bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

1 Submission to Genetics 2 3 Title:

4 Mutation of the nuclear pore complex component, aladin1, disrupts 5 asymmetric cell division in Zea mays (maize)

6 7 Authors: Norman B. Best*†‡, Charles Addo-Quaye‡§, Bong-Suk Kim**, Clifford F. 8 Weil††‡‡, Burkhard Schulz†, Guri Johal**‡‡, Brian P. Dilkes‡‡‡

9 Affiliations: 10 *USDA, Agriculture Research Service, Plant Genetics Research Unit; Columbia, MO, 65211 11 †Department of Horticulture & Landscape Architecture; Purdue University; West Lafayette, IN, 12 47907 13 ‡Department of Biochemistry, Purdue University; West Lafayette, IN, 47907 14 §Natural Sciences and Mathematics, Lewis-Clark State College; Lewiston, ID, 83501 15 **Department of Botany and Plant Pathology, Purdue University; West Lafayette, IN, 47907 16 ††Department of Agronomy, Purdue University; West Lafayette, IN, 47907 17 ‡‡Center for Plant Biology, Purdue University; West Lafayette, IN, 47907 18 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

19 Short Running Title:

20 aladin1 controls asymmetric cell division

21

22 Key words:

23 Nuclear Pore Complex

24 Asymmetric cell division

25 Stomata

26 Subsidiary cells

27 Maize

28 29 Corresponding Author:

30 Brian P. Dilkes

31 Address: 32 Whistler Building Room B036B 33 Purdue University 34 West Lafayette, IN 47907 35 36 Phone Number: 37 765-494-2584 38 39 Email Address: 40 [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

41 Abstract: 42 The nuclear pore complex (NPC) regulates the movement of macromolecules between the

43 nucleus and cytoplasm. Dysfunction of many components of the NPC results in human genetic

44 diseases, including triple A syndrome (AAAS) as a result of mutations in ALADIN. Here we

45 report a nonsense mutation in the maize ortholog, aladin1 (ali1-1), at the orthologous amino acid

46 residue of an AAAS allele from humans, alters plant stature, tassel architecture, and asymmetric

47 divisions of subsidiary mother cells (SMCs). Crosses with the stronger nonsense allele ali1-2

48 identified complex allele interactions for plant height and aberrant SMC division. RNA-seq

49 analysis of the ali1-1 mutant identified compensatory transcript accumulation for other NPC

50 components as well as gene expression consequences consistent with conservation of ALADIN1

51 functions between humans and maize. These findings demonstrate that ALADIN1 is necessary

52 for normal plant development, shoot architecture, and asymmetric cell division in maize. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

53 Introduction

54 The nuclear pore complex (NPC) is a multi-protein complex that is involved in regulating

55 the movement of macromolecules into and out of the nucleus. The NPC also plays important

56 roles in nuclear assembly during cell division (Rasala, Orjalo, Shen, Briggs, & Forbes, 2006).

57 NPC proteins assemble in groups of eight, as spokes, around the opening of the pore to control

58 transport between the nucleus and cytoplasm (Lin et al., 2016; Reichelt et al., 1990).

59 Components of the NPC are conserved across many eukaryotic species, including mammals (J.

60 M. Cronshaw, Krutchinsky, Zhang, Chait, & Matunis, 2002), plants (Tamura, Fukao, Iwamoto,

61 Haraguchi, & Hara-Nishimura, 2010; Tamura & Hara-Nishimura, 2013), fungi (Liu, De Souza,

62 Osmani, & Osmani, 2009; Stuwe et al., 2015), and yeast (Rout et al., 2000). Dysfunction and/or

63 mutation of the genes encoding NPC components has drastic effects on growth, development,

64 and survival of eukaryotic species. In humans, genetic mutations of NPC members have been

65 linked to a number of diseases and illnesses, including different types of cancer, neurological

66 diseases, and autoimmune diseases (Nofrini, Di Giacomo, & Mecucci, 2016; Roth & Wiermer,

67 2012; Sakuma & D'Angelo, 2017).

