Molecular Phylogenetics and Evolution 103 (2016) 6–18

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev

Out of Africa: Phylogeny and biogeography of the widespread genus Acanthodactylus (Reptilia: Lacertidae) ⇑ Karin Tamar a,b, , Salvador Carranza c, Roberto Sindaco d, Jirˇí Moravec e, Jean-François Trape f, Shai Meiri a,b a Department of Zoology, George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv 6997801, Israel b The Steinhardt Museum of Natural History, Israel National Center for Biodiversity Studies, Tel Aviv University, Tel Aviv 6997801, Israel c Institut de Biologia Evolutiva (CSIC-Universitat Pompeu Fabra), Passeig Maritím de la Barceloneta, 37-49, 08003 Barcelona, Spain d Museo Civico de Storia Naturale, via San Francesco di Sales 188, I-10022 Carmagnola, Torino, Italy e Department of Zoology, National Museum, Cirkusová 1740, 19300 Prague 9, Czech Republic f Laboratoire de paludologie et zoologie médicale, Institut de Recherche pour le Développement, UMR MIVEGEC, B.P. 1386, Dakar, Senegal article info abstract

Article history: Acanthodactylus lizards are among the most diverse and widespread diurnal reptiles in the arid regions Received 15 February 2016 spanning from North Africa across to western India. Acanthodactylus constitutes the most species-rich Revised 1 June 2016 genus in the family Lacertidae, with over 40 recognized species inhabiting a wide variety of dry habitats. Accepted 5 July 2016 The genus has seldom undergone taxonomic revisions, and although there are a number of described spe- Available online 6 July 2016 cies and species-groups, their boundaries, as well as their interspecific relationships, remain largely unre- solved. We constructed a multilocus phylogeny, combining data from two mitochondrial (12S, cytb) and Keywords: three nuclear (MC1R, ACM4, c-mos) markers for 302 individuals belonging to 36 known species, providing Arabia the first large-scale time-calibrated molecular phylogeny of the genus. We evaluated phylogenetic rela- Diversification Molecular clock tionships between and within species-groups, and assessed Acanthodactylus biogeography across its Phylogeography known range. Acanthodactylus cladogenesis is estimated to have originated in Africa due to vicariance Systematics and dispersal events from the Oligocene onwards. Radiation started with the separation into three clades: Taxonomy the Western and scutellatus clades largely distributed in North Africa, and the Eastern clade occurring mostly in south-west Asia. Most Acanthodactylus species diverged during the Miocene, possibly as a result of regional geological instability and climatic changes. We support most of the current taxonomic classi- fications and phylogenetic relationships, and provide genetic validity for most species. We reveal a new distinct blanfordii species-group, suggest new phylogenetic positions (A. hardyi, A. masirae), and syn- onymize several species and subspecies (A. lineomaculatus, A. boskianus khattensis and A. b. nigeriensis) with their phylogenetically closely-related species. We recommend a thorough systematic revision of taxa, such as A. guineensis, A. grandis, A. dumerilii, A. senegalensis and the pardalis and erythrurus species-groups, which exhibit high levels of intraspecific variability, and clear evidence of phylogenetic complexity. Ó 2016 Elsevier Inc. All rights reserved.

1. Introduction members (i.e., Eremias, Mesalina, Ophisops; Pyron et al., 2013), it inhabits mostly xeric habitats in North Africa and Asia (Sindaco The Old World genus Acanthodactylus Fitzinger, 1834 is the and Jeremcˇenko, 2008). Acanthodactylus ranges from the Iberian most species-rich genus in the family Lacertidae, comprising over Peninsula, across North Africa (including the Sahel) and the 40 currently recognized species (Uetz and Hošek, 2016). These Arabian Peninsula towards western India, and northward to Cyprus lizards are commonly known as fringe-fingered lizards due to their and southern Turkey (Fig. 1; Salvador, 1982; Arnold, 1983; Schleich distinctive lateral finger scalation. Acanthodactylus is a member of et al., 1996; Sindaco and Jeremcˇenko, 2008). Acanthodactylus are the Saharo-Eurasian clade within the Eremiadini tribe (Mayer and diurnal, ground-dwelling, medium-sized lizards, occurring in Pavlicev, 2007), and along with its phylogenetically closest several climatic regions, from the Mediterranean ecoregion to the harsh desert environments of the Sahara and Arabia, occupying a wide array of arid ecosystems from open woodland, shrubland ⇑ Corresponding author at: Department of Zoology, George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv 6997801, Israel. and savanna to sand dune deserts (Salvador, 1982; Arnold, 1983; E-mail address: [email protected] (K. Tamar). Sindaco and Jeremcˇenko, 2008). http://dx.doi.org/10.1016/j.ympev.2016.07.003 1055-7903/Ó 2016 Elsevier Inc. All rights reserved. K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18 7

Fig. 1. Map illustrating the distributional range of Acanthodactylus (modified from Sindaco and Jeremcˇenko, 2008), including the phylogenetic tree with the three clades and the localities of each clade member.

Acanthodactylus is known among herpetologists as one of the systematic identifications within the groups are intricate (e.g., A. most taxonomically complex genera. The genus is morphologically schreiberi and A. boskianus within the boskianus group; Tamar highly conservative, but some species have great intraspecific vari- et al., 2014; A. dumerilii and A. senegalensis within the scutellatus ability (e.g., A. boskianus; Salvador, 1982; Arnold, 1983). The taxon- group; Schleich et al., 1996; Crochet et al., 2003; Trape et al., omy of this genus is unstable due to complex microevolution, great 2012). The systematic classification is further obscured by the intraspecific variation (usually non-clinal; Schleich et al., 1996), ambiguous boundaries and relationships among species and and morphological convergence (Tamar et al., 2014). Consequently, groups (Salvador, 1982; Arnold, 1983; Mellado and Olmedo, the classification of many species remains unresolved and even 1990; Harris and Arnold, 2000; Crochet et al., 2003; Harris et al., ambiguous (e.g., A. mechriguensis; Nouira and Blanc, 1999; 2004; Fonseca et al., 2008, 2009; Tamar et al., 2014). Fonseca et al., 2008). The widely-distributed, relatively species-rich Acanthodactylus The current systematic knowledge of Acanthodactylus is based genus provides an excellent model group to test biogeographic on several revisions of its morphology, osteology, and hemipenial hypotheses and examine the processes that have resulted in its features (Boulenger, 1918; Salvador, 1982; Arnold, 1983; Harris current diversification. However, an objective assessment of these and Arnold, 2000), as well as on phylogenetic studies (Harris and hypotheses is complicated as there is no consensus regarding the Arnold, 2000; Harris et al., 2004; Fonseca et al., 2008, 2009; evolutionary and biogeographical timeframe of the origin and Carretero et al., 2011; Heidari et al., 2014; Tamar et al., 2014). diversification within the Eremiadini tribe and its Saharo- The first genus-level molecular phylogeny of Acanthodactylus sam- Eurasian clade, to which Acanthodactylus belongs. Several studies pled 15 species and divided the genus into three clades: Eastern, of the Lacertidae have suggested that the diversification within Western, and scutellatus (Harris and Arnold, 2000). The genus is Eremiadini occurred during the Miocene, 17–19 million years ago further divided into species-groups based on gross morphological (Mya), following the collision of Africa-Arabia and Eurasia, with similarities among species (Salvador, 1982; Arnold, 1983; Harris the later recolonization of Asia (Arnold, 1989a, 2004; Mayer and and Arnold, 2000). Currently, Acanthodactylus species are divided Benyr, 1994; Harris et al., 1998; Arnold et al., 2007; Mayer and into the following species-groups (hereafter ‘groups’) within the Pavlicev, 2007; Pavlicev and Mayer, 2009). Other authors, such as three clades: the Western clade comprises the tristrami group from Wiens et al. (2006), Hipsley et al. (2009) and Zheng and Wiens the Middle East, and the erythrurus and pardalis groups occupying (2016), have suggested much older dates, during the Eocene. In the Sub-Saharan region and the coastal areas of North Africa; the addition, several studies have hypothesized that Acanthodactylus, scutellatus clade corresponds to the scutellatus group solely, occur- and its closest relatives within the Saharo-Eurasian clade (i.e., Ere- ring mainly in the sandy areas of North Africa; and the Eastern mias, Mesalina, Ophisops), originated in south-west Asia where clade is composed of the micropholis, grandis, cantoris, opheodurus most of their species occur, with multiple later invasions into and boskianus groups, mostly inhabiting south-west Asia. The Africa (Arnold, 1989b, 2004; Harris and Arnold, 2000; Mayer and group division within Acanthodactylus is frequently used today, Pavlicev, 2007; Hipsley et al., 2009). although the actual number of groups is debated (Salvador, A thorough examination of the phylogeny and phylogeography 1982; Arnold, 1983; Harris and Arnold, 2000), as is the assignment of Acanthodactylus will help to shed light on the complex of some species to groups (e.g., A. blanfordii and A. masirae within systematics and biogeography of this genus. In this study we the cantoris group; Harris and Arnold, 2000). Furthermore, clear produce the first comprehensive, time-calibrated phylogeny of 8 K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18

Acanthodactylus, based on multilocus genetic data, in order to elu- and Cytochrome b (cytb), and three nuclear gene fragments: cidate the biogeographical and evolutionary history and to clarify melano-cortin 1 receptor (MC1R), acetylcholinergic receptor M4 its systematics. (ACM4) and oocyte maturation factor MOS (c-mos). Primers, PCR protocols and source references are listed in Table S2. 2. Material and methods Chromatographs were edited using Geneious v.7.1.9 (Biomatter Ltd.). For the nuclear loci, MC1R, ACM4 and c-mos, heterozygous 2.1. DNA extraction, amplification and sequence analysis positions were coded according to the IUPAC ambiguity codes. Coding gene fragments (cytb, MC1R, ACM4, c-mos) were translated We analysed 302 specimens of Acanthodactylus, representing 36 into amino acids and no stop codons were observed, suggesting recognizing species, from across its known distribution range that the sequences are all functional and no pseudogenes were (Figs. 1–4; Table S1). To enlarge the number of samples, additional amplified. DNA sequences were aligned for each gene fragment sequences of eight species were retrieved from GenBank (sequences independently using the online version of MAFFT v.7 (Katoh and from Tamar et al., 2014). Mesalina olivieri and M. guttulata were used Standley, 2013) with default parameters (Auto strategy, Gap open- as outgroups based on previous publications (Harris et al., 1998; Fu, ing penalty: 1.53, Offset value: 0.0). For the 12S fragments we 2000; Mayer and Pavlicev, 2007; Kapli et al., 2011; Pyron et al., applied the Q-INS-i strategy, in which data on the secondary 2013). Codes, locations and GenBank accession numbers are listed structure of the RNA are considered. Poorly aligned positions of in Table S1. Localities are shown in Figs. 2–4. 12S were eliminated with G-blocks (Castresana, 2000) using low Genomic DNA was isolated from ethanol-preserved tissue sam- stringency options (Talavera and Castresana, 2007). Inter and ples using either the DNeasy Blood & Tissue Kit (Qiagen, Valencia, intra-specific uncorrected p-distances with pairwise deletion of CA, USA) or the SpeedTools Tissue DNA Extraction kit (Biotools, 12S and cytb, and the number of variable (V) and parsimony Madrid, Spain). Individuals were sequenced for both strands of informative (Pi) sites for the ingroup only, were calculated in two mitochondrial gene fragments, the 12S ribosomal RNA (12S) MEGA v.5.2 (Tamura et al., 2011).

Fig. 2. The Western clade within Acanthodactylus, part of a Bayesian Inference tree inferred from the concatenated dataset (12S, cytb, MC1R, ACM4, c-mos). Distribution ranges of Acanthodactylus species were modified from Sindaco and Jeremcˇenko (2008). Codes next to each taxon refer to the locality in the distribution maps and country of origin (sample A227 is not shown). Data on all samples are given in Table S1. Maximum likelihood bootstrap support values (values P 70%) are indicated near the nodes and posterior probability in the Bayesian analysis is indicated by black dots on the nodes (values P 0.95). Age estimates obtained with BEAST are indicated near the relevant nodes and include the mean and, in parentheses, the 95% highest posterior densities (HPD). K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18 9

Fig. 3. The scutellatus clade within Acanthodactylus, part of a Bayesian Inference tree inferred from the concatenated dataset (12S, cytb, MC1R, ACM4, c-mos). Distribution ranges of Acanthodactylus species were modified from Sindaco and Jeremcˇenko (2008). Codes next to each taxon refer to the locality in the distribution maps and country of origin (sample A224 is not shown). Data on all samples are given in Table S1. Maximum likelihood bootstrap support values (values P 70%) are indicated near the nodes and posterior probability in the Bayesian analysis is indicated by black dots on the nodes (values P 0.95). Age estimates obtained with BEAST are indicated near the relevant nodes and include the mean and, in parentheses, the 95% highest posterior densities (HPD).

2.2. Phylogenetic analyses for the dataset, with the following parameters: linked branch length; models available in BEAST; AIC model selection; greedy We used PartitionFinder v.1.1.1 (Lanfear et al., 2012) to select search algorithm. Due to the large size of the dataset, to avoid the best-fit partitioning scheme and models of molecular evolution over-parameterization, each of the five markers was set in the 10 K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18

Fig. 4. The Eastern clade within Acanthodactylus, part of a Bayesian Inference tree inferred from the concatenated dataset (12S, cytb, MC1R, ACM4, c-mos). Distribution ranges of Acanthodactylus species were modified from Sindaco and Jeremcˇenko (2008). Codes next to each taxon refer to the locality in the distribution maps and country of origin (sample A178 is not shown). Data on all samples are given in Table S1. Maximum likelihood bootstrap support values (values P 70%) are indicated near the nodes and posterior probability in the Bayesian analysis is indicated by black dots on the nodes (values P 0.95). Age estimates obtained with BEAST are indicated near the relevant nodes and include the mean and, in parentheses, the 95% highest posterior densities (HPD). K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18 11 input file as a distinct data block. A summary of DNA partitions and Gallotia and Psammodromus algirus (age of the oldest islands relevant models as determined by PartitionFinder is given in Fuerteventura and Lanzarote; Normal distribution, mean 18, stdev Table S3. 2); (b) the split between G. galloti and G. caesaris (age of La Gomera Phylogenetic analyses were performed using maximum likeli- Island; Normal distribution, mean 6, stdev 3); (c) the split between hood (ML) and Bayesian Inference (BI) methods. Models, priors G. galloti palmae and the ancestor of G. g. galloti and G. g. eisentrauti and parameter specifications applied are listed in Table S3. ML (age of La Palma Island; Normal distribution, mean 1, stdev 0.5); analyses were performed with RAxML v.7.4.2 (Stamatakis, 2006) and (d) the splits between G. gomerana and G. simonyi machadoi as implemented in raxml GUI v.1.3 (Silvestro and Michalak, and between G. caesaris caesaris and G. c. gomerae (age of El Hierro 2012) with a GTRGAMMA model of sequence evolution. All ML Island; Normal distribution, mean 0.8, stdev 0.2). analyses were performed with 100 random addition replicates with parameters estimated independently for each partition. Nodal 2.4. Ancestral area reconstruction support was assessed by bootstrap analysis with 1000 pseudorepli- cations (Felsenstein, 1985). BI analyses were performed with In order to identify the phylogeographic history and reconstruct BEAST v.1.8.0 (Drummond et al., 2012). For all analyses imple- the ancestral origin of Acanthodactylus, we used the Bayesian mented in BEAST, the .xml file was modified to ‘‘Ambigui- Stochastic Search Variable Selection (BSSVS; Lemey et al., 2009)of ties = true” for the nuclear partitions to account for variability in the discrete phylogeographic model as implemented in BEAST the heterozygote positions, rather than treating them as missing v.1.8.0. We used the complete concatenated dataset with one repre- data. Parameter values both for clock and substitution models sentative of each independent GMYC entity (Table S1; ingroup only; were unlinked across partitions. All BEAST analyses were carried nuclear genes unphased). For a temporal frame we applied the aver- out in CIPRES Science Gateway (Miller et al., 2010). Convergence age sequence evolution rates of 12S and cytb mitochondrial regions was assessed by confirming that all parameters had reached sta- (as estimated in Carranza and Arnold, 2012) also to cross-check the tionarity and had sufficient effective sample sizes (> 200) using divergence time estimations. These rates were extracted from a TRACER v.1.6 (Rambaut et al., 2014). LogCombiner and TreeAnno- fully calibrated phylogeny of the lacertid genus Gallotia from the tator (both available in the BEAST package) were used to combine Canary Islands and the divergence between Podarcis pityusensis the runs and produce the ultrametric tree after discarding 10% as and P. lilfordi from the Balearic Islands (for a full account of the burn-in. We treated alignment gaps as missing data, and the specific calibration points see Carranza and Arnold, 2012). These nuclear gene sequences were not phased. Nodes were considered rates had been implemented in other lacertid phylogenies, such P strongly supported if they received ML bootstrap values 70% as Tamar et al. (2014) and Bellati et al. (2015). We assigned the phy- P and posterior probability (pp) support values 0.95 (Wilcox logeographic traits according to two discrete geographic regions, et al., 2002; Huelsenbeck and Rannala, 2004). corresponding to the main areas from which Acanthodactylus was In order to identify divergent lineages within Acanthodactylus,we suggested to originate (Arnold, 1983, 1989a; Harris and Arnold, performed the independent Generalized Mixed Yule-coalescent 2000) – Africa (including the Iberian Peninsula) and south-west (GMYC) analysis (Pons et al., 2006). As this analysis relies on single Asia (including Cyprus and the Sinai and Arabian Peninsulas). Mod- locus data, we used a Bayesian concatenated mitochondrial phylo- els, prior settings and parameters are listed in Table S3. genetic tree including haplotypes only, reconstructed with BEAST v.1.8.0. Models, priors and parameters are specified in Table S3. We applied the single threshold algorithm implemented in the R 3. Results ‘‘SPLITS” package (Species Limits by Threshold Statistics; Ezard et al., 2009) and compared to the null model (i.e., all individuals 3.1. Taxon sampling, genetic data and phylogenetic analyses belong to a single species) using a log-likelihood ratio test. The dataset for the phylogenetic analyses comprised 302 individ- 2.3. Estimation of divergence times uals of 36 known species (Table S1). The dataset totalling 2404 bp comprised mitochondrial gene fragments of 12S (385 bp; Due to the lack of internal calibration points for Acanthodacty- V = 176; Pi = 154) and cytb (405 bp; V = 217; Pi = 200), and nuclear lus, we used calibration points of other lacertids, Gallotia and gene fragments of MC1R (663 bp; V = 100; Pi = 73), ACM4 (429 bp; Podarcis, as previously used in other lacertid phylogenies (e.g., V = 76; Pi = 44) and c-mos (522 bp; V = 104; Pi = 80). The uncor- Kaliontzopoulou et al., 2011; Carranza and Arnold, 2012; Kapli rected p-distances of the 12S and cytb mitochondrial gene fragments et al., 2013, 2015; Tamar et al., 2015). Divergence times were esti- between and within each species are summarized in Table S4. mated in BEAST v.1.8.0 using the complete concatenated dataset The results of the phylogenetic analyses of the complete and (nuclear genes unphased). The dataset for this analysis included mitochondrial datasets, using ML and BI methods, produced very one representative of each independent GMYC entity of Acantho- similar topologies, differing primarily at the less supported nodes dactylus (in order to account for the deep lineages in the phy- (Figs. 2–4 and S1–S2). The level of genetic variability within Acan- logeny; see Metallinou et al., 2015 for dataset strategy thodactylus is very high, as reflected in both the genetic distances comparisons) and sequences of Gallotia and Podarcis (retrieved (Table S4) and the results of the GMYC analysis with the single from GenBank; Table S1). The .xml file was manually modified to threshold approach (Fig. S3; based on the concatenated mitochon- ‘‘Ambiguities = true” for the nuclear genes (MC1R, ACM4, c-mos). drial haplotype dataset). The latter analysis recovered three clades Models, priors and parameters are specified in Table S3. and 111 different entities, probably due to incomplete geographic One calibration coincides with the end of the Messinian Salinity sampling (Talavera et al., 2013). The result of the likelihood ratio Crisis (Normal distribution, mean 5.32, stdev 0.05) - the separation test was significant (p < 0.0001), indicating that the null model between Podarcis pityusensis and Podarcis lilfordi (endemic to the (i.e., single population) could be rejected. Balearic Islands; Brown et al., 2008), and between Podarcis cretensis and Podarcis peloponnesiacus (isolation of Crete from the Pelopon- 3.2. Phylogenetic relationships and genetic diversity within nesus; Poulakakis et al., 2005). The other calibrations were based Acanthodactylus on the ages of the Canary Islands and the splits between the spe- cies of the Canary Islands’ endemic genus Gallotia (Cox et al., The phylogenetic results reveal three clearly distinct clades 2010; Carranza and Arnold, 2012) as follows: (a) the split between within Acanthodactylus. Within them, ten groups are defined, 12 K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18 though not all relationships among groups or species are equally the bootstrap support values are low (Figs. S1–S2). The two mem- supported (Figs. 1–4 and S1–S3). The three clades in our study cor- bers of the boskianus group, A. schreiberi and A. boskianus, are both respond to the clades shown in Harris and Arnold (2000), we thus paraphyletic as the former species is nested entirely within the lat- retain the names they coined: Western, scutellatus and Eastern. The ter. The two Sahelian subspecies of A. boskianus, A. b. nigeriensis and phylogenetic results reveal that the Western clade is sister to a A. b. khattensis, are also nested within the third widespread sub- clade composed of the scutellatus and Eastern clades (ML support species, A. b. asper. only for the mitochondrial tree; Figs. S1–S2). The Western clade (Fig. 2 and S1–S2) incorporated one well- 3.3. Estimation of divergence times defined lineage representing A. guineensis, and three groups, tris- trami, erythrurus, and pardalis, though the phylogenetic relation- The divergence time estimations (Fig. S4) are presented in ships within the clade are not well supported. Acanthodactylus Figs. 2–4 at the relevant nodes. Acanthodactylus guineensis is recov- guineensis, a Sub-Saharan member, is represented by mitochon- ered as a sister taxon to Acanthodactylus in the BI dating analysis drial gene fragments only (the nuclear gene fragments failed to (Fig. S4), contradictory to its position within the Western clade amplify properly). This species is recovered as sister to the remain- based on the phylogenetic analyses of the complete and mitochon- ing species of the clade, genetically very distant from the other spe- drial datasets (Figs. 2 and S1–S2). Our results indicate that diversi- cies of the group, clade, and genus (p-distance 12S: 11.7–17.6%; fication within Acanthodactylus originated during the Oligocene cytb: 17.4–25.1%). The phylogenetic position of A. guineensis within around 30–33 Mya (95% highest posterior density, HPD: 22.2– the genus is not stable. According to the phylogenetic analyses of 45.3 Mya). The Eastern and scutellatus clades separated approxi- the complete and mitochondrial datasets, it is situated within the mately 27 Mya (95% HPD: 20–35.8 Mya). Further radiation within Western clade (Figs. 2 and S1–S3), whereas in the BI dating analy- the genus occurred from the Miocene onwards. sis it is sister to the entire genus (Fig. S4). The tristrami group, rep- resented by A. orientalis and A. tristrami, is monophyletic. The erythrurus group is paraphyletic. The phylogenetic positions of A. 3.4. Ancestral area reconstruction savignyi from Algeria and the Sub-Saharan A. boueti are not well supported and they are highly genetically distant from the remain- The results of the discrete phylogeographic analyses using the ing members of the group (Table S4). The remaining species of the BSSVS model, within a temporal framework of evolutionary rates, erythrurus group form a well-supported clade, in which A. blanci are presented in Fig. 5. The two dating approaches (i.e., geological and A. lineomaculatus are nested within A. erythrurus, making the calibration points and evolution rates) resulted in almost identical latter paraphyletic (A. blanci is not nested in the ML analysis; dates (Figs. 2–5). Acanthodactylus most likely originated in Africa Fig. S1). The relationships within the pardalis group are very com- (83% probability). The origin of both the Western and scutellatus plex. Two species of this group, A. beershebensis and A. pardalis, are clades is probably also African (91% and 99% probability, respec- monophyletic, whereas A. bedriagai and A. maculatus are para- tively), whereas the Eastern clade colonized south-west Asia from phyletic and exhibit high genetic diversity (Table S4). Acantho- Africa (82% probability at the split between the scutellatus and the dactylus busacki is paraphyletic in the ML analyses of the Eastern clades) and radiated there extensively. Subsequent splits complete and mitochondrial datasets (Figs. S1–S2) with no support within the genus imply dispersal from Africa to Arabia and vice for monophyly in the BI analysis (Fig. 2). versa. The scutellatus clade (Figs. 3 and S1–S2) is composed solely of the scutellatus group, represented by seven species. Acanthodacty- 4. Discussion lus taghitensis A. aureus, A. longipes and A. aegyptius are mono- phyletic. Both A. aegyptius and A. longipes form a distinct, 4.1. Systematics of the genus Acanthodactylus strongly supported, lineage. Although monophyly of the nominate species A. scutellatus is recovered, the bootstrap and pp support Our study constitutes the first large-scale time-calibrated phy- values are low. This species is divided into two reciprocally mono- logenetic study of Acanthodactylus. Our results are mostly congru- phyletic lineages corresponding to its two subspecies, A. s. scutella- ent with the current taxonomic classifications, with some tus and A. s. audouini. Both A. dumerilii and A. senegalensis are systematic discrepancies. The molecular results confirm that Acan- paraphyletic in respect to one another and form a monophyletic thodactylus is composed of three well-supported clades: the Wes- lineage. Within this lineage they form two geographic clusters, a tern, scutellatus, and Eastern clades (Harris and Arnold, 2000; northern cluster from Algeria and Morocco and a southern cluster Figs. 1 and S1–S2). from Western Sahara southwards. The Eastern clade (Figs. 4 and S1–S2) comprises 16 species rep- resenting six well-supported monophyletic groups. The micropholis 4.1.1. The Western clade group (A. micropholis) is sister to the grandis group. Acanthodactylus This clade comprises one deeply-separated lineage represented grandis is paraphyletic with respect to A. harranensis and is highly by A. guineensis and three defined groups, containing mostly North diverse genetically (p-distance 12S: 6.1%; cytb: 14.6%). A distinct African species (Figs. 2 and S1–S2). Acanthodactylus guineensis was lineage is composed of the sister species A. blanfordii and A. originally described within the genus Eremias (Boulenger, 1887) schmidti. The phylogenetic position of A. hardyi is not supported and was later assigned to Acanthodactylus, within the erythrurus in either the ML or the BI analyses, but it forms a well-supported group (Salvador, 1982; Arnold, 1983). Its phylogenetic position monophyletic lineage. The cantoris group is composed of six spe- within the genus, however, is not resolved. Salvador (1982) noted cies: A. cantoris, A. masirae, A. haasi, A. gongrorhynchatus, A. tilburyi, that A. guineensis diversification from the erythrurus group must and A. arabicus, though the phylogenetic relationships among the have taken place before the separation of the morphologically sim- species are mostly not supported. Acanthodactylus cantoris and A. ilar Sub-Saharan species A. boueti. This, however, is in contrast to masirae are sister species, while the remaining species form a dis- their phylogenetic affinity hypothesized by Fonseca et al. (2009). tinct clade. The opheodurus and boskianus are sister groups. The Our results, based solely on mitochondrial data of A. guineensis, two species representing the opheodurus group, A. opheodurus accord with Salvador (1982), but also bring into question its phy- and A. felicis, are reciprocally monophyletic. Although the mono- logenetic position within the genus as well as within the group. phyly of the opheodurus group is recovered, in the ML analyses The extremely high genetic distance from the other species sug- K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18 13

