3S10 can occur at different stages of the cell cycle by multiple kinases, depending on the context. In interphase, H3S10 phosphorylation correlates with chromatin relaxation and gene expression, whereas in mitosis it is associated with chromosome condensation (Prigent and Dimitrov, 2003). Interestingly, all three kinases (Aurora B, PKA and ROCK1) that phosphorylate serine 184 of YY1 in vitro, also phosphorylate H3S10 (Belkina et al., 2009; Crosio et al., 2002; DeManno et al., 1999; Hirota et al., 2005; Schmitt et al., 2002). Therefore, in vivo

phosphorylation of YY1 at serine 184 by a specific kinase, might be dependent on the context, and/or tissue type. The timing of the phosphorylation of serine 184 on YY1 occurs at the G2/M stage of the cell cycle (Figure 5B), which correlates with the increase in expression and activation of Aurora B (Bischoff et al., 1998). Aurora B activity is maintained throughout mitosis and cytokinesis. The majority of Aurora B substrates, including H3S10 are phosphorylated during this time in the cell cycle (Hayama et al., 2007; Nair et al., 2009; Perrera et al., 2010; Sakita-Suto et al., 2007; Wu et al., 2011; Yang et al., 2011). Evidence that YY1 is a physiological substrate of Aurora B is strengthened by the physical interaction between YY1 and Aurora B shown by co-immunoprecipitation (Figure 8B). Also, inhibition of phosphorylation by a specific Aurora inhibitor, VX-680, shows clearly that Aurora B is indeed the kinase responsible for serine 184 phosphorylation in vivo at G2/M. An interesting finding in this study was the rapid dephosphorylation of serine 184 as cells exited mitosis and entered G1 stage of the cell cycle (Figure 5C, right panel). In addition to the presence of highly active phosphatases at the end of mitosis (Wurzenberger and Gerlich, 2011), Aurora B is also known to be quickly degraded (Stewart and Fang, 2005). One of the major phosphatases that opposes and counteracts Aurora B kinase activity is protein phosphatase 1 (PP1) (Liu et al., 2010; Murnion et al., 2001; Sugiyama et al., 2002). PP1 is also known to dephosphorylate H3S10 and many other Aurora B substrates (Murnion et al., 2001). In a cold in vitro kinase assay, we show that after YY1 phosphorylation at serine 184 by Aurora B, the addition of PP1, but not PP2A can efficiently dephosphorylate serine 184 (Figure 6E). Dephosphorylation of YY1 at serine 184 by PP1 in vivo remains to be determined. The functional significance of serine 180 phosphorylation, a possible in vivo phosphorylation site (Fig. 1D) and serine 184 phosphorylation, was also studied. Overexpression of a Flag-YY1 mutant, where both serine 180 and serine 184 were changed to alanine (non-phosphorylatable) or aspartic acid (phosphomimetic), did not show any significant differences in cell cycle progression of HEK293 cells, nor did we see any differences in cellular localization between the phosphomutants and wild type YY1. However, the timing of serine 184 phosphorylation at the G2/M stage of the cell

cycle functionally overlaps with YY1 transcriptional regulation of genes. To test this, we performed a luciferase reporter assay using three different YY1-binding elements driving the luciferase gene. A significant reduction in transcriptional activation was observed with the phosphomimetic mutant, indicating that phosphorylation in this domain of YY1 plays an important role and negatively regulates YY1 transcriptional function. A similar result was also observed when using a deletion mutant that had the YY1 regulatory domain truncated (∆154-199), demonstrating the significance of this domain in transcriptional regulation. Thus, it is likely that phosphorylation on these serines affects YY1 DNA binding to cognate regions in its target genes. The phosphomimetic mutant exhibited an increased DNA binding affinity in an electrophoretic mobility shift assay compared to wild type YY1. It is possible that phosphorylation of YY1 in this regulatory domain might cause YY1 interference with the function of other transcription factors by competitively occupying the DNA binding sites or this phosphorylation might affect the recruitment of chromatin modifiers which can play a role in gene expression. YY1 has been shown to interact with numerous proteins, including transcriptional initiators (TFIIB, TBP and RNA polymerase II), transcriptional repressors (HDAC1, HDAC2 and HDAC4) and transcriptional activators and chromatin modifiers (CBP/p300 and PCAF) (Austen et al., 1997b; Lee et al., 1995a; Maldonado et al., 1996; Ren et al., 2009; Usheva and Shenk, 1994; Yang et al., 1996b; Yao et al., 2001). Most of these interactions with YY1 occur via the central glycine/alanine rich regulatory domain which includes both serine 180 and serine 184. It has been reported that the histone acetyltransferase p300 acetylates the lysine residues adjacent to both serines (Figure 4C) and this modification can regulate YY1 transcriptional activity (Yao et al., 2001). In this study, we show that purified p300-HAT domain acetylates both GST-tagged and non-tagged full length YY1 (Figure 12A). More importantly, it also appears that phosphorylation of serine 180 and serine 184 inhibits the acetylation of YY1 by p300 (Figure 12B). It is possible that the phosphorylation of these two residues in the regulatory domain of YY1 might interfere with protein/protein interaction with chromatin modifiers and therefore affect YY1 target gene expression. A unique interplay between acetylation and phosphorylation on adjacent residues has also been observed in other

proteins, such as, estrogen receptor alpha (ERα), thymine DNA glycocylase (TDG) and histone H3(Cui et al., 2004; Lo et al., 2000; Mohan et al., 2010; Prigent and Dimitrov, 2003). The interplay between these two different post-translational modifications was shown to have a significant impact on their respective function and activity. Whether a similar signaling cascade occurs in the process of posttranslational modification of YY1 and whether there are cellular mechanisms for coordination of YY1 phosphorylation and acetylation remain to be determined. In summary, the findings of the present study identify YY1 as a novel substrate for the Aurora B kinase. Aurora B kinase phosphorylates YY1 on serine 184 at the G2/M stage of the cell cycle. We show that YY1 is rapidly dephosphorylated as the cells exit mitosis, likely by PP1. Also, our data indicates that phosphorylation at serine 180 and serine 184 prevents YY1 acetylation by p300 and regulates the transcriptional activity of YY1 (Figure 13). However, the genes that are regulated by the phosphorylation of YY1 in this domain remain to be determined.

Figure 13. Schematic model of the regulation of YY1 by Aurora B at G2/M. YY1 is an Aurora B substrate at G2/M. Phosphorylation of YY1 in the regulatory domain prevents its association and acetylation by the histone acetyltransferase p300 and inhibits YY1 target gene expression.

CHAPTER 3

IDENTIFICATION OF TYROSINE KINASES THAT PHOSPHORYLATE YY1 in vitro

Introduction

YY1 is a ubiquitously expressed multifunctional transcription factor that is involved in a variety of cellular processes. Many YY1-regulated genes have crucial roles in cell proliferation, differentiation and apoptosis. YY1 is expressed in all tissues and is conserved among species and inhibition of YY1 protein synthesis by RNAi has been shown to cause defects in cell cycle progression and cytokinesis (Affar el et al., 2006a) . Moreover, deletion of YY1 from mouse embryos results in peri-implantation lethality (Donohoe et al., 1999). For the past two decades, the multiple functions of YY1, such as expression of its numerous target genes, its DNA binding motifs and the identification of its many binding partners have been extensively studied (Gordon et al., 2006). Understanding the regulation of YY1 and the signaling pathways and enzymes that regulate its function is one of the major focus of our lab. Numerous residues on YY1 have been reported to be targets of posttranslational modifications, such as S-nitrosation (Hongo et al., 2005), acetylation (Takasaki et al., 2007; Yao et al., 2001), O-linked glycosylation (Hiromura et al., 2003), sumoylation (Deng et al., 2007), and poly(ADP-ribosyl)ation (Oei et al., 1997b; Oei et al., 1998). However, phosphorylation, which plays an essential role in nearly every aspect of cellular physiology and is considered one of the most crucial reversible modifications regulating transcription factor function, has only recently been studied in detail. Our lab was the first to directly confirm that YY1 is a phosphoprotein. More recently, we have been able to map YY1 phosphorylation sites and identify multiple serine/threonine kinases that phosphorylate YY1 in vivo (Riman et al., 2012; Rizkallah et al., 2011a; Rizkallah et al., 2011b; Rizkallah and Hurt, 2009). Although phosphorylation of YY1 at serine/threonine residues is being extensively studied by our lab, the regulation of YY1 by tyrosine phosophorylation is a new area of study. 65

The protein tyrosine kinases are a large and diverse multi-gene family found predominantly in metazoans. While most protozoans contain no tyrosine kinases, they have a few simple protein tyrosine phosphatases (PTP) that are enzymatically active. These PTPs may have evolved to control phosphorylated tyrosine residues modified by dual specificity kinases (Miller, 2012). The signals that are frequently transmitted through the tyrosine kinase phosphorylation pathways are involved in the regulation of multicellular aspects of the organism, such as cell to cell signals concerning growth, differentiation, adhesion and motility. In contrast, many of the serine/threonine kinase families, such as cyclin dependent kinases and MAP kinases, are conserved throughout eukaryotes and regulate processes in both unicellular and multicellular organisms (Robinson et al., 2000). The examination of the amino acid sequence of YY1 using Group-based Phosphorylation Scoring method (GPS), a software tool that extends the analysis to the prediction of candidate kinases to specific sites (Xue et al., 2005), shows that all six of YY1’s tyrosine residues have the potential to be phosphorylated by multiple tyrosine kinases. We have tested YY1 as a substrate in a large profiling experiment against one hundred kinases chosen based on their relevance in the cell cycle. We employed a profiling service, supplied by a specialized facility at SignalChem company (British Columbia, Canada), to alleviate the cost of materials and time needed for the testing of such a large number of enzymes. Eight of the hundred kinases tested were tyrosine kinases. Several tyrosine kinases were shown to phosphorylate YY1 in vitro. Based on these results, we have initiated a mapping project to identify the phosphorylated tyrosine residues on YY1 for the prospective tyrosine kinases and explore the functional significance of these modifications.

Materials and Methods

Cell Culture and Reagents HeLa S3 cells and HeLa-Flag-YY1, a stable cell line that was generated as previously described (Rizkallah and Hurt, 2009), were grown in DMEM (Cellgro,

Herndon,VA) supplemented with 10% fetal bovine serum (FBS; Sigma, St. Louis, MO), 1% nonessential amino acids (Sigma, St. Louis, MO), and 1% Penicillin-Streptomycin (Mediatech). All cells were grown at 37°C in 5% CO2. Cells were trypsinized and split into new plates at subconfluency.

Mutagenesis Generation of a YY1 point mutations at tyrosines 251, 254 and 383 to phenylalanine was performed using pET-20b(+)-YY1 plasmid. Mutagenesis was performed using QuikChange II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA), according to the manufacturer's instructions. The tyrosine to phenylalanine mutations were confirmed by sequencing. Primers were designed using the QuikChange Primer Design Program on the Agilent Technologies web site. The mutated YY1 sequences were then subcloned into the pCS2(+)-Flag vector and pGEX-2T-GST vector as described previously (Rizkallah et al., 2011b; Rizkallah and Hurt, 2009).

Bacterial Expression of GST-YY1 and Deletion Mutants

Rosetta (DE3) cells (Novagen) were transformed with the pGEX-2T-YY1 construct and grown overnight in LB Miller broth medium (EMD) with ampicillin (100µg/ml final concentration). The overnight culture was diluted 1:10 in the same medium (with ampicillin) and grown to a density of 0.6 O.D. (about 1 hour), then induced with isopropyl β-D-1-thiogalactopyranoside (IPTG-Sigma-Aldrich) at a final concentration of 0.5 mM for about 4 hours. The volume of the culture medium never exceeded 25 % of the volume of the flask to allow proper aeration of the cells. Cells were pelleted by centrifugation at 3000xg for 15 minutes at 4ºC, and then resuspended in lysis buffer (ice-cold phosphate-buffered saline (PBS) pH 8.0 or 50 mM Tris pH 8.0, 150 mM NaCl) supplemented with a cocktail of protease inhibitors (Sigma). The suspension was sonicated on ice (three bursts, 15 second each, with 2 minutes intervals between sonication bursts to allow cooling). Lysates were cleared by centrifugation at 18,000xg for 30 minutes at 4ºC in a microcentrifuge, then incubated with immobilized glutathione beads (Pierce) (prewashed 3 times with lysis buffer, 10

volumes each wash) with rocking for 2-4 hours at 4ºC. The slurry of beads and lysates was then centrifuged at 500xg for 2 minutes at 4ºC. After aspirating the supernatant, the beads were washed 3 times, 10 volumes each time, with lysis buffer and the purified GST-YY1 attached to the beads was used subsequently in in vitro kinase assays.

Cold In Vitro Kinase Assay GST-YY1 attached to glutathione beads was used in cold (non radioactive ATP) in vitro kinase assays with purified Focal adhesion kinase (FAK), sarcoma kinase (SRC), Abelson kinase 1 (ABL1), and epidermal growth factor receptor (EGFR) kinases, which were purchased from SignalChem (British Columbia, Canada). Kinase reactions

were performed in kinase buffer (50 mM Tris pH 7.5, 150 mM NaCl, 10 mM MgCl2, 5 mM cold ATP) for 30 minutes at 30° C, with shaking. Reactions were then stopped by the addition of SDS-PAGE buffer and loaded for separation on a 10% SDS-PAGE gel.