68 The structure and conserved components of the NPC of plants have been identified

69 (Fiserova, Kiseleva, & Goldberg, 2009; Neumann, Jeffares, & Poole, 2006; Tamura et al., 2010;

70 Tamura & Hara-Nishimura, 2013). Genetic studies have functionally characterized a few NPC

71 members in plant species. The Arabidopsis NPC member, AtMOS7/Nup88, was shown to

72 regulate the nuclear concentrations of a subset of defense proteins, but other proteins tested were

73 not affected in Atmos7 mutants (Cheng et al., 2009). Additional forward and reverse genetic

74 approaches in plant species; primarily Arabidopsis, tobacco, and Lotus japonica, have further

75 characterized the function and role of NPC members in plant defense, plant symbioses, and bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

76 responses to abiotic stress (Binder & Parniske, 2018; Cheng et al., 2009; Dong et al., 2006; Roth

77 & Wiermer, 2012; Wiermer et al., 2012; Zhang & Li, 2005). To date, no member of the NPC has

78 been functionally characterized in Zea mays (maize). It is unclear to what extent the specific

79 function of NPC members can be inferred from phylogeny. In comparisons between mice and

80 human, mutation of WD-40 repeat containing NPC member ALADIN did not produce the same

81 phenotypic outcomes (Huebner et al., 2006). It is unclear whether such species-specific

82 phenotypic impacts will characterize NPC functions in plants.

83 Here we describe the first characterization of an NPC mutant in maize and the first

84 description of an ALADIN mutant in plants. The aladin1-1 (ali1-1) mutant was identified in an

85 ethyl methanesulfonate (EMS) screen as a short plant with unusual tassel architecture and

86 defective subsidiary cell asymmetric division in developing stomata. The ali1-1 mutant results in

87 a weak allele and crosses with a null allele identified allelic dosage effects of the ali1 gene,

88 demonstrating that ali1-1 was haploinsufficient for maintaining normal development especially

89 after phase change. RNA-sequencing identified a compensatory increase in transcripts encoding

90 other NPC members in ali1-1, even during juvenile growth before the defects in SMC

91 asymmetric division were visible. These results implicate this gene in cell division control and

92 NPC homeostasis that may also be true for humans and contribute to AAAS disease.

93 Materials and Methods

94 Plant material and growth conditions

95 In the summer of 2010, the ali1-1 mutant was identified in a B73 background ethyl

96 methanesulfonate (EMS) population as M3 generation plants segregating in the line

97 04IAB73PS007D8 (Weil, 2009). The ali1-2 allele was created by an EMS-targeted mutagenesis

98 approach. B73 pollen was incubated with 6.48 mM EMS (Sigma-Aldrich, St. Louis, MO) in bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

99 paraffin oil (Sigma-Aldrich, St. Louis, MO) for 35 mins then squirted onto ~205 ali1-1/ali1-1

100 ears using a 40 mL squeezable bottle (Hobby Lobby, Oklahoma City, OK). ~10,000 M1 seeds

101 were screened in the field in the summer of 2015 in West Lafayette, IN for phenotypes similar to

102 ali1-1. A total of 13 plants resembling ali1-1 were identified. One of the twelve was

103 heterozygous for the causative single nucleotide polymorphism (SNP) in ali1-1. This plant was

104 backcrossed to ali1-1/ali1-1 and B73 to propagate the ali1-2 allele.

105 To map the ali1 gene, an F2 population was created by crossing Mo17 with ali1-1/ali1-1

106 pollen and self-pollinated the F1 generation. The F2 progeny was planted in the field to collect

107 tissue from selected wildtype and ali1-1 phenotypical plants. Wild-type and ali1-1/ali1-1 shoot

108 apical meristem (SAM) and surrounding tissue of 15 days after planting (DAP) plants were

109 grown in the greenhouse in trays with a 2:1 mixture of peat germinating mix (Conrad Fafard Inc.,

110 Agawam, MA) to Turface MVP (Profile Products LLC, Buffalo Grove, IL). Total plant height,

111 stomatal index, stomatal density, and percent aberrant stomata measurements of the 8th leaf were

112 collected from plants grown in the field in the summer of 2016 in West Lafayette, IN. Plant

113 height, internode length, tassel length, and rachis length of B73 and ali1-1 were measured on

114 field grown plants in the summer of 2013. The +/+, +/ali1-1, +/ali1-2, ali1-1/ali1-1, ali1-1/ali1-

115 2, and ali1-2/ali1-2 plants used for total plant photographs and epidermal peel photographs were

116 grown in the Purdue Horticulture Plant Growth Facility in the spring of 2016 and spring of 2017,

117 respectively. The nine individual BC1F2 plants used for DNA sequencing were grown in the

118 greenhouse in the spring of 2014. The temperature settings were 27ᵒC (day) and 21ᵒC (night)

119 with a 16 h day length provided by supplemental lighting. Plants were grown in two-gallon pots

120 in soilless media as previously described.