Fig. 5. BEAST consensus tree using the BSSVS method of ancestral area reconstruction with a temporal framework based on evolutionary rates (see Section 2). Branch colour indicates inferred ancestral range (ranges visualized in the lower left map), with posterior probabilities of ancestral range above the nodes (values P 0.95). A pie chart depicting the probability of each inferred area is presented near the major nodes. 14 K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18 gests a very old divergence, but further sampling is required to with their known taxonomy (Baha El Din, 2007). The remaining determine its status. species, A. scutellatus, A. dumerilii and A. senegalensis, exhibit The Middle Eastern monophyletic tristrami group is phylogenet- unsupported phylogenetic relationships and the two latter species ically closely-related to the north-west African erythrurus group, a cluster together. A distinct lineage of A. scutellatus from northern finding congruent with their morphology (Arnold, 1983; Harris and Egypt, the Sinai Peninsula and Israel corresponds to the subspecies Arnold, 2000). Despite the geographic gap, the systematic affinity A. scutellatus scutellatus (Bons and Girot, 1964; Crochet et al., 2003). of these two groups suggests a shared ancestral origin between We thus support the validity of the subspecies as discrete. Another North Africa and the Middle East. monophyletic lineage includes the subspecies A. scutellatus The erythrurus group is paraphyletic. The phylogenetic position audouini from Egypt eastwards, although both bootstrap and pp of the Sub-Saharan species, A. boueti, is not well supported in either support values are low. Acanthodactylus senegalensis and A. dumer- phylogenetic analysis. It clearly differs from A. erythrurus, thus ilii, sampled from their type localities, are not clearly defined (the rejecting its derivation from it (Boulenger, 1921). Its high genetic latter’s type locality is not in Senegal according to the revision by distance from A. guineensis (Table S4) and its phylogenetic position Crochet et al. (2003), but no other locality was given). Since its may indicate that the two lineages evolved independently within description, A. senegalensis has been assigned by several authors the Sub-Saharan region. Acanthodactylus savignyi is sister to the as a subspecies/variant/synonym of A. scutellatus or A. dumerilii rest of the erythrurus group members, a notable finding, as it was (Boulenger, 1921; Bons and Girot, 1964; Salvador, 1982; Arnold, expected to be phylogenetically closely-related either to A. blanci 1983; Crochet et al., 2003). In addition to the morphological diffi- due to similar morphology and sandy habitat preference; or, alter- culties in establishing taxonomic identification between these natively, to A. erythrurus belli, as they both co-occur in northern two species, our results reveal that they cluster together into two Algeria (Arnold, 1983; Schleich et al., 1996). The nominate species, phylogenetic, geographic inner-groups. A further comprehensive A. erythrurus, is paraphyletic, with both A. blanci and A. lineomacu- and meticulous revision is necessary in order to evaluate the status latus nested within it (as in Harris et al., 2004; Fonseca et al., 2009). of the populations assigned to the two species, and to establish the Our results support the phylogenetic affinities of A. blanci with A. true specific boundaries and their geographical distribution. erythrurus rather than with A. savignyi (Salvador, 1982). However, the phylogenetic position of A. blanci has not been determined 4.1.3. The Eastern clade either in morphological or molecular revisions, including this study This clade is comprised of six monophyletic groups (Figs. 4 and (Boulenger, 1921; Mertens, 1929; Salvador, 1982; Arnold, 1983; S1–S2). The micropholis and grandis are sister groups (see also Harris et al., 2004; Fonseca et al., 2009), leaving its current specific Heidari et al., 2014). This phylogenetic relationship conflicts with status unclear. Acanthodactylus lineomaculatus was classified as a previous hypotheses regarding the closely-related systematic allo- subspecies of A. erythrurus (Salvador, 1982; Arnold, 1983; cation of the micropholis with cantoris or the grandis with boskianus Schleich et al., 1996), and later elevated to specific status (Bons groups (Arnold, 1983; Harris and Arnold, 2000). These results are and Geniez, 1995; Harris and Arnold, 2000). However, the phyloge- interesting due to the allopatric distribution of the two groups, netic studies of Harris et al. (2004), Fonseca et al. (2009) and this and the habitats occupied, as A. micropholis occupies sandy habitats study, show no genetic support for the separation of this species (Minton, 1966; Khan, 2006) whereas A. grandis prefers semi-desert from A. erythrurus. We agree with Fonseca et al. (2009) and suggest to desert hamada soils (Disi et al., 2001), although digit pectination that A. lineomaculatus is an ecotype reflecting local morphological indicates that it may occur on a variety of soil types (Arnold, 1983). adaptation, and should thus be treated as a junior synonym of A. These two groups may represent an invasion eastwards from the erythrurus. Middle East into Asia, as the separation zone between them is in The pardalis group is monophyletic. The sister taxa relationship southern Iran. Within the grandis group, the results support the with its phylogenetically closely-related erythrurus group is not phylogenetically-close affinities between the morphologically- supported (agreeing with Fonseca et al., 2009). Although our similar A. grandis and A. harranensis (Baran et al., 2005). The para- results support the specific status of A. beershebensis and A. parda- phyly and the high genetic diversity of A. grandis indicate it is a lis, we cannot account for their phylogenetic position. The complex species complex, as was also suggested by Salvador (1982) and phylogenetic structures and relationships among A. busacki, A. Arnold (1983). bedriagai and A. maculatus remain unresolved (as in Fonseca The same pattern of contact zone and dispersal eastwards is et al., 2008). The geographic clustering of these species indicates also evident in the monophyletic lineage formed by A. blanfordii that environmental conditions have strongly influenced their dis- and its sister species A. schmidti. Our results suggest that they tribution, which in turn may be responsible for their current sys- are not members of the cantoris group (Boulenger, 1918; Haas, tematic complexity (Fonseca et al., 2008). These complex 1957; Salvador, 1982; Arnold, 1983; Harris and Arnold, 2000), phylogenetic relationships highlight the potential flaws in current but form a distinct independent group, which we name the blan- taxonomic classifications based on morphological identifications. It fordii group. Taxonomically, A. hardyi is considered a member of is thus necessary to examine and revise the identification of dis- the scutellatus group (previously a subspecies of A. scutellatus; tinctive phenotypic features of each population, especially from Salvador, 1982; Arnold, 1983; Harris and Arnold, 2000; Crochet contact zones. et al., 2003). The present known differences between A. hardyi and A. scutellatus include morphology, a distributional gap 4.1.2. The scutellatus clade (Salvador, 1982; Arnold, 1983, 1986), and preferred substrates Our results show that seven species belong to the psam- (Rifai et al., 2003). We retain the specific status of A. hardyi, but mophilous scutellatus clade/group, in contrast to the eight species phylogenetically allocate it to within the Eastern clade (Fig. 4), as was traditionally believed (A. hardyi is phylogenetically differ- though its phylogenetic position there is not well defined. ent, being included instead in the Eastern clade; Salvador, 1982; We support the five species taxonomically recognized within Arnold, 1983; Figs. 3 and 4 and S1–S2). The scutellatus clade began the cantoris group: A. arabicus, A. cantoris, A. gongrorhynchatus, A. radiating within north-west Africa with the split of two clearly haasi, and A. tilburyi. Although A. masirae is taxonomically regarded genetically-distinct species, A. aureus and A. taghitensis; though as a member of the opheodurus group (Salvador, 1982; Arnold, the phylogenetic position of the latter species is less significant. 1983), it is phylogenetically sister to A. cantoris (also in Harris Acanthodactylus longipes and A. aegyptius are reciprocally mono- and Arnold, 2000). Our results thus conflict with the known phyletic sister species and comprise a separate lineage, coinciding taxonomy, as only a few morphological similarities and shared K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18 15 characters are known between A. masirae and A. cantoris (Salvador, during the Oligocene with the separation of the three clades (33– 1982; Arnold, 1983). Local adaptation of A. masirae to different 27 Mya). Radiation within the three clades and groups mostly habitats may have accelerated its evolutionary morphological occurred during the Miocene (Figs. 2–5). divergence, thus accounting for its morphological disparity from The suggested timeframe in our study is congruent with that of the phylogenetically closely-related A. cantoris. This hypothesis previous studies on the diversification of North-African and Ara- may also explain the classification of A. cantoris with mostly Ara- bian herpetofauna during the Oligocene (e.g., Pook et al., 2009; bian species, and the different habitat preferences (Salvador, Šmíd et al., 2013; Metallinou et al., 2012, 2015; Portik and 1982; Arnold, 1983; Khan, 2006; Sindaco and Jeremcˇenko, 2008). Papenfuss, 2012, 2015). Divergence time estimations in those stud- We thus suggest the systematic relocation of A. masirae into the ies, and ours, suggest that the Oligocene and Miocene radiations cantoris group. may correlate with two major environmental changes that affected The opheodurus and boskianus are sister groups, congruent with the western Palearctic realm at the time. The first event is the sep- their morphology (Salvador, 1982; Arnold, 1980, 1983). Our results aration of the Arabian and African plates, and their later collision agree with the assignment of A. felicis and A. opheodurus within the with the Eurasian landmass. These tectonic movements resulted opheodurus group. The boskianus group is represented by two para- in continuous regional geological instability, which subsequently phyletic species, A. boskianus and A. schreiberi (see Tamar et al., led to the opening of the Red Sea, periodic sea-level fluctuation, 2014 for relevant discussion and systematic accounts). We suggest the Messinian Salinity Crisis, and the uplift of high mountain ridges that the two subspecies, A. boskianus khattensis (from Mauritania) such as the Atlas in Morocco, the Zagros in Iran, and the coastal and A. b. nigeriensis (from Niger), are synonyms of the widespread mountains of Arabia (Bohannon et al., 1989; Rögl, 1999; Popov A. b. asper, possibly representing phenotypic variations, as they are et al., 2004; Bosworth et al., 2005; Edgell, 2006; Jolivet et al., nested within the latter subspecies with other geographically- 2006; Mouthereau, 2011). These major tectonic events may adjacent specimens. Acanthodactylus boskianus is known to be an explain the split between the three clades, and the ancestral rela- extremely morphologically variable species (Salvador, 1982; tives of the Middle Eastern tristrami group separating from the Arnold, 1980, 1983; Harris and Arnold, 2000), phylogenetically original North-African populations of the erythrurus and pardalis exhibiting geographical groupings (Tamar et al., 2014). The rela- groups within the Western clade. The second major environmental tively similar morphology of A. boskianus and the close phyloge- event was the global climate change during the Miocene. Climatic netic relationships between North African and Arabian fluctuations and aridification during this period led to the forma- populations suggest recent migration (Salvador, 1982; Arnold, tion, and episodic expansion and contraction, of the Sahara and 1983; Tamar et al., 2014), probably from south-west Asia (Fig. 5). Arabian deserts, which in turn strongly affected species divergence Acanthodactylus boskianus inhabits a wide range of dry habitats and distributions within the area (Ruddiman et al., 1989; Flower and displays the largest distribution within the genus. The high and Kennett, 1994; Le Houérou, 1992, 1997; Zachos et al., 2001; degree of genetic diversity within A. boskianus (Table S4) may Griffin, 2002; Kroepelin, 2006; Schuster et al., 2006; Swezey, result from a non-uniform geographic sampling of this species in 2006, 2009). As Acanthodactylus is an arid-adapted genus, the arid- our dataset. ification process most likely promoted diversification and facili- tated dispersal in most lineages. 4.2. Biogeography of Acanthodactylus - Origin and diversification There are three Acanthodactylus groups (erythrurus, pardalis and scutellatus) inhabiting North Africa, with the erythrurus and pardalis Several authors have suggested that lacertids and the ancestor groups typically inhabiting areas of solid ground in the northern of the Eremiadini tribe, to which Acanthodactylus belongs, dis- and western coastal areas (Fig. 2), while the psammophilous scutel- persed to Africa during the Miocene around 17–19 Mya after the latus group inhabits sandy areas, principally across the Sahara tectonic collision between Africa-Arabia and Eurasia (Arnold, desert (Fig. 3). The expansion/contraction of sands and the rise of 1989a, 2004; Mayer and Benyr, 1994; Harris et al., 1998; Harris the Atlas Mountains during the mid-late Miocene created biogeo- and Arnold, 2000; Arnold et al., 2007; Mayer and Pavlicev, 2007; graphical barriers and probably triggered diversification, as has Pavlicev and Mayer, 2009). Arnold (2004) suggested that the been suggested for other reptile taxa (e.g., Brown et al., 2002; ancestor of the Saharo-Eurasian clade within the Eremiadini, to Amer and Kumazawa, 2005; Fritz et al., 2005; Carranza et al., which Acanthodactylus belongs, recolonized Asia through a land 2008; Gonçalves et al., 2012; Kapli et al., 2015; Metallinou et al., bridge between the Horn of Africa and Arabia (10–5 Mya; 2012, 2015; Tamar et al., 2016). The Sahara sands constitute a Bosworth et al., 2005), with later recolonizations of North Africa. southern barrier for the erythrurus and pardalis groups, which radi- Mayer and Pavlicev (2007) discussed another plausible scenario, ated from the late-Miocene, restricting them to the western and in which the Eremiadini diversified in the Near East and members northern coastal areas, characterized by a less arid climate. These invaded Africa on several occasions. Following this line, the biogeo- groups were influenced both by the shifting Saharan sand area, graphical assessment by Harris and Arnold (2000) suggested that as well as by sea levels of the Atlantic Ocean and the Mediter- Acanthodactylus originated in south-west Asia and later invaded ranean Sea. The fluctuating climate, sea-level and desert areas Africa, probably during the mid-late Miocene (Arnold, 1989a). (Sarnthein, 1978; Douady et al., 2003; Schuster et al., 2006), are Others, however, have hypothesized that the Eremiadini originated likely to have enhanced diversification and created complex phylo- much earlier, during the Eocene (Wiens et al., 2006; Hipsley et al., genetic structures within the North-African Acanthodactylus groups 2009; Zheng and Wiens, 2016), and the radiation of the Saharo- (e.g., Douady et al., 2003; Fonseca et al., 2008, 2009; Metallinou Eurasian members occurred approximately 40 Mya (Hipsley et al., 2015). The Sahara sands are also likely to have facilitated et al., 2009). All these studies suggest that the xerophilous mem- diversification and dispersal within the scutellatus group, similar bers of the Saharo-Eurasian clade within Eremiadini (i.e., Acantho- to other psammophilous North-African reptile taxa (e.g., Carranza dactylus, Eremias, Mesalina, Ophisops) most likely originated in et al., 2008; Metallinou et al., 2012). The two evidently separate Eurasia, specifically in south-west Asia. events in the Sub-Saharan region, the dispersal of A. guineensis Our phylogenetic and biogeographical reconstructions predate and the vicariance of A. boueti, were probably enabled through the often suggested Miocene radiation onset and rapid dispersal the western edges of North Africa, restricted since the Miocene from a south-west Asian origin, as noted above. Our results support by the Sahara sands. a deeper ancestral diversification of Acanthodactylus probably from The members of the Eastern clade (Fig. 4), distributed mostly in an African origin (Fig. 5). We show that diversification originated Arabia to western India, began radiating during the mid-Miocene. 16 K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18