Radioactive In Vitro Kinase Assay Kinase reactions were performed in kinase buffer (50 mM Tris pH 7.4, 150 mM 32 NaCl, 10 mM MgCl2, 50 µM ATP, 0.25 µM P-γ-ATP, 5 mM beta-glycerophosphate, 10 mM NaF, 1 mM DTT) for 30 minutes at 30° C, with shaking. Reactions were stopped by the addition of SDS-PAGE buffer and separated on a 10% SDS-PAGE gel. After staining with Coomassie Brilliant Blue R-250 (Sigma) to visualize the protein bands, gels were dried and exposed to a Phosphorimager screen at room temperature (RT) overnight. The screen was then scanned on a Typhoon 9410 imager (GE Healthcare, Waukesha, WI) for analysis.

Whole Cell Extract Preparation from Human Cells After washing cells three times with cold PBS on ice, mammalian cells were scraped in freshly prepared ice-cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% NP-40, and 2mM EDTA, 1mM DTT, 10 mM NaF, 25 mM β-glycerophosphate, 1 mM Na- Orthovanadate and a cocktail of protease inhibitors (Sigma). Cells were lysed on ice for 15 minutes. Lysates were pipetted up and down several times to shear DNA followed by centrifugation at 18,000 x g for 15 minutes at 4ºC.

Western Blotting Protein samples were separated on SDS-PAGE gels and then transferred by electroblotting onto a Trans-Blot Transfer Membrane (Bio-Rad Laboratories). After blotting, the transfer of proteins was inspected by quickly staining and destaining the membrane with Ponceau S solution (Sigma). Afterwards, the membrane was blocked for 30 minutes at RT in blocking solution (PBS, 0.5% Tween-20, 5% non-fat dry milk), and then incubated with primary antibodies in blocking solution overnight at 4ºC. The membrane was washed 3 times for 10 minutes with PBST (PBS with 0.5 % Tween-20). Horseradish peroxidase (HRP)-conjugated anti-mouse or anti-rabbit (GE Healthcare, Waukesha, WI) were added to the membrane in blocking solution and incubated for an hour at RT, after which it was washed as above. Specific protein bands were detected by the addition of SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL) for 5 minutes and exposure to X-Ray film (Fuji Medical Systems, Stamford, CT). Three anti-YY1 antibodies from Santa Cruz Biotechnology were used for Western blot analyses. Anti-YY1 (C20), a rabbit polyclonal antibody, recognizes the last 20 amino acids at the C-terminal end of YY1. Anti-YY1 (H10) is a mouse monoclonal antibody raised against the full-length protein, while anti-YY1 (H414) is a rabbit polyclonal antibody raised against the full-length protein. The rabbit polyclonal anti- pY251 and anti-pY254 was generated for us by New England Peptide using a synthesized phospho-peptide corresponding to amino acids 248-253 of YY1 (Ac- C(dPEG4)PPD(pY)SE -amide) for anti-pY251antibody and amino acids 252-260 of YY1 (Ac-SE(pY)MTGKKC-amide) for anti-pY254 antibody. Incubation and blocking using the general phospho-tyrosine antibody (Santa Cruz Biotechnology) was done using blocking solution of TBS, 0.5% Tween-20 and 5% BSA.

Cell Synchronization To synchronize HeLa cells at G1/S, a double-thymidine arrest was performed as previously described (Whitfield et al., 2000). For the double thymidine arrest/release experiment, cells were synchronized with 2.5mM thymidine (Sigma) as described above, the cells were washed three times with PBS, one time with growth medium, and then released into fresh media. Samples were collected at the indicated time points. To

synchronize cells at prometaphase, nocodazole (Sigma) was added to the medium at a final concentration of 100 ng/ml for 18 hours. For the nocodazole arrest/release experiment, cells were synchronized with nocodazole as described, then mitotic cells were detached from the plate surface by tapping the plate and collected by aspiration. Cells were washed two times with PBS and then one time with medium and replated in fresh growth medium. Samples were collected at indicated times for preparation of whole-cell extracts (WCEs).

Plasmid Constructions pGEX-2T-YY1. For the construction of GST-tagged YY1 bacterial expression plasmid, an NcoI/EcoI fragment encompassing the open reading frame of human YY1 was digested out of pCMV-HA-YY1 (a gift from Dr. Bernhard Lüscher) (Austen et al., 1997), gel purified, and inserted into BamHI/EcoRI digested pGEX-2T vector (Amersham Pharmacia), after blunting the NcoI and BamHI of the insert and vector, respectively. The NcoI and BamHI cut sites were blunted using the Klenow fragment of Pol I (New England Biolabs (NEB)). pGEX-2T-YY1 deletion mutants were a generous gift from Dr. Bernhard Lüscher, Aachen university, Germany (Austen et al., 1997).

pEGFP-YY1. For the construction of pEGFP-tagged YY1 mammalian expression plasmids, an NcoI/EcoI fragment encompassing the open reading frame of human YY1 was digested out of pET-20b-YY1, gel purified, and inserted into BglII/EcoRI digested pEGFP-C1 vector (kind gift from Dr. Branko Stefanovic (College of Medicine, FSU)), after blunting the NcoI and BglII cut sites of the insert and vector, respectively. The NcoI and BamHI sites were blunted using the Klenow fragment of Pol I (NEB).

pCS2(+)-Flag-YY1. pCS2(+)-Flag was a generous gift from Dr. Yoichi Kato (Biomedical Sciences Dept, College of Medicine, Florida State University). Dr. Kato constructed pCS2(+)-Flag by inserting the Flag sequence in the BamHI site of pCS2+ vector. For the construction of Flag-tagged YY1 mammalian expression plasmid, the NcoI/EcoRI fragment was digested out from pGEX-2T-YY1, after blunting the NcoI site

with Klenow fragment of Pol I (NEB) and was inserted into pCS2(+)-Flag digested with BamHI and EcoRI, after blunting the BamHI site Klenow fragment of Pol I (NEB).

Transfections The gene of interest was transfected into HeLa cells (grown as previously described) using Lipofectamine transfection reagent (Invitrogen) according to manufacturer’s instructions. Briefly, after equilibration with DMEM for 5 minutes, Lipofectamine was mixed with DNA in DMEM and incubated for 30 minutes prior to addition to HeLa cells in serum-free and antibiotic-free medium. After 6 hours, the medium/DNA/Lipofectamine mixture was replaced with HeLa normal growth medium, as described above.

Immunoprecipitation Immunoprecipitation (IP) of YY1 was performed using anti-YY1 (C-20) rabbit polyclonal antibody (Santa Cruz Biotechnology). This antibody recognizes the last 20 amino acids at the C-terminal end of YY1. Whole cell extracts were incubated with antibody for 3 hours, rotating at 4ºC. Protein A-agarose beads were then added to the mixture and incubated for an additional hour. Immune complexes bound to the beads were collected by centrifugation at 500xg, 4ºC, for 2 minutes, and then washed 3 times with lysis buffer. SDS-PAGE buffer was added to the beads and boiled for 3-5 minutes. Samples collected from the beads were separated on a 10% SDS-PAGE gel, and stained with Coomassie blue. For IP of Flag-YY1 with anti-Flag antibody, the same procedure was followed, except that anti-Flag mouse monoclonal antibody cross-linked to resin beads (Resin M2, Sigma) was used. Resin M2-anti-Flag was added to the lysates and the mixture was incubated for 4 hours at 4ºC with rotation.

7.5, 50mM NaCl, 1mM DTT, 5% glycerol). The protein-DNA complexes were then separated on 6% (or 8%) native polyacrylamide gels, fixed briefly (10-15 minutes) in 10% acetic acid, 10% methanol, and dried for one hour before exposure to phosphorimager screens. Exposure varied from 1 hour to overnight. Then the screen was then scanned using a Typhoon 9410 Imager (Amersham Biosciences). H3.2α oligonucleotide:

5’-gatcCTCGGCCGTCATGGCGCTGCAGGAGGCA-3’ 3’-GAGCCGGCAGTACCGCGACGTCCTCCGTctag-5’

Adeno-associated virus (AAV) (p5-60):

5’-gatcCGTTTTGCGACATTTTGCGACACA-3’ 3’-GCAAAACGCTGTAAAACGCTGTGTctag-5’

Results

Tyrosine Phosphorylation of YY1 in vitro and in vivo For the past couple of years, the research on phosphorylation of YY1 has been focused on serine/threonine residues present in YY1 and serine/threonine kinases that are responsible for these modifications. Described here are experiments focused on the regulation of YY1 by tyrosine phosophorylation and the tyrosine kinases that are involved. The first experimental goal was to directly show that YY1 is phosphorylated at tyrosine residue(s). pGEX-2T-YY1 was expressed in Rosetta (DE3) cells (an E.Coli strain), which would produce a GST-N-terminally tagged YY1 protein so that none of the possible eukaryotic posttranslational modifications were present on YY1. GST-YY1 expressed in these cells was purified from the bacterial extracts using glutathione beads. The GST-YY1 still attached to the beads was incubated with 50µg of protein from HeLa asynchronous whole cell extracts (WCE) which served as the tyrosine kinase source. The reaction was supplemented with 1mM ATP and kinase buffer, and incubated at 30°C for 30 minutes (in vitro cold kinase assay). As a negative control,

72 equal amounts of GST-YY1 was also incubated with double distilled H20 (ddH20), 1mM ATP and kinase buffer. After incubation, the beads attached to GST-YY1 were washed extensively and loaded on a 10% SDS-PAGE gel followed by Western blot analysis. The membrane was probed with a general phospho-tyrosine antibody then stripped and reprobed by anti-YY1 antibody (Figure 14A). Only the lane that had the GST-YY1 incubated with HeLa WCE at 30°C contained YY1, which was recognized by the general anti-phosphotyrosine antibody. This indicates that YY1 is phosphorylated on tyrosines in vitro. To see if this was also the case in vivo, WCE was prepared from HeLa asynchronous cells stably transfected with pCS2(+)-Flag-YY1. Flag-YY1 was then immunoprecipitated (IP) using an anti-Flag antibody with protein A and protein G (A/G) beads. Any posttranslational modification, including tyrosine phosphorylation should be present on YY1 after the purification by IP. After immunoprecipitating Flag-YY1, the beads were divided into two fractions, the first serving as the control, and calf intestinal phosphatase (CIP), a general phosphatase, was added to the second. Both samples were incubated at 30°C for 30 minutes. The samples were then loaded on an SDS- PAGE gel, separated by electrophoresis and probed with anti-phosphotyrosine antibody (Figure 14B). The blot was then stripped and re-probed with anti-YY1 antibody to check for equal loading. The results show that Flag-YY1 is tyrosine phosphorylated in vivo, confirming the in vitro results, and that this modification is removed when incubated with CIP.

Figure 14. YY1 is phosphorylated on tyrosine residue(s) in vitro and in vivo. (A) Cold in vitro kinase assay using GST-YY1 incubated in the presence or absence of 50 µg HeLa WCE, followed by western blotting and probed first with a general α-p-Ty

antibody, the blot was stripped and reprobed with α-YY1 antibody. (B) Whole cell extract was prepared from HeLa cells stably transfected with pCS2(+)-Flag-YY1. Flag- YY1 was immunoprecipitated using α-flag antibody and incubated at 30°C for 30 minutes with or without calf intestinal phosphatase (CIP). Western blot of Flag-YY1 IPs was first probed with a general α-p-Tyr antibody, stripped and reprobed with -YY1 α antibody.

Tyrosine phosphorylation of YY1 is cell cycle regulated YY1 protein levels do not change significantly during the cell cycle (Palko et al., 2004). To determine if there are any changes in the levels of tyrosine phosphorylation during the cell cycle, WCEs were prepared from asynchronous, S-phase and mitotic arrested HeLa cells stably transfected with Flag-YY1. S-phase cells were obtained by treating the cells with 2mM thymidine for 18 hours. Mitotic cells were obtained by treating the cells with 100ng/ml of nocodazole for 18 hours. Flag-YY1 was purified by IP from the cells using anti-Flag antibody and incubated with A/G beads. The IP samples were then separated by electrophoresis on an SDS-PAGE gel and probed with anti- phosphotyrosine antibody (Figure 15A). The blot was stripped and probed with anti-YY1 antibody to check for equal loading (Figure 15A, lower panel). The results indicate that YY1 is highly phosphorylated on tyrosines in nocodazole blocked cells arrested in mitosis. To better understand exactly when in the cell cycle YY1 was being phosphorylated, HeLa cells were synchronized with double thymidine block (G1/S arrest) and then released into fresh growth medium. Cells were collected at 2-12 hours every 2 hours post release from the S-phase block. Flag-YY1 was purified from the cells by IP. The samples were separated by electrophoresis on an SDS-PAGE gel, transferred to a nitrocellulose membrane and probed with anti-phosphotyrosine antibody (Figure 15B, upper panel). The blot was stripped and probed with anti-YY1 antibody to check for equal loading (Figure 15B, lower panel). A Western blot of the separated extracts prepared from the different time points after release from double thymidine block was performed using anti-cyclin B1 antibody. Expression of cyclin B protein levels increase from the end of S-phase and accumulate at the G2/M boundary. In anaphase, cyclin B levels drop dramatically due to rapid degradation, and can be used as a cell

cycle marker (Sullivan and Morgan., 2007). As observed in figure 15B, cyclin B1 levels increase and then decrease dramatically indicating that the cells proceeded from S phase to G2 into mitosis. Based on the levels of cyclin B1, the data confirms that YY1 is tyrosine phosphorylated in vivo during mitosis, which occurs 8-10 hours post release from the S-phase block.