121 Phylogenetic analysis bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

122 Phylogenetic analysis was performed by obtaining protein homolog coding sequences of

123 GRMZM2G180205 through Phytozome version 10.2.2 (Goodstein et al., 2012) using the

124 Inparanoid method (O'Brien, Remm, & Sonnhammer, 2005) with a Dual Affine Smith-

125 Waterman score greater than 1,250 and sequence similarity of greater than 50%, resulting in 37

126 sequences from 32 taxa. Sequences were downloaded and a phylogenetic consensus tree was

127 obtained as previously described in (Best et al., 2016). The N-terminus sequence was trimmed

128 from species Manihot esculenta (cassava4_1.026236m), Malus domestica (MDP0000250771),

129 and Solanum tuberosum (PGSC0003DMG400017881) due to incorrect start sites based upon

130 alignment similarities.

131 Sequencing and linkage analysis of ali1 locus

132 To determine the DNA sequence of wild-type, ali1-1/ali1-1, and ali1-1/ali1-2, and ali1-2/ali1-2,

133 total DNA was extracted and amplified using the primers described in Table S1. PCR products

134 were sequenced (Psomagen Inc., Maryland) using the Sanger method (Sanger, Nicklen, &

135 Coulson, 1977). Restriction fragment length polymorphism genotyping of ali1-1 and ali1-2

136 alleles was performed using the derived Cleaved Amplified Polymorphic Sequences (dCAPS)

137 method (Neff, Neff, Chory, & Pepper, 1998) and separated on a 3% agarose gel in Tris-Acetate-

138 EDTA to observe size differences. For the ali1-1 dCAPS genotyping, polymerase chain reaction

139 (PCR) was carried out using primers DCali-1_FOR and ZmALI_REV+4119 (Table S1). The

140 amplified DNA was incubated with the restriction endonuclease TaqI (New England Biolabs;

141 Ipswich, MA) resulting in an uncut wild-type band of approximately 140 bp and the ali1-1

142 mutant amplicon was cleaved to 115 bp (Fig. S1). For the ali1-2 genotyping, amplification was

143 carried out using primers DCali-2_FOR and ZmALI_REV+3243 (Table S1) and the uncut wild-

144 type band was about 340bp and the ali1-2 mutant band was 320 bp following cleavage by the bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

145 restriction endonuclease HindIII (New England Biolabs; Ipswich, MA). Digestion of the ali1-2

146 fragments was incomplete and as a result, heterozygous and homozygous ali1-2 plants could not

147 be distinguished using this molecular marker (data not shown). M37W was crossed as ear parent

148 with ali1-1/ali1-1 pollen. F1 plants were selfed and F2 generation ali1-1/ali1-1 plants were

149 phenotyped and tissue was collected for genotyping by the dCAPS method in the summer of

150 2015. Linkage of ali1-1 to the rp1 locus (AC152495.1_FG002) on maize chromosome 10 was

151 determined by crossing ali1-1/ali1-1 ears with Rp1-D21/+ pollen (backcrossed 8 generations to

152 B73) and then backcrossing the F1 Rp1-D21 phenotype plants with ali1-1/ali1-1 as ear parents

153 (Pryor, 1993). The BC1 F1 generation was phenotyped for both the Rp1-D21 and ali1-1

154 phenotypes in the field during the summer of 2016.

155 Bulked segregant analysis and RNA sequencing

156 For bulked segregant analysis (Michelmore, Paran, & Kesseli, 1991) of SNP co-

157 segregation with ali1-1 and mRNA accumulation differences, total RNA was extracted

158 (Eggermont, Goderis, & Broekaert, 1996) from 2 replicates of 60 wild-type and 60 ali1-1/ali1-1

159 tassel stem punches at the location of the lowest primary tassel branch before tassel emergence.