The dispersal of Acanthodactylus eastwards from Arabia further References into Asia is estimated to have occurred after the uplift of the Zagros Mountains in Iran during the mid-Miocene, 12.4–10 Mya Agard, P., Omrani, J., Jolivet, L., Whitechurch, H., Vrielynck, B., Spakman, W., Monié, P., Meyer, B., Wortel, R., 2011. Zagros orogeny: a subduction-dominated (Sborshchikov et al., 1981; Agard et al., 2011; Mouthereau, 2011). process. Geol. Mag. 148, 692–725. http://dx.doi.org/10.1017/ This accords with the biogeographic patterns observed in other S001675681100046X. lizard taxa from the region (e.g., Macey et al., 1998; Šmíd and Amer, S.A.M., Kumazawa, Y., 2005. Mitochondrial DNA sequences of the Afro- Frynta, 2012). We suggest that the Zagros Mountains acted as a Arabian spiny-tailed lizards (genus Uromastyx; family Agamidae): phylogenetic analyses and evolution of gene arrangements. Biol. J. Linn. Soc. 85, 247–260. physical barrier, restricting dispersal of Acanthodactylus north- http://dx.doi.org/10.1111/j.1095-8312.2005.00485.x. wards to potential habitats in the Iranian plateau, thus constrain- Arnold, E.N., 1980. The scientific results of the Oman flora and fauna survey 1977 ing their dispersal eastward along the southern coast (e.g., (Dhofar). The reptiles and amphibians of Dhofar, southern Arabia. J. Oman Stud. Special Report 2, 273–332. Heidari et al., 2014). Another possibility is that the Iranian plateau Arnold, E.N., 1983. Osteology, genitalia and the relationships of Acanthodactylus had already been colonized by another lacertid, Eremias, with anal- (Reptilia: Lacertidae). Bull. British Mus. (Natural History) Zool. London 44, 291– ogous ecological adaptations to Acanthodactylus. A more recent dis- 339. Arnold, E.N., 1986. A key and annotated check list to the lizards and amphisbaenas persal eastwards from Arabia is unlikely considering the profound of Arabia. Fauna Saudi Arabia 8, 385–435. level of differentiation, indicating a prolonged presence within the Arnold, E.N., 1989a. Towards a phylogeny and biogeography of the Lacertidae: region. The biogeographical history of Acanthodactylus assemblage relationships within an Old-World family of lizards derived from morphology. Bull. British Mus. (Natural History) Zool. London 55, 209–257. in the Arabian Peninsula is harder to interpret, since the area lacks Arnold, E.N., 1989b. Systematics and adaptive radiation of equatorial African lizards both comprehensive sampling and adequate geological and cli- assigned to the genera Adolfus, Bedriagaia, Gastropholis, Holaspis and Lacerta matic data. During the Miocene, the peninsula interior, character- (Reptilia: Lacertidae). J. Nat. Hist. 23, 525–555. Arnold, E.N., 2004. Overview of morphological evolution and radiation in the ized by the existence of a river system and basins, was highly Lacertidae. In: Pérez-Mellado, V., Riera, N., Perera, A. (Eds.), The Biology of influenced by the changing climate, which led to the formation Lacertid Lizards. Evolutionary and Ecological Perspectives. Institut Menorquí or migration of desert sands. Local geological events such as peri- d’Estudis, Recerca, 8. Maó, Menorca, pp. 11–36. odic volcanism, earthquakes and mountain ridges uplifting also Arnold, E.N., Arribas, Ó., Carranza, S., 2007. Systematics of the Palaearctic and Oriental lizard tribe Lacertini (Squamata: Lacertidae: Lacertinae), with took place during this period (Bosworth et al., 2005; Edgell, descriptions of eight new genera. Zootaxa 1430, 1–86. 2006). The changing landscapes and habitats within the Arabian Baha El Din, S.M., 2007. A new lizard of the Acanthodactylus scutellatus group Peninsula during the mid-late Miocene are likely to have caused (Squamata: Lacertidae) from Egypt. Zool. Middle East 40, 21–32. Baran, I., Kumlutasß, Y., Lanza, B., Sindaco, R., Ilgaz, Ç., Avci, A., Crucitti, P., 2005. either contact or fragmentation of ancestral Acanthodactylus popu- Acanthodactylus harranensis, a new species of lizard from southeastern Turkey lations, and thus been responsible for the diversification within the (Reptilia: Sauria: Lacertidae). Boll. Mus. Reg. Sci. Nat. Torino 23, 323–341. Eastern clade. Bellati, A., Carranza, S., Garcia-Porta, J., Fasola, M., Sindaco, R., 2015. Cryptic diversity within the Anatololacerta species complex (Squamata: Lacertidae) in the Anatolian Peninsula: evidence from a multi-locus approach. Mol. Phylogenet. Evol. 82, 219–233. http://dx.doi.org/10.1016/j.ympev.2014.10.003. Acknowledgments Bohannon, R.G., Naeser, C.W., Schmidt, D.L., Zimmermann, R.A., 1989. The timing of uplift, volcanism, and rifting peripheral to the Red Sea: a case for passive We are grateful to the following people for providing samples rifting? J. Geophys. Res.: Sol. Ea. (1978–2012) 94, 1683–1701. http://dx.doi.org/ 10.1029/JB094iB02p01683. for this study: S.M. Baha El Din, D. Donaire, J. Padial, S. Pelts, J.M. Bons, J., Geniez, P., 1995. Contribution to the systematics of the lizard Pleguezuelos, J. Šmíd, S. Trape, E. Wade. We also wish to thank Acanthodactylus erythrurus (Sauria, Lacertidae) in Morocco. Herpetol. J. 5, 271. the following for their help with the shipment of tissue samples: Bons, J., Girot, B., 1964. Révision de l’espèce Acanthodactylus scutellatus (Lacertidé- saurien). Bull. Soc. Sci. nat. phys. Maroc 42, 311–336. J. Vindum from the California Academy of Sciences, USA; C. Spencer Bosworth, W., Huchon, P., McClay, K., 2005. The Red Sea and Gulf of Aden basins. J. from the Museum of Vertebrate Zoology, University of California, Afr. Earth Sci. 43, 334–378. http://dx.doi.org/10.1016/j.jafrearsci.2005.07.020. Berkeley, USA; U. Bott from the Zoologisches Forschungsmuseum Boulenger, G.A., 1887. Catalogue of the lizards in the British Museum (Natural History), . second ed. Lacertidae, Gerrhosauridae, Scincidae, Anelytropidae, Alexander Koenig, Bonn, Germany; P.A. Crochet and P. Geniez, from Dibamidae, Chamaeleontidae second ed., vol. 3 Trustees of the British Museum the Centre d’Ecologie Fonctionnelle et Evolutive, Montpellier, (Natural History), London. France; B. Shacham from the Zoological Museum, Hebrew Univer- Boulenger, G.A., 1918. Sur les lézards du genre Acanthodactylus Wieg. Bull. Soc. Zool. France 43, 143–155. sity of Jerusalem, Israel; E. Maza from the Steinhardt Museum of Boulenger, G.A., 1921. Monograph of the Lacertidae, vol. 2. Trustees of the British Natural History in Tel Aviv University, Israel. We thank J.C. Brito, Museum (Natural History), London. P.A. Crochet and P. Geniez for fruitful discussions. Israeli specimens Brown, R.P., Suárez, N.M., Pestano, J., 2002. The Atlas Mountains as a were obtained under collecting permits (No. 38074, 38451, 38489, biogeographical divide in North-West Africa: evidence from mtDNA evolution in the Agamid lizard Agama impalearis. Mol. Phylogenet. Evol. 24, 324–332. 38540) and collecting and exporting permits from Oman were http://dx.doi.org/10.1016/S1055-7903(02)00218-X. issued to S.C. by the Nature Conservation Department of the Min- Brown, R.P., Terrasa, B., Pérez-Mellado, V., Castro, J.A., Hoskisson, P.A., Picornell, A., istry of Environment and Climate, Sultanate of Oman (Refs: Ramon, M.M., 2008. Bayesian estimation of post-Messinian divergence times in Balearic Island lizards. Mol. Phylogenet. Evol. 48, 350–358. http://dx.doi.org/ 08/2005; 16/2008; 38/2010; 12/2011; 13/2013; 21/2013). The 10.1016/j.ympev.2008.04.013. work of J.M. was financially supported by the Ministry of Culture Carranza, S., Arnold, E.N., 2012. A review of the geckos of the genus Hemidactylus of the Czech Republic (DKRVO 2013/15, 2014/14, National (Squamata: Gekkonidae) from Oman based on morphology, mitochondrial and nuclear data, with descriptions of eight new species. Zootaxa 3378, 1–95. Museum, 00023272). This study was funded by Israel Taxonomic Carranza, S., Arnold, E.N., Geniez, P., Roca, J., Mateo, J.A., 2008. Radiation, multiple Initiative grant to S.M. and by grant CGL2012-36970 from the Min- dispersal and parallelism in the skinks, Chalcides and Sphenops (Squamata: isterio de Economía y Competitividad, Spain (co-funded by FEDER- Scincidae), with comments on Scincus and Scincopus and the age of the Sahara Desert. Mol. Phylogenet. Evol. 46, 1071–1094. http://dx.doi.org/10.1016/j. EU) to S.C. K.T. was supported by an Israel Taxonomic Initiative ympev.2007.11.018. scholarship. We thank two anonymous reviewers for helpful com- Carretero, M.A., Fonseca, M.M., Garcia-Munoz, E., Brito, J.C., Harris, D.J., 2011. ments on an earlier version of the manuscript. Adding Acanthodactylus beershebensis to the mtDNA phylogeny of the Acanthodactylus pardalis group. North-West J. Zool. 7, 138–142. Castresana, J., 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Phylogenet. Evol. 17, 540–552. Appendix A. Supplementary material Cox, S.C., Carranza, S., Brown, R.P., 2010. Divergence times and colonization of the Canary Islands by Gallotia lizards. Mol. Phylogenet. Evol. 56, 747–757. http://dx. doi.org/10.1016/j.ympev.2010.03.020. Supplementary data associated with this article can be found, in Crochet, P.A., Geniez, P., Ineich, I., 2003. A multivariate analysis of the fringe-toed the online version, at http://dx.doi.org/10.1016/j.ympev.2016.07. lizards of the Acanthodactylus scutellatus group (Squamata: Lacertidae): 003. systematic and biogeographical implications. Zool. J. Linn. Soc. 137, 117–155. K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18 17

Disi, A., Modry, D., Necas, P., Rifai, L., 2001. Amphibians and Reptiles of the biogeography of the lacertid lizard Mesalina in North Africa and the Middle Hashemite Kingdom of Jordan: An Atlas and Field Guide. Chimaira, Frankfurt East. J. Biogeogr. 42, 267–279. http://dx.doi.org/10.1111/jbi.12420. am Main. Kapli, P., Poulakakis, N., Lymberakis, P., Mylonas, M., 2011. A re-analysis of the Douady, C.J., Catzeflis, F., Raman, J., Springer, M.S., Stanhope, M.J., 2003. The Sahara molecular phylogeny of Lacertidae with currently available data. Basic Appl. as a vicariant agent, and the role of Miocene climatic events, in the Herpetol. 25, 97–104. diversification of the mammalian order Macroscelidea (elephant shrews). Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software Proc. Natl. Acad. Sci. USA 100, 8325–8330. http://dx.doi.org/10.1073/ version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772– pnas.0832467100. 780. http://dx.doi.org/10.1093/molbev/mst010. Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian phylogenetics Khan, M.S., 2006. Amphibians and Reptiles of Pakistan. Krieger Publishing with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 29, 1969–1973. http://dx.doi. Company. org/10.1093/molbev/mss075. Kroepelin, S., 2006. Revisiting the age of the Sahara Desert. Science 312 (5777), Edgell, H.S., 2006. Arabian Deserts: Nature, Origin and Evolution. Springer Science & 1138–1139. Business Media. Lanfear, R., Calcott, B., Ho, S.Y., Guindon, S., 2012. PartitionFinder: combined selection Ezard, T., Fujisawa, T., Barraclough, T.G., 2009. SPLITS: Species Limits by Threshold of partitioning schemes and substitution models for phylogenetic analyses. Mol. Statistics. R package version 1.0-11/r29 . Le Houérou, H.N., 1992. Outline of the biological history of the Sahara. J. Arid Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the Environ. 22, 3–30. bootstrap. Evolution 39, 783–791. Le Houérou, H.N., 1997. Climate, flora and fauna changes in the Sahara over the past Fitzinger, L.J.F.J., 1834. Acanthodactylus. In: Wiegman, A.F.A. (Ed.), Herpetologia 500 million years. J. Arid Environ. 37, 619–647. http://dx.doi.org/ mexicana, seu Descriptio amphibiorum Novae Hispaniae quae itineribus 10.1006/jare.1997.0315. comitis De Sack, Ferdinandi Deppe et Chr. Guil. Schiede in Museum Lemey, P., Rambaut, A., Drummond, A., Suchard, M., 2009. Bayesian phylogeography zoologicum Berolinense pervenerunt. Pars prima saurorum species finds its roots. PLoS Comput. Biol. 5, e1000520. http://dx.doi.org/10.1371/ amplectens, adjecto systematis saurorum prodromo, additisque multis in journal.pcbi.1000520. hunc amphibiorum ordinem observationibus. C.G. Luderitz, Berlin, p. 10. Macey, J.R., Schulte, J.A., Ananjeva, N.B., Larson, A., Rastegar-Pouyani, N., Flower, B.P., Kennett, J.P., 1994. The middle Miocene climatic transition: east Shammakov, S.M., Papenfuss, T.J., 1998. Phylogenetic relationships among Antarctic ice sheet development, deep ocean circulation and global carbon Agamid Lizards of the Laudakia caucasia species group: testing hypotheses of cycling. Palaeogeogr. Palaeoclimatol. Palaeoecol. 108, 537–555. biogeographic fragmentation and an Area Cladogram for the Iranian Plateau. Fonseca, M.M., Brito, J.C., Paulo, O.S., Carretero, M.A., Harris, D.J., 2009. Systematic Mol. Phylogenet. Evol. 10, 118–131. and phylogeographical assessment of the Acanthodactylus erythrurus group Mayer, W., Benyr, G., 1994. Albumin-Evolution und Phylogenese in der Familie (Reptilia: Lacertidae) based on phylogenetic analyses of mitochondrial and Lacertidae (Reptilia: Sauria). Ann. Naturhist. Mus. Wien 96, 621–648. nuclear DNA. Mol. Phylogenet. Evol. 51, 131–142. http://dx.doi.org/10.1016/j. Mayer, W., Pavlicev, M., 2007. The phylogeny of the family Lacertidae (Reptilia) ympev.2008.11.021. based on nuclear DNA sequences: convergent adaptations to arid habitats Fonseca, M.M., Brito, J.C., Rebelo, H., Kalboussi, M., Larbes, S., Carretero, M.A., Harris, within the subfamily Eremiainae. Mol. Phylogenet. Evol. 44, 1155–1163. http:// D.J., 2008. Genetic variation among spiny-footed lizards in the Acanthodactylus dx.doi.org/10.1016/j.ympev.2007.05.015. pardalis group from North Africa. Afr. Zool. 43, 8–15. Mellado, J., Olmedo, G., 1990. El género Acanthodactylus en Marruecos: problemas Fritz, U., Fritzsch, G., Lehr, E., Ducotterd, J.M., Müller, A., 2005. The Atlas Mountains, de identificación en los grupos de especies A. pardalis y A. scutellatus. Amphibia- not the Strait of Gibraltar, as a biogeographic barrier for Mauremys leprosa Reptilia 11, 131–146. (Reptilia: Testudines). Salamandra 41, 97–106. Mertens, R., 1929. Beitraege zur Herpetologie Tunesiens. Senckenbergiana 11, 291– Fu, J., 2000. Toward the phylogeny of the family Lacertidae-Why 4708 base pairs of 310. mtDNA sequences cannot draw the picture. Biol. J. Linn. Soc. 71, 203–217. Metallinou, M., Arnold, E.N., Crochet, P.A., Geniez, P., Brito, J.C., Lymberakis, P., Baha Gonçalves, D.V., Brito, J.C., Crochet, P.A., Geniez, P., Padial, J.M., Harris, D.J., 2012. El Din, S., Sindaco, R., Robinson, M., Carranza, S., 2012. Conquering the Sahara Phylogeny of North African Agama lizards (Reptilia: Agamidae) and the role of and Arabian deserts: systematics and biogeography of Stenodactylus geckos the Sahara desert in vertebrate speciation. Mol. Phylogenet. Evol. 64, 582–591. (Reptilia: Gekkonidae). BMC Evol. Biol. 12 (1), 258. http://dx.doi.org/10.1186/ http://dx.doi.org/10.1016/j.ympev.2012.05.007. 1471-2148-12-258. Griffin, D.L., 2002. Aridity and humidity: two aspects of the late Miocene climate of Metallinou, M., Cˇervenka, J., Crochet, P.A., Kratochvíl, L., Wilms, T., Geniez, P., North Africa and the Mediterranean. Palaeogeogr. Palaeoclimatol. Palaeoecol. Shobrak, M.Y., Brito, J.C., Carranza, S., 2015. Species on the rocks: Systematics 182, 65–91. http://dx.doi.org/10.1016/S0031-0182(01)00453-9. and biogeography of the rock-dwelling Ptyodactylus geckos (Squamata: Haas, G., 1957. Some amphibians and reptiles from Arabia. Proc. Calif. Acad. Sci. 29, Phyllodactylidae) in North Africa and Arabia. Mol. Phylogenet. Evol. 85, 208– 47–86. 220. http://dx.doi.org/10.1016/j.ympev.2015.02.010. Harris, D.J., Arnold, E.N., 2000. Elucidation of the relationships of spiny footed Miller, M., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES Science Gateway for lizards, Acanthodactylus spp. (Reptilia: Lacertidae) using mitochondrial DNA inference of large phylogenetic trees. In: Proceedings of the Gateway sequence, with comments on their biogeography and evolution. J. Zool. 252, Computing Environments Workshop (GCE). IEEE, L.A, pp. 1–8. http://dx.doi. 351–362. org/10.1109/GCE.2010.5676129. Harris, D.J., Arnold, E.N., Thomas, R.H., 1998. Relationships of lacertid lizards Minton, S.A., 1966. A contribution to the herpetology of West Pakistan. Bull. Am. (Reptilia: Lacertidae) estimated from mitochondrial DNA sequences and Mus. Nat. His. 134, 27–184. morphology. Proc. R. Soc. Lond. B. Bio. Sci. 265, 1939–1948. Mouthereau, F., 2011. Timing of uplift in the Zagros belt/Iranian plateau and Harris, D.J., Batista, V., Carretero, M., 2004. Assessment of genetic diversity within accommodation of late Cenozoic Arabia-Eurasia convergence. Geol. Mag. 148, Acanthodactylus erythrurus (Reptilia: Lacertidae) in Morocco and the Iberian 726–738. http://dx.doi.org/10.1017/S0016756811000306. Peninsula using mitochondrial DNA sequence data. Amphibia-Reptilia 25, 227. Nouira, S., Blanc, C., 1999. Description d’une nouvelle espèce d’acanthodactyle Heidari, N., Rastegar-Pouyani, E., Rastegar-Pouyani, N., Faizi, H., 2014. Molecular de Tunisie: Acanthodactylus mechriguensis n. sp. (Sauria, Reptilia). Siciliana 5, phylogeny and biogeography of the genus Acanthodactylus Fitzinger, 1834 101–108. (Reptilia: Lacertidae) in Iran, inferred from mtDNA Sequences. Zootaxa 3860, Pavlicev, M., Mayer, W., 2009. Fast radiation of the subfamily Lacertinae (Reptilia: 379–395. Lacertidae): history or methodical artefact? Mol. Phylogenet. Evol. 52, 727–734. Hipsley, C.A., Himmelmann, L., Metzler, D., Müller, J., 2009. Integration of Bayesian http://dx.doi.org/10.1016/j.ympev.2009.04.020. molecular clock methods and fossil-based soft bounds reveals early Cenozoic Pons, J., Barraclough, T.G., Gomez-Zurita, J., Cardoso, A., Duran, D.P., Hazell, S., origin of African lacertid lizards. BMC Evol. Biol. 9, 151. http://dx.doi.org/ Kamoun, S., Sumlin, W.D., Vogler, A.P., 2006. Sequence-based species 10.1186/1471-2148-9-151. delimitation for the DNA taxonomy of undescribed insects. Syst. Biol. 55, Huelsenbeck, J.P., Rannala, B., 2004. Frequentist properties of Bayesian posterior 595–609. http://dx.doi.org/10.1080/10635150600852011. probabilities of phylogenetic trees under simple and complex substitution Pook, C.E., Joger, U., Stümpel, N., Wüster, W., 2009. When continents collide: models. Syst. Biol. 53, 904–913. http://dx.doi.org/10.1080/ phylogeny, historical biogeography and systematics of the medically important 10635150490522629. viper genus Echis (Squamata: Serpentes: Viperidae). Mol. Phylogenet. Evol. 53, Jolivet, L., Augier, R., Robin, C., Suc, J.P., Rouchy, J.M., 2006. Lithospheric-scale 792–807. http://dx.doi.org/10.1016/j.ympev.2009.08.002. geodynamic context of the Messinian salinity crisis. Sediment. Geol. 188, 9–33. Popov, S.V., Rögl, F., Rozanov, A.Y., Steininger, F.F., Shcherba, I.G., Kovac, M., 2004. http://dx.doi.org/10.1016/j.sedgeo.2006.02.004. Lithological-paleogeographic maps of Paratethys 10 maps Late Eocene to Kaliontzopoulou, A., Pinho, C., Harris, D.J., Carretero, M.A., 2011. When cryptic Pliocene. Cour. Forsch. Inst. Senckenb 250, 1–46. diversity blurs the picture: a cautionary tale from Iberian and North African Portik, D.M., Papenfuss, T.J., 2012. Monitors cross the Red Sea: the biogeographic Podarcis wall lizards. Biol. J. Linn. Soc. 103, 779–800. http://dx.doi.org/10.1111/ history of Varanus yemenensis. Mol. Phylogenet. Evol. 62, 561–565. http://dx. j.1095-8312.2011.01703.x. doi.org/10.1016/j.ympev.2011.09.024. Kapli, P., Botoni, D., Ilgaz, Ç., Kumlutasß, Y., Avcı, A., Rastegar-Pouyani, N., Fathinia, B., Portik, D.M., Papenfuss, T.J., 2015. Historical biogeography resolves the origins of Lymberakis, P., Ahmadzadeh, F., Poulakakis, N., 2013. Molecular phylogeny and endemic Arabian toad lineages (Anura: Bufonidae): evidence for ancient historical biogeography of the Anatolian lizard Apathya (Squamata, Lacertidae). vicariance and dispersal events with the Horn of Africa and South Asia. BMC Mol. Phylogenet. Evol. 66, 992–1001. http://dx.doi.org/10.1016/j. Evol. Biol. 15, 152. http://dx.doi.org/10.1186/s12862-015-0417-y. ympev.2012.12.002. Poulakakis, N., Lymberakis, P., Valakos, E., Pafilis, P., Zouros, E., Mylonas, M., 2005. Kapli, P., Lymberakis, P., Crochet, P.A., Geniez, P., Brito, J.C., Almutairi, M., Phylogeography of Balkan wall lizard (Podarcis taurica) and its relatives inferred Ahmadzadeh, F., Schmitz, A., Wilms, T., Poulakakis, N., 2015. Historical from mitochondrial DNA sequences. Mol. Ecol. 14, 2433–2443. 18 K. Tamar et al. / Molecular Phylogenetics and Evolution 103 (2016) 6–18