Figure 15. YY1 is phosphorylated on tyrosine residues during mitosis. (A) Flag- YY1 was immunoprecipitated using a α-flag antibody from synchronized HeLa cells, separated by SDS-PAGE followed by Western blot analysis (A) HeLa cells stably transfected with Flag-YY1 were blocked with thymidine or nocodazole for 18 hours. Whole cell extracts were prepared from the blocked cells and Flag-YY1 was immunoprecipitated using -flag α antibody. The Western blot was first probed with a general α-p-Tyr followed by α-YY1 antibody. (B) HeLa cells stably transfected with Flag- YY1 was blocked with double thymidine and then released into fresh media (2-12 hrs). Flag-YY1 was purified from WCE by IP. Western blot of Flag-YY1 IPs was first probed with a general α-p-Tyr followed by α-YY1 antibody. Whole cell extracts were also probed with α-cyclin B1 antibody to serve as a cell cycle marker.

Identifying Tyrosine residues that are phosphorylated on YY1 YY1 has six tyrosine residues distributed along its primary amino acid sequence and at least one tyrosine is found in each of the different functional elements (Figure 16). As stated previously, several phosphorylation-prediction software programs predict that all six of the tyrosine residues have the potential to be phosphorylated by different tyrosine kinases. Cell Signaling Technology, a company in Massachusetts has been performing global mass spectrometry-based identification of in vivo phosphorylation sites in proteins. The data is available online for viewing (www.phosphosite.org). Two tyrosine phosphopeptides have been identified in these global proteome studies that have matched peptide sequences to YY1, showing that Y251 and Y254 are phosphorylated. A separate study done on global mitotic phosphorylated proteins shows Y251 on YY1 to be phosphorylated in mitosis (Dephoure et al., 2008). More recently, Cell Signaling Technology also identified Y185 of YY1 to be phosphorylated, this site is located in the central G/A rich domain of YY1, and adjacent to serine 184, which is phosphorylated by Aurora B as described earlier.

Figure 16. Structural and functional domains of YY1 showing the location of the six tyrosine residues in YY1.

Based on these results, the QuickChange II site directed mutagenesis kit was used to mutate both Y251 and Y254 to phenyalanine (F) to prevent phosphorylation on these residues. Once the mutations were obtained, YY1 (Y251F and Y254F) cDNA was subcloned into the pEGFP-C1, pCS2 (Flag) and pGEX-2T (GST) vectors. The Y251F and Y254F mutants were bacterially expressed using the pGEX-2T vector which produced a GST-N-terminally tagged mutant YY1 protein and were purified with glutathione beads as described earlier. The GST-YY1(WT) along with the two mutants (Y251F and Y254F) attached to the glutathione beads were incubated with 50µg of protein from HeLa asynchronous WCE or HeLa nocodazole blocked mitotic WCE (tyrosine kinase source), supplemented with 1mM ATP, and incubated at 30°C for 30 minutes (in vitro cold kinase assay). After the incubation, the beads were washed extensively, then boiled in 4X SDS-PAGE loading buffer and was loaded on a 10% SDS-PAGE gel. After separation by electrophoresis, the gel was transferred to a nitrocellulose membrane. The membrane was probed with a general phospho-tyrosine antibody (Figure 17A, upper panel). The membrane was stripped and probed with anti- 77

YY1 antibody to check for equal GST-YY1 loading (Figure 17A, lower panel). The tyrosine phosphorylation was reduced in the two mutants that were incubated with the mitotic extracts compared to the wild type. However, there was not much difference in the phosphorylation levels for the samples incubated with the asynchronous extracts (Figure 17A, upper panels), indicating that these two tyrosine residues, 251 and 254, were phosphorylated by tyrosine kinases present or active in the mitotic extract. We currently have a number of deletion mutants of YY1 that have already been subcloned into the pGEXT-2T vector. Because tyrosine residues in YY1 are almost evenly spaced along the length of the primary sequence of YY1, we can use some of these deletion mutants to our advantage when identifying and mapping phosphorylated tyrosines. An in vitro cold kinase assay was performed using HeLa asynchronous WCE and HeLa mitotic WCE, similar to the above experiment. GST-YY1 Δ2-197 which contains tyrosine 251, 254 and 383 only, showed a significant increase in tyrosine phosphorylation when incubated with the mitotic extracts compared to the asynchronous WCE (Figure 17B), which further indicates that both tyrosine 251 and 254 are possible targets of activated mitotic tyrosine kinases.

Figure 17. Phosphorylation of Y251 and Y254 by mitotic extracts. (A) Cold in vitro kinase assay using GST-YY1 wild type, Y251F and Y254F (B) Deletion mutant GST- YY1 Δ2-197 incubated with 50 μg asynchronous or mitotic HeLa extracts at 30°C for 30 minutes, followed by western blotting using general α-p-Tyr. The blots were stripped and reprobed with α-YY1 antibody for equal loading.

Identifying tyrosine kinases that phosphorylate YY1 in vitro One hundred purified kinases (serine/threonine and tyrosine kinases) involved in cell cycle regulation or cell proliferation were chosen to be tested for their phosphorylation activity and specificity using YY1 as a substrate by SignalChem facility (British Columbia, Canada). The enzymes used by SignalChem were expressed either by baculovirus in Sf9 insect cells or E.coli bacterial cells. Each kinase carries a His-tag (histidine tag) or a GST-tag (Glutathione-S-Transferase) that was used in the purification procedure. After purification, the kinases were tested with biologically relevant ideal substrates to assess activity, specificity, and optimal reaction conditions.

For this profiling experiment, YY1 protein was expressed and purified from Rosetta cells as previously described using the pET-20b-YY1 plasmid, which produces a non-tagged YY1 protein (Rizkallah et al., 2011b). 1100 μg of purified protein were shipped to SignalChem for the assays. Five μg of the purified YY1 protein were used as a substrate in each kinase reaction. For each kinase, 3 types of reactions were performed. The first had no substrate (blank), the second contained a peptide which was an optimal phosphorylation consensus site for the respective kinase (control) , and the third reaction contained purified YY1 (test). All three reactions were performed in duplicate. The individual kinase assays were performed at 30ºC for 30 minutes in a 25 μl reaction volume. Twenty microliters of each reaction were then spotted onto a phosphocellulose p81 plate. The plate was subsequently washed three times for a total of 15 minutes with a 1% phosphoric acid solution. The incorporation of radioactivity was quantitated in a scintillation counter. The tyrosine kinases tested in this study are included in figure 18. Tyrosine kinases FAK, SRC and ABL1 showed moderate to good phosphorylation levels on YY1. According to the company, values less than 2% are considered not highly significant.

Figure 18. Tyrosine kinases included in the kinase profiling screen. Eight tyrosine kinases were tested for their phosphorylation activity using bacterially expressed and purified YY1 as substrate.

Multiple tyrosine kinases phosphorylate YY1 in vitro Next, we were interested in directly identifying the tyrosine kinases that phosphorylate YY1 and confirming the results obtained by SignalChem. To test if YY1 is a good substrate for the tyrosine kinases in figure 18, we performed a radioactive in vitro kinase assay using bacterially expressed non-tagged YY1 as substrate and purified FAK, SRC, ABL1 and EGFR (SignalChem). In this assay we also included EGFR, a receptor tyrosine kinase that was not included in the kinase profiling screen, but showed high probability for phosphorylating YY1 using a phosphorylation software tool. As shown in Figure 19, all four tyrosine kinases were able to phosphorylate YY1 in vitro (lanes 2-5) at different levels, with FAK giving the highest phosphorylation signal (lane 2) and EGFR giving the lowest (lane 5). YY1 alone did not show any autophosphorylation (lane 1).

Figure 19. Multiple tyrosine kinases phosphorylate YY1 in vitro. Radioactive in vitro kinase assay using purified tyrosine kinases (FAK,SRC,ABL1,EGFR) and non-tagged YY1 as substrate. The kinase reactions include YY1 only (no kinase), YY1 with a tyrosine kinase and kinase only, as indicated. The reactions were performed at 30°C for 30 minutes. The reaction mixture was separated on a 10% SDS-PAGE gel and stained with Coomassie blue to visualize the protein bands and exposed to a phosphorimager screen.

To better understand and characterize the phosphorylation of YY1 at tyrosine 251, a rabbit polyclonal phospho-specific antibody (α-pY251) was developed against a synthetic peptide encompassing YY1 residues 248-253 and containing a phosphorylation on tyrosine 251. To characterize the phosphorylation of YY1 at tyrosine 254 a rabbit polyclonal phospho-specific antibody (α-pY254) was developed against a synthetic peptide encompassing YY1 residues 252-260 and containing a phosphorylation on tyrosine 254. To test the phospho-specificity of the antibodies, we performed a dot blot assay where we spotted synthetic non-phosphorylated and phosphorylated forms of the synthetic peptides onto a nitrocellulose membrane. Both phospho-antibodies efficiently recognized only the phosphorylated form of the peptide (Figure 20).

Figure 20. Dot blot assay of non-phosphorylated and tyrosine phosphorylated synthetic peptides of YY1 probed with anti-pY251 or anti-pY254.

To identify the tyrosine kinase that phosphorylates YY1 at Y251 and Y254, we performed a cold in vitro kinase assay using bacterially expressed non-tagged YY1 as substrate and purified FAK, SRC, ABL1and EGFR. The kinase reactions were then separated on a SDS-PAGE gel and transferred to a nitrocellulose membrane. The blot was probed with both α-pY251 and α-pY254 antibodies. Two bands were detected, specifically in the lane where YY1 was incubated with FAK and ABL1 (Figure 21), indicating that both FAK and ABL1 were able to phosphorylate YY1 at tyrosine 251 and 254. The blot was stripped and reprobed with anti-YY1 antibody to show equal YY1 levels. No phospho-specific band was detected after YY1 was incubated with SRC or EGFR kinases (Figure 21) indicating that both SRC and EGFR phosphorylate at other tyrosine residues on YY1.

Figure 21. FAK and SRC phosphorylate YY1 at Y251 and Y254 in vitro. Cold in vitro kinase assay using purified tyrosine kinases (FAK, SRC, ABL1, EGFR) and bacterially expressed non-tagged YY1 as substrate. The kinase reactions include YY1 only (no kinase) and YY1 with each tyrosine kinase as indicated. The reactions were performed at 30°C for 30 minutes. The reaction mixture was separated on a 10% SDS-PAGE gel and the blot was probed with α-pY251 or α-pY254 antibodies followed by α-YY1 antibody.

Effect of Y251F and Y254F mutation on YY1 function

Both tyrosine mutants were subcloned into the pEGFP-C1 vector as described in the materials and methods. The pEGFP-YY1 plasmid was transfected in HeLa cells for 24 hours and a whole cell extract was prepared. The EGFP-YY1 (Y251F and Y254F) expression was analyzed on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. The membrane was probed for YY1 using an anti-YY1 antibody. The western blot showed equal expression between the wild type and both mutants (Figure 22B). To test the DNA binding activity of these mutants, an EMSA was performed using the H3.2 alpha element as probe. There was no difference in DNA binding by wild type YY1 or the mutants, indicating that phosphorylation at these sites does not affect DNA

84 binding activity (Figure 22A). Sub-cellular localization of these mutants observed with a fluorescence microscope was similar to the localization of wild type EGFP-YY1 (nuclear) in interphase cells (data not shown), indicating that the phosphorylation at these 2 sites is not involved in the localization of YY1. Further experiments must be performed to address other possible roles for phosphorylation of YY1 at Y251 and Y254.

Figure 22. Protein expression and DNA binding activity of EGFP-YY1 Y251F and Y254F in HeLa extracts. (A) EMSA using HeLa WCE expressing EGFP-YY1, EGFP- YY1-Y251F or EGFP-YY1-Y254F incubated with H3.2 alpha as probe labeled with 32P. (B) Western blot analysis showing endogenous YY1 and EGFP-YY1 wild type and mutant protein expression levels in HeLa WCE.

Effect of Y383F mutation on YY1 function

Tyrosine 383 of YY1 is an amino acid residue located in the zinc finger DNA binding domain of YY1. It is specifically located in the third linker region between zinc finger 3 and zinc finger 4 (Figure 2). These linker peptides are highly conserved among the different zinc finger proteins and they usually contain a tyrosine or a phenylalanine at the C-terminus end of the linker (Figure 23). They play a critical role in wrapping around the DNA in a locking position.

Figure 23. Examples of zinc finger containing proteins with conserved tyrosine (Y) or phenyalanine (F) residues at the linker region.