160 Samples were taken from F2 individuals derived by selfing the F1 progeny from a cross of Mo17

161 ears pollinated with ali1-1/ali1-1. Non-stranded cDNA libraries were prepared with a TruSeq

162 RNA sample preparation kit v2 and sequenced on a HiSeq 2000 (Illumina, San Diego, CA) using

163 SBS v3-HS reagents for paired-end sequencing (2 x 100bp). Raw reads were quality filtered to

164 remove reads with less than 20 quality score and adapters were clipped using Trimmomatic

165 (version 0.22) (Bolger, Lohse, & Usadel, 2014) and fastx_clipper as a part of the FASTX-Toolkit

166 (version 0.0.13) (http://hannonlab.cshl.edu/fastx_toolkit/). Filtered reads were aligned to the B73

167 reference genome (version 3.30) using Bowtie2 (version 2.2.8) (Langmead & Salzberg, 2012). bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

168 Total reads and alignment rate are shown in Table S2. Polymorphisms between Mo17 and B73

169 were used to map the causative mutation in ali1-1 (Data table S1). Single-nucleotide

170 polymorphism positions were identified by aligning Mo17 Illumina sequence to the B73

171 reference genome and calling SNPs by SAMtools (version 1.3.1) (Li et al., 2009) “mpileup”

172 command. Only SNPs that were homozygous non-B73 reference, had reads on forward and

173 reverse strands, and had less than 12 reads aligning to respective position were retained and used

174 as SNPs for distinguishing sequencing reads from B73 and Mo17 chromosomes.

175 To map the causative mutation in ali1-1, B73 and Mo17 allele frequencies were

176 determined from the ali1-1/ali1-1 and wild-type samples and plotted in 100 SNP bins for each

177 maize chromosome (Fig. S2-S6). To identify potential causative mutations for the ali1

178 phenotype, SNPs that differed between the ali1-1 pools and B73 reference that were in coding

179 sequences were identified using SAMtools mpileup command and filtered to be homozygous

180 non-B73 reference, G to A or C to T transitions, and have reads on both forward and reverse

181 strands at the position. Identified SNP positions were then annotated for effect on coding

182 sequence and protein function using SnpEff (Cingolani et al., 2012). An Arabidopsis protein

183 BLAST database was created using BLAST (version 2.6.0+) and used to align all maize protein

184 sequences. Best hits were used to provide additional annotations to the maize genes using the

185 TAIR10 annotations (Lamesch et al., 2012). The E-value score cutoff was set at 10-5. Therefore,

186 if the best BLASTP result had an E-value greater than 10-5, the result was not included for

187 annotation and these columns are denoted with an asterisk. .

188 To identify differential mRNA accumulation between mutant and wild-type samples

189 (Data table S2 and S3), reads were aligned to B73 reference genome (version 3.30) using

190 Bowtie2 (version 2.2.8) (Langmead & Salzberg, 2012). Counts tables were created in HTseq bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

191 (version 0.6.1) (Anders, Pyl, & Huber, 2015) and passed to DESeq2 (R-bioconductor; version

192 3.3.0) (Love, Huber, & Anders, 2014). Dfferential expression between wild-type and ali1-1

193 samples were assessed using the “nbinomLRT” setting with “parametric” dispersion. Additional

194 annotation of maize differentially expressed genes was conducted by comparing Arabidopsis

195 (version TAIR10) and maize (version 3.30) proteomes using BLASTP (Tatusova & Madden,

196 1999). Genes were annotated as previously described.

197 DNA sequencing of ali1 mutants

198 DNA was extracted from nine individual ali1-1/ali1-1 plants, sonicated, and were libraries

199 constructed using the Illumina TruSeq DNA PCR-free LT Library Preparation protocol. Paired-

200 end 100 bp reads were generated on an Illumina HiSeq 2500 using SBS v3-HS reagents.

201 Sequencing statistics for the nine individual ali1-1/ali1-1;B73 BC1 plants are described in Table

202 S12. The nine fastq files were concatenated together for downstream analysis. Reads were

203 mapped to the B73 reference genome (version 3.30) using BWA (version 0.7.12) (Li & Durbin,

204 2009). SNPs in coding sequence between aligned reads and the reference genome were done as

205 previously described. Data table S6 shows high quality SNPs as called by SAMtools and

206 annotated for coding sequence effects by SnpEff.