Pyron, R.A., Burbrink, F.T., Wiens, J.J., 2013. A phylogeny and revised classification of Talavera, G., Castresana, J., 2007. Improvement of phylogenies after removing Squamata, including 4161 species of lizards and snakes. BMC Evol. Biol. 13, 93. divergent and ambiguously aligned blocks from protein sequence alignments. http://dx.doi.org/10.1186/1471-2148-13-93. Syst. Biol. 56, 564–577. http://dx.doi.org/10.1080/10635150701472164. Rambaut, A., Suchard, M.A., Xie, D., Drummond, A.J., 2014. Tracer v1.6. Available Talavera, G., Dinca, V., Vila, R., 2013. Factors affecting species delimitations with the from . GMYC model: insights from a butterfly survey. Methods Ecol. Evol. 4, 1101– Rifai, L., Modry´ , D., Necas, P., Amr, Z.S., 2003. The occurrence of Acanthodactylus 1110. http://dx.doi.org/10.1111/2041-210X.12107. hardyi Haas, 1957 in the Hashemite Kingdom of Jordan and notes on its ecology. Tamar, K., Carranza, S., Sindaco, R., Moravec, J., Meiri, S., 2014. Systematics and Zool. Middle East 28, 33–38. phylogeography of Acanthodactylus schreiberi and its relationships with Rögl, F., 1999. Mediterranean and Paratethys. Facts and hypotheses of an Oligocene Acanthodactylus boskianus (Reptilia: Squamata: Lacertidae). Zool. J. Linn. Soc. to Miocene paleogeography (short overview). Geol. Carpath. 50, 339–349. 172, 720–739. http://dx.doi.org/10.1111/zoj.12170. Ruddiman, W.F., Raymo, M., Martinson, D.G., Clement, B.M., Backman, J., 1989. Tamar, K., Carranza, S., in den Bosch, H., Sindaco, R., Moravec, J., Meiri, S., 2015. Pleistocene evolution: northern hemisphere ice sheets and North Atlantic Hidden relationships and genetic diversity: molecular phylogeny and Ocean. Paleoceanography 4, 353–412. phylogeography of the Levantine lizards of the genus Phoenicolacerta Salvador, A., 1982. A revision of the lizards of the genus Acanthodactylus (Sauria: (Squamata: Lacertidae). Mol. Phylogenet. Evol. 91, 86–97. http://dx.doi.org/ Lacertidae). Bonner Zoologische Monographien. Zoologisches 10.1016/j.ympev.2015.05.002. Forschungsinstitut und Museum Alexander Koenig, Bonn (16). Tamar, K., Scholz, S., Crochet, P.A., Geniez, P., Meiri, S., Schmitz, A., Wilms, A., Sarnthein, M., 1978. Sand deserts during glacial maximum and climatic optimum. Carranza, S., 2016. Evolution around the Red Sea: systematics and biogeography Nature 272, 43–46. of the agamid genus Pseudotrapelus (Squamata: Agamidae) from North Africa Schleich, H.H., Kästle, W., Kabisch, K., 1996. Amphibians and Reptiles of North and Arabia. Mol. Phylogenet. Evol. 97, 55–68. http://dx.doi.org/10.1016/j. Africa. Koeltz, Koenigstein. ympev.2015.12.021. Sborshchikov, I.M., Savostin, L.A., Zonenshain, L.P., 1981. Present plate tectonics Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: between Turkey and Tibet. Tectonophysics 79, 45–73. molecular evolutionary genetics analysis using maximum likelihood, Schuster, M., Duringer, P., Ghienne, J.-F., Vignaud, P., Mackaye, H.T., Likius, A., evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, Brunet, M., 2006. The age of the Sahara desert. Science 311, 821. 2731–2739. http://dx.doi.org/10.1093/molbev/msr121. Silvestro, D., Michalak, I., 2012. RaxmlGUI: a graphical front-end for RAxML. Org. Trape, J.F., Trape, S., Chirio, L., 2012. Lézards, Crocodiles Et Tortues d’Afrique Divers. Evol. 12, 335–337. http://dx.doi.org/10.1007/s13127-011-0056-0. Occidentale Et Du Sahara. IRD Éditions, Marseille. Sindaco, R., Jeremcˇenko, V.K., 2008. The reptiles of the Western Palearctic. 1. Uetz, P., Hošek, J., 2016. The Reptile Database. Available at . (April 2016). amphisbaenians and lizards of Europe, North Africa, Middle East and Central Wiens, J.J., Brandley, M.C., Reeder, T.W., 2006. Why does a trait evolve multiple Asia. Monografie della Societas Herpetologica Italica, Edizioni Belvedere, Latina. times within a clade? Repeated evolution of snakeline body form in squamate Šmíd, J., Carranza, S., Kratochvíl, L., Gvozˇdík, V., Nasher, A.K., Moravec, J., 2013. Out reptiles. Evolution 60, 123–141. of Arabia: a complex biogeographic history of multiple vicariance and dispersal Wilcox, T.P., Zwickl, D.J., Heath, T.A., Hillis, D.M., 2002. Phylogenetic relationships of events in the gecko genus Hemidactylus (Reptilia: Gekkonidae). PLoS ONE 8, the dwarf boas and a comparison of Bayesian and bootstrap measures of e64018. http://dx.doi.org/10.1371/journal.pone.0064018. phylogenetic support. Mol. Phylogenet. Evol. 25, 361–371. http://dx.doi.org/ Šmíd, J., Frynta, D., 2012. Genetic variability of Mesalina watsonana (Reptilia: 10.1016/S1055-7903(02)00244-0. Lacertidae) on the Iranian plateau and its phylogenetic and biogeographic Zachos, J., Pagani, M., Sloan, L., Thomas, E., Billups, K., 2001. Trends, rhythms, and affinities as inferred from mtDNA sequences. Acta Herpetol. 7, 139–153. aberrations in global climate 65 Ma to present. Science 292, 686–693. http://dx. Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic doi.org/10.1126/science.1059412. analyses with thousands of taxa and mixed models. Bioinformatics 22, 2688– Zheng, Y., Wiens, J.J., 2016. Combining phylogenomic and supermatrix approaches, 2690. http://dx.doi.org/10.1093/bioinformatics/btl446. and a time-calibrated phylogeny for squamate reptiles (lizards and snakes) Swezey, C.S., 2006. Revisiting the age of the Sahara Desert. Science 312, 1138–1139. based on 52 genes and 4162 species. Mol. Phylogenet. Evol. 94, 537–547. http:// http://dx.doi.org/10.1126/science.312.5777.1138b. dx.doi.org/10.1016/j.ympev.2015.10.009. Swezey, C.S., 2009. Cenozoic stratigraphy of the Sahara, northern Africa. J. Afr. Earth Sci. 53, 89–121. http://dx.doi.org/10.1016/j.jafrearsci.2008.08.001. 100 Mesalina guttulata - M18 - Israel 100 Mesalina guttulata - M17 - Israel Mesalina olivieri - M21 - Israel 100 Mesalina olivieri - M19 - Israel Mesalina olivieri - M20 - Israel A. guineensis - A275 - Niger 99 A. orientalis - A244 - Syria 100 A. orientalis - A246 - Syria 75 100 A. orientalis - A245 - Syria tristrami A. tristrami - A196 - Jordan 95 A. tristrami - A252 - Syria group 94 A. tristrami - A254 - Syria 94 73 A. tristrami - A253 - Syria A. boueti - A276 - Benin 100 A. savignyi - A264 - Algeria A. savignyi - A265 - Algeria 100 A. blanci - A86 - Tunisia 71 A. blanci - A85 - Tunisia 99 A. erythrurus belli - A56 - Morocco A. erythrurus belli - A124 - Morocco erythrurus A. erythrurus atlanticus - A60 - Morocco group 100 A. lineomaculatus - A130 - Morocco 87 A. lineomaculatus - A129 - Morocco Western A. erythrurus belli - A146 - Morocco A. erythrurus belli - A61 - Morocco 97 A. erythrurus erythrurus - A125 - Spain A. erythrurus erythrurus - A126 - Spain A. busacki - A263 - Morocco 100 A. busacki - A88 - Morocco 85 A. busacki - A89 - Morocco A. busacki - A87 - Morocco A. busacki - A271 - Morocco 100 A. busacki - A272 - Morocco A. busacki - A269 - Morocco 100 A. busacki - A270 - Morocco 96 A. busacki - A268 - Western Sahara A. maculatus - A58 - Morocco

100 A. maculatus - A262 - Morocco A. maculatus - A91 - Libya clade 96 A. maculatus - A141 - Algeria A. maculatus - A142 - Algeria 77 A. pardalis - A227 - Egypt A. pardalis - A54 - Egypt A. pardalis - A41 - Egypt 71 A. pardalis - A55 - Egypt A. bedriagai - A258 - Algeria 99 A. maculatus - A259 - Algeria pardalis A. maculatus - A90 - Morocco 99 A. maculatus - A143 - Morocco group A. maculatus - A49 - Morocco 100 A. maculatus - A52 - Morocco A. maculatus - A145 - Tunisia 100 A. bedriagai - A189 - Tunisia A. maculatus - A144 - Tunisia A. maculatus - A81 - Morocco A. maculatus - A82 - Morocco 100 A. beershebensis - A17 - Israel 100 A. beershebensis - A47 - Israel A. beershebensis - A284 - Israel 100 A. beershebensis - A53 - Israel A. beershebensis - A40 - Israel A. beershebensis - A2 - Israel A. beershebensis - A75 - Israel A. beershebensis - A278 - Israel A. beershebensis - A283 - Israel A. beershebensis - A74 - Israel A. beershebensis - A280 - Israel A. aureus - A71 - Western Sahara A. aureus - A166 - Mauritania 100 86 A. aureus - A184 - Mauritania A. aureus - A22 - Western Sahara A. aureus - A39 - Morocco 100 77 A. aureus - A43 - Morocco A. aureus - A45 - Morocco 98 A. aureus - A188 - Morocco 100 A. taghitensis - A266 - Algeria A. taghitensis - A267 - Algeria 100 A. scutellatus scutellatus - A215 - Egypt A. scutellatus scutellatus - A218 - Egypt A. scutellatus scutellatus - A219 - Egypt 96 A. scutellatus scutellatus - A221 - Egypt A. scutellatus scutellatus - A220 - Egypt A. scutellatus scutellatus - A216 - Egypt A. scutellatus scutellatus - A214 - Egypt 71 A. scutellatus scutellatus - A24 - Egypt 82 A. scutellatus scutellatus - A213 - Egypt A. scutellatus scutellatus - A212 - Egypt A. scutellatus scutellatus - A226 - Egypt A. scutellatus scutellatus - A26 - Egypt A. scutellatus scutellatus - A217 - Egypt A. scutellatus scutellatus - A20 - Israel A. scutellatus scutellatus - A68 - Israel A. scutellatus scutellatus - A13 - Israel 78 A. scutellatus scutellatus - A9 - Israel A. scutellatus scutellatus - A8 - Israel 100 A. scutellatus scutellatus - A14 - Israel A. scutellatus scutellatus - A44 - Israel 97 A. scutellatus scutellatus - A65 - Israel A. scutellatus scutellatus - A11 - Israel scutellatus A. scutellatus scutellatus - A42 - Israel A. scutellatus scutellatus - A6 - Israel A. scutellatus audouini - A103 - Tunisia 94 A. scutellatus audouini - A94 - Tunisia 99 A. scutellatus audouini - A104 - Tunisia A. longipes - A131 - Algeria 94 A. longipes - A127 - Mauritania A. longipes - A139 - Mauritania 79 A. longipes - A137 - Mauritania A. longipes - A179 - Mauritania 100 A. longipes - A185 - Mauritania A. longipes - A180 - Mauritania A. aegyptius - A277 - Israel 87 A. aegyptius - A7 - Israel A. aegyptius - A23 - Israel 100 A. aegyptius - A10 - Israel scutellatus 82 A. aegyptius - A37 - Israel group A. aegyptius - A36 - Israel A. aegyptius - A135 - Egypt A. aegyptius - A134 - Egypt A. aegyptius - A136 - Egypt

A. aegyptius - A133 - Egypt A. aegyptius - A132 - Egypt A. scutellatus audouini - A210 - Algeria clade 100 A. scutellatus audouini - A101 - Libya A. scutellatus audouini - A304 - Libya 86 84 A. scutellatus audouini - A96 - Tunisia A. scutellatus audouini - A93 - Tunisia A. scutellatus audouini - A83 - Tunisia 99 A. scutellatus audouini - A97 - Tunisia 94 A. scutellatus audouini - A95 - Tunisia A. scutellatus audouini - A92 - Libya 71 A. scutellatus audouini - A99 - Libya 94 A. scutellatus audouini - A102 - Libya 81 A. scutellatus audouini - A100 - Libya A. scutellatus audouini - A222 - Mauritania 97 A. scutellatus audouini - A223 - Mauritania 87 A. scutellatus audouini - A119 - Egypt A. scutellatus audouini - A211 - Egypt A. scutellatus audouini - A29 - Egypt 84 A. scutellatus audouini - A27 - Egypt 99 A. scutellatus audouini - A225 - Morocco A. scutellatus audouini - A224 - Morocco A. dumerilii - A3 - Algeria 73 A. dumerilii - A249 - Morocco A. dumerilii - A248 - Morocco 97 A. dumerilii - A46 - Morocco 100 A. senegalensis - A187 - Mauritania A. senegalensis - A1 - Mauritania A. senegalensis - A305 - Senegal 91 A. senegalensis - A19 - Senegal 99 A. senegalensis - A307 - Senegal A. senegalensis - A306 - Senegal A. senegalensis - A201 - Mauritania A. dumerilii - A300 - Senegal A. dumerilii - A301 - Senegal A. senegalensis - A202 - Western Sahara A. dumerilii - A140 - Western Sahara A. dumerilii - A138 - Mauritania A. dumerilii - A182 - Mauritania A. senegalensis - A186 - Mauritania A. dumerilii - A181 - Mauritania A. senegalensis - A155 - Western Sahara A. dumerilii - A183 - Mauritania A. haasi - A302 - Oman 100 A. tilburyi - A251 - Jordan A. tilburyi - A250 - Jordan 90 A. gongrorhynchatus - A128 - UAE 100 A. arabicus - A77 - Yemen 100 A. arabicus - A72 - Yemen cantoris 86 A. arabicus - A84 - Yemen A. masirae - A63 - Oman group 100 A. masirae - A50 - Oman 98 93 A. masirae - A48 - Oman A. cantoris - A287 - Pakistan 100 A. cantoris - A178 - Pakistan A. cantoris - A286 - Pakistan 100 A. micropholis - A67 - Pakistan A. micropholis - A150 - Iran micropholis group 95 100 A. grandis - A241 - Syria A. harranensis - A151 - Turkey 99 A. grandis - A243 - Syria grandis group 96 A. grandis - A242 - Syria A. grandis - A192 - Jordan A. hardyi - A273 - Kuwait 97 A. hardyi - A122 - Jordan A. hardyi - A247 - Jordan A. hardyi - A123 - Jordan 99 A. schmidti - A195 - Jordan 98 A. schmidti - A51 - Oman 100 A. schmidti - A228 - UAE 98 A. blanfordii - A208 - Iran blanfordi A. blanfordii - A207 - Iran 86 A. blanfordii - A291 - UAE group 100 A. blanfordii - A290 - Oman 82 A. blanfordii - A59 - Oman 100 A. felicis - A34 - Oman 84 A. felicis - A30 - Oman A. felicis - A32 - Oman 100 A. felicis - A164 - Oman A. felicis - A165 - Oman A. felicis - A163 - Oman A. felicis - A31 - Oman A. felicis - A197 - Oman 88 A. felicis - A162 - Oman 100 A. opheodurus - A33 - Israel opheodurus A. opheodurus - A25 - Israel group 100 A. opheodurus - A79 - Jordan A. opheodurus - A193 - Jordan A. opheodurus - A194 - Jordan 99 A. opheodurus - A38 - Oman A. opheodurus - A35 - Oman 100 A. opheodurus - A69 - Israel A. opheodurus - A288 - Israel 99 A. opheodurus - A209 - UAE 86 A. opheodurus - A303 - Oman A. boskianus asper - A256 - Syria 100 A. boskianus asper - A255 - Syria A. boskianus asper - A257 - Syria A. boskianus asper - A240 - Syria A. boskianus asper - A239 - Syria A. schreiberi schreiberi - A229 - Cyprus 100 99A. schreiberi schreiberi - A289 - Cyprus A. schreiberi schreiberi - A70 - Cyprus Eastern A. schreiberi schreiberi - A230 - Cyprus A. schreiberi schreiberi - A118 - Cyprus 92 A. schreiberi ataturi - A198 - Turkey 98 A. schreiberi ataturi - A199 - Turkey A. boskianus asper - A231 - Oman 100 A. boskianus asper - A191 - Jordan A. boskianus asper - A294 - UAE 71 A. boskianus asper - A115 - Oman A. boskianus asper - A149 - Oman 72 A. boskianus asper - A293 - Oman A. boskianus asper - A168 - Egypt A. boskianus asper - A285 - Niger 98 A. boskianus nigeriensis - A299 - Niger 100 95 A. boskianus nigeriensis - A298 - Niger 73 A. boskianus asper - A148 - Sudan A. boskianus asper - A172 - Egypt clade 95 A. boskianus asper - A120 - Egypt A. boskianus asper - A158 - Morocco A. boskianus asper - A161 - Morocco 100 A. boskianus asper - A147 - Morocco A. boskianus asper - A175 - Morocco A. boskianus asper - A160 - Morocco A. boskianus asper - A109 - Algeria A. boskianus asper - A176 - Tunisia 100 A. boskianus asper - A110 - Tunisia 92 A. boskianus asper - A157 - Tunisia A. boskianus asper - A154 - Tunisia 87 77 A. boskianus khattensis - A296 - Mauritania A. boskianus khattensis - A297 - Mauritania 100 A. boskianus khattensis - A295 - Mauritania A. boskianus asper - A108 - Libya 94 A. boskianus asper - A234 - Morocco A. boskianus asper - A235 - Morocco A. boskianus asper - A236 - Western Sahara 100 A. boskianus asper - A174 - Mauritania 99 A. boskianus asper - A173 - Mauritania A. boskianus asper - A107 - Yemen boskianus 100 A. boskianus asper - A106 - Yemen A. boskianus asper - A156 - Yemen group A. boskianus asper - A232 - Oman 100 A. boskianus asper - A116 - Oman A. boskianus asper - A159 - Oman 90 A. boskianus asper - A117 - Oman A. boskianus asper - A169 - Egypt 89 A. boskianus asper - A292 - Egypt A. boskianus asper - A167 - Egypt 7193 99 A. schreiberi syriacus - A153 - Lebanon A. schreiberi syriacus - A152 - Lebanon 100 A. schreiberi syriacus - A15 - Israel A. schreiberi syriacus - A274 - Israel A. schreiberi syriacus - A62 - Israel A. schreiberi syriacus - A57 - Israel 100 A. schreiberi syriacus - A21 - Israel A. schreiberi syriacus - A121 - Israel A. boskianus asper - A114 - Jordan A. schreiberi syriacus - A4 - Israel 100 A. schreiberi syriacus - A204 - Israel A. schreiberi syriacus - A205 - Israel 98 A. schreiberi syriacus - A5 - Israel A. boskianus asper - A76 - Israel A. boskianus asper - A64 - Israel A. boskianus asper - A111 - Egypt A. boskianus asper - A105 - Egypt A. boskianus asper - A66 - Israel A. boskianus asper - A203 - Israel A. boskianus asper - A279 - Israel A. boskianus asper - A112 - Egypt A. boskianus asper - A170 - Egypt A. boskianus asper - A177 - Egypt A. boskianus asper - A190 - Egypt A. boskianus asper - A28 - Israel A. boskianus asper - A281 - Israel A. boskianus asper - A206 - Israel A. boskianus asper - A282 - Israel A. boskianus asper - A18 - Israel A. boskianus asper - A113 - Jordan A. boskianus asper - A73 - Israel A. boskianus asper - A233 - Jordan A. boskianus asper - A171 - Egypt A. boskianus asper - A237 - Jordan A. boskianus asper - A78 - Israel A. boskianus asper - A238 - Jordan A. boskianus asper - A12 - Israel 0.04 A. boskianus asper - A80 - Israel 100 Mesalina guttulata - M18 - Israel 100 Mesalina guttulata - M17 - Israel 100 Mesalina olivieri - M20 - Israel Mesalina olivieri - M19 - Israel Mesalina olivieri - M21 - Israel A. guineensis - A275 - Niger 100 A. savignyi - A264 - Algeria A. savignyi - A265 - Algeria 72 97 A. orientalis - A244 - Syria 100 A. orientalis - A245 - Syria 100 A. orientalis - A246 - Syria tristrami A. tristrami - A196 - Jordan 91 85 group 100 A. tristrami - A253 - Syria A. tristrami - A254 - Syria A. tristrami - A252 - Syria A. erythrurus - A124 - Morocco A. erythrurus - A56 - Morocco 93 100 A. blanci - A86 - Tunisia A. blanci - A85 - Tunisia A. erythrurus - A60 - Morocco 100 A. lineomaculatus - A130 - Morocco erythrurus 81 A. lineomaculatus - A129 - Morocco group 90 A. erythrurus - A126 - Spain Western A. erythrurus - A125 - Spain A. erythrurus - A146 - Morocco A. erythrurus - A61 - Morocco A. boueti - A276 - Benin A. busacki - A263 - Morocco 100 A. busacki - A88 - Morocco A. busacki - A89 - Morocco A. busacki - A87 - Morocco A. busacki - A272 - Morocco A. busacki - A271 - Morocco 100 A. busacki - A269 - Morocco 99 A. busacki - A270 - Morocco A. busacki - A268 - Western Sahara