Mutating Y383 to phenylalanine has a significant effect on its DNA binding activity. Tyrosine 383 was mutated to phenylalanine and subcloned into the pEGFP-C1 vector as described in the materials and methods. The pEGFP-YY1 plasmid was transfected in HeLa cells for 24 hours and a whole cell extract was prepared. The

EGFP-YY1 Y383F expression was analyzed on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. The membrane was probed for YY1 using an anti-YY1 antibody. The western blot showed equal expression between the wild type and both mutants (Figure 24B). To test the DNA binding activity of this mutant, an EMSA was performed using the H3.2 alpha element and the P5-60 DNA binding sites of YY1 as probe. When using H3.2 alpha DNA binding site, EGFP-YY1 Y383F showed less DNA binding efficiency compared to EGFP-YY1 WT. Interestingly, when P5-60 binding site was used, EGFP-YY1 Y383F showed an increase in binding efficiency compared to EGFP-YY1 WT (Figure 24A). Whether Y383 is phosphorylated in vivo still needs to be determined.

Figure 24. Protein expression and DNA binding activity of EGFP-YY1 Y383F in HeLa extracts. (A) EMSA using HeLa WCE expressing EGFP-YY1 and EGFP-YY1- Y383F incubated with H3.2 alpha and P5-60 as probe labeled with 32P. (B) Western blot analysis showing endogenous YY1 and EGFP-YY1 wild type and mutant protein expression levels in HeLa WCE.

Discussion

Reversible protein phosphorylation has been shown to be one of the most important post-translational modifications regulating many cellular signaling cascades. Proteins can be phosphorylated on serine, threonine and tyrosine residues. The relative abundance of serine, threonine and tyrosine phosphorylation in the human phosphoproteome has been estimated to be 86.4, 11.8 and 1.8%, respectively (Olsen et al., 2006). Unicellular organisms such as the budding yeast have no conventional protein tyrosine kinases and therefore, have an extremely low extent of tyrosine phosphorylation. Their phosphoproteome has been estimated to be serine (82.3%), threonine (17.5%) and tyrosine (0.027%) (Chi et al., 2007). In general, tyrosine kinases represent 10–15% of all protein kinase genes in a typical metazoan organism. In humans 90 of the 525 protein kinase genes are tyrosine kinases (Manning et al., 2002). Of the 90 human tyrosine kinases 58 are receptor tyrosine kinases (RTK) containing a transmembrane domain and 32 are non-receptor tyrosine kinases. Tyrosine kinases play a particularly important role in development and cellular differentiation in metazoans, consistent with their role in cell–cell signaling and transmembrane signal transduction, a crucial function for establishment of a multicellular organism (Hunter, 2009). Although tyrosine phosphorylation is relatively rare compared to serine/threonine phosphorylation, it is highly significant in normal developmental regulation. Of the more than 100 dominant oncogenes known to date, tyrosine kinases comprise a large fraction of these oncogenes (Blume-Jensen and Hunter, 2001). Therefore, understanding the signaling network and the substrates for critical tyrosine kinases is of great importance. YY1 performs a wide spectrum of functions in various cellular processes. It is likely that multiple pathways and multiple signaling cascades regulate YY1 differentially in specific contexts (Gordon et al., 2006; Shi et al., 1997). We have already identified multiple phosphorylation sites and multiple serine/threonine kinases that phosphorylate YY1. The upstream signaling pathways and the tyrosine kinases that regulate YY1 through phosphorylation was the focus of this study. To gain insights into the regulation of YY1 by tyrosine phosphorylation and to identify the possible tyrosine phosphorylation sites in YY1, a general anti-

phosphotyrosine antibody were used. Here, we report that YY1 is phosphorylated at tyrosine residues both in vitro and in vivo in HeLa cells (Figure 14A and 14B). By synchronizing cells using double thymidine block and release, we show that tyrosine phosphorylation of YY1 peaks in mitosis in vivo (Figure 15B). We identified both tyrosine 251 and 254 to be phosphorylated in vitro by mitotic Hela WCE (Figure 17A and 17B), which suggests that Y251 and Y254 are possible phosphorylation sites by a tyrosine kinase(s) that are expressed or only active in mitotic extracts. This is true in HeLa cell extracts; in the future it will be important to also test the presence of the phosphorylation in other cell types. To identify tyrosine kinases that can phosphorylate YY1 in vitro we followed an empirical approach of testing one hundred kinases with bacterially expressed and purified YY1 as a substrate. From the 100 kinases chosen for the assay, 8 were cellular tyrosine kinases (92 were serine/threonine kinases) as seen in figure 18. Tyrosine kinases FAK, SRC and ABL1 were all able to phosphorylate YY1 in vitro, which was confirmed by performing a radioactive in vitro kinase assay (Figure 19). FAK and ABL1 showed the highest levels of YY1 tyrosine phosphorylation and EGFR showed the least amount of phosphorylation on YY1 in vitro. FAK is a non-receptor tyrosine kinase that plays an important role in signal transduction pathways that are initiated at sites of integrin-mediated cell adhesions and by growth factor receptors. FAK is also a key regulator of survival, proliferation, migration and invasion: processes that are all involved in the development and progression of cancer (van Nimwegen and van de Water, 2007). Similar to FAK, ABL1 is also a non-receptor tyrosine kinase that plays important roles in actin reorganization. ABL1 has a DNA binding domain and can also localize to the nucleus where it mediates DNA damage-repair functions. ABL1 has many different substrates that range from receptor proteins, adaptor proteins, cytoskeletal proteins and transcription factors (Colicelli, 2010). Using a phospho-specific antibody against tyrosines 251 and 254, we showed that both FAK and ABL1 kinases phosphorylate these sites, although with differing affinities. FAK phosphorylated Y251 to a greater extent than ABL1 (Figure 21, left panel) and ABL1 phosphorylated Y254 to a greater extent than FAK (Figure 21, right panel). Whether both tyrosine kinases phosphorylate YY1 in vivo still needs to be

89 determined. Mutating both tyrosine 251 and 254 to phenyalanine did not affect the DNA binding ability of YY1 (Figure 22). This was not surprising since both residues are located in the spacer region of the YY1 protein and not in the DNA binding domain. This spacer region of YY1 has been shown to be involved in the interactions of YY1 with other proteins including c-myc, Hdm-2 and AP-2 (Shrivastava et al., 1993; Sui et al., 2004; Wu and Lee, 2001). It will be interesting to see if phosphorylation of these tyrosine residues plays any role in protein/protein interactions. We were also interested in studying tyrosine 383 of YY1, which is situated in the DNA binding domain of YY1. It is a highly conserved residue in YY1 among the different animal species. It is also conserved in other zinc finger containing proteins as tyrosine or a structurally similar amino acid, phenylalanine, which unlike tyrosine does not contain the hydroxyl group required for phosphorylation (Figure 23). We show that this residue is important for the DNA binding ability of YY1. Mutating Y383 to phenylalanine has a significant effect on its DNA binding activity in an EMSA. When using H3.2 alpha DNA binding site (probe) of YY1, which is a sequence located within the protein- encoding sequence of the histone 3.2 gene, EGFP-YY1 Y383F showed less DNA binding efficiency compared to EGFP-YY1 WT. Interestingly, when P5-60 binding site (probe) of YY1 was used, which is a site located in adeno-associated virus promoter, EGFP-YY1 Y383F showed an increase in binding efficiency compared to EGFP-YY1 WT (Figure 24A). Even though tyrosine 383 is an amino acid residue that does not have any direct contact with DNA based on YY1 co-crystal structure (Houbaviy et al., 1996), it appears to play an important role in specific DNA sequence recognition and binding. Apart from being potentially phosphorylated, tyrosine side chains have the ability to form hydrogen bonds through their hydroxyl groups (Singh and Gunjan, 2011), as well as participate in ring stacking interactions with other aromatic rings, thereby stabilizing both intra- and inter-molecular interactions (Burley and Petsko, 1985). This might explain the differences observed in DNA binding when using YY1 Y383F mutant which cannot form these stabilizing interactions. It will also be important to see the affect of a phosphomimetic mutant (Y383E) on YY1 DNA binding ability. Whether Y383 is phosphorylated in vivo still needs to be determined.

In summary, we have identified several tyrosine kinases that phosphorylate YY1 in vitro and have mapped the locations of FAK and ABL1 phosphorylation sites to tyrosine 251 and tyrosine 254 of YY1. FAK and ABL1 have the ability to phosphorylate both tyrosine residues, but with different affinities. YY1 only has six tyrosine residues in its amino acid sequence, all of which are highly conserved across different animal species. Tyrosine 8 and tyrosine 145 are located in the N-terminal transactivation domain of YY1, tyrosine 185 is located in the central regulatory domain of YY1 adjacent to serine 184 which we have previously shown to be phosphorylated by Aurora B. Whether a possible phosphorylation cross talk and interplay exists between the two adjacent residues remains to be determined. Tyrosine 383 is located in the C-terminal DNA binding domain of YY1. It is a conserved residue among the DNA binding zinc finger proteins, indicating its potential significance in the protein. Tyrosine 251 and tyrosine 254 are located in the spacer region of YY1, and phosphorylation of these residues could have significant effects on the interactions between YY1 and other proteins. Future studies will focus on the identification of additional tyrosine phosphorylation sites and elucidation of the regulation of YY1 by tyrosine phosphorylation.

CHAPTER 4

CONCLUSIONS

YY1 is an essential multifunctional transcription factor that plays critical roles in development, cell proliferation, differentiation, and apoptosis. It has been shown to regulate a very large number of genes involved in a wide range of biological processes and is therefore known as a global gene regulator. However, little is known about how the YY1 protein itself is controlled or the upstream signaling pathways and enzymes that regulate its functions. The Yy1 gene was first identified and cloned in 1991 (Shi et al., 1991). It encodes a transcription factor that belongs to the group of C2H2-containing zinc finger proteins. Since its identification, there has been much research focused on the genes that YY1 regulates and different protein interactions. The phosphorylation of YY1 had been a mystery for more than a decade. Very few studies existed on this topic and the evidence that had been presented was unclear and mostly indirect. In addition, the results reported about the effect of phosphorylation on the DNA binding activity of YY1 had been contradictory (Becker et al., 1994; Kaludov et al., 1996; Shi et al., 1997). More recently, our lab was able to directly show the phosphorylation of YY1 in HeLa cells. We identified and mapped multiple phosphorylation sites in YY1, including threonine 39, serine 118, serine 247, threonine 348 and threonine 378 (Riman et al., 2012; Rizkallah et al., 2011a; Rizkallah et al., 2011b; Rizkallah and Hurt, 2009). The first kinase proven to phosphorylate YY1 in vivo was Plk1, which phosphorylates threonine 39 during G2/M stage of the cell cycle (Rizkallah et al., 2011b). CK2α was the second kinase identified which constitutively phosphorylates YY1 at serine 118. This modification protects YY1 from cleavage by caspase 7 during apoptosis (Riman et al., 2012). Our lab also reported that phosphorylation of YY1 in the DNA binding domain (threonine 348 and threonine 378) during mitosis abolishes its DNA binding activity (Rizkallah and Hurt, 2009). Here, we provide evidence regarding a third kinase, the Aurora B of the Aurora kinase family which also phosphorylates YY1 in vitro and in vivo. We map the Aurora B

92 phosphorylation site on YY1 to the central regulatory domain of the protein, at serine 184. Critical to our work, we developed a phospho-specific antibody which recognizes serine 184 on YY1 only in its phosphorylated state. We show that this phosphorylation is cell-cycle regulated and occurs specifically at the G2/M transition of the cell cycle. This timing correlates well with the known functions of Aurora B and YY1 in the proper entry into and execution of mitosis. An interesting finding in this study was the rapid dephosphorylation of serine 184 as cells exited mitosis and entered G1 stage of the cell cycle. We show that YY1 is dephosphorylated by PP1, a major phosphatase that opposes and counteracts Aurora B kinase activity. Based on the consensus phosphorylation site at serine 184 of YY1, we also identified two other mitotic kinases, PKA and ROCK1, that can also phosphorylate YY1 at serine 184 in vitro. This might suggest the presence of multiple signaling pathways and multiple kinases that can phosphorylate YY1 at the same residue. In vivo phosphorylation of YY1 at serine 184 by a specific kinase might be dependent on the context, and/or tissue type. By performing a luciferase reporter assay using three different YY1-binding elements driving the luciferase gene, we provide evidence that phosphorylation of YY1 in the central regulatory domain is important for its transcriptional regulation function which it negatively affects. Interestingly, phosphomimetic mutant of YY1 (S180,184D) shows an increased DNA binding affinity in an electrophoretic mobility shift assay compared to wild type YY1. In vivo, this might cause interference with the function of other transcription factors by competitively occupying DNA binding sites. In addition, we present evidence for a potential phosphorylation/acetylation switch that occurs on YY1 in the central regulatory domain of the protein. This type of interplay between posttranslational modifications has been well studied on histone proteins, as part of the histone code which plays an important role in chromatin structure and gene expression. This mechanism, wherein phosphorylation inhibits acetylation (or vice versa), may play an important role in the regulation of YY1. Tyrosine phosphorylation of YY1 was also a topic of this study. By using a general anti-phosphotyrosine antibody, we show that YY1 is phosphorylated at tyrosine residues both in vitro and in vivo. We show that tyrosine phosphorylation of YY1 peaks

93 during mitosis in vivo. We identified both tyrosine 251 and 254 as phosphorylation sites in vitro by kinase(s) in mitotic Hela WCE. A phospho-specific antibody which recognizes tyrosine 251 or tyrosine 254 only in their phosphorylated state was also developed. Using these phospho-specific antibodies, we show both FAK and ABL1 kinases phosphorylate tyrosines 251 and 254 located in the spacer region of YY1 in vitro. Although mutating the two tyrosine residues to phenyalanine did not affect YY1 DNA binding ability, future studies using phosphomimetic mutants may reveal the function of these phosphorylation sites in vivo. We also show the significance of tyrosine 383 located in the DNA binding domain of YY1. Even though tyrosine 383 does not have direct contact with DNA, we show that this residue is important for YY1 DNA binding. Mutating Y383 to phenylalanine had a significant affect on its DNA binding activity and appears to play an important role in DNA sequence recognition and binding. Future studies using a phosphomimetic mutant (Y383E) of YY1 will be critical in understanding the significance of phosphorylation of YY1 in its DNA binding domain. Much remains to be learned regarding the role of tyrosine phosphorylation in the regulation of YY1. These studies have opened the door to various intriguing avenues of investigation. We believe that dissecting the cellular pathways and mechanisms affecting YY1 regulation in various contexts of multicellular life is crucial to the understanding of the role of this global gene regulator. Because of the essential role YY1 plays in cellular life and death, understanding the signaling pathways that regulate its functions is critical. The exciting link between the multiple kinases that we have identified and YY1 will no doubt lead to a better understanding of their biological function and may well be of great importance to the success of cancer therapy research.