207 Quantification of stomatal phenotypes

208 Epidermal imprints and peels were collected from field-grown B73 (+/+), +/ali1-1, ali1-1/ali1-1,

209 ali1-1/ali1-2, and ali1-2/ali1-2 plants. Epidermal cell layer imprints were produced from the

210 widest portion of the eighth leaf when the plants were at V9 stage using ethyl-2 cyanoacrylate

211 (Scotch SuperGlue; 3M, Maplewood, MN) applied to the leaves and then pressed onto and

212 recovered on glass microscope slides (Thermo Fisher Scientific, Waltham, MA). Imprints of the

213 abaxial leaf surfaces were observed by light microscopy using a UNICO H606T microscope bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

214 (United Products & Instruments Inc., Dayton, NJ). The percent aberrant stomata and subsidiary

215 cells were calculated by non-repeatedly randomly selecting viewable areas at 40X magnification

216 until total stomata observed per sample was greater than 500 (n=6 per genotype). Stomatal

217 density and indices were calculated by counting all the cells in 5 randomly selected viewable

218 areas between vasculature tissues for each imprint at 20X magnification. An average was

219 calculated from 5 viewable areas from each of 6 biological replicates per genotype. An

220 additional set of wild-type B73 (+/+), +/ali1-1, ali1-1/ali1-1, ali1-1/ali1-2, and ali1-2/ali1-2

221 plants were grown in the greenhouse and epidermal cell layer imprints were used for

222 quantification of aberrant stomata from the fourth leaf at V5 stage and tenth leaf at V11 stage

223 were conducted as previously stated.

224 Leaf epidermal peels were performed by cutting 1-cm squares from greenhouse-grown

225 plants and fixing the tissue in 4% formaldehyde, 50 mM KPO4, 5 mM EDTA, and 0.2% saponin

226 at pH 7.0 for at least 2 h at room temperature. Leaf tissue pieces were rinsed 3 times with ddH2O

227 and incubated in 100 mM Na-acetate, 1% cellulase, and 0.5% pectinase at pH 5.0 for at least 2 h

228 at room temperature. The tissue was then rinsed with ddH2O and the abaxial leaf epidermis was

229 peeled from the rest of the leaf and incubated in a 1:10 dilution of 0.05% TBO and 10 mM Na-

230 acetate until evenly stained. Epidermal peels were viewed and photographed using an Olympus

231 BX43 light microscope with Olympus DP80 camera (Olympus Corporation, Center Valley, PA)

232 at 40X magnification.

233 Results

234 Characterization and identification of the ali1 mutant

235 Mutagenized progeny of the maize inbred B73 (Weil, 2009) were screened in the M3

236 generation for reduced stature phenotypes in the field. The aladin1-1 (ali1-1) mutant was bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

237 identified as semi-dwarf maize plants with reduced tassel length in a single M3 family. Shown in

238 Fig. 1 are the ali1 mutant gross morphological phenotypes. The ali1-1 mutation was inherited as

239 a monogenic recessive trait after backcrossing to the wild-type B73 (Fig. 1 A,B). Field grown

240 ali1-1 mutants were significantly shorter than wild-type plants and exhibited a 29% or 27%

241 reduction in plant height measured to the tip of the tassel or flag leaf collar, respectively (Fig. 1

242 F,G). The reduction in plant height observed in ali1-1 mutants was due to compression of the

243 first two and last five internodes compared to wild-type siblings (Fig. 1 A, B, and H). The largest

244 suppression of internode length was observed in the internodes above the ears, which elongate

245 primarily after phase change has occurred (Fournier & Andrieu, 2000). Total tassel length of

246 ali1-1 mutants was 40% reduced compared to wild type (Fig. 1I). Tassel and stem elongation

247 were variably affected, and some tassels did not completely emerge from the leaf whorl. The

248 rachis length, as measured from the lowest tassel branch to the tip of the rachis, was 41% less in

249 ali1-1 mutants as compared to wild-type siblings and tassel internodes were shortened along the