100 A. maculatus - A58 - Morocco A. maculatus - A262 - Morocco A. beershebensis - A17 - Israel clade A. beershebensis - A40 - Israel A. beershebensis - A284 - Israel A. beershebensis - A47 - Israel 100 A. beershebensis - A53 - Israel A. beershebensis - A74 - Israel A. beershebensis - A280 - Israel pardalis A. beershebensis - A75 - Israel A. beershebensis - A2 - Israel group A. beershebensis - A283 - Israel A. beershebensis - A278 - Israel 100 A. maculatus - A141 - Algeria 85 A. maculatus - A142 - Algeria A. pardalis - A54 - Egypt A. pardalis - A227 - Egypt 78 A. pardalis - A41 - Egypt A. pardalis - A55 - Egypt A. maculatus - A49 - Morocco 96 A. maculatus - A52 - Morocco 99 A. maculatus - A259 - Algeria A. bedriagai - A258 - Algeria 72 A. maculatus - A143 - Morocco 99 A. maculatus - A90 - Morocco A. maculatus - A91 - Libya 100 A. maculatus - A82 - Morocco 100 A. maculatus - A81 - Morocco A. bedriagai - A189 - Tunisia 88 A. maculatus - A144 - Tunisia 96 A. maculatus - A145 - Tunisia 100 98 A. aureus - A45 - Morocco A. aureus - A188 - Morocco A. aureus - A39 - Morocco 100 80 A. aureus - A43 - Morocco A. aureus - A22 - Western Sahara A. aureus - A71 - Western Sahara 72 A. aureus - A166 - Mauritania 83 A. aureus - A184 - Mauritania 100 A. taghitensis - A266 - Algeria A. taghitensis - A267 - Algeria A. longipes - A131 - Algeria 89 A. longipes - A139 - Mauritania 99 A. longipes - A179 - Mauritania 100 A. longipes - A185 - Mauritania A. longipes - A127 - Mauritania A. longipes - A137 - Mauritania 99 A. longipes - A180 - Mauritania A. aegyptius - A132 - Egypt 76 A. aegyptius - A133 - Egypt A. aegyptius - A136 - Egypt A. aegyptius - A134 - Egypt 100 A. aegyptius - A135 - Egypt A. aegyptius - A7 - Israel 89 A. aegyptius - A277 - Israel A. aegyptius - A23 - Israel 94 A. aegyptius - A10 - Israel A. aegyptius - A36 - Israel A. aegyptius - A37 - Israel A. dumerilii - A46 - Morocco A. dumerilii - A3 - Algeria scutellatus 91 A. dumerilii - A248 - Morocco scutellatus 99 A. senegalensis - A1 - Mauritania group 97 A. senegalensis - A187 - Mauritania A. senegalensis - A305 - Senegal 74 99 A. senegalensis - A19 - Senegal A. senegalensis - A307 - Senegal 75 A. senegalensis - A306 - Senegal A. senegalensis - A201 - Mauritania A. dumerilii - A140 - Western Sahara A. dumerilii - A138 - Mauritania A. senegalensis - A186 - Mauritania A. dumerilii - A301 - Senegal A. dumerilii - A181 - Mauritania A. senegalensis - A202 - Western Sahara A. senegalensis - A155 - Western Sahara A. dumerilii - A183 - Mauritania A. dumerilii - A300 - Senegal A. dumerilii - A182 - Mauritania A. scutellatus audouini - A210 - Algeria A. scutellatus audouini - A103 - Tunisia 97 A. scutellatus audouini - A94 - Tunisia - A104 - Tunisia 74 99 A. scutellatus audouini 100 A. scutellatus audouini - A101 - Libya A. scutellatus audouini - A304 - Libya 87 95 A. scutellatus audouini - A93 - Tunisia A. scutellatus audouini - A96 - Tunisia clade A. scutellatus audouini - A83 - Tunisia 100 A. scutellatus audouini - A97 - Tunisia 92 A. scutellatus audouini - A95 - Tunisia A. scutellatus audouini - A92 - Libya 75 88 A. scutellatus audouini - A99 - Libya 99 A. scutellatus audouini - A102 - Libya 76 A. scutellatus audouini - A100 - Libya A. scutellatus audouini - A119 - Egypt 74 A. scutellatus audouini - A211 - Egypt A. scutellatus audouini - A27 - Egypt 99 A. scutellatus audouini - A29 - Egypt 93 A. scutellatus audouini - A222 - Mauritania A. scutellatus audouini - A223 - Mauritania A. scutellatus audouini - A224 - Morocco A. scutellatus audouini - A225 - Morocco A. dumerilii - A249 - Morocco A. scutellatus scutellatus - A212 - Egypt A. scutellatus scutellatus - A26 - Egypt A. scutellatus scutellatus - A24 - Egypt A. scutellatus scutellatus - A213 - Egypt 100 A. scutellatus scutellatus - A226 - Egypt A. scutellatus scutellatus - A217 - Egypt A. scutellatus scutellatus - A214 - Egypt A. scutellatus scutellatus - A216 - Egypt A. scutellatus scutellatus - A219 - Egypt A. scutellatus scutellatus - A221 - Egypt A. scutellatus scutellatus - A220 - Egypt A. scutellatus scutellatus - A218 - Egypt A. scutellatus scutellatus - A215 - Egypt A. scutellatus scutellatus - A8 - Israel A. scutellatus scutellatus - A9 - Israel A. scutellatus scutellatus - A13 - Israel A. scutellatus scutellatus - A20 - Israel A. scutellatus scutellatus - A68 - Israel 93 A. scutellatus scutellatus - A14 - Israel A. scutellatus scutellatus - A44 - Israel 97 A. scutellatus scutellatus - A65 - Israel A. scutellatus scutellatus - A6 - Israel A. scutellatus scutellatus - A42 - Israel A. scutellatus scutellatus - A11 - Israel A. hardyi - A273 - Kuwait 94 A. hardyi - A122 - Jordan A. hardyi - A247 - Jordan A. hardyi - A123 - Jordan 100 A. micropholis - A67 - Pakistan - A150 - Iran micropholis group 89 A. micropholis 100 A. harranensis - A151 - Turkey A. grandis - A241 - Syria grandis group 77 93 A. grandis - A243 - Syria 100 A. grandis - A192 - Jordan A. grandis - A242 - Syria 99 A. schmidti - A195 - Jordan 98 74 A. schmidti - A228 - UAE 74 A. schmidti - A51 - Oman 97 A. blanfordii - A208 - Iran blanfordi 74 A. blanfordii - A207 - Iran group 100 A. blanfordii - A291 - UAE A. blanfordii - A290 - Oman 84 A. blanfordii - A59 - Oman A. cantoris - A178 - Pakistan 100 A. cantoris - A287 - Pakistan 70 A. cantoris - A286 - Pakistan 100 A. masirae - A63 - Oman 70 A. masirae - A48 - Oman A. masirae - A50 - Oman cantoris A. haasi - A302 - Oman 100 A. tilburyi - A251 - Jordan group A. tilburyi - A250 - Jordan A. gongrorhynchatus - A128 - UAE 100 A. arabicus - A77 - Yemen 100 A. arabicus - A84 - Yemen A. arabicus - A72 - Yemen 84 A. felicis - A197 - Oman A. felicis - A31 - Oman 100 A. felicis - A162 - Oman A. felicis - A32 - Oman 75 A. felicis - A163 - Oman A. felicis - A164 - Oman 89 A. felicis - A165 - Oman A. felicis - A30 - Oman A. felicis - A34 - Oman opheodurus 93 A. opheodurus - A209 - UAE A. opheodurus - A303 - Oman group 100 100 A. opheodurus - A69 - Israel A. opheodurus - A288 - Israel 99 A. opheodurus - A35 - Oman A. opheodurus - A38 - Oman 100 A. opheodurus - A25 - Israel A. opheodurus - A33 - Israel A. opheodurus - A194 - Jordan 71 A. opheodurus - A193 - Jordan A. opheodurus - A79 - Jordan A. boskianus asper - A256 - Syria 100 A. boskianus asper - A240 - Syria A. boskianus asper - A255 - Syria A. boskianus asper - A239 - Syria A. boskianus asper - A257 - Syria A. schreiberi schreiberi - A229 - Cyprus 100 A. schreiberi schreiberi - A70 - Cyprus Eastern 100 A. schreiberi schreiberi - A289 - Cyprus A. schreiberi schreiberi - A118 - Cyprus A. schreiberi schreiberi - A230 - Cyprus 95 A. schreiberi ataturi - A199 - Turkey A. schreiberi ataturi - A198 - Turkey A. boskianus asper - A231 - Oman 98 A. boskianus asper - A191 - Jordan 95 A. boskianus asper - A294 - UAE A. boskianus asper - A115 - Oman A. boskianus asper - A149 - Oman A. boskianus asper - A293 - Oman A. boskianus asper - A168 - Egypt 84 97 A. boskianus asper - A148 - Sudan A. boskianus asper - A120 - Egypt 100 A. boskianus asper - A172 - Egypt A. boskianus asper - A285 - Niger A. boskianus nigeriensis - A298 - Niger clade 100 79 A. boskianus nigeriensis - A299 - Niger A. boskianus asper - A158 - Morocco A. boskianus asper - A109 - Algeria A. boskianus asper - A175 - Morocco 100 A. boskianus asper - A160 - Morocco A. boskianus asper - A147 - Morocco 96 A. boskianus asper - A161 - Morocco 100 A. boskianus asper - A176 - Tunisia A. boskianus asper - A110 - Tunisia 91 A. boskianus asper - A157 - Tunisia A. boskianus asper - A154 - Tunisia 77 A. boskianus khattensis - A296 - Mauritania 100 A. boskianus khattensis - A297 - Mauritania 75 A. boskianus khattensis - A295 - Mauritania A. boskianus asper - A108 - Libya 93 A. boskianus asper - A234 - Morocco 99 A. boskianus asper - A235 - Morocco A. boskianus asper - A236 - Western Sahara A. boskianus asper - A174 - Mauritania 99 A. boskianus asper - A173 - Mauritania A. boskianus asper - A114 - Jordan boskianus 100 A. boskianus asper - A106 - Yemen A. boskianus asper - A156 - Yemen group A. boskianus asper - A232 - Oman 100 A. boskianus asper - A117 - Oman A. boskianus asper - A159 - Oman 95 A. boskianus asper - A116 - Oman A. boskianus asper - A169 - Egypt 72 91 A. boskianus asper - A292 - Egypt A. boskianus asper - A167 - Egypt A. schreiberi syriacus - A15 - Israel 97 A. schreiberi syriacus - A274 - Israel 100 A. schreiberi syriacus - A153 - Lebanon 99 A. schreiberi syriacus - A152 - Lebanon A. schreiberi syriacus - A62 - Israel A. schreiberi syriacus - A57 - Israel 100 A. schreiberi syriacus - A21 - Israel A. schreiberi syriacus - A121 - Israel A. boskianus asper - A107 - Yemen A. schreiberi syriacus - A4 - Israel 100 A. schreiberi syriacus - A205 - Israel A. schreiberi syriacus - A5 - Israel 97 A. schreiberi syriacus - A204 - Israel A. boskianus asper - A203 - Israel A. boskianus asper - A66 - Israel A. boskianus asper - A279 - Israel A. boskianus asper - A64 - Israel A. boskianus asper - A190 - Egypt A. boskianus asper - A105 - Egypt A. boskianus asper - A112 - Egypt A. boskianus asper - A111 - Egypt A. boskianus asper - A170 - Egypt A. boskianus asper - A177 - Egypt A. boskianus asper - A113 - Jordan A. boskianus asper - A206 - Israel A. boskianus asper - A282 - Israel A. boskianus asper - A76 - Israel A. boskianus asper - A73 - Israel A. boskianus asper - A78 - Israel A. boskianus asper - A28 - Israel A. boskianus asper - A238 - Jordan A. boskianus asper - A233 - Jordan A. boskianus asper - A18 - Israel A. boskianus asper - A12 - Israel A. boskianus asper - A80 - Israel A. boskianus asper - A281 - Israel A. boskianus asper - A237 - Jordan 0.06 A. boskianus asper - A171 - Egypt A. guineensis - A275 - Niger * A. boueti - A276 - Benin * (a) A. tristrami - A196 - Jordan * A. tristrami - A252 - Syria * A. orientalis - A244 - Syria tristrami A. orientalis - A246 - Syria * A. orientalis - A245 - Syria * group A. savignyi - A264 - Algeria* A. savignyi - A265 - Algeria * A. erythrurus belli - A124 - Morocco A. erythrurus belli - A56 - Morocco * A. blanci - A86 - Tunisia * Western A. blanci - A85 - Tunisia erythrurus A. lineomaculatus - A129* - Morocco A. erythrurus atlanticus - A60 - Morocco* A. erythrurus erythrurus - A125 - Spain * group A. erythrurus erythrurus - A126 - Spain * A. erythrurus belli - A61 - Morocco * A. erythrurus belli - A146 - Morocco* A. busacki - A263 - Morocco * A. busacki - A88 - Morocco * A. busacki - A89 - Morocco A. busacki - A87 - Morocco* A. busacki - A269 - Morocco A. busacki - A270 - Morocco A. busacki - A268 - Western Sahara* A. maculatus - A58 - Morocco * clade A. maculatus - A262 - Morocco * A. maculatus - A91 - Libya * A. beershebensis - A17 - Israel A. beershebensis - A74 - Israel A. beershebensis - A283 - Israel * A. beershebensis - A278 - Israel pardalis A. maculatus - A142 - Algeria A. pardalis - A227 - Egypt * A. pardalis - A55 - Egypt group A. pardalis - A41 - Egypt * A. pardalis - A54 - Egypt (b) A. maculatus - A81 - Morocco A. bedriagai - A189 - Tunisia A. maculatus - A144 - Tunisia* A. maculatus - A52 - Morocco A. maculatus - A49 - Morocco * A. maculatus - A259 - Algeria A. bedriagai - A258 - Algeria * A. maculatus - A90 - Morocco 200 A. maculatus - A143 - Morocco A. aureus - A43 - Morocco * A. aureus - A39 - Morocco A. aureus - A45 - Morocco * A. aureus - A188 - Morocco* 100 A. aureus - A22 - Western Sahara * A. aureus - A71 - Western Sahara * A. aureus - A184 - Mauritania A. aureus - A166 - Mauritania A. taghitensis - A267 - Algeria 50 A. longipes - A131 - Algeria * A. longipes - A139 - Mauritania* A. longipes - A179 - Mauritania A. longipes - A127 - Mauritania* A. aegyptius - A7 - Israel

A. aegyptius - A277 - Israel 20

A. aegyptius - A132 - Egypt N A. aegyptius - A134 - Egypt A. aegyptius - A133 - Egypt A. aegyptius - A23 - Israel

A. aegyptius - A10 - Israel 10 A. aegyptius - A36 - Israel * scutellatus A. aegyptius - A37 - Israel A. dumerilii - A46 - Morocco A. dumerilii - A249 - Morocco*

* 5 A. dumerilii - A3 - Algeria * A. dumerilii - A248 - Morocco A. senegalensis - A187 - Mauritania* A. senegalensis - A1 - Mauritania * A. senegalensis - A307 - Senegal A. senegalensis - A19 - Senegal - A305 - Senegal A. senegalensis * 2 A. senegalensis - A201 - Mauritania A. senegalensis - A186 - Mauritania A. dumerilii - A138 - Mauritania A. dumerilii - A183 - Mauritania A. dumerilii - A300 - Senegal * 1 A. dumerilii - A140 - Western Sahara A. dumerilii - A181 - Mauritania scutellatus A. dumerilii - A301 - Senegal group A. senegalensis - A155 - Western Sahara −0.30 −0.25 −0.20 −0.15 −0.10 −0.05 0.00 A. dumerilii - A182 - Mauritania

A. scutellatus scutellatus - A14 - Israel A. scutellatus scutellatus - A65 - Israel A. scutellatus scutellatus - A6 - Israel clade Time A. scutellatus scutellatus - A13 - Israel* A. scutellatus scutellatus - A8 - Israel A. scutellatus scutellatus - A13 - Israel A. scutellatus scutellatus - A214 - Egypt A. scutellatus scutellatus - A215 - Egypt A. scutellatus scutellatus - A216 - Egypt A. scutellatus scutellatus - A226 - Egypt A. scutellatus scutellatus - A26 - Egypt A. scutellatus scutellatus - A212 - Egypt A. scutellatus scutellatus - A214 - Egypt A. scutellatus audouini - A92 - Libya A. scutellatus audouini - A102 - Libya* A. scutellatus audouini - A99 - Libya A. scutellatus audouini - A224 - Morocco* A. scutellatus audouini - A222 - Mauritania* A. scutellatus audouini - A223 - Mauritania * A. scutellatus audouini - A119 - Egypt * A. scutellatus audouini - A29 - Egypt A. scutellatus audouini - A211 - Egypt A. scutellatus audouini - A27 - Egypt * A. scutellatus audouini - A210 - Algeria A. scutellatus audouini - A103 - Tunisia* A. scutellatus audouini - A94 - Tunisia A. scutellatus audouini - A104 - Tunisia* A. scutellatus audouini - A101 - Libya * A. scutellatus audouini - A93 - Tunisia A. scutellatus audouini - A96 - Tunisia * A. scutellatus audouini - A83 - Tunisia A. scutellatus audouini - A95 - Tunisia * A. scutellatus audouini - A97 - Tunisia A. micropholis - A150 - Iran * micropholis A. micropholis - A67 - Pakistan * A. harranensis - A151 - Turkey group A. grandis - A241 - Syria * A. grandis - A243 - Syria * grandis A. grandis - A242 - Syria * group A. grandis - A192 - Jordan* A. hardyi - A247 - Jordan A. hardyi - A273 - Kuwait * A. hardyi - A122 - Jordan * A. hardyi - A123 - Jordan * A. schmidti - A195 - Jordan * A. schmidti - A228 - UAE * A. schmidti - A51 - Oman * A. blanfordii - A208 - Iran * blanfordii A. blanfordii - A207 - Iran group A. blanfordii - A291 - UAE * A. blanfordii - A59 - Oman A. blanfordii - A290 - Oman A. masirae - A50 - Oman A. masirae - A48 - Oman * A. masirae - A63 - Oman A. cantoris - A287 - Pakistan A. cantoris - A286 - Pakistan * A. cantoris - A178 - Pakistan A. haasi - A302 - Oman * cantoris A. tilburyi - A250 - Jordan group (c) A. tilburyi - A251 - Jordan * A. gongrorhynchatus - A128 - UAE * A. arabicus - A77 - Yemen * A. arabicus - A84 - Yemen A. arabicus - A72 - Yemen * A. felicis - A197 - Oman A. felicis - A162 - Oman *

A. felicis - A31 - Oman 1750 A. felicis - A34 - Oman A. felicis - A164 - Oman A. felicis - A163 - Oman A. felicis - A30 - Oman *

A. felicis - A165 - Oman 1745 A. opheodurus - A303 - Oman * opheodurus A. opheodurus - A209 - UAE group A. opheodurus - A38 - Oman A. opheodurus - A35 - Oman * A. opheodurus - A288 - Israel

* 1740 A. opheodurus - A25 - Israel * A. opheodurus - A194 - Jordan Eastern A. opheodurus - A193 - Jordan A. opheodurus - A79 - Jordan A. boskianus asper - A256 - Syria elihood A. boskianus asper - A257 - Syria 1735 A. schreiberi schreiberi - A229 - Cyprus*

A. schreiberi schreiberi - A289 - Cyprus li k A. schreiberi schreiberi - A118 - Cyprus * A. schreiberi ataturi - A198 - Turkey * A. schreiberi schreiberi - A230 - Cyprus 1730 A. boskianus asper - A231 - Oman * A. boskianus asper - A191 - Jordan A. boskianus asper - A115 - Oman * A. boskianus asper - A294 - UAE clade

A. boskianus asper - A149 - Oman 1725 A. boskianus asper - A293 - Oman * A. boskianus asper - A158 - Morocco A. boskianus asper - A109 - Algeria * A. boskianus asper - A175 - Morocco*

A. boskianus asper - A160 - Morocco 1720 A. boskianus asper - A161 - Morocco * A. boskianus asper - A168 - Egypt * A. boskianus asper - A285 - Niger * A. boskianus nigeriensis - A299 - Niger A. boskianus asper - A148 - Sudan A. boskianus asper - A172 - Egypt * 1715 A. boskianus asper - A120 - Egypt −0.30 −0.25 −0.20 −0.15 −0.10 −0.05 0.00 A. boskianus asper - A110 - Tunisia A. boskianus asper - A176 - Tunisia* A. boskianus asper - A108 - Libya * A. boskianus asper - A154 - Tunisia * Time A. boskianus khattensis - A296 - Mauritania A. boskianus khattensis - A295 - Mauritania * A. boskianus asper - A234 - Morocco A. boskianus asper - A235 - Morocco A. boskianus asper - A236 - Western Sahara* boskianus A. boskianus asper - A174 - Mauritania A. boskianus asper - A173 - Mauritania * group A. boskianus asper - A114 - Jordan A. boskianus asper - A106 - Yemen * A. boskianus asper - A156 - Yemen A. boskianus asper - A159 - Oman * A. boskianus asper - A232 - Oman * A. boskianus asper - A169 - Egypt * A. boskianus asper - A292 - Egypt * A. boskianus asper - A167 - Egypt A. schreiberi syriacus - A15 - Israel A. schreiberi syriacus - A152 - Lebanon A. schreiberi syriacus - A62 - Israel A. schreiberi syriacus - A57 - Israel * A. schreiberi syriacus - A121 - Israel A. schreiberi syriacus - A21 - Israel A. boskianus asper - A107 - Yemen A. boskianus asper - A177 - Egypt * A. schreiberi syriacus - A4 - Israel A. schreiberi syriacus - A5 - Israel A. boskianus asper - A238 - Jordan* A. boskianus asper - A114 - Jordan A. boskianus asper - A206 - Israel A. boskianus asper - A28 - Israel * A. boskianus asper - A78 - Israel A. boskianus asper - A233 - Jordan A. boskianus asper - A279 - Israel A. boskianus asper - A203 - Israel A. boskianus asper - A190 - Egypt A. boskianus asper - A170 - Egypt A. boskianus asper - A112 - Egypt A. boskianus asper - A105 - Egypt Pssamodromus algirus 1.1 Pssamodromus algirus 18.7 8.1 Gallotia stehlini 1.4 Gallotia atlantica atlantica Gallotia atlantica mahoratae 9.8 Gallotia intermedia 3.4 Gallotia gomerana 7.3 0.7 Gallotia simonyi machadoi 0.7 Gallotia caesaris gomerae 4.1 Gallotia caesaris caesaris 1.1 Gallotia galloti palmae Gallotia galloti galloti 0.3 Gallotia galloti eisentrauti 0.5 Podarcis peloponnesiacus 47.7 5.3 Podarcis peloponnesiacus 0.4 Podarcis cretensis 13.1 Podarcis cretensis 1.9 Podarcis lilfordi 5.3 Podarcis lilfordi 0.7 Podarcis pityusensis Podarcis pityusensis A. guineensis - A275 - Niger 3.7 A. tristrami - A196 - Jordan 8.2 A. tristrami - A252 - Syria A. orientalis - A244 - Syria tristrami 41.5 4.3 A. orientalis - A246 - Syria group 1.6 A. orientalis - A245 - Syria 19.4 A. boueti - A276 - Benin Western A. savignyi - A264 - Algeria A. erythrurus - A124 - Morocco 17.8 6 A. erythrurus - A56 - Morocco 7.9 A. blanci - A85 - Tunisia erythrurus - A60 - Morocco 16.3 A. erythrurus group 6.8 3.2 A. lineomaculatus - A129 - Morocco 1.9 A. erythrurus - A125 - Spain 33.3 4.5 A. erythrurus - A126 - Spain 3.8 A. erythrurus - A61 - Morocco 14.8 3.3 A. erythrurus - A146 - Morocco clade A. busacki - A270 - Morocco 4.7 A. busacki - A89 - Morocco 0.7 A. busacki - A263 - Morocco A. beershebensis - A283 - Israel 6.2 4 A. maculatus - A262 - Morocco 0.8 A. maculatus - A58 - Morocco pardalis 4.8 A. pardalis - A41 - Egypt 1.9 A. maculatus - A142 - Algeria group A. maculatus - A91 - Libya 4.3 A. bedriagai - A189 - Tunisia 3.9 A. maculatus - A49 - Morocco 29.9 3.3 2 A. maculatus - A143 - Morocco 1.6 A. maculatus - A259 - Algeria A. taghitensis - A267 - Algeria 10.2 2.2 A. aureus - A39 - Morocco 3.4 A. aureus - A45 - Morocco A. aureus - A71 - Western Sahara scutellatus 2.1 A. aureus - A22 - Western Sahara A. aegyptius - A10 - Israel 14.6 3.6 A. longipes - A179 - Mauritania 1.7 A. longipes - A131 - Algeria A. scutellatus audouini - A210 - Algeria 4.5 A. scutellatus scutellatus - A6 - Israel 9.8 3.2 A. scutellatus audouini - A94 - Tunisia 5.8 A. scutellatus audouini - A93 - Tunisia 3.2 A. scutellatus audouini - A101 - Libya 2.3 A. scutellatus audouini - A95 - Tunisia scutellatus 7.5 1.5 A. scutellatus audouini - A99 - Libya group A. scutellatus audouini - A92 - Libya A. scutellatus audouini - A223 - Mauritania 2.1 1 A. scutellatus audouini - A119 - Egypt clade 0.8 A. scutellatus audouini - A211 - Egypt 6.2 A. scutellatus audouini - A224 - Morocco - A3 - Algeria 26.9 2.4 A. dumerilii 4.7 A. dumerilii - A248 - Morocco 1 A. dumerilii - A249 - Morocco 3.5 A. dumerilii - A46 - Morocco A. senegalensis - A187 - Mauritania 2.9 1.4 A. dumerilii - A300 - Senegal 0.9 A. senegalensis - A305 - Senegal A. hardyi - A247 - Jordan 4.8 A. hardyi - A123 - Jordan 12.6 3 A. hardyi - A273 - Kuwait 3.6 A. blanfordii - A291 - UAE 6 A. blanfordii - A208 - Iran blanfordii A. schmidti - A195 - Jordan group 3.5 A. schmidti - A51 - Oman 1.7 A. schmidti - A228 - UAE 3.2 A. micropholis - A67 - Pakistan micropholis A. micropholis - A150 - Iran group 10.2 15.3 3.4 A. grandis - A242 - Syria 8.9 A. grandis - A243 - Syria grandis 1.4 A. grandis - A241 - Syria group A. harranensis - A151 - Turkey 7.4 A. masirae - A50 - Oman 14.4 A. cantoris - A286 - Pakistan A. gongrorhynchatus - A128 - UAE cantoris 12.6 9.9 A. tilburyi - A251 - Jordan group 10.8 A. haasi - A302 - Oman 4.3 A. arabicus - A77 - Yemen 9.1 A. arabicus - A84 - Yemen Eastern 0.8 A. felicis - A30 - Oman 14 7.7 A. felicis - A162 - Oman A. opheodurus - A25 - Israel opheodurus 2.4 A. opheodurus - A288 - Israel group 1.9 A. opheodurus - A38 - Oman 9.9 1.5 A. opheodurus - A303 - Oman