APPENDIX

DNA AND AMINO ACID SEQUENCE OF HUMAN YY1

DNA Sequence of the Open Reading Frame of Human YY1

atggcctcgggcgacaccctctacatcgccacggacggctcggagatgccggccgagatcgtggagctgcacgagatc

gaggtggagaccatcccggtggagaccatcgagaccacagtggtgggcgaggaggaggaggaggacgacgacga

cgaggacggcggcggtggcgaccacggcggcgggggcggccacgggcacgccggccaccaccaccaccaccatc

accaccaccaccacccgcccatgatcgctctgcagccgctggtcaccgacgacccgacccaggtgcaccaccaccag

gaggtgatcctggtgcagacgcgcgaggaggtggtgggcggcgacgactcggacgggctgcgcgccgaggacggctt

cgaggatcagattctcatcccggtgcccgcgccggccggcggcgacgacgactacattgaacaaacgctggtcaccgt

ggcggcggccggcaagagcggcggcggcggctcgtcgtcgtcgggaggcggccgcgtcaagaagggcggcggca

agaagagcggcaagaagagttacctcagcggcggggccggcgcggcgggcggcggcggcgccgacccgggcaa

caagaagtgggagcagaagcaggtgcagatcaagaccctggagggcgagttctcggtcaccatgtggtcctcagatga

aaaaaaagatattgaccatgagacagtggttgaagaacagatcattggagagaactcacctcctgattattcagaatatat

gacaggaaagaaacttcctcctggaggaatacctggcattgacctctcagatcccaaacaactggcagaatttgctagaa

tgaagccaagaaaaattaaagaagatgatgctccaagaacaatagcttgccctcataaaggctgcacaaagatgttcag

ggataactcggccatgagaaaacatctgcacacccacggtcccagagtccacgtctgtgcagaatgtggcaaagcttttg

ttgagagttcaaaactaaaacgacaccaactggttcatactggagagaagccctttcagtgcacgttcgaaggctgtggg

aaacgcttttcactggacttcaatttgcgcacacatgtgcgaatccataccggagacaggccctatgtgtgccccttcgatgg

ttgtaataagaagtttgctcagtcaactaacctgaaatctcacatcttaacacatgctaaggccaaaaacaaccagtga

Functional Domains and Amino Acid Sequence of Human YY1

M A S G D T L Y I A T D G S E M P A E I V E L H E I E V E T I P V E T I E T T V V G E

E E E E D D D D E D G G G G D H G G G G G H G H A G H H H H H H H H H H H P P

M I A L Q P L V T D D P T Q V H H H Q E V I L V Q T R E E V V G G D D S D G L R A

E D G F E D Q I L I P V P A P A G G D D D Y I E Q T L V T V A A A G K S G G G G S

S S S G G G R V K K G G G K K S G K K S Y L S G G A G A A G G G G A D P G N K

K W E Q K Q V Q I K T L E G E F S V T M W S S D E K K D I D H E T V V E E Q I I G

E N S P P D Y S E Y M T G K K L P P G G I P G I D L S D P K Q L A E F A R M K P R

K I K E D D A P R T I A C P H K G C T K M F R D N S A M R K H L H T H G P R V H V

C A E C G K A F V E S S K L K R H Q L V H T G E K P F Q C T F E G C G K R F S L D Zinc Finger 1 Zinc Finger 2

F N L R T H V R I H T G D R P Y V C P F D G C N K K F A Q S T N L K S H I L T H A Zinc Finger 3

K A K N N Q C P F D G C N K K F A Q S T N L K S H I L T H A K A K N N Q Zinc Finger 4

REFERENCES

Affar el, B., Gay, F., Shi, Y., Liu, H., Huarte, M., Wu, S., Collins, T., and Li, E. (2006a). Essential dosage-dependent functions of the transcription factor yin yang 1 in late embryonic development and cell cycle progression. Molecular and cellular biology 26, 3565-3581.

Affar el, B., Gay, F., Shi, Y., Liu, H., Huarte, M., Wu, S., Collins, T., Li, E., and Shi, Y. (2006b). Essential dosage-dependent functions of the transcription factor yin yang 1 in late embryonic development and cell cycle progression. Molecular and cellular biology 26, 3565-3581.

Ahmad, K.A., Wang, G., Unger, G., Slaton, J., and Ahmed, K. (2008). Protein kinase CK2--a key suppressor of apoptosis. Adv Enzyme Regul 48, 179-187.

Austen, M., Cerni, C., Henriksson, M., Hilfenhaus, S., Luscher-Firzlaff, J.M., Menkel, A., Seelos, C., Sommer, A., and Luscher, B. (1997a). Regulation of cell growth by the Myc-Max-Mad network: role of Mad proteins and YY1. Current topics in microbiology and immunology 224, 123-130.

Austen, M., Cerni, C., Luscher-Firzlaff, J.M., and Luscher, B. (1998). YY1 can inhibit c- Myc function through a mechanism requiring DNA binding of YY1 but neither its transactivation domain nor direct interaction with c-Myc. Oncogene 17, 511-520.

Austen, M., Luscher, B., and Luscher-Firzlaff, J.M. (1997b). Characterization of the transcriptional regulator YY1. The bipartite transactivation domain is independent of interaction with the TATA box-binding protein, transcription factor IIB, TAFII55, or cAMP-responsive element-binding protein (CPB)-binding protein. J Biol Chem 272, 1709-1717.

Baritaki, S., Chatzinikola, A.M., Vakis, A.F., Soulitzis, N., Karabetsos, D.A., Neonakis, I., Bonavida, B., and Spandidos, D.A. (2009). YY1 Over-expression in human brain gliomas and meningiomas correlates with TGF-beta1, IGF-1 and FGF-2 mRNA levels. Cancer Invest 27, 184-192.

Baritaki, S., Katsman, A., Chatterjee, D., Yeung, K.C., Spandidos, D.A., and Bonavida, B. (2007a). Regulation of tumor cell sensitivity to TRAIL-induced apoptosis by the metastatic suppressor Raf kinase, inhibitor protein via Yin Yang 1 inhibition and death receptor 5 up-regulation. Journal of Immunology 179, 5441-5453.

Baritaki, S., Sifakis, S., Huerta-Yepez, S., Neonakis, I.K., Soufla, G., Bonavida, B., and Spandidos, D.A. (2007b). Overexpression of VEGF and TGF-beta1 mRNA in Pap smears correlates with progression of cervical intraepithelial neoplasia to cancer: implication of YY1 in cervical tumorigenesis and HPV infection. Int J Oncol 31, 69-79.

Baumeister, P., Luo, S.Z., Skarnes, W.C., Sui, G.C., Seto, E., Shi, Y., and Lee, A.S. (2005). Endoplasmic reticulum stress induction of the Grp78/BiP promoter: Activating mechanisms mediated by YY1 and its interactive chromatin modifiers. Molecular and cellular biology 25, 4529-4540.

Beausoleil, S.A., Jedrychowski, M., Schwartz, D., Elias, J.E., Villen, J., Li, J., Cohn, M.A., Cantley, L.C., and Gygi, S.P. (2004). Large-scale characterization of HeLa cell nuclear phosphoproteins. Proceedings of the National Academy of Sciences of the United States of America 101, 12130-12135.

Becker, K.G., Jedlicka, P., Templeton, N.S., Liotta, L., and Ozato, K. (1994). Characterization of hUCRBP (YY1, NF-E1, delta): a transcription factor that binds the regulatory regions of many viral and cellular genes. Gene 150, 259-266.

Begon, D.Y., Delacroix, L., Vernimmen, D., Jackers, P., and Winkler, R. (2005). Yin Yang 1 cooperates with activator protein 2 to stimulate ERBB2 gene expression in mammary cancer cells. J Biol Chem 280, 24428-24434.

Belkina, N.V., Liu, Y., Hao, J.J., Karasuyama, H., and Shawa, S. (2009). LOK is a major ERM kinase in resting lymphocytes and regulates cytoskeletal rearrangement through ERM phosphorylation. Proceedings of the National Academy of Sciences of the United States of America 106, 4707-4712.

Bernard, M., and Voisin, P. (2008). Photoreceptor-specific expression, light-dependent localization, and transcriptional targets of the zinc-finger protein Yin Yang 1 in the chicken retina. Journal of neurochemistry 105, 595-604.

Bischoff, J.R., Anderson, L., Zhu, Y.F., Mossie, K., Ng, L., Souza, B., Schryver, B., Flanagan, P., Clairvoyant, F., Ginther, C., et al. (1998). A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers. Embo Journal 17, 3052-3065.

Blattler, S.M., Cunningham, J.T., Verdeguer, F., Chim, H., Haas, W., Liu, H.F., Romanino, K., Ruegg, M.A., Gygi, S.P., Shi, Y., et al. (2012). Yin Yang 1 Deficiency in Skeletal Muscle Protects against Rapamycin-Induced Diabetic-like Symptoms through Activation of Insulin/IGF Signaling. Cell Metab 15, 505-517.

Blume-Jensen, P., and Hunter, T. (2001). Oncogenic kinase signalling. Nature 411, 355-365.

Brennan, I.M., Peters, U., Kapoor, T.M., and Straight, A.F. (2007). Polo-like kinase controls vertebrate spindle elongation and cytokinesis. PLoS One 2, e409.

Broillet, M.C. (1999). S-Nitrosylation of proteins. Cellular and Molecular Life Sciences 55, 1036-1042.

Brown, J.L., Fritsch, C., Mueller, J., and Kassis, J.A. (2003). The Drosophila pho-like gene encodes a YY1-related DNA binding protein that is redundant with pleiohomeotic in homeotic gene silencing. Development 130, 285-294.

Brown, J.L., Mucci, D., Whiteley, M., Dirksen, M.L., and Kassis, J.A. (1998). The Drosophila Polycomb group gene pleiohomeotic encodes a DNA binding protein with homology to the transcription factor YY1. Mol Cell 1, 1057-1064.

Burley, S.K., and Petsko, G.A. (1985). Aromatic-aromatic interaction: a mechanism of protein structure stabilization. Science 229, 23-28.

Bushmeyer, S., Park, K., and Atchison, M.L. (1995). Characterization of functional domains within the multifunctional transcription factor, YY1. J Biol Chem 270, 30213-30220.

Canton, D.A., and Litchfield, D.W. (2006). The shape of things to come: an emerging role for protein kinase CK2 in the regulation of cell morphology and the cytoskeleton. Cell Signal 18, 267-275.

Caretti, G., Di Padova, M., Micales, B., Lyons, G.E., and Sartorelli, V. (2005). The Polycomb Ezh2 methyltransferase regulates muscle gene expression and skeletal muscle differentiation (vol 18, pg 2627, 2004). Genes & development 19, 768-768.

Carpinelli, P., and Moll, J. (2008). Aurora kinases and their inhibitors: More than one target and one drug. Targeted Therapies in Cancer: Myth or Reality? 610, 54-73.

Ceulemans, H., and Bollen, M. (2004). Functional diversity of protein phosphatase-1, a cellular economizer and reset button. Physiol Rev 84, 1-39.

Chen, K.S., Paladugu, A., Aldaz, C.M., and Gould, M.N. (1996). Cloning and chromosomal localization of the rat Stat5 and Yy1 genes. Cytogenetics and cell genetics 74, 277-280.