250 entire distal axis of the tassel in the ali1-1 mutants (Fig. 1J). Tassel branching was also reduced

251 in ali1-1 mutants (Table S3). Visible phenotypes in ali1-1 mutants primarily affected adult

252 tissues that developed after phase change, suggesting a progressive effect on plant development

253 resulting from the ali1-1 mutation. Similar to field-grown plants, the ali1-1 mutant was

254 significantly shorter than wild type when grown in the greenhouse in spring months of 2016

255 (Table S3 and S4). By contrast, when grown in the greenhouse during the shorter days of winter

256 2015, ali1-1 mutants were considerably taller, possibly due to suppression of the mutant

257 phenotype by short days and/or low light quality and ali1-1 plants were visually

258 indistinguishable from wild-type siblings. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

259 The genetic map position for ali1-1 was determined by bulked-segregant analysis of

260 RNA-Seq data from F2 mutant and wild-type pools of ali1-1 x Mo17. Reads were mapped to the

261 B73 reference sequence and the allele frequencies at SNP positions between Mo17 and B73

262 (Data table S1) were scored in 100-SNP bins and graphed (Fig. S2-S5). A region near the

263 telomere of chromosome 10S approached homozygosity for B73 in the mutant pools (Fig. S6;

264 Data table S4-S7). To obtain additional linkage information, ali1-1 was crossed to Rp1-D21/+, a

265 hyper active allele of a NUCLEOTIDE-BINDING LEUCINE-RICH REPEAT (NLR) gene for

266 resistance to Puccina sorghi on 10S (Pryor, 1993), and F1 progeny were backcrossed to ali1-1

267 homozygotes. In the BC1 F1, 23 recombinant individuals were recovered out of 322 progeny,

268 demonstrating that ali1 was located 7.1 cM from the Rp1 locus on chromosome 10S (Table S5).

269 Genomic DNA was sequenced from ali1-1 mutants derived from nine independent ali1-1 x B73

270 BC1 F2 families. Within the mapped region, a single homozygous G to A transition was

271 identified which resulted in a premature stop codon in the last exon of GRMZM2G180205 (v4

272 gene model Zm00001d023264) removing the last 16 amino acids from the protein-coding

273 sequence (Fig. S7A, S8, S9, and Data table S8). Perfect co-segregation between the mutant

274 phenotype and this G to A transition (n=125) was observed in a F2 population derived by

275 crossing ali1-1 with the maize inbred line M37W. GRZM2G180205 encodes a WD-40 repeat

276 protein and the ortholog of the triple A syndrome (AAAS; OMIM 231550) human disease gene,

277 also called the ALacrimia-Achalasia-aDrenal Insufficiency Neurologic disorder1 (ALADIN1)

278 protein, which is a component of the NPC (Fig. S7B and S9). A large-scale duplication of ~20kb

279 at this locus resulted in a pseudogene annotated as GRZM2G180249 (v4 gene model

280 Zm00001d023266) and encoding sequences similar to the latter half of the protein sequence of

281 GRZM2G180205. All B73-derived ESTs in NCBI match the sequence of GRZM2G180205 and bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

282 not GRZM2G180249 at the 10 SNPs and N-terminal deletion that distinguish the paralogs (Table

283 S6). The ali1-1 mutant (Exon 16, W430*) resulted in an amber stop codon within the final WD-

284 40 domain of ALADIN1. A nonsense allele at the homologous position in the human ALADIN

285 protein encodes a disease allele (Exon 16, W474*) that results in moderate AAAS when

286 inherited in combination with a likely null allele, but has not been observed as a homozygote in

287 human (Houlden et al., 2002).

288 ali1 affects plant development and asymmetric cell division in an allelic dosage manner

289 A targeted EMS mutagenesis approach was used to generate additional mutant ali1

290 alleles. Mutants were used as ear parents and crossed with EMS-mutagenized B73 pollen. 10,000

291 M1 plants were screened for the ali1-1 phenotype and mutant plants were genotyped at the ali1-1

292 allele by dCAPS to distinguish pollen contaminants and gynogenetic haploids (Sarkar & Coe,

293 1966) from plants harboring novel alleles. Twelve plants displayed phenotypes reminiscent of

294 ali1-1, but 11 were homozygous for ali1-1. One plant was heterozygous for the ali1-1 mutation