A. boskianus asper - A257 - Syria clade 0.7 A. schreiberi ataturi - A198 - Turkey A. schreiberi schreiberi - A289 - Cyprus A. boskianus asper - A114 - Jordan 7.1 A. boskianus asper - A159 - Oman 4 2.4 A. boskianus asper - A107 - Yemen 1 - A156 - Yemen 6.2 A. boskianus asper 1.7 A. boskianus asper - A28 - Israel 3.7 A. schreiberi syriacus - A5 - Israel 3 A. schreiberi syriacus - A57 - Israel 2.6 A. boskianus asper - A292 - Egypt 4.8 1.7 A. boskianus asper - A169 - Egypt A. boskianus asper - A231 - Oman 2.6 A. boskianus asper - A149 - Oman boskianus 1.5 A. boskianus asper - A191 - Jordan group A. boskianus asper - A168 - Egypt 4.5 2.9 A. boskianus asper - A148 - Sudan 1.3 A. boskianus asper - A285 - Niger 3.9 A. boskianus asper - A158 - Morocco A. boskianus asper - A161 - Morocco 3.5 A. boskianus asper - A109 - Algeria 3.4 A. boskianus asper - A110 - Tunisia 3.1 A. boskianus asper - A154 - Tunisia 3 1.9 A. boskianus khattensis - A295 - Mauritania 2.6 A. boskianus asper - A108 - Libya 2 A. boskianus asper - A235 - Morocco 5.0 0.9 A. boskianus asper - A174 - Mauritania

60 50 40 30 20 10 0 Mya Table S1. Data on the specimens sampled and related GenBank accession numbers used in this study. Codes correspond to localities presented in Figs. 2-4; (a) haplotypes (n=235); (b) GMYC representatives (n=111).