Chi, A., Huttenhower, C., Geer, L.Y., Coon, J.J., Syka, J.E., Bai, D.L., Shabanowitz, J., Burke, D.J., Troyanskaya, O.G., and Hunt, D.F. (2007). Analysis of phosphorylation sites on proteins from Saccharomyces cerevisiae by electron transfer dissociation (ETD) mass spectrometry. Proceedings of the National Academy of Sciences of the United States of America 104, 2193-2198.

Chinnappan, D., Xiao, D., Ratnasari, A., Andry, C., King, T.C., and Weber, H.C. (2009). Transcription factor YY1 expression in human gastrointestinal cancer cells. Int J Oncol 34, 1417-1423.

Cohen, P. (2000). The regulation of protein function by multisite phosphorylation--a 25 year update. Trends in biochemical sciences 25, 596-601.

Colicelli, J. (2010). ABL tyrosine kinases: evolution of function, regulation, and specificity. Sci Signal 3, re6.

Crosio, C., Fimia, G.M., Loury, R., Kimura, M., Okano, Y., Zhou, H., Sen, S., Allis, C.D., and Sassone-Corsi, P. (2002). Mitotic phosphorylation of histone H3: spatio- temporal regulation by mammalian Aurora kinases. Molecular and cellular biology 22, 874-885.

Cui, Y., Mao, Z., Pestell, R., Curran, E.M., Welshons, W.V., and Fuqua, S.A.W. (2004). Phosphorylation of estrogen receptor a blocks its acetylation and regulates estrogen sensitivity. Cancer research 64, 9199-9208. de Nigris, F., Botti, C., de Chiara, A., Rossiello, R., Apice, G., Fazioli, F., Fiorito, C., Sica, V., and Napoli, C. (2006). Expression of transcription factor Yin Yang 1 in human osteosarcomas. Eur J Cancer 42, 2420-2424.

Delehouzee, S., Yoshikawa, T., Sawa, C., Sawada, J., Ito, T., Omori, M., Wada, T., Yamaguchi, Y., Kabe, Y., and Handa, H. (2005). GABP, HCF-1 and YY1 are involved in Rb gene expression during myogenesis. Genes Cells 10, 717-731.

DeManno, D.A., Cottom, J.E., Kline, M.P., Peters, C.A., Maizels, E.T., and Hunzicker- Dunn, M. (1999). Follicle-stimulating hormone promotes histone h3 phosphorylation on serine-10. Molecular Endocrinology 13, 91-105.

Deng, Z., Cao, P., Wan, M.M., and Sui, G. (2010). Yin Yang 1: a multifaceted protein beyond a transcription factor. Transcription 1, 81-84.

Deng, Z., Wan, M., and Sui, G. (2007). PIASy-mediated sumoylation of Yin Yang 1 depends on their interaction but not the RING finger. Molecular and cellular biology 27, 3780-3792.

Dephoure, N., Zhou, C., Villen, J., Beausoleil, S.A., Bakalarski, C.E., Elledge, S.J., and Gygi, S.P. (2008). A quantitative atlas of mitotic phosphorylation. Proc Natl Acad Sci U S A 105, 10762-10767.

Donohoe, M.E., Zhang, X., McGinnis, L., Biggers, J., Li, E., and Shi, Y. (1999). Targeted disruption of mouse Yin Yang 1 transcription factor results in peri-implantation lethality. Molecular and cellular biology 19, 7237-7244.

Duncan, J.S., and Litchfield, D.W. (2008). Too much of a good thing: the role of protein kinase CK2 in tumorigenesis and prospects for therapeutic inhibition of CK2. Biochim Biophys Acta 1784, 33-47.

Duncan, J.S., Turowec, J.P., Vilk, G., Li, S.S., Gloor, G.B., and Litchfield, D.W. (2010). Regulation of cell proliferation and survival: convergence of protein kinases and caspases. Biochim Biophys Acta 1804, 505-510.

100

Durrin, L.K., Mann, R.K., Kayne, P.S., and Grunstein, M. (1991). Yeast histone H4 N- terminal sequence is required for promoter activation in vivo. Cell 65, 1023-1031.

Eliassen, K.A., Baldwin, A., Sikorski, E.M., and Hurt, M.M. (1998). Role for a YY1- binding element in replication-dependent mouse histone gene expression. Mol Cell Biol 18, 7106-7118.

Erkeland, S.J., Valkhof, M., Heijmans-Antonissen, C., Delwel, R., Valk, P.J., Hermans, M.H., and Touw, I.P. (2003). The gene encoding the transcriptional regulator Yin Yang 1 (YY1) is a myeloid transforming gene interfering with neutrophilic differentiation. Blood 101, 1111-1117.

Flanagan, J.R. (1995). Autologous stimulation of YY1 transcription factor expression: role of an insulin-like growth factor. Cell Growth Differ 6, 185-190.

Flanagan, J.R., Becker, K.G., Ennist, D.L., Gleason, S.L., Driggers, P.H., Levi, B.Z., Appella, E., and Ozato, K. (1992). Cloning of a Negative Transcription Factor That Binds to the Upstream Conserved Region of Moloney Murine Leukemia- Virus. Molecular and cellular biology 12, 38-44.

Galvin, K.M., and Shi, Y. (1997). Multiple mechanisms of transcriptional repression by YY1. Molecular and cellular biology 17, 3723-3732.

Geiss-Friedlander, R., and Melchior, F. (2007). Concepts in sumoylation: a decade on. Nat Rev Mol Cell Biol 8, 947-956.

Giet, R., and Prigent, C. (1999). Aurora/Ipl1p-related kinases, a new oncogenic family of mitotic serine-threonine kinases. J Cell Sci 112 ( Pt 21), 3591-3601.

Glover, D.M., Leibowitz, M.H., McLean, D.A., and Parry, H. (1995). Mutations in aurora prevent centrosome separation leading to the formation of monopolar spindles. Cell 81, 95-105.

Gordon, S., Akopyan, G., Garban, H., and Bonavida, B. (2006). Transcription factor YY1: structure, function, and therapeutic implications in cancer biology. Oncogene 25, 1125-1142.

Goto, H., Yasui, Y., Kawajiri, A., Nigg, E.A., Terada, Y., Tatsuka, M., Nagata, K., and Inagaki, M. (2003). Aurora-B regulates the cleavage furrow-specific vimentin phosphorylation in the cytokinetic process. Journal of Biological Chemistry 278, 8526-8530.

Gronroos, E., Terentiev, A.A., Punga, T., and Ericsson, J. (2004). YY1 inhibits the activation of the p53 tumor suppressor in response to genotoxic stress. Proceedings of the National Academy of Sciences of the United States of America 101, 12165-12170.

101

Gully, C.P., Zhang, F., Chen, J., Yeung, J.A., Velazquez-Torres, G., Wang, E., Yeung, S.C., and Lee, M.H. (2010). Antineoplastic effects of an Aurora B kinase inhibitor in breast cancer. Molecular cancer 9, 42.

Guo, B., Odgren, P.R., Vanwijnen, A.J., Last, T.J., Nickerson, J., Penman, S., Lian, J.B., Stein, J.L., and Stein, G.S. (1995). The Nuclear Matrix Protein Nmp-1 Is the Transcription Factor Yy1. Proceedings of the National Academy of Sciences of the United States of America 92, 10526-10530.

Hariharan, I.K., Chuang, P.T., and Rubin, G.M. (1991a). Cloning and characterization of a receptor-class phosphotyrosine phosphatase gene expressed on central nervous system axons in Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America 88, 11266-11270.

Hariharan, N., Kelley, D.E., and Perry, R.P. (1991b). Delta, a transcription factor that binds to downstream elements in several polymerase II promoters, is a functionally versatile zinc finger protein. Proceedings of the National Academy of Sciences of the United States of America 88, 9799-9803.

Hart, G.W. (1997). Dynamic O-linked glycosylation of nuclear and cytoskeletal proteins. Annual review of biochemistry 66, 315-335.

Hayama, S., Daigo, Y., Yamabuki, T., Hirata, D., Kato, T., Miyamoto, M., Ito, T., Tsuchiya, E., Kondo, S., and Nakamura, Y. (2007). Phosphorylation and activation of cell division cycle associated 8 by aurora kinase B plays a significant role in human lung carcinogenesis. Cancer research 67, 4113-4122.

He, Y., Kim, J.Y., Dupree, J., Tewari, A., Melendez-Vasquez, C., Svaren, J., and Casaccia, P. (2010). Yy1 as a molecular link between neuregulin and transcriptional modulation of peripheral myelination. Nat Neurosci 13, 1472- U1454.

Hergeth, S.P., Dundr, M., Tropberger, P., Zee, B.M., Garcia, B.A., Daujat, S., and Schneider, R. (2011). Isoform-specific phosphorylation of human linker histone H1.4 in mitosis by the kinase Aurora B. J Cell Sci 124, 1623-1628.

Hiromura, M., Choi, C.H., Sabourin, N.A., Jones, H., Bachvarov, D., and Usheva, A. (2003). YY1 is regulated by O-linked N-acetylglucosaminylation (O- glcNAcylation). J Biol Chem 278, 14046-14052.

Hirota, T., Lipp, J.J., Toh, B.H., and Peters, J.M. (2005). Histone H3 serine 10 phosphorylation by Aurora B causes HP1 dissociation from heterochromatin. Nature 438, 1176-1180.

Hogan, C.J., Aligianni, S., Durand-Dubief, M., Persson, J., Will, W.R., Webster, J., Wheeler, L., Mathews, C.K., Elderkin, S., Oxley, D., et al. (2010). Fission Yeast Iec1-Ino80-Mediated Nucleosome Eviction Regulates Nucleotide and Phosphate Metabolism. Molecular and cellular biology 30, 657-674.

102

Honda, R., Korner, R., and Nigg, E.A. (2003). Exploring the functional interactions between Aurora B, INCENP, and survivin in mitosis. Molecular biology of the cell 14, 3325-3341.

Hongo, F., Garban, H., Huerta-Yepez, S., Vega, M., Jazirehi, A.R., Mizutani, Y., Miki, T., and Bonavida, B. (2005). Inhibition of the transcription factor Yin Yang 1 activity by S-nitrosation. Biochem Biophys Res Commun 336, 692-701.

Houbaviy, H.B., Usheva, A., Shenk, T., and Burley, S.K. (1996). Cocrystal structure of YY1 bound to the adeno-associated virus P5 initiator. Proceedings of the National Academy of Sciences of the United States of America 93, 13577-13582.

Huerta-Yepez, S., Vega, M., Garban, H., and Bonavida, B. (2006). Involvement of the TNF-alpha autocrine-paracrine loop, via NF-kappa B and YY1, in the regulation of tumor cell resistance to Fas-induced apoptosis. Clin Immunol 120, 297-309.

Hunter, T. (1995). Protein kinases and phosphatases: the yin and yang of protein phosphorylation and signaling. Cell 80, 225-236.

Hunter, T. (2009). Tyrosine phosphorylation: thirty years and counting. Current opinion in cell biology 21, 140-146.

Huttlin, E.L., Jedrychowski, M.P., Elias, J.E., Goswami, T., Rad, R., Beausoleil, S.A., Villen, J., Haas, W., Sowa, M.E., and Gygi, S.P. (2010). A Tissue-Specific Atlas of Mouse Protein Phosphorylation and Expression. Cell 143, 1174-1189.

Hyde-DeRuyscher, R.P., Jennings, E., and Shenk, T. (1995). DNA binding sites for the transcriptional activator/repressor YY1. Nucleic acids research 23, 4457-4465.

Ishizaki, T., Maekawa, M., Fujisawa, K., Okawa, K., Iwamatsu, A., Fujita, A., Watanabe, N., Saito, Y., Kakizuka, A., Morii, N., et al. (1996). The small GTP-binding protein Rho binds to and activates a 160 kDa Ser/Thr protein kinase homologous to myotonic dystrophy kinase. Embo Journal 15, 1885-1893.

Kaludov, N.K., Bowman, T.L., Sikorski, E.M., and Hurt, M.M. (1996). Cell cycle- regulated binding of nuclear proteins to elements within a mouse H3.2 histone gene. Proceedings of the National Academy of Sciences of the United States of America 93, 4465-4470.

Kaludov, N.K., Pabon-Pena, L., Seavy, M., Robinson, G., and Hurt, M.M. (1997). A mouse histone H1 variant, H1b, binds preferentially to a regulatory sequence within a mouse H3.2 replication-dependent histone gene. J Biol Chem 272, 15120-15127.

Katayama, H., Brinkley, W.R., and Sen, S. (2003). The Aurora kinases: role in cell transformation and tumorigenesis. Cancer metastasis reviews 22, 451-464.

103

Kawajiri, A., Yasui, Y., Goto, H., Tatsuka, M., Takahashi, M., Nagata, K., and Inagaki, M. (2003). Functional significance of the specific sites phosphorylated in desmin at cleavage furrow: Aurora-B may phosphorylate and regulate type III intermediate filaments during cytokinesis coordinatedly with Rho-kinase. Molecular biology of the cell 14, 1489-1500.

Kettenbach, A.N., Schweppe, D.K., Faherty, B.K., Pechenick, D., Pletnev, A.A., and Gerber, S.A. (2011a). Quantitative phosphoproteomics identifies substrates and functional modules of Aurora and Polo-like kinase activities in mitotic cells. Sci Signal 4, rs5.