295 and sequencing of GRMZM2G180205 isolated by PCR from DNA extracted from this plant

296 contained a new C-to-T transition at nucleotide position 2925 in exon 10 resulting in a premature

297 stop codon that would remove the last 134 amino acids (Fig. S7A, S8, and S9). Testcrosses to

298 ali1-1 and wild-type B73 confirmed that the new allele, ali1-2, failed to complement ali1-1, was

299 recessive to the wild-type allele, and that ali1-1/ali1-2 heterozygotes had a phenotype

300 intermediate to the two homozygotes (Fig. 1 F,G). The ali1-2 homozygotes were severely

301 reduced in height and arrest in development after producing 9-10 leaves, without developing a

302 tassel or ear or undergoing stem elongation (Fig. 1 D, E).

303 The mutant alleles displayed incomplete dominance to one another, unlike their recessive

304 relationship to the wild-type allele. The ali1-1/ali1-2 heterozygotes were 55% the height of bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

305 wildtype, 77% the height of ali1-1 homozygotes (Fig. 1 F,G), and were taller than ali1-2

306 homozygotes. In addition, unlike ali1-2 homozygotes which fail to produce any seeds, ali1-

307 1/ali1-2 heterozygotes were fertile. Given the greater severity of the ali1-2 phenotype, this

308 suggests that the gene product encoded by the ali1-1 allele was partially functional and dosage

309 sensitive.

310 Numerous defects in leaf morphology were visible in ali1-1 and ali1-2 mutants. Some

311 ali1-2 mutant leaves split and became necrotic at the midrib as they aged. Both ali1-2 and ali1-1

312 leaf surfaces were crinkly or wrinkled in appearance (Fig. 1). To investigate the basis of this,

313 epidermal peels were taken from one juvenile leaf (leaf 4) and one adult leaf (leaf 10) from

314 greenhouse-grown plants and an adult leaf 8 from field-grown plants. In adult leaves, both ali1-1

315 and ali1-2 mutants had more aberrant stomatal complexes than non-mutant plants, primarily due

316 to aberrant or a lack of subsidiary mother cell (SMC) divisions, and ali1-2 was more severely

317 affected than ali1-1 (Fig. 2 A-D). Inheritance of this leaf trait was monogenic recessive (Fig. 2

318 E-G). There were no discernable effects on nuclear shape in epidermal subsidiary or pavement

319 cells of ali1-1/ali1-1 plants compared to wild type when observed at maturity with 4′, 6-

320 diamidino-2-phenylindole (DAPI) staining (Fig. S10 and S11). Consistent with the greater

321 severity of defects in adult tissues, the ali1-1 mutants did not discernably alter SMC division in

322 the juvenile fourth leaf. The more severe ali1-2 mutant, on the other hand, did affect aberrant

323 SMC divisions in juvenile leaves indicating that the ali1 gene was necessary for normal juvenile

324 stomatal development.

325 Incomplete dominance between the mutant alleles was also observed for the SMC

326 division phenotypes. Normal SMC divisions were observed on the fourth leaf of ali1-1/ali1-2

327 plants grown in the greenhouse indicating that the protein encoded by ali1-1 was sufficient to bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

328 support normal SMC division in juvenile leaves and ali1-1 was dominant to ali1-2 (Fig. S12 A-

329 F). A greater proportion of stomatal complexes were aberrant on the eighth leaf of field grown

330 (Fig. S12 G-L) and the tenth leaf of greenhouse grown ali1-1/ali1-2 plants than in ali1-1

331 homozygous mutants, indicating that a single dose of ali1-1 was insufficient to support normal

332 development after phase change. The ali1-1/ali1-2 heterozygotes were still less severe than the

333 ali1-2 homozygotes in the greenhouse-grown adult tenth leaves indicating the same dosage

334 dependence as observed for height (Figure 1). Interestingly, the SMC division phenotypes of

335 ali1-1/ali1-2 heterozygotes and ali1-2 homozygotes were not different on the eighth leaf of field

336 grown plants, indicating that ali1-2 was completely dominant to ali1-1 for SMC division in adult

337 leaves in the field but not greenhouse conditions. The ali1-1 mutant plants are suppressed in the

338 greenhouse and the reduction in aberrant stomata of ali1-1/ali1-2 as compared to ali1-2 when

339 grown in the greenhouse is likely due to differences between the two growing environments (Fig.