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A132 a A. aegyptius Egypt 5.5 km NW. to Bir Qatia, Sinai KX296855 KX297105 KX297244 KX297530 KX297713 A133 a A. aegyptius Egypt 17 km NW. to Bir Qatia, Sinai KX296856 KX297109 KX297247 KX297531 KX297714 A134 a A. aegyptius Egypt Zaraniq, Sinai KX296857 KX297106 KX297248 KX297532 KX297715 A135 A. aegyptius Egypt Zaraniq, Sinai KX296858 KX297107 KX297251 KX297533 KX297716 A136 A. aegyptius Egypt Zaraniq, Sinai KX296859 KX297108 KX297252 KX297534 KX297717 A10 a b A. aegyptius Israel Bir Mashash sands KX296863 KX297112 KX297249 KX297536 KX297718 A23 a A. aegyptius TAU.R16365 Israel Bir Mashash sands KX296861 KX297113 KX297253 KX297539 KX297719 A36 a A. aegyptius TAU.R16400 Israel Bir Mashash sands KX296864 KX297114 KX297254 KX297537 KX297720 A37 a A. aegyptius Israel Ashelim KX296865 KX297115 KX297250 KX297538 KX297721 A7 a A. aegyptius TAU.R16331 Israel Ashelim KX296862 KX297111 KX297246 KX297535 KX297722 A277 a A. aegyptius TAU.R16161 Israel Shivta junction KX296860 KX297110 - - - A72 a A. arabicus MVZ:Herp236580 Yemen Lahij, Bir Nasr Farm, 3 km SW. (by air) of Sabir KX296920 KX297031 - - - A77 a b A. arabicus MCCI-R819 Yemen Bir Ali KX296922 KX297033 - - - A84 a b A. arabicus MCCI-R820(1) Yemen Tor Albaha KX296921 KX297032 - - - A166 a A. aureus Mauritania Nouadhibou - KX297116 KX297261 KX297521 KX297728 A184 a A. aureus Mauritania Between Nouadhibou and Bou Lanouar KX296866 KX297117 KX297263 KX297525 KX297729 A188 a A. aureus Morocco Sidi Rbat (near Agadir) KX296868 KX297119 KX297264 KX297522 KX297731 A39 a b A. aureus Morocco Plage Blanche KX296870 KX297121 KX297245 KX297523 KX297732 A43 a A. aureus Morocco Tan-Tan beach KX296871 KX297122 KX297266 KX297524 KX297733 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A45 a b A. aureus IBES1371 Morocco Aglou-Plage KX296869 KX297120 KX297267 KX297526 KX297734 A22 a b A. aureus TR4086 Western Sahara 76 km S. to the turn to Dakhla KX296872 - - - - A71 a b A. aureus TR4112 Western Sahara 155 km N. of Nouadhibou KX296867 KX297118 KX297262 KX297528 KX297730 A258 a b A. bedriagai Algeria Djelfa KX296941 KX297144 KX297325 KX297447 KX297647 A189 a b A. bedriagai Tunisia Roman Ruins Bou Chebka-Haidra KX296948 KX297153 KX297346 KX297446 KX297628 A283 a b A. beershebensis Israel 3 km S. of Ofakim KX296956 KX297158 KX297327 KX297451 KX297620 A75 A. beershebensis Israel 3 km S. of Ofakim KX296958 KX297159 - - - A280 A. beershebensis Israel E. to park Arad KX296954 KX297156 - - - A74 a A. beershebensis Israel E. to park Arad KX296955 KX297157 KX297328 KX297452 KX297621 A40 A. beershebensis HUJ.R19192 Israel Hanegev junction KX296961 KX297164 - KX297449 KX297617 A53 A. beershebensis HUJ.R19261 Israel Hanegev junction KX296963 KX297166 KX297326 KX297450 KX297619 A17 a A. beershebensis TAU.R16012 Israel Nahal Hed KX296960 KX297163 KX297342 KX297453 KX297622 A2 A. beershebensis TAU.R16396 Israel Nahal Hed KX296959 KX297161 KX297329 KX297456 KX297616 A47 A. beershebensis TAU.R16017 Israel Nahal Hed KX296962 KX297165 KX297330 KX297455 KX297618 A278 a A. beershebensis Israel Nahal Tzavoa KX296964 KX297160 - - - A284 A. beershebensis Israel NW. to road 40 KX296957 KX297162 - - - A85 a b A. blanci MCCI-R1321(1) Tunisia Jebel Tamesmida KX296930 KX297133 KX297313 KX297415 KX297599 A86 a A. blanci MCCI-R1325(1) Tunisia Jebel Semmama KX296931 KX297134 KX297314 KX297416 KX297600 A207 a A. blanfordii MVZ:Herp234464 Iran 6 km NW. of Bampur, Balluchestan KJ567754 KJ567846 KJ548101 KJ547929 KJ548020 A208 a b A. blanfordii MVZ:Herp246009 Iran Sand Dunes 7 km N. of Bampur, Balluchestan KJ567755 KJ567847 KJ548102 KJ547930 KJ548021 A59 a A. blanfordii Oman Al Azaiba KX296907 KX297018 KX297306 KX297381 KX297577 A290 a A. blanfordii Oman 2 km SW. of Suadi Al Batha KX296906 KX297017 KX297305 KX297380 KX297575 A291 a b A. blanfordii UAE Kalba mangroves KX296905 KX297016 KX297304 KX297379 KX297574 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A109 a b A. boskianus asper MCCI-R471 Algeria Tassili 'n' Ajjer KJ567694 KJ567812 KJ548037 KJ547885 KJ547987 A292 a b A. boskianus asper ZFMK77460 Egypt Rasheed KX296878 KX296995 KX297273 KX297371 KX297557 A171 A. boskianus asper Egypt El Arish, Sinai KJ567676 KJ567776 KJ548044 KJ547854 KJ548003 A167 a A. boskianus asper Egypt Baluza, Sinai KJ567727 KJ567790 KJ548063 KJ547852 KJ548014 A105 a A. boskianus asper MCCI-R1566 Egypt Between SerAit el Khadim to Gebel RaqAa, Sinai KJ567672 KJ567768 KJ548035 KJ547849 KJ547966 A190 a A. boskianus asper Egypt 14 km SW. of Nuweibaa, Sinai KJ567693 KJ567773 KJ548057 KJ547856 KJ547951 A112 a A. boskianus asper MCCI-R1568 Egypt Gebel Gunna, Sinai KJ567690 KJ567771 KJ548038 KJ547851 KJ547950 A170 a A. boskianus asper Egypt St. Catherine, Sinai KJ567751 KJ567772 KJ548043 KJ547853 KJ547964 A111 A. boskianus asper MCCI-R1567 Egypt Crossroad St. Catherine to Fox camp, Sinai KJ567689 KJ567770 KJ548056 KJ547886 KJ547982 A177 a A. boskianus asper Egypt Sharm el Sheikh, Sinai - KJ567774 KJ548047 KJ547855 KJ547965 A168 a b A. boskianus asper Egypt Matruh KJ567728 KJ567824 KJ548042 KJ547910 - A169 a b A. boskianus asper Egypt Sidi Brani KJ567729 KJ567813 KJ548068 KJ547872 KJ548015 A172 a A. boskianus asper Egypt Wadi El Natrun KJ567699 KJ567822 KJ548079 KJ547887 KJ547986 A120 a A. boskianus asper Egypt 60 km E. of Idfu KJ567698 - KJ548039 KJ547870 KJ547969 A279 a A. boskianus asper TAU.R16058 Israel Wadi Revivim KJ567673 KJ567767 KJ548051 KJ547911 KJ547952 A66 A. boskianus asper TAU.R16160 Israel Shivta junction KJ567671 KJ567765 KJ548033 KJ547879 KJ547949 A282 A. boskianus asper TAU.R16295 Israel Kmehin KJ567682 KJ567780 KJ548053 KJ547932 KJ547954 A64 A. boskianus asper Israel Rotem plain KJ567670 KJ567764 KJ548078 KJ547875 KJ547945 A203 a A. boskianus asper HUJ.R24055 Israel S. of Wadi Zafit KJ567691 KJ567766 - - - A76 A. boskianus asper TAU.R16274 Israel Mt. Tzin KJ567674 KJ567775 KJ548034 KJ547880 KJ547946 A73 A. boskianus asper TAU.R16013 Israel Mitzpe Ramon KJ567686 KJ567783 KJ548058 KJ547864 KJ547962 A78 a A. boskianus asper TAU.R16001 Israel Mitzpe Ramon KJ567692 KJ567784 KJ548061 KJ547874 KJ547963 A80 A. boskianus asper TAU.R16002 Israel Mitzpe Ramon KJ567687 KJ567785 KJ548060 KJ547865 KJ547957 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A281 A. boskianus asper TAU.R16272 Israel Wadi Nekarot KJ567681 KJ567779 KJ548052 KJ547892 KJ547953 A206 a A. boskianus asper HUJ.R19646 Israel Paran KJ567677 KJ567787 - - - A12 A. boskianus asper Israel Wadi Paran KJ567683 KJ567781 KJ548059 KJ547861 KJ547955 A18 A. boskianus asper Israel Wadi Paran KJ567684 KJ567782 KJ548064 KJ547884 KJ547956 A28 a b A. boskianus asper Israel Wadi Paran KJ567685 KJ567789 KJ548028 KJ547862 KJ547960 A191 a b A. boskianus asper Jordan Tell al Heber KJ567733 KJ567830 KJ548067 KJ547883 KJ547974 A233 a A. boskianus asper Jordan Petra KJ567679 KJ567777 KJ548048 KJ547858 KJ547958 A237 A. boskianus asper NMP6V70481-2 Jordan Petra KJ567680 KJ567778 - KJ547881 KJ547959 A238 a A. boskianus asper NMP6V70481-3 Jordan Petra KJ567688 KJ567788 - KJ547908 KJ547961 A113 a A. boskianus asper MCCI-R618 Jordan Petra KJ567675 KJ567786 - - - A114 a b A. boskianus asper MCCI-R621 Jordan Wadi Ramm KJ567730 KJ567826 - KJ547876 KJ547988 A108 a b A. boskianus asper MCCI-R1452(1) Libya Wadi Mathkendush KJ567736 KJ567805 KJ548036 KJ547850 KJ547967 A173 a A. boskianus asper Mauritania Between Zouerat to Bir Moghrein KJ567710 KJ567807 KJ548045 KJ547894 KJ547983 A174 a b A. boskianus asper Mauritania Between Zouerat to Bir Moghrein KJ567714 KJ567808 KJ548030 KJ547895 KJ547973 A158 a b A. boskianus asper MCCI-R1088(4) Morocco Between Saidia to Moulouya KJ567735 KJ567825 KJ548041 KJ547878 KJ547984 A160 a A. boskianus asper NMP6V74482 Morocco Between Ait-Khoujman to Kerrandou KJ567716 KJ567819 KJ548062 - KJ548001 A161 a b A. boskianus asper NMP6V74483-1 Morocco Rissani KJ567717 KJ567818 KJ548054 KJ547882 KJ547985 A147 A. boskianus asper NMP6V74483-2 Morocco Rissani KJ567715 KJ567817 - - - A175 a A. boskianus asper Morocco Ouarzazate KJ567718 KJ567820 KJ548046 KJ547897 KJ548002 A234 a A. boskianus asper Morocco 6.5 km E. of Oum El-Alek KJ567711 KJ567810 KJ548049 KJ547898 KJ547976 A235 a b A. boskianus asper Morocco Akka KJ567713 KJ567811 KJ548069 KJ547899 KJ547977 A285 a b A. boskianus asper MVZ:Herp238925 Niger Tafokin, 13 km NNE. of Agadez KJ567701 KJ567823 KJ548086 KJ547860 KJ548000 A115 a A. boskianus asper Oman 2 km S. of Lizq KJ567731 KJ567827 KJ548087 KJ547912 KJ547968 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A231 a b A. boskianus asper Oman Nizwa KJ567678 KJ567829 KJ548089 KJ547914 KJ547975 A149 a b A. boskianus asper Oman 10 km SE. of Kubarah KJ567732 KJ567828 KJ548088 KJ547913 KJ547971 A117 A. boskianus asper Oman 16 km S. of Duqm KJ567707 KJ567802 KJ548091 KJ547905 KJ547990 A116 A. boskianus asper MCCI-R1773(1) Oman Wadi Salit KJ567706 KJ567801 KJ548090 KJ547903 KJ547989 A159 a b A. boskianus asper MCCI-R1773(2) Oman Wadi Salit KJ567708 KJ567803 KJ548092 KJ547906 KJ547991 A232 a A. boskianus asper Oman 4 km N. of Rawiyyah KJ567709 KJ567804 KJ548093 KJ547904 KJ547992 A293 a A. boskianus asper IBECN866 Oman Miskin KX296879 - KX297274 KX297372 KX297554 A294 a A. boskianus asper IBECN9004 Oman Near Dubai KX296880 KX296996 KX297275 KX297373 KX297555 A148 a b A. boskianus asper Sudan N. of El-Koin KJ567700 KJ567821 KJ548040 KJ547877 KJ547970 A256 a A. boskianus asper NMP6V70450-2 Syria Ar Raqqah KJ567747 KJ567842 KJ548032 KJ547915 KJ548012 A257 a b A. boskianus asper NMP6V70470-1 Syria Ar Raqqah KJ567748 KJ567841 KJ548080 KJ547889 KJ548013 A239 A. boskianus asper NMP6V72502-1 Syria Qasr al Hayr al Gharbi KJ567744 KJ567838 KJ548031 KJ547890 KJ548009 A240 A. boskianus asper NMP6V72502-2 Syria Qasr al Hayr al Gharbi KJ567745 KJ567839 KJ548055 KJ547888 KJ548010 A255 A. boskianus asper NMP6V70443 Syria Sadad KJ567746 KJ567840 - KJ547891 KJ548011 A110 a b A. boskianus asper MCCI-R1326(1) Tunisia NE. slopes of Jebel Semmama KJ567695 KJ567814 KJ548085 KJ547893 KJ548004 A157 A. boskianus asper MCCI-R1326(2) Tunisia NE. slopes of Jebel Semmama KJ567696 KJ567815 - - - A176 a A. boskianus asper Tunisia Hammat al-Jarid KJ567697 KJ567816 KJ548070 KJ547909 KJ548005 A154 a b A. boskianus asper MCCI-R1346(2) Tunisia 33 km S. of Tataouine KJ567702 KJ567806 KJ548081 KJ547907 KJ547972 A236 a A. boskianus asper Western Sahara Laayoune KJ567712 KJ567809 KJ548050 KJ547896 KJ547978 A156 a b A. boskianus asper MCCI-R823(3) Yemen Sa'yun oasis KJ567705 KJ567800 KJ548066 KJ547902 KJ547981 A106 a A. boskianus asper MCCI-R823(4) Yemen Sa'yun oasis KJ567703 KJ567799 KJ548065 KJ547900 KJ547980 A107 a b A. boskianus asper MCCI-R824 Yemen Dunes W. of Shibam KJ567704 KJ567769 - KJ547901 KJ547979 A295 a b A. boskianus kattensis TR4287 Mauritania Near Akjoujt KX296875 KX296992 KX297270 KX297369 KX297556 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A296 a A. boskianus kattensis TR4288 Mauritania Near Akjoujt KX296877 KX296993 KX297271 KX297401 KX297552 A297 A. boskianus kattensis TR4289 Mauritania Near Akjoujt KX296876 KX296994 KX297272 KX297370 KX297553 A298 A. boskianus nigeriensis TR1566 Niger Karosofoua - KX296990 - KX297366 KX297550 A299 a A. boskianus nigeriensis TR1567 Niger Karosofoua - KX296991 - KX297367 KX297551 A276 a b A. boueti TR3244 Benin Guiguisso KX296974 KX297186 - KX297542 KX297614 A263 a b A. busacki Morocco 1 km N. of Bou Soun KX296968 KX297170 KX297348 KX297430 KX297626 A269 a A. busacki BEV.10869 Morocco 39 km S. of El Quatia KX296967 KX297168 KX297339 KX297432 KX297646 A270 a b A. busacki BEV.10829 Morocco Akhfennir KX296966 KX297169 KX297332 KX297433 KX297645 A271 A. busacki BEV.9440 Morocco 3 km S. of Ain Nekhla KX296969 KX297171 - - KX297630 A272 A. busacki BEV.9439 Morocco Park Massa, near Sidi Binzarne KX296970 KX297172 KX297349 KX297434 KX297627 A87 a A. busacki MCCI-R560 Morocco Between Inchaden and Tifnite KX296971 KX297173 KX297336 KX297435 KX297636 A88 a A. busacki MCCI-R561 Morocco Souss valley, Biougra KX296972 KX297174 KX297337 KX297436 KX297629 A89 a b A. busacki MCCI-R562 Morocco Souss valley, Biougra KX296973 KX297175 KX297350 KX297437 KX297624 A268 a A. busacki BEV.10877 Western Sahara 104 km NNW. of Dakhla KX296965 KX297167 KX297338 KX297431 KX297644 A178 a A. cantoris Pakistan KX296908 - KX297302 KX297374 KX297592 A286 a b A. cantoris MVZ:Herp248443 Pakistan 10 km S. of Uthal, Las Bela, Baluchistan KJ567756 KJ567850 KJ548096 KJ547922 KJ548018 A287 a A. cantoris MVZ:Herp248447 Pakistan 45 km NW. of Nagar Parkar, Thar Parkar KJ567757 KJ567851 KJ548097 KJ547923 KJ548019 A3 a b A. dumerilii TR4025 Algeria Near Taghit KX296800 KX297052 KX297219 - KX297691 A138 a A. dumerilii Mauritania 15 km NE. of Oued Choum (Adrar) KX296789 KX297043 KX297202 KX297471 KX297658 A181 a A. dumerilii Mauritania 35 km S. of Bennichchab (Inchiri) KX296792 KX297038 KX297197 KX297474 KX297660 A182 a A. dumerilii Mauritania 60 km S. of Zouerat (Tiris Zemmour) KX296784 KX297039 KX297194 KX297475 KX297659 A183 a A. dumerilii Mauritania 65 km S. of Atar (Adrar) KX296785 KX297040 KX297199 KX297478 KX297661 A248 a b A. dumerilii NMP6V74299-1 Morocco Mhamid KX296796 KX297051 KX297213 KX297482 KX297694 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A249 a b A. dumerilii NMP6V74299-2 Morocco Mhamid KX296795 - KX297214 KX297483 KX297663 A46 a b A. dumerilii IBES1342 Morocco 15 km N. of Merzouga KX296799 KX297053 KX297215 KX297473 KX297727 A300 a b A. dumerilii TR4282 Senegal Saint Louis KX296782 KX297034 KX297192 KX297460 KX297650 A301 a A. dumerilii TR4283 Senegal Saint Louis KX296783 KX297042 KX297193 - KX297651 A140 a A. dumerilii Western Sahara Tifariti KX296790 KX297035 KX297200 KX297529 KX297656 A60 a b A. erythrurus atlanticus IBES2898 Morocco Azrou KX296932 KX297135 KX297318 KX297411 KX297603 A124 a b A. erythrurus belli Morocco Sidi ifni KX296933 KX297136 KX297320 KX297413 KX297604 A56 a b A. erythrurus belli IBES2947 Morocco 3 km N. of Boulaajoul KX296929 KX297132 KX297301 KX297414 KX297597 A61 a b A. erythrurus belli Morocco Jebel Tazekka KX296924 KX297129 KX297319 KX297412 KX297598 A146 a b A. erythrurus belli Morocco Jebala (close to Chefchaouen) KX296923 KX297126 KX297311 KX297407 KX297594 A125 a b A. erythrurus erythrurus Spain Barbate KX296928 KX297127 KX297312 KX297408 KX297601 A126 a b A. erythrurus erythrurus Spain Darrical, Almeria KX296925 KX297128 KX297315 KX297419 KX297602 A162 a b A. felicis Oman Uyun pools KX296888 KX297012 KX297295 KX297394 KX297564 A31 a A. felicis IBES7898 Oman Uyun pools KX296883 KX297011 KX297294 KX297396 KX297573 A163 a A. felicis Oman Mirbat KX296885 KX297008 KX297296 KX297395 KX297565 A164 a A. felicis IBES7473 Oman Mirbat KX296886 KX297010 KX297300 KX297399 KX297569 A165 a A. felicis Oman Mirbat KX296887 KX297009 KX297297 KX297397 KX297566 A30 a b A. felicis IBES7733 Oman Mirbat KX296881 KX297005 KX297293 KX297391 KX297567 A34 a A. felicis Oman Mirbat KX296882 KX297007 KX297299 KX297393 KX297563 A32 A. felicis Oman Mirbat KX296884 KX297006 KX297298 KX297392 KX297568 A197 a A. felicis CAS227596 Oman 23 km W. of Ajdarawt KJ567734 KJ567845 KJ548100 KJ547928 KJ548008 A128 a b A. gongrorhynchatus UAE Al Ain KX296909 KX297125 KX297310 KX297459 KX297586 A192 a A. grandis Jordan Daheek KX296913 - KX297288 KX297375 KX297589 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A241 a b A. grandis NMP6V70442-1 Syria Sadad KX296918 KX297022 KX297286 KX297377 KX297582 A242 a b A. grandis NMP6V70498-2 Syria 5 km S. of Palmyra KX296914 KX297024 KX297289 KX297402 KX297590 A243 a b A. grandis NMP6V 70499-2 Syria 5 km SW. of Au Kemal KX296915 - KX297290 KX297368 KX297591 A275 a b A. guineensis TR4143 Niger Near Kollo KX296989 KX297178 - - - A302 a b A. haasi IBECN7491 Oman 88 km NW. of Haime KX296904 KX297030 KX297283 KX297405 KX297584 A122 a A. hardyi NMP6V 71353-2 Jordan E. of Al Hazim - KX297027 - KX297404 KX297579 A123 a b A. hardyi NMP6V 71353-3 Jordan E. of Al Hazim KX296900 KX297028 KX297291 KX297376 KX297580 A247 a b A. hardyi NMP6V 71352 Jordan Batn Al Ghul KX296902 - - - - A273 a b A. hardyi BEV.11053 Koweït 35 km SW. of Ratqa KX296901 KX297029 KX297292 KX297541 KX297581 A151 a b A. harranensis MCCI-R1057 Turkey Harran KX296919 KX297023 - - - A129 a b A. lineomaculatus Morocco Tangier KX296926 KX297130 KX297316 KX297409 KX297595 A130 A. lineomaculatus Morocco Tangier KX296927 KX297131 KX297317 KX297410 KX297596 A131 a b A. longipes Algeria Tinduf KX296854 KX297104 KX297257 KX297462 KX297711 A127 a A. longipes Mauritania Oued Choum (Adrar) KX296848 KX297098 KX297243 KX297461 KX297710 A137 A. longipes Mauritania Oued Choum (Adrar) KX296849 KX297099 KX297255 KX297463 KX297723 A139 a A. longipes Mauritania Oued Choum (Adrar) KX296853 KX297100 KX297256 KX297464 KX297724 A185 A. longipes Mauritania 65 km S. of Atar KX296852 KX297102 KX297260 KX297466 KX297726 A179 a b A. longipes Mauritania 55 km SW. of Tidjikja; 25 km S of Lekhcheb KX296850 KX297103 KX297258 KX297465 KX297725 A180 A. longipes Mauritania 55 km SW. of Tidjikja; 25 km S of Lekhcheb KX296851 KX297101 KX297259 KX297484 KX297712 A141 A. maculatus Algeria El Aricha KX296937 KX297137 KX297323 KX297427 KX297615 A142 a b A. maculatus Algeria El Aricha KX296938 KX297138 KX297324 KX297428 KX297623 A259 a b A. maculatus Algeria 25 km SE. of Elbayadh KX296942 KX297145 KX297351 KX297448 KX297643 A91 a b A. maculatus MCCI-R1456 Libya 5 km E. of Al Jawsh KX296951 KX297142 KX297341 KX297458 KX297625 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A58 a b A. maculatus IBES2958 Morocco 6 km N. of Erfoud KX296952 KX297149 KX297353 KX297457 KX297634 A143 a b A. maculatus Morocco El Aioun KX296940 KX297143 KX297340 KX297442 KX297649 A262 a b A. maculatus BEV.5510 Morocco North shore of Dayet Srji (near Merzouga) KX296953 KX297150 - - KX297635 A49 a b A. maculatus IBES1340 Morocco 10 km N. of Midelt KX296944 KX297147 KX297352 KX297443 KX297631 A52 a A. maculatus IBES2957 Morocco 3 km N. of Boulojou KX296945 KX297148 KX297343 KX297444 KX297632 A90 a A. maculatus MCCI-R1084 Morocco Tafrata plain KX296943 KX297146 - - KX297633 A144 a A. maculatus Tunisia Close to Kasserine KX296946 KX297151 KX297345 KX297429 KX297640 A145 A. maculatus Tunisia Close to Kasserine KX296947 KX297152 KX297347 KX297445 KX297648 A81 a A. maculatus MCCI-R1318(2) Tunisia Sidi Mechrig KX296949 KX297154 KX297333 KX297438 KX297641 A82 A. maculatus MCCI-R1318(1) Tunisia Sidi Mechrig KX296950 KX297155 KX297334 KX297439 KX297642 A48 a A. masirae IBES1765 Oman 3 km N of Dawwah KX296903 KX297015 KX297284 KX297406 KX297593 A63 a A. masirae IBES7643 Oman 20 km E. of Ras Madrakah KJ567753 KJ567849 KJ548095 KJ547925 KJ548017 A50 a b A. masirae Oman 0.5 km E. of Ras Abu Zabil KJ567752 KJ567848 KJ548094 KJ547931 KJ548016 A150 a b A. micropholis NMP6V74175-1 Iran Gahkom, Hormozgan KX296917 KX297026 KX297287 KX297403 KX297588 A67 a b A. micropholis MVZ:Herp248441 Pakistan 8.5 km W. of Bela, Las Bela District, Baluchistan KX296916 KX297025 KX297285 KX297378 KX297587 A25 a b A. opheodurus HUJ.R19189 Israel Timna valley KJ567750 KJ567844 KJ548099 KJ547927 KJ548007 A33 A. opheodurus HUJ.R19190 Israel Timna valley KX296895 KX297002 - KX297398 KX297572 A288 a b A. opheodurus TAU.R16286 Israel Grufit KX296898 KX296999 KX297282 KX297400 KX297560 A69 A. opheodurus TAU.R16157 Israel Grufit KX296899 KX297000 - - - A79 a A. opheodurus MCCI-R627 Jordan Diseh KJ567749 KJ567843 KJ548098 KJ547926 KJ548006 A193 a A. opheodurus Jordan Daheek KX296893 KX297001 KX297279 KX297389 KX297570 A194 a A. opheodurus Jordan Wisad KX296894 - KX297280 KX297390 KX297571 A303 a b A. opheodurus IBECN809 Oman 5 km NW. of Tawa KX296891 KX296997 KX297276 KX297385 KX297558 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A35 a A. opheodurus IBEAO145 Oman Thumrayt KX296896 KX297003 KX297278 KX297387 KX297561 A38 a b A. opheodurus Oman Thumrayt KX296897 KX297004 KX297281 KX297388 KX297562 A209 a A. opheodurus UAE Al Ain KX296892 KX296998 KX297277 KX297386 KX297559 A244 a b A. orientalis NMP6V70441-1 Syria Hawwarin KX296979 KX297183 KX297356 KX297424 KX297606 A245 a b A. orientalis NMP6V70489-2 Syria 28 km N. of Palmyra KX296980 KX297184 KX297358 KX297426 KX297607 A246 a b A. orientalis NMP6V70491-1 Syria 5-10 km SW. of Au Kemal KX296981 KX297185 KX297357 KX297425 KX297611 A227 a A. pardalis Egypt KX296934 - - - - A41 a b A. pardalis HUJ.R18993 Egypt El Nasr KX296935 KX297139 KX297344 KX297440 KX297637 A54 a A. pardalis HUJ.R18994 Egypt El Nasr KX296936 KX297141 KX297335 KX297454 KX297639 A55 a A. pardalis HUJ.R18995 Egypt El Nasr KX296939 KX297140 KX297331 KX297441 KX297638 A264 a A. savignyi Algeria Sidi Mansour, El Makta KX296982 KX297176 KX297321 KX297417 KX297612 A265 a A. savignyi Algeria 7 km W. of Ain El-Turck KX296983 KX297177 KX297322 KX297418 KX297613 A195 a b A. schmidti Jordan Shahbat al Hazim KX296912 KX297021 KX297309 KX297382 KX297578 A51 a b A. schmidti IBES1893 Oman Al-Areesh Desert Camp KX296911 KX297020 KX297308 KX297384 KX297583 A228 a b A. schmidti UAE Sharjah Airport KX296910 KX297019 KX297307 KX297383 KX297576 A198 a b A. schreiberi ataturi MCCI-R1693(1) Turkey Botas KJ567740 KJ567835 KJ548075 KJ547919 KJ547996 A199 A. schreiberi ataturi MCCI-R1693(1) Turkey Botas KJ567741 KJ567836 KJ548076 KJ547918 KJ547997 A70 A. schreiberi schreiberi TAU.R16151 Cyprus Lara bay, Akamas peninsula KJ567737 KJ567831 KJ548071 KJ547916 KJ547993 A289 a b A. schreiberi schreiberi TAU.R16150 Cyprus Lara bay, Akamas peninsula KJ567738 KJ567832 KJ548074 KJ547924 KJ547994 A118 a A. schreiberi schreiberi NMP6V74532 Cyprus 3 km S. of Mersinlik, Famagusta KJ567739 KJ567834 KJ548072 KJ547917 KJ547995 A229 a A. schreiberi schreiberi Cyprus Episkopi KJ567743 KJ567833 KJ548073 KJ547921 KJ547999 A230 a A. schreiberi schreiberi Cyprus Vrysoulles KJ567742 KJ567837 KJ548077 KJ547920 KJ547998 A15 a A. schreiberi syriacus HUJ.R23653 Israel Caesarea sands KJ567719 KJ567791 KJ548025 KJ547866 KJ547937 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A274 A. schreiberi syriacus HUJ.R23410 Israel Between Hadera and Binyamina KJ567722 KJ567792 - KJ547859 KJ547947 A121 a A. schreiberi syriacus TAU.R16262 Israel Rishon LeZion sands KJ567723 KJ567795 KJ548026 KJ547867 KJ547938 A21 a A. schreiberi syriacus TAU.R16398 Israel Holon sands KJ567724 KJ567798 KJ548027 KJ547873 KJ547942 A57 a b A. schreiberi syriacus TAU.R16407 Israel Holon sands KJ567726 KJ567796 KJ548084 KJ547863 KJ547943 A62 a A. schreiberi syriacus TAU.R16412 Israel Holon sands KJ567725 KJ567797 KJ548029 KJ547871 KJ547944 A4 a A. schreiberi syriacus HUJ.R23986 Israel Nizzanim reserve KJ567666 KJ567760 KJ548024 KJ547847 KJ547935 A5 a b A. schreiberi syriacus HUJ.R23987 Israel Nizzanim reserve KJ567667 KJ567761 KJ548082 KJ547848 KJ547936 A204 A. schreiberi syriacus HUJ.R23321 Israel Ashqelon KJ567668 KJ567762 - KJ547857 KJ547940 A205 A. schreiberi syriacus HUJ.R23331 Israel Ashqelon KJ567669 KJ567763 KJ548083 - KJ547941 A152 a A. schreiberi syriacus MCCI-R925(1) Lebanon Tyre KJ567720 KJ567793 - KJ547868 KJ547948 A153 A. schreiberi syriacus MCCI-R925(2) Lebanon Tyre KJ567721 KJ567794 - KJ547869 KJ547939 A210 a b A. scutellatus audouini Algeria El Aricha KX296805 KX297054 KX297222 KX297479 KX297690 A119 a b A. scutellatus audouini Egypt El Khattara, Aswan KX296812 KX297058 KX297208 KX297491 KX297705 A211 a b A. scutellatus audouini Egypt Ad el Malek, W. Desert KX296809 KX297055 KX297204 KX297485 KX297695 A27 a A. scutellatus audouini Egypt Sitra Oasis KX296810 KX297056 - KX297488 KX297698 A29 a A. scutellatus audouini Egypt Dakhla Oasis KX296811 KX297057 KX297205 KX297516 KX297699 A212 a A. scutellatus scutellatus Egypt Cairo-Alexandria desert road KX296826 KX297076 KX297223 KX297494 KX297665 A213 A. scutellatus scutellatus Egypt Cairo-Alexandria desert road KX296827 KX297077 KX297224 KX297495 KX297666 A214 a A. scutellatus scutellatus Egypt Sinai, 3.5 km NE. of Bir el-Ad KX296832 KX297082 KX297225 KX297498 KX297668 A215 a A. scutellatus scutellatus Egypt 25 km NE. of Ismalia, E. bank of Nile KX296833 KX297083 KX297265 KX297496 KX297669 A216 a A. scutellatus scutellatus Egypt Sinai, 10 km NE. of Bir Qatia KX296834 KX297088 KX297232 KX297499 KX297670 A217 A. scutellatus scutellatus Egypt El Omayed protected area KX296828 KX297080 KX297233 KX297500 KX297683 A218 A. scutellatus scutellatus Egypt Zaraniq, Sinai KX296835 KX297084 KX297226 KX297501 KX297671 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A220 A. scutellatus scutellatus Egypt Zaraniq, Sinai KX296837 KX297086 KX297234 KX297503 KX297673 A221 A. scutellatus scutellatus Egypt Zaraniq, Sinai KX296838 KX297087 KX297228 KX297512 KX297685 A219 A. scutellatus scutellatus Egypt Sinai, 55 km W. of Zaraniq KX296836 KX297085 KX297227 KX297502 KX297672 A226 a A. scutellatus scutellatus Egypt El Omayed protected area KX296829 KX297081 KX297235 KX297519 KX297674 A24 a A. scutellatus scutellatus IBES3537 Egypt Al-Natroun Road KX296830 KX297078 KX297241 KX297504 KX297667 A26 a A. scutellatus scutellatus IBES3545 Egypt Al-Natroun Road KX296831 KX297079 KX297236 KX297497 KX297684 A11 A. scutellatus scutellatus TAU.R16389 Israel Bir Mashash sands KJ567758 KJ567852 KJ548103 KJ547933 KJ548022 A13 a A. scutellatus scutellatus TAU.R16391 Israel Revivim KX296841 KX297090 KX297229 KX297509 KX297678 A14 a A. scutellatus scutellatus HUJ.R23946 Israel Nativ Ha-Asara sands KX296847 KX297094 - KX297513 KX297676 A20 A. scutellatus scutellatus TAU.R16397 Israel Bir Mashash sands KX296842 KX297091 KX297230 KX297511 KX297679 A42 A. scutellatus scutellatus HUJ.R23473 Israel Nizzanim sands KX296845 KX297096 KX297238 KX297515 KX297680 A44 A. scutellatus scutellatus Israel Holon sands KJ567759 KJ567853 KJ548104 KJ547934 KJ548023 A6 a b A. scutellatus scutellatus TAU.R16410 Israel Holon sands KX296844 KX297095 KX297237 KX297514 KX297677 A65 a A. scutellatus scutellatus Israel Holon sands KX296846 KX297097 KX297239 KX297510 KX297681 A68 A. scutellatus scutellatus Israel Bir Mashash sands KX296843 KX297092 KX297231 KX297518 KX297682 A8 a A. scutellatus scutellatus TAU.R16156 Israel Shivta junction KX296839 KX297089 - - - A9 a A. scutellatus scutellatus Israel Shivta junction KX296840 KX297093 KX297240 KX297507 KX297675 A100 A. scutellatus audouini MCCI-R1466 Libya Between Erg Ouan Kasa and Erg Murzuq KX296814 KX297064 - - KX297702 A101 a b A. scutellatus audouini MCCI-R1465 Libya 15 km N. of Dirj KX296820 KX297067 KX297212 KX297490 KX297703 A102 a A. scutellatus audouini MCCI-R1467 Libya Between Erg Ouan Kasa and Erg Murzuq KX296815 KX297065 KX297209 KX297505 KX297704 A92 a b A. scutellatus audouini MCCI-R1463 Libya Akakus, Adadh area KX296818 KX297062 KX297206 KX297520 KX297700 A99 a b A. scutellatus audouini MCCI-R1464 Libya Akakus, Awiss area KX296813 KX297063 KX297207 KX297489 KX297701 A304 A. scutellatus audouini MCCI-R1468(1) Libya 50 km N. of Dirj KX296819 KX297066 - - - Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A222 a A. scutellatus audouini Mauritania 60 km S. of Zouerat (Tiris Zemmour) KX296816 KX297059 KX297210 KX297486 KX297696 A223 a b A. scutellatus audouini Mauritania 60 km S. of Zouerat (Tiris Zemmour) KX296817 KX297061 KX297211 KX297487 KX297697 A224 a b A. scutellatus audouini Morocco KX296793 KX297060 KX297220 KX297480 KX297692 A225 A. scutellatus audouini Morocco S. of Zagora KX296794 - KX297221 KX297481 KX297693 A103 a A. scutellatus audouini MCCI-R1345 Tunisia 2 km SW. of Béni Kheddache KX296806 KX297073 - KX297506 KX297708 A104 a A. scutellatus audouini MCCI-R1348 Tunisia Between Tataouine and Remada KX296808 KX297074 - - - A83 a A. scutellatus audouini MCCI-R1338(1) Tunisia 2-3 km W. of Zaafrane KX296821 KX297070 KX297216 KX297493 KX297707 A93 a b A. scutellatus audouini MCCI-R1341 Tunisia 29 km E. of Douz KX296824 KX297068 KX297218 KX297517 KX297686 A94 a b A. scutellatus audouini MCCI-R1347 Tunisia 33 km S. of Tataouine KX296807 KX297075 KX297242 KX297508 KX297689 A95 a b A. scutellatus audouini MCCI-R1334(1) Tunisia Between Hazoua and Matrouha KX296822 KX297071 KX297217 KX297492 KX297709 A96 a A. scutellatus audouini MCCI-R1344(1) Tunisia 2 km W. of Béni Keddache KX296825 KX297069 - KX297467 KX297706 A97 a A. scutellatus audouini MCCI-R1332(1) Tunisia Between Nefta and Hazoua KX296823 KX297072 - - - A186 a A. senegalensis Mauritania Walatah KX296786 KX297044 KX297198 KX297476 KX297657 A187 a b A. senegalensis Mauritania Walatah KX296797 KX297049 KX297203 KX297472 KX297664 A201 a A. senegalensis TR109 Mauritania 50 km SW. of Atar KX296791 KX297041 - - - A1 a A. senegalensis TR2287 Mauritania 150 km NNW. of Walatah KX296798 KX297050 - - KX297652 A305 a b A. senegalensis TR4284 Senegal Dakar KX296801 KX297045 KX297196 KX297468 KX297655 A306 A. senegalensis TR4285 Senegal Dakar KX296803 KX297046 KX297195 KX297469 KX297653 A307 a A. senegalensis TR4286 Senegal Dakar KX296804 KX297047 KX297201 KX297470 KX297654 A19 a A. senegalensis TR2881 Senegal Sangalcam near Dakar KX296802 KX297048 - - - A155 a A. senegalensis TR4138 Western Sahara 80 km SE. of Dakhla KX296788 KX297037 - KX297477 KX297662 A202 A. senegalensis TR4095 Western Sahara 80 km SE. of Dakhla KX296787 KX297036 - KX297540 - A266 A. taghitensis BEV.11659 Algeria 3 km S. of El-Aiodh Sidi Cheikh KX296873 KX297123 KX297268 - KX297687 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A267 a b A. taghitensis BEV.11658 Algeria 3 km S. of El-Aiodh Sidi Cheikh KX296874 KX297124 KX297269 KX297527 KX297688 A250 a A. tilburyi NMP6V70599 Jordan Al Muddawara (Husn el Mudawwara) KX296889 KX297013 - KX297543 - A251 a b A. tilburyi NMP6V70868 Jordan Al Muddawara (Husn el Mudawwara) KX296890 KX297014 KX297303 KX297544 KX297585 A196 a b A. tristrami Jordan Al Harir (Near Tafilah) KX296975 KX297179 KX297354 KX297420 KX297605 A252 a b A. tristrami NMP6V70472 Syria 5 km E. of Rashiedeh KX296976 KX297180 KX297355 KX297423 KX297608 A253 A. tristrami NMP6V70515-1 Syria 2-3km E. of Rdemeh Sh´Sharqyieh KX296977 KX297181 KX297359 KX297421 KX297610 A254 A. tristrami NMP6V70515-2 Syria 2-3km E. of Rdemeh Sh´Sharqyieh KX296978 KX297182 KX297360 KX297422 KX297609 M17 Mesalina guttulata Israel 4 km W. to Arad KX296984 KX297187 KX297361 KX297545 KX297735 M18 Mesalina guttulata Israel Hirbet Nizana KX296985 KX297188 KX297362 KX297546 KX297736 M19 Mesalina olivieri Israel Ramat Hovav KX296986 KX297189 KX297363 KX297547 KX297737 M20 Mesalina olivieri Israel Hirbet Mamshit KX296987 KX297191 KX297364 KX297548 KX297738 M21 Mesalina olivieri Israel Ramat Hovav KX296988 KX297190 KX297365 KX297549 KX297739 Gallotia atlantica atlantica Canary Islands Lanzarote AY151915 AY151836 - - AY151999 Gallotia atlantica mahoratae Canary Islands Fuerteventura AY151916 AY151837 - - AY152000 Gallotia caesaris caesaris Canary Islands El Hierro AY151922 AY151843 - - AY152006 Gallotia caesaris gomerae Canary Islands La Gomera AY151921 AY151842 - - AY152005 Gallotia gomerana Canary Islands La Gomera AJ272395 AJ272396 - - - Gallotia galloti eisentrauti Canary Islands Tenerife AY151918 AY151839 - - AY152002 Gallotia galloti galloti Canary Islands Tenerife AY151919 AY151840 - - AY152003 Gallotia galloti palmae Canary Islands La Palma AY151920 AY151841 - - AY152004 Gallotia intermedia Canary Islands Tenerife AY151923 AY151844 - - AY152007 Gallotia simonyi machadoi Canary Islands El Hierro AY151924 AF101219 - - AY152008 Gallotia stehlini Canary Islands Gran Canaria AY151917 AY151838 - - AY152001 Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

Podarcis cretensis Greece Crete - AF486216 - - KF003242 Podarcis cretensis Greece Crete - AF486218 - - KF003244 Podarcis lilfordi Balearic Islands Gymnesic Islands, Menorca EF694766 EF694810 - - EF679323 Podarcis lilfordi Balearic Islands Gymnesic Islands, Cabrera EF694764 EF694805 - - EF679302 Podarcis peloponnesiacus Greece Peloponnese - AY896121 - - KF003245 Podarcis peloponnesiacus Greece Peloponnese - AY896124 - - KF003246 Podarcis pityusensis Balearic Islands Pityusic Islands, Ibiza EF694768 EF694814 - - EF679324 Podarcis pityusensis Balearic Islands Pityusic Islands, Espardell EF694769 EF694815 - - EF679325 Psammodromus algirus AY151914 AY151835 - - AY151998 Psammodromus algirus Morocco S. of Tizi Chika, High Atlas AF080308 AF080309 - - -

1 Abreviations: [BEV] Centre d’Ecologie Fonctionnelle et Evolutive, Montpellier, France; [CAS] California Academy of Sciences, San Francisco, USA; [HUJ.R] Zoological Museum, Hebrew University of Jerusalem, Israel; [IBE] Institute of Evolutionary Biology, Barcelona, Spain; [MCCI-R] Museo Civico di Storia Naturale, Carmagnola, Turin, Italy; [MVZ:Herp] Museum of Vertebrate Zoology, University of California, Berkeley, USA; [NMP6V] National Museum (Natural History), Prague, Czech Republic; [TAU.R] The Steinhardt Museum of Natural History, Tel Aviv University, Israel; [TR] Private collection of Jean-François Trape, Dakar, Senegal; [ZFMK] Zoologisches Forschungsmuseum Alexander Koenig, Bonn, Germany.