Kettenbach, A.N., Schweppe, D.K., Faherty, B.K., Pechenick, D., Pletnev, A.A., and Gerber, S.A. (2011b). Quantitative Phosphoproteomics Identifies Substrates and Functional Modules of Aurora and Polo-Like Kinase Activities in Mitotic Cells. Sci Signal 4.

Kim, J., and Do Kim, J. (2008). In vivo YY1 knockdown effects on genomic imprinting. Hum Mol Genet 17, 391-401.

Kim, W., Bennett, E.J., Huttlin, E.L., Guo, A., Li, J., Possemato, A., Sowa, M.E., Rad, R., Rush, J., Comb, M.J., et al. (2011). Systematic and Quantitative Assessment of the Ubiquitin-Modified Proteome. Molecular Cell 44, 325-340.

Kirschner, L.S., Yin, Z.R., Jones, G.N., and Mahoney, E. (2009). Mouse models of altered protein kinase A signaling. Endocrine-related cancer 16, 773-793.

Kreppel, L.K., Blomberg, M.A., and Hart, G.W. (1997). Dynamic glycosylation of nuclear and cytosolic proteins. Cloning and characterization of a unique O-GlcNAc transferase with multiple tetratricopeptide repeats. J Biol Chem 272, 9308-9315.

Krippner-Heidenreich, A., Walsemann, G., Beyrouthy, M.J., Speckgens, S., Kraft, R., Thole, H., Talanian, R.V., Hurt, M.M., and Luscher, B. (2005). Caspase- dependent regulation and subcellular redistribution of the transcriptional modulator YY1 during apoptosis. Molecular and cellular biology 25, 3704-3714.

Lee, D.Y., Teyssier, C., Strahl, B.D., and Stallcup, M.R. (2005). Role of protein methylation in regulation of transcription. Endocr Rev 26, 147-170.

Lee, J.S., Galvin, K.M., See, R.H., Eckner, R., Livingston, D., Moran, E., and Shi, Y. (1995a). Relief of YY1 transcriptional repression by adenovirus E1A is mediated by E1A-associated protein p300. Genes & development 9, 1188-1198.

Lee, J.S., See, R.H., Galvin, K.M., Wang, J., and Shi, Y. (1995b). Functional interactions between YY1 and adenovirus E1A. Nucleic acids research 23, 925- 931.

104

Lewis, B.A., Tullis, G., Seto, E., Horikoshi, N., Weinmann, R., and Shenk, T. (1995). Adenovirus E1A proteins interact with the cellular YY1 transcription factor. J Virol 69, 1628-1636.

Lindqvist, A., Rodriguez-Bravo, V., and Medema, R.H. (2009). The decision to enter mitosis: feedback and redundancy in the mitotic entry network. The Journal of cell biology 185, 193-202.

Litchfield, D.W. (2003a). Protein kinase CK2: structure, regulation and role in cellular decisions of life and death. Biochem J 369, 1-15.

Litchfield, D.W. (2003b). Protein kinase CK2: structure, regulation and role in cellular decisions of life and death. Biochemical Journal 369, 1-15.

Liu, D., Vleugel, M., Backer, C.B., Hori, T., Fukagawa, T., Cheeseman, I.M., and Lampson, M.A. (2010). Regulated targeting of protein phosphatase 1 to the outer kinetochore by KNL1 opposes Aurora B kinase. Journal of Cell Biology 188, 809- 820.

Lo, W.S., Trievel, R.C., Rojas, J.R., Duggan, L., Hsu, J.Y., Allis, C.D., Marmorstein, R., and Berger, S.L. (2000). Phosphorylation of serine 10 in histone H3 is functionally linked in vitro and in vivo to Gcn5-mediated acetylation at lysine 14. Molecular Cell 5, 917-926.

Maldonado, E., Shiekhattar, R., Sheldon, M., Cho, H., Drapkin, R., Rickert, P., Lees, E., Anderson, C.W., Linn, S., and Reinberg, D. (1996). A human RNA polymerase II complex associated with SRB and DNA-repair proteins. Nature 381, 86-89.

Manning, G., Whyte, D.B., Martinez, R., Hunter, T., and Sudarsanam, S. (2002). The protein kinase complement of the human genome. Science 298, 1912-1934.

Meggio, F., and Pinna, L.A. (2003). One-thousand-and-one substrates of protein kinase CK2? FASEB J 17, 349-368.

Miller, W.T. (2012). Tyrosine kinase signaling and the emergence of multicellularity. Biochim Biophys Acta.

Mohan, R.D., Litchfield, D.W., Torchia, J., and Tini, M. (2010). Opposing regulatory roles of phosphorylation and acetylation in DNA mispair processing by thymine DNA glycosylase. Nucleic acids research 38, 1135-1148.

Molina, H., Horn, D.M., Tang, N., Mathivanan, S., and Pandey, A. (2007). Global proteomic profiling of phosphopeptides using electron transfer dissociation tandem mass spectrometry. Proc Natl Acad Sci U S A 104, 2199-2204.

Morgan, M.J., Woltering, J.M., Rieden, P.M.J.I.D., Durston, A.J., and Thiery, J.P. (2004). YY1 regulates the neural crest-associated slug gene in Xenopus laevis. Journal of Biological Chemistry 279, 46826-46834.

105

Muller, S., Hoege, C., Pyrowolakis, G., and Jentsch, S. (2001). Sumo, ubiquitin's mysterious cousin. Nat Rev Mol Cell Bio 2, 202-210.

Murnion, M.E., Adams, R.R., Callister, D.M., Allis, C.D., Earnshaw, W.C., and Swedlow, J.R. (2001). Chromatin-associated protein phosphatase 1 regulates aurora-B and histone H3 phosphorylation. Journal of Biological Chemistry 276, 26656-26665.

Nair, J.S., Ho, A.L., Tse, A.N., Coward, J., Cheema, H., Ambrosini, G., Keen, N., and Schwartz, G.K. (2009). Aurora B Kinase Regulates the Postmitotic Endoreduplication Checkpoint via Phosphorylation of the Retinoblastoma Protein at Serine 780. Molecular biology of the cell 20, 2218-2228.

Nguyen, N., Zhang, X.H., Olashaw, N., and Seto, E. (2004). Molecular cloning and functional characterization of the transcription factor YY2. Journal of Biological Chemistry 279, 25927-25934.

Nigg, E.A. (2001). Mitotic kinases as regulators of cell division and its checkpoints. Nat Rev Mol Cell Biol 2, 21-32.

Nousiainen, M., Sillje, H.H., Sauer, G., Nigg, E.A., and Korner, R. (2006). Phosphoproteome analysis of the human mitotic spindle. Proceedings of the National Academy of Sciences of the United States of America 103, 5391-5396.

Oei, S.L., Griesenbeck, J., and Schweiger, M. (1997a). The role of poly(ADP- ribosyl)ation. Reviews of physiology, biochemistry and pharmacology 131, 127-173.

Oei, S.L., Griesenbeck, J., Schweiger, M., Babich, V., Kropotov, A., and Tomilin, N. (1997b). Interaction of the transcription factor YY1 with human poly(ADP-ribosyl) transferase. Biochem Biophys Res Commun 240, 108-111.

Oei, S.L., Griesenbeck, J., Schweiger, M., and Ziegler, M. (1998). Regulation of RNA polymerase II-dependent transcription by poly(ADP-ribosyl)ation of transcription factors. J Biol Chem 273, 31644-31647.

Oh, H.J., Kim, M.J., Song, S.J., Kim, T., Lee, D., Kwon, S.H., Choi, E.J., and Lim, D.S. (2010). MST1 Limits the Kinase Activity of Aurora B to Promote Stable Kinetochore-Microtubule Attachment. Curr Biol 20, 416-422.

Olsen, J.V., Blagoev, B., Gnad, F., Macek, B., Kumar, C., Mortensen, P., and Mann, M. (2006). Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 127, 635-648.

Palko, L., Bass, H.W., Beyrouthy, M.J., and Hurt, M.M. (2004). The Yin Yang-1 (YY1) protein undergoes a DNA-replication-associated switch in localization from the cytoplasm to the nucleus at the onset of S phase. J Cell Sci 117, 465-476.

Park, K., and Atchison, M.L. (1991). Isolation of a candidate repressor/activator, NF-E1 (YY-1, delta), that binds to the immunoglobulin kappa 3' enhancer and the

106

immunoglobulin heavy-chain mu E1 site. Proceedings of the National Academy of Sciences of the United States of America 88, 9804-9808.

Pascreau, G., Delcros, J.G., Morin, N., Prigent, C., and Arlot-Bonnemains, Y. (2008). Aurora-A kinase Ser349 phosphorylation is required during Xenopus laevis oocyte maturation. Developmental biology 317, 523-530.

Patten, M., Wang, W., Aminololama-Shakeri, S., Burson, M., and Long, C.S. (2000). IL- 1 beta increases abundance and activity of the negative transcriptional regulator yin yang-1 (YY1) in neonatal rat cardiac myocytes. Journal of molecular and cellular cardiology 32, 1341-1352.

Perrera, C., Colombo, R., Valsasina, B., Carpinelli, P., Troiani, S., Modugno, M., Gianellini, L., Cappella, P., Isacchi, A., Moll, J., et al. (2010). Identification of Myb-binding Protein 1A (MYBBP1A) as a Novel Substrate for Aurora B Kinase. Journal of Biological Chemistry 285, 11775-11785.

Petkova, V., Romanowski, M.J., Sulijoadikusumo, I., Rohne, D., Kang, P., Shenk, T., and Usheva, A. (2001). Interaction between YY1 and the retinoblastoma protein. Regulation of cell cycle progression in differentiated cells. The Journal of biological chemistry 276, 7932-7936.

Petronczki, M., Lenart, P., and Peters, J.M. (2008). Polo on the Rise-from Mitotic Entry to Cytokinesis with Plk1. Developmental cell 14, 646-659.

Pickart, C.M. (2001). Mechanisms underlying ubiquitination. Annual review of biochemistry 70, 503-533.

Pisaneschi, G., Ceccotti, S., Falchetti, M.L., Fiumicino, S., Carnevali, F., and Beccari, E. (1994). Characterization of FIII/YY1, a Xenopus laevis conserved zinc-finger protein binding to the first exon of L1 and L14 ribosomal protein genes. Biochem Biophys Res Commun 205, 1236-1242.

Prigent, C., and Dimitrov, S. (2003). Phosphorylation of serine 10 in histone H3, what for? J Cell Sci 116, 3677-3685.

Ren, G., Zhang, G., Dong, Z., Liu, Z., Li, L., Feng, Y., Su, D., Zhang, Y., Huang, B., and Lu, J. (2009). Recruitment of HDAC4 by transcription factor YY1 represses HOXB13 to affect cell growth in AR-negative prostate cancers. The international journal of biochemistry & cell biology 41, 1094-1101.

Rezai-Zadeh, N., Zhang, X.H., Namour, F., Fejer, G., Wen, Y.D., Yao, Y.L., Gyory, I., Wright, K., and Seto, E. (2003). Targeted recruitment of a histone H4-specific methyltransferase by the transcription factor YY1. Genes & development 17, 1019-1029.

Riento, K., and Ridley, A.J. (2003). Rocks: Multifunctional kinases in cell behaviour. Nat Rev Mol Cell Bio 4, 446-456.

107

Riggs, K.J., Saleque, S., Wong, K.K., Merrell, K.T., Lee, J.S., Shi, Y., and Calame, K. (1993). Yin-yang 1 activates the c-myc promoter. Molecular and cellular biology 13, 7487-7495.

Riman, S., Rizkallah, R., Kassardjian, A., Alexander, K.E., Luscher, B., and Hurt, M.M. (2012). Phosphorylation of the transcription factor YY1 by CK2alpha prevents cleavage by caspase 7 during apoptosis. Molecular and cellular biology 32, 797- 807.

Rizkallah, R., Alexander, K.E., and Hurt, M.M. (2011a). Global mitotic phosphorylation of C2H2 zinc finger protein linker peptides. Cell Cycle 10, 3327-3336.

Rizkallah, R., Alexander, K.E., Kassardjian, A., Luscher, B., and Hurt, M.M. (2011b). The transcription factor YY1 is a substrate for Polo-like kinase 1 at the G2/M transition of the cell cycle. PloS one 6, e15928.

Rizkallah, R., and Hurt, M.M. (2009). Regulation of the transcription factor YY1 in mitosis through phosphorylation of its DNA-binding domain. Molecular biology of the cell 20, 4766-4776.

Robinson, D.R., Wu, Y.M., and Lin, S.F. (2000). The protein tyrosine kinase family of the human genome. Oncogene 19, 5548-5557.

Safrany, G., and Perry, R.P. (1993). Characterization of the mouse gene that encodes the delta/YY1/NF-E1/UCRBP transcription factor. Proceedings of the National Academy of Sciences of the United States of America 90, 5559-5563.

Sakhinia, E., Glennie, C., Hoyland, J.A., Menasce, L.P., Brady, G., Miller, C., Radford, J.A., and Byers, R.J. (2007). Clinical quantitation of diagnostic and predictive gene expression levels in follicular and diffuse large B-cell lymphoma by RT-PCR gene expression profiling. Blood 109, 3922-3928.

Sakita-Suto, S., Kanda, A., Suzuki, F., Sato, S., Takata, T., and Tatsuka, M. (2007). Aurora-B regulates RNA methyltransferase NSUN2. Molecular biology of the cell 18, 1107-1117.

Santiago, F.S., Lowe, H.C., Bobryshev, Y.V., and Khachigian, L.M. (2001). Induction of the transcriptional repressor Yin Yang-1 by vascular cell injury. Autocrine/paracrine role of endogenous fibroblast growth factor-2. J Biol Chem 276, 41143-41149.

Schlisio, S., Halperin, T., Vidal, M., and Nevins, J.R. (2002). Interaction of YY1 with E2Fs, mediated by RYBP, provides a mechanism for specificity of E2F function. The EMBO journal 21, 5775-5786.

Schmitt, A., Gutierrez, G.J., Lenart, P., Ellenberg, J., and Nebreda, A.R. (2002). Histone H3 phosphorylation during Xenopus oocyte maturation: regulation by the MAP

108

kinase/p90Rsk pathway and uncoupling from DNA condensation. FEBS letters 518, 23-28.

Seligson, D., Horvath, S., Huerta-Yepez, S., Hanna, S., Garban, H., Roberts, A., Shi, T., Liu, X., Chia, D., Goodglick, L., et al. (2005). Expression of transcription factor Yin Yang 1 in prostate cancer. Int J Oncol 27, 131-141.

Shahbazian, M.D., and Grunstein, M. (2007). Functions of site-specific histone acetylation and deacetylation. Annual review of biochemistry 76, 75-100.

Shen, T., Zong, C., Hamelberg, D., McCammon, J.A., and Wolynes, P.G. (2005). The folding energy landscape and phosphorylation: modeling the conformational switch of the NFAT regulatory domain. Faseb J 19, 1389-1395.

Shi, Y., Lee, J.S., and Galvin, K.M. (1997). Everything you have ever wanted to know about Yin Yang 1. Biochim Biophys Acta 1332, F49-66.

Shi, Y., Seto, E., Chang, L.S., and Shenk, T. (1991). Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell 67, 377-388.

Shrivastava, A., Saleque, S., Kalpana, G.V., Artandi, S., Goff, S.P., and Calame, K. (1993). Inhibition of transcriptional regulator Yin-Yang-1 by association with c- Myc. Science 262, 1889-1892.

Shrivastava, A., Yu, J., Artandi, S., and Calame, K. (1996). YY1 and c-Myc associate in vivo in a manner that depends on c-Myc levels. Proceedings of the National Academy of Sciences of the United States of America 93, 10638-10641.

Singh, R.K., and Gunjan, A. (2011). Histone tyrosine phosphorylation comes of age. Epigenetics : official journal of the DNA Methylation Society 6, 153-160.

Sirvent, A., Benistant, C., and Roche, S. (2008). Cytoplasmic signalling by the c-Abl tyrosine kinase in normal and cancer cells. Biology of the Cell 100, 617-631.

Song, H.D., Sun, X.J., Deng, M., Zhang, G.W., Zhou, Y., Wu, X.Y., Sheng, Y., Chen, Y., Ruan, Z., Jiang, C.L., et al. (2004). Hematopoietic gene expression profile in zebrafish kidney marrow. Proceedings of the National Academy of Sciences of the United States of America 101, 16240-16245.

Stamler, J.S., Lamas, S., and Fang, F.C. (2001). Nitrosylation. the prototypic redox- based signaling mechanism. Cell 106, 675-683.

Stewart, S., and Fang, G. (2005). Destruction box-dependent degradation of aurora B is mediated by the anaphase-promoting complex/cyclosome and Cdh1. Cancer research 65, 8730-8735.

109

Strahl, B.D., and Allis, C.D. (2000). The language of covalent histone modifications. Nature 403, 41-45.

Sugiyama, K., Sugiura, K., Hara, T., Sugimoto, K., Shima, H., Honda, K., Furukawa, K., Yamashita, S., and Urano, T. (2002). Aurora-B associated protein phosphatases as negative regulators of kinase activation. Oncogene 21, 3103-3111.

Sui, G., Affar el, B., Shi, Y., Brignone, C., Wall, N.R., Yin, P., Donohoe, M., Luke, M.P., Calvo, D., and Grossman, S.R. (2004). Yin Yang 1 is a negative regulator of p53. Cell 117, 859-872.

Sullivan, M., and Morgan, D.O. (2007). Finishing mitosis, one step at a time. Nat Rev Mol Cell Biol 8, 894-903.

Sunkel, C.E., and Glover, D.M. (1988). polo, a mitotic mutant of Drosophila displaying abnormal spindle poles. J Cell Sci 89 ( Pt 1), 25-38.

Takaki, T., Trenz, K., Costanzo, V., and Petronczki, M. (2008a). Polo-like kinase 1 reaches beyond mitosis--cytokinesis, DNA damage response, and development. Current opinion in cell biology 20, 650-660.

Takaki, T., Trenz, K., Costanzo, V., and Petronczkil, M. (2008b). Polo-like kinase 1 reaches beyond mitosis-cytokinesis, DNA damage response, and development. Current opinion in cell biology 20, 650-660.

Takasaki, N., Kurokawa, D., Nakayama, R., Nakayama, J., and Aizawa, S. (2007). Acetylated YY1 regulates Otx2 expression in anterior neuroectoderm at two cis- sites 90 kb apart. Embo J 26, 1649-1659.

Taylor, S., and Peters, J.M. (2008). Polo and Aurora kinases - lessons derived from chemical biology. Current opinion in cell biology 20, 77-84.

Terada, Y., Tatsuka, M., Suzuki, F., Yasuda, Y., Fujita, S., and Otsu, M. (1998). AIM-1: a mammalian midbody-associated protein required for cytokinesis. Embo Journal 17, 667-676.

Thomas, M.J., and Seto, E. (1999). Unlocking the mechanisms of transcription factor YY1: are chromatin modifying enzymes the key? Gene 236, 197-208.

Usheva, A., and Shenk, T. (1994). TATA-binding protein-independent initiation: YY1, TFIIB, and RNA polymerase II direct basal transcription on supercoiled template DNA. Cell 76, 1115-1121.

Vader, G., and Lens, S.M. (2008). The Aurora kinase family in cell division and cancer. Biochim Biophys Acta 1786, 60-72.

Vadlamudi, R.K., Adam, L., Wang, R.A., Mandal, M., Nguyen, D., Sahin, A., Chernoff, J., Hung, M.C., and Kumar, R. (2000). Regulatable expression of p21-activated

110

kinase-1 promotes anchorage-independent growth and abnormal organization of mitotic spindles in human epithelial breast cancer cells. J Biol Chem 275, 36238- 36244. van Nimwegen, M.J., and van de Water, B. (2007). Focal adhesion kinase: a potential target in cancer therapy. Biochemical pharmacology 73, 597-609. van Vugt, M.A., and Medema, R.H. (2005). Getting in and out of mitosis with Polo-like kinase-1. Oncogene 24, 2844-2859.

Walowitz, J.L., Bradley, M.E., Chen, S., and Lee, T. (1998). Proteolytic regulation of the zinc finger transcription factor YY1, a repressor of muscle-restricted gene expression. J Biol Chem 273, 6656-6661.

Walsh, D.A., Perkins, J.P., and Krebs, E.G. (1968). An Adenosine 3',5'-Monophosphate- Dependant Protein Kinase from Rabbit Skeletal Muscle. Journal of Biological Chemistry 243, 3763-&.

Wang, H., Garzon, R., Sun, H., Ladner, K.J., Singh, R., Dahlman, J., Cheng, A., Hall, B.M., Qualman, S.J., Chandler, D.S., et al. (2008). NF-kappa B-YY1-miR-29 Regulatory Circuitry in Skeletal Myogenesis and Rhabdomyosarcoma. Cancer Cell 14, 369-381.

Wang, H.T., Hertlein, E., Bakkar, N., Sun, H., Acharyya, S., Wang, J.X., Carathers, M., Davuluri, R., and Guttridge, D.C. (2007). NF-kappa B regulation of YY1 inhibits skeletal myogenesis through transcriptional silencing of myofibrillar genes. Molecular and cellular biology 27, 4374-4387.

Wang, L., Brown, J.L., Cao, R., Zhang, Y., Kassis, J.A., and Jones, R.S. (2004). Hierarchical recruitment of Polycomb group silencing complexes. Molecular Cell 14, 637-646.

Whitfield, M.L., Zheng, L.X., Baldwin, A., Ohta, T., Hurt, M.M., and Marzluff, W.F. (2000). Stem-loop binding protein, the protein that binds the 3' end of histone mRNA, is cell cycle regulated by both translational and posttranslational mechanisms. Molecular and cellular biology 20, 4188-4198.

Whitmarsh, A.J., and Davis, R.J. (2000). Regulation of transcription factor function by phosphorylation. Cellular and Molecular Life Sciences 57, 1172-1183.

Wu, F., and Lee, A.S. (2001). YY1 as a regulator of replication-dependent hamster histone H3.2 promoter and an interactive partner of AP-2. J Biol Chem 276, 28- 34.

Wu, L.M., Ma, C.A., Zhao, Y.G., and Jain, A. (2011). Aurora B Interacts with NIR-p53, Leading to p53 Phosphorylation in Its DNA-binding Domain and Subsequent Functional Suppression. Journal of Biological Chemistry 286, 2236-2244.

111

Wurzenberger, C., and Gerlich, D.W. (2011). Phosphatases: providing safe passage through mitotic exit. Nat Rev Mol Cell Bio 12, 469-482.

Xue, Y., Zhou, F., Zhu, M., Ahmed, K., Chen, G., and Yao, X. (2005). GPS: a comprehensive www server for phosphorylation sites prediction. Nucleic acids research 33, W184-187.

Yang, C.Y., Tang, X., Guo, X.J., Niikura, Y., Kitagawa, K., Cui, K.M., Wong, S.T.C., Fu, L., and Xu, B. (2011). Aurora-B Mediated ATM Serine 1403 Phosphorylation Is Required for Mitotic ATM Activation and the Spindle Checkpoint. Molecular Cell 44, 597-608.

Yang, H., On, C.C., Feldman, R.I., Nicosia, S.V., Kruk, P.A., and Cheng, J.Q. (2004). Aurora-A kinase regulates telomerase activity through c-Myc in human ovarian and breast epithelial cells. Cancer research 64, 463-467.

Yang, W.M., Inouye, C., Zeng, Y., Bearss, D., and Seto, E. (1996a). Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3. Proceedings of the National Academy of Sciences of the United States of America 93, 12845-12850.

Yang, W.M., Inouye, C., Zeng, Y.Y., Bearss, D., and Seto, E. (1996b). Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3. Proceedings of the National Academy of Sciences of the United States of America 93, 12845-12850.

Yao, Y.L., Dupont, B.R., Ghosh, S., Fang, Y., Leach, R.J., and Seto, E. (1998). Cloning, chromosomal localization and promoter analysis of the human transcription factor YY1. Nucleic acids research 26, 3776-3783.

Yao, Y.L., Yang, W.M., and Seto, E. (2001). Regulation of transcription factor YY1 by acetylation and deacetylation. Molecular and cellular biology 21, 5979-5991.

Yasui, Y., Urano, T., Kawajiri, A., Nagata, K., Tatsuka, M., Saya, H., Furukawa, K., Takahashi, T., Izawa, I., and Inagaki, M. (2004). Autophosphorylation of a newly identified site of Aurora-B is indispensable for cytokinesis. J Biol Chem 279, 12997-13003.

Yoon, S., and Seger, R. (2006). The extracellular signal-regulated kinase: Multiple substrates regulate diverse cellular functions. Growth Factors 24, 21-44.

Zaravinos, A., and Spandidos, D.A. (2009). Yin Yang 1 as a prognostic factor. Cell Cycle 8, 1305.

Zaravinos, A., and Spandidos, D.A. (2010). Yin yang 1 expression in human tumors. Cell Cycle 9, 512-522.

112

Zhao, J., and Guan, J.L. (2009). Signal transduction by focal adhesion kinase in cancer. Cancer Metast Rev 28, 35-49.

Zheng, H., Chu, J., Zeng, Y., Loh, H.H., and Law, P.Y. (2010). Yin Yang 1 Phosphorylation Contributes to the Differential Effects of mu-Opioid Receptor Agonists on MicroRNA-190 Expression. Journal of Biological Chemistry 285, 21994-22002.

Zhu, W., Lossie, A.C., Camper, S.A., and Gumucio, D.L. (1994). Chromosomal localization of the transcription factor YY1 in the mouse and human. Mamm Genome 5, 234-236.

113

BIOGRAPHICAL SKETCH

Ari Kassardjian was born in Beirut, Lebanon in 1984. He received his Bachelor of Science, in Biology, from the American University of Beirut in 2005. He received his Master of Science, in Biology, from the American University of Beirut in 2007. He Joined the Molecular Biophysics Graduate program at Florida State University in 2007 and joined the laboratory of Dr. Myra Hurt in March 2008. He received his Ph.D. in Molecular Biophysics in 2012.

114