Table S2. Data on the gene fragments used in this study, including their lengths and the primers used (with their orientation, sequences, references and PCR conditions).

Gene Length (bp) Primer Primer sequence (5’-3’) Primer reference PCR conditions

12Sa F: AAACTGGGATTAGATACCCCACTAT Kocher et al. (1989) 12S ~385 94°C (5’), [94°C (30’’), 56°C (45’’), 72°C (1’)] x35, 72°C (5’) 12Sb R: GAGGGTGACGGGCGGTGTGT Kocher et al. (1989) GludG F: TGACTTGAARAACCAYCGTTG Palumbi (1996) cytb 405 94°C (5’), [94°C (30’’), 49°C (45’’), 72°C (90’)] x35, 72°C (5’) Cytb2 R: CCCTCAGAATGATATTTGTCCTCA Kocher et al. (1989) MC1RF F: AGGCNGCCATYGTCAAGAACCGGAACC Pinho et al. (2009) MC1R 663 94°C (5’), [94°C (30’’), 56°C (45’’), 72°C (80’)] x35, 72°C (5’) MC1RR R: CTCCGRAAGGCRTAAATGATGGGGTCCAC Pinho et al. (2009) Tg-F F: CAAGCCTGAGAGCAARAAGG Gamble et al. (2008) ACM4 429 94°C (5’) [94°C (30’’), 56°C (45’’), 72°C (80’)] x35, 72°C (5’) Tg-R R: ACYTGACTCCTGGCAATGCT Gamble et al. (2008) Lsc1(Mos-F) F: CTCTGGKGGCTTTGGKKCTGTSTACAAGG Godinho et al. (2005) c-mos 522 94°C (5’), [94°C (30’’), 57°C (45’’), 72°C (70’)] x35, 72°C (5’) Lsc2(Mos-R) R: GGTGATGGCAAANGAGTAGATGTCTGC Godinho et al. (2005)

References

Gamble, T., Bauer, A.M., Greenbaum, E., Jackman, T.R., 2008. Evidence of Gondwanan vicariance in an ancient clade of geckos. J. Biogeogr., 35, 88–104. Godinho, R., Crespo, E.G., Ferrand, N., Harris, D.J., 2005. Phylogeny and evolution of the green lizards, Lacerta spp. (Squamata: Lacertidae) based on mitochondrial and nuclear DNA sequences. Amph. Rept., 26, 271-285. Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pääbo, S., Villablanca, F.X., Wilson, A.C., 1989. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. P. Natl. Acad. Sci. USA, 86, 6196-6200. Palumbi, S., 1996. Nucleic acids II: the polymerase chain reaction. In: D.M. Hillis, C. Moritz, B.K. Mable (Eds.), Molecular Systematics, Sinauer Associates, Sunderland, MA, pp. 205–247. Pinho, C., Rocha, S., Carvalho, B.M., Lopes, S., Mourao, S., Vallinoto, M., Brunes, T.O., Haddad, C.F.B., Goncalves, H., Sequeira, F., Ferrand, N., 2009. New primers for the amplification and sequencing of nuclear loci in a taxonomically wide set of reptiles and amphibians. Conserv. Genet. Resour., 2(S1), 181–185.

Table S3. Data on the phylogenetic, calibration and range reconstruction analyses, including partitions, models and parameters.

Analysis Dataset Partition Length Model Clock model (unlinked) Rate Tree model (linked) Other Priors/Parameters Run Specifications

12S 379 mtDNA Phylogenetic cytb 405 trees 12S 379 Replicates x100 cytb 405 GTR+G Bootstrap x1000 Maximum Complete MC1R 663 Likelihood ACM4 429 c-mos 522 12S 379 GTR+I+G Relaxed Uncorrelated Lognormal 2 runs; 108 generations; 104 mtDNA Phylogenetic cytb 405 TrN+I+G Relaxed Uncorrelated Lognormal sampling frequency; 10% burn-in trees 12S 379 GTR+I+G Relaxed Uncorrelated Lognormal Coalescence Alpha Uniform (0, 10); Base cytb 405 GTR+I+G Relaxed Uncorrelated Lognormal Rate fixed to 1 Random starting tree substitution Uniform (0, 100) 2 runs; 2x108 generations; 2x104 Bayesian Complete MC1R 663 GTR+I+G Strict clock sampling frequency; 10% burn-in Inference ACM4 429 GTR+I+G Strict clock c-mos 522 TrN +G Strict clock Bayesian mtDNA 12S 385 GTR+I+G Relaxed Uncorrelated Lognormal Coalescence Alpha Uniform (0, 10); Base 2 runs; 108 generations; 104 Rate fixed to 1 Inference Haplotypes cytb 405 GTR+I+G Relaxed Uncorrelated Lognormal Random starting tree substitution Uniform (0, 100) sampling frequency; 10% burn-in Estimation of Complete 12S 381 GTR+I+G Relaxed Uncorrelated Lognormal divergence cytb 405 GTR+I+G Relaxed Uncorrelated Lognormal Yule Alpha Uniform (0, 10); Base 2 runs; 3x108 generations; 3x104 times (Including MC1R 663 GTR+I+G Strict clock Uniform 1 (0-100) (Geological Random starting tree substitution Uniform (0, 100) sampling frequency; 10% burn-in Gallotia and ACM4 429 GTR+I+G Strict clock calibration Podarcis) HKY+I+ points) c-mos 522 Strict clock Ancestral area 12S 384 GTR+I+GG Relaxed Uncorrelated Lognormal Normal 0.00553-0.00128 reconstruction Complete cytb 405 GTR+I+G Relaxed Uncorrelated Lognormal Normal 0.0164-0.00317 Yule + MC1R 663 GTR+I+G Strict clock Uniform 0.0001 (0-0.0164) Alpha Uniform (0, 10); Base 2 runs; 3x108 generations; 3x104 Estimation of Random starting tree (ingroup substitution Uniform (0, 100) sampling frequency; 10% burn-in divergence ACM4 429 GTR+I+G Strict clock Uniform 0.0001 (0-0.0164) times (Evolution only) c-mos 522 TrN+I+G Strict clock Uniform 0.0001 (0-0.0164) rates) Location Symmetric discrete Strict clock Exponential (mean 1; offset 0)

Table S4. Pairwise uncorrected genetic divergence (p-distance) among Acanthodactylus taxa, derived from the mitochondrial genes 12S (below the diagonal) and cytb (above the diagonal), and within the taxa (12S/cytb). A. aegyptius A. arabicus A. aureus A. bedriagai A. beershebensis A. blanci A. blanfordi A. boskianus A. busacki A. boueti A. cantoris A. dumerilii A. erythrurus A. felicis A. gongrorhynchatus A. grandis A. guineensis A. haasi A. hardyi A. harranensis A. lineomaculatus A. longipes A. maculatus A. masirae A. micropholis A. opheodurus A. orientalis A. pardalis A. savignyi A. schmidti A. schreiberi A. scutellatus A. senegalensis A. taghitensis A. tilburyi A. tristrami A. aegyptius 0/1 26,9 17,1 20,8 20,3 23,3 21,6 21,9 21,4 22,1 23,4 15 22,8 20,8 24 20,8 25,1 23 22 21 25,1 10,7 20,7 23,3 20,3 23,7 22,5 20,7 23,4 22 21,9 14 15 18,2 21,9 21,2 A. arabicus 13,7 4/7.7 22,6 23,7 23,4 22,1 19,2 19,7 23,6 24,5 19 23,5 22,3 17,2 19,7 20,9 21,9 19,8 17,9 20,6 21,8 25,3 23,6 18,4 20,1 17,8 23,8 23,6 21 18,9 19,6 22,7 23,3 22,5 16,2 23,1 A. aureus 9,5 13,9 1.5/3.6 20,9 20 21 17,8 18,7 20,7 21,6 21,1 15,6 21,5 18,6 22,9 18,3 21,2 20,2 20,2 17 23,1 17,2 20,5 20,2 18,5 19,6 22,8 19,7 19,4 18,6 19,7 15,2 15,6 16,2 20,6 21,2 A. bedriagai 15,8 18 17 2.6/10.1 9,7 19,8 23,7 22,3 12,6 21,9 24,1 21,5 19,9 22 24,4 22,4 17,8 22,5 20,9 22,5 20,4 20,6 7,1 21 21,2 21,9 22,3 8,5 19,7 22,3 22,4 21,2 21,4 18,1 22,2 21,8 A. beershebensis 16 18,2 15,8 4 0.1/0.4 17,9 23,2 22,4 11,2 20,2 24,5 20,4 18,8 22,4 25,6 21,5 18,2 22,9 21,9 22,4 19 20,6 9,9 19,2 21,5 22,4 22,4 8,3 18,4 21,1 22,4 21,1 20,6 17,3 22,7 20 A. blanci 14,5 14 13,3 8,7 8,7 0/0.7 22,3 21,4 20,2 22,2 23,6 22,4 13,9 21 23,3 21,6 19,1 23,8 22,3 21,2 13,5 21,9 19,5 20,7 21,6 20,8 21,1 18,8 16,8 21,2 21,1 22,7 22,2 21,5 22 20,2 A. blanfordi 13 9,8 13,9 16,5 17,2 13,1 2.6/7.7 17 21,3 20,4 17,5 19,9 21,1 15,9 20,8 18,1 20,2 18,2 16,7 16,8 22,7 20,2 23,2 17,3 16,2 16,2 21,5 22,6 21,3 13,4 17,5 18,7 20,5 20,7 16,6 22,6 A. boskianus 13,4 9,3 13 15,9 16,4 13,5 7,2 3.3/7.8 21,7 21,9 18,9 20,1 21,6 15,3 18,9 17,4 19,5 17,7 16 17,6 22,5 19,7 22,1 15,9 15,8 14,7 22,6 21,5 21,8 16,7 9,4 19,3 20,2 18,9 15,9 22,1 A. busacki 14,7 16,8 14,9 4,8 5,8 9,1 15 14,3 2.9/6.6 19,7 23,1 20,5 19,1 20,2 24,1 22,4 18,8 21,1 20,6 21,2 18,9 19,1 12,6 18,9 21,5 20,3 20,6 11,2 17,4 20,3 22,1 19,3 20,4 18,5 21,7 20,4 A. boueti 16,9 17,1 16,3 11,1 12,1 9,4 16,7 16,2 11,6 n/c 23,8 22,9 21 21,7 23,7 22 20,2 22,7 23 20,2 22,7 22,9 21,9 23,5 22 22,3 21,4 21,1 19,9 22,3 20,6 21,1 22,8 23 23,2 21,3 A. cantoris 11 8,8 12,4 16,6 15,5 12 6 6,3 14,7 16,2 0.7/0.7 21,7 23,6 18,2 20,5 19,4 23,1 19,4 17 18,4 24,6 23,2 24,1 16,3 20,6 19 23,7 23,1 21 18,5 20,6 21,6 22,1 23,6 14,9 22,7 A. dumerilii 4,9 13 10,1 16,7 16,6 13,9 14,1 13,5 15,5 16,8 12,3 1.5/4.1 22,3 19 23,1 20,6 22,7 22,2 20 19,9 23 14,8 20,8 20,3 19,5 19,5 24,3 19,3 20,7 19,6 20,2 12,1 4,3 16,5 20,6 20,8 A. erythrurus 12,9 14,1 13 9,1 9,2 3,8 13,2 13,2 8,9 10,1 12 13,3 3.6/12.1 20,3 22,2 21,6 18 23,2 21,3 22,2 12,1 21,7 20,1 20,7 20,3 20,4 22,8 19 17,8 20,8 21 21,9 22,5 21,9 20,6 20,5 A. felicis 14 10,6 13,8 17,6 17,3 15,4 7,8 5,1 15,9 16,6 7,4 14,6 14,5 0.3/0.9 18,6 18,9 19,5 17,1 15,5 17,1 21,8 19 21,7 16,7 16,6 13,6 21,7 21,5 20,8 16,5 15,3 18,4 19,4 18,8 15,3 21,2 A. gongrorhynchatus 14,7 10,8 14,7 18,1 18,6 16,4 9,5 9,2 16,3 18,8 9,5 14,8 15,8 10,4 n/c 19 21,5 18 19,4 18 24,2 22,2 24,6 18,5 19,5 18,3 22,4 25,9 20,5 19,6 19,1 21,6 23,3 23,2 16,8 22,2 A. grandis 13,4 12,6 16,8 16,1 16,4 16,4 10,6 10,1 15,2 17,6 9,1 14,9 16,1 10,4 11,2 6.1/14.6 22,8 20,1 18,4 8,5 24,3 19,4 22,2 18,8 15,3 17,1 22,6 22 18,7 16,5 17,6 19 20,7 19,4 17 22,2 A. guineensis 11,7 16,8 13,5 13,6 14 13,2 15 15,4 13,8 16,8 14,8 12,6 12,6 16,2 16,5 17,3 n/c 18,3 20,4 22,5 20 23,6 18,1 18,7 20,5 18,4 23,1 17,4 19,9 22,3 18,8 21,7 22,1 20 20,5 20,2 A. haasi 12,8 9,7 13,6 16,8 16,8 13,8 8,8 7,3 15,1 16,4 7,6 12,4 13,2 7,7 8,9 10,4 15,3 n/c 17,4 18 23,7 20,5 22,3 16,5 19,9 15,1 23 22 21,9 17,6 18,5 20,6 21,3 20,2 15,8 23,7 A. hardyi 11,6 10,7 12,6 16,1 17 12,8 7,1 8,5 14,7 16,3 6,4 11,9 12,1 9 9,5 10,7 14,9 7,8 3.3/4 18,8 21,5 19,9 21,1 16,1 18,2 15,5 22,2 21,1 21,8 15,2 17 19,1 20 17,7 14,8 21,2 A. harranensis 12,5 12,2 15,6 15,6 16 15,9 10,3 9,3 15,3 17,2 8,9 14,4 15,8 9,7 10,7 6,6 17,1 9,1 9,7 n/c 25,4 19,9 22,6 18,3 15,7 17,6 21,6 23,2 18,5 16 17,5 18,3 19,7 20,2 17,5 20,9 A. lineomaculatus 13,5 14,1 13,8 8,7 9,5 3,4 12,8 13 9,1 8,6 12,3 14,1 3,1 14,6 15,9 16,7 12,6 13,3 12,3 16,7 0/0 22,9 20,5 21,4 22,3 21,3 23 18,3 19,3 21,6 22,3 23,9 23,2 22,5 22 21,2 A. longipes 2,4 14,6 10,5 15,9 16,3 15,6 14,2 14,2 15,3 17,6 11,4 5,4 14,3 15,2 15,6 14 13 13,5 11,7 12,8 15,3 0.5/1.3 20,6 22,1 19,8 20,7 21,7 20,6 22,4 20 19,9 13,4 14,9 15,9 22,8 22,8 A. maculatus 15,8 17,9 16,3 2,5 4,5 9,2 15,9 15,3 5,1 11,4 16,2 16,3 9,2 16,9 17,6 16 13,6 16,3 15,7 15,4 8,9 15,8 3/7.9 20,5 21 21,6 22,2 7,9 19,6 21,8 22,3 20,7 20,9 17,7 21,8 21,6 A. masirae 10,9 9,4 11,9 15,7 15,6 12,9 8 7,8 15 16,8 5,6 12,6 13 9,2 10,3 10,7 12,9 8,5 8,7 10,9 12,7 11,1 15,6 0.2/0.3 17,8 16,4 21,8 18,2 19,7 17,6 17,2 21,3 20,7 20,2 13,1 21,3 A. micropholis 12,3 11,4 14 17,2 17,5 16,9 10,1 10 16,3 19,3 9,7 14 16,8 10,6 11,6 9,6 17,6 11,3 9,8 9,9 16,7 12,7 17,1 10,7 3.1/6.4 16,5 24 21,9 19,6 15,4 16 19,5 19,8 20,5 15,6 23,7 A. opheodurus 12,9 9,7 13 18,2 17,7 14,7 6,7 5,7 16,1 17,4 5,3 14,4 14,7 5,4 9,9 10 16,6 8,3 7,1 9,2 14,5 13,4 17,6 6,9 9,3 1.6/3.9 23,5 19,5 20,1 15,3 14,9 19,7 19,6 19,7 13,5 21,8 A. orientalis 13,9 16,4 15,5 12,9 13,9 10,6 14,3 15 12,5 13 14,6 14,6 11,1 16,4 16,4 16,2 14,1 15,7 13,4 14,8 11,3 14,8 12,6 16,1 15 15,3 3.9/9.2 22,3 20,7 21,6 22,1 22,7 24,1 20,6 21,9 16,2 A. pardalis 15,4 18,3 16,6 2,4 4,2 9,3 16,2 15,6 4,4 11,5 16,4 16 9,1 17,4 17,4 15,9 13,4 16,7 16,1 14,8 9,1 15,4 2,6 15,5 17,2 18,1 12 0.1/0.2 19,1 21,8 21,8 20,1 19,9 17,5 20,7 20,3 A. savignyi 14,8 16,5 14,5 13,1 14,6 10,9 15,5 13,9 12,3 14 14,5 15,6 10,5 15,1 18,1 17,8 13,3 16,1 14,1 16,9 10,3 14,8 12,8 13,8 15,8 15,2 11,3 12,7 0.3/2.2 20,1 21,5 20,6 20,8 21,4 19,5 19,4 A. schmidti 13,2 11,1 13,9 16,3 17,5 14,4 5,8 7,6 15,3 17,1 7,5 14,8 13,8 7,5 10,4 11 16,2 9,7 6,7 10,1 13,6 13,3 15,8 8,7 10,6 6,3 15,2 16,2 14,7 3.2/6.9 16,9 19,5 20,2 16,7 16 21,6 A. schreiberi 12,8 9,8 12,9 16,3 16,4 13,2 7,4 3,7 14,7 15,8 5,8 13,7 13 5,3 9,3 10,3 15,1 7,7 8,7 9,6 12,8 13,8 15,6 7,7 10,7 5,8 15,2 15,8 14,7 7,4 2.9/7.5 19,3 20,3 18,9 16,9 22,9 A. scutellatus 4,5 13,4 10,3 16,8 16,8 14,4 13,6 13,3 15,8 16,7 11,8 4,4 13,2 13,9 14,6 14,3 12,8 12,7 12,2 13,5 13,6 5,5 16,6 11,7 13,5 13,4 14,4 16,1 15,9 13,9 12,9 2.8/7.4 11,7 16,1 20,6 20,8 A. senegalensis 4,7 12,9 9,6 16,5 16,2 13,8 13,9 13,3 15,3 16,5 12,2 1,3 13,1 14,2 14,6 14,8 12,4 12,2 11,8 14,5 13,9 5,5 16 12,5 13,8 14,2 14,4 15,8 15,2 14,8 13,4 4,4 0.7/3.9 16,5 21,3 20,7 A. taghitensis 9,7 17,1 9,2 19 17,6 17 16,7 15,2 17,6 19,1 14,9 9,6 16,2 16,4 16,1 16,6 15,2 14,4 13,9 15,7 17 9,4 18,5 14,2 15,9 15,9 16,4 18,5 17,4 16,4 15,1 10,5 9,4 0/0 21,2 19,6 A. tilburyi 13,8 8,6 14,5 16,5 17,2 15,3 7,3 5,6 14,6 17,6 6,7 13 14,7 6 8,5 9,4 16,2 6,6 8,7 9 15 14,7 16,1 8,8 9,8 7,1 15,9 16,5 15,4 8 6,5 13,4 12,8 16,1 0.3/0 21,7 A. tristrami 13,4 16,7 14,3 13,2 13,9 10,3 15,1 15,9 12,8 13,6 14,1 13,7 10,6 17,2 17,2 17,6 12,7 15,7 13,5 16 10,5 14,8 12,6 15,2 16,4 15,8 5,6 12,5 11,1 15,4 16 14,6 13,3 16,6 17 2.1/3.2