340 1 and 2). The aberrant SMC divisions were not accompanied by defects in stomatal initiation as

341 there were no significant differences in stomatal indices or stomatal densities (Table S7 and S8).

342 Therefore, the SMC division defect was solely the result of failed asymmetric division and not

343 due to an increased number of guard mother cells or SMCs.

344 NPC members show a transcriptional compensation effect in ali1-1 mutants

345 To investigate the gene expression consequences of reduced ali1 function we performed

346 RNA-seq experiments comparing ali1-1 and wild type tissues. Tassels were the most severely

347 affected organ in ali1-1 mutants (Fig. 1). RNA was extracted from stem tissue in developing

348 tassels just before tassel emergence from the developing leaf whorl from wild-type and mutant

349 plants and differential gene expression was assessed by RNA-seq. Assessment of differential

350 gene expression identified 962 genes significantly up-regulated and 1719 genes down-regulated bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

351 in ali1-1 tassels as compared to wild type with FDR less than 0.05 and greater than two-fold

352 change (Data table S2). The ALADIN1 transcript was not differentially expressed in the

353 experiment. The presence of the ALADIN1 transcript in the ali1-1 mutant provides an

354 explanation for apparent partial function of the ali1-1 allele and indicates that the premature stop

355 codon that was still encoded by the last exon did not trigger nonsense-mediated decay of the

356 mRNA. Known determinants of asymmetric division in the SMC, PANGLOSS1 (PAN1) and

357 suppressor of cAMP receptor/Wiskott-Aldrich syndrome protein-family verprolin-homologous

358 protein (SCAR/WAVE) complex member BRICK1 (BRK1) (Facette et al., 2015; Gallagher &

359 Smith, 2000), were significantly down-regulated in ali1-1 tassels (Data table S9) suggesting that

360 mis-expression of these genes may contribute to aberrant control of SMC divisions in ali1

361 mutants. Among the differentially expressed genes, only four NPC genes, RIBONUCLEIC

362 ACID EXPORT1-LIKE1 (RAE1-L1), CANDIDATE GENE1 (CG1), NUCLEOPORIN205

363 (NUP205), and CONSTITUTIVE EXPRESSOR OF PR GENES5 (CPR5) were significantly up-

364 regulated in ali1-1 tassels (Fig. 3 and Table S9). RAE1 and ALADIN from A. thaliana

365 physically interact and CG1 was previously predicted to be in the same subcomplex as ALI1 on

366 the cytoplasmic region of the NPC (Tamura et al., 2010). To assess if other ALADIN-interacting

367 proteins might display compensatory changes in expression in the ali1-1 mutant, genes similar to

368 known ALADIN1-interacting proteins from humans were identified. Of the 64 maize sequences

369 similar to the human ALADIN protein interactors, six were differentially expressed genes at a

370 false discovery rate (FDR) of <0.05 including the C-TERMINAL DOMAIN NUCLEAR

371 ENVELOPE PHOSPHATASE1-L1 (CTDNEP1-L1), RAN BINDING PROTEIN2-L5

372 (RANBP2-L5), and RANBP2-L7 genes (Table S10). ALADIN has been shown in humans to be

373 anchored to the NPC via NUCLEAR DIVISION CYCLE1 (NDC1) (Gu et al., 2016; Kind, bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

374 Koehler, Lorenz, & Huebner, 2009; Yamazumi et al., 2009) but a maize homolog of this gene

375 was not differentially expressed in ali1-1 mutants. The NPC is comprised of ~30 subunits that

376 have been described in detail in Arabidopsis (Tamura et al., 2010) so we identified the maize

377 genes encoding the homologs of these genes (Fig. 3, Table S7, and Table S8). In developing

378 mutant tassels, the mRNA encoded by NPC component genes were more likely to be

379 accumulated at higher levels (40 of 49 expressed transcripts) in ali1-1 mutant tassel stem tissue

380 than in wild type (2 p-value = 9.49 E-06) (Fig. 3).

381 Unlike tassels, juvenile leaves were the least phenotypically affected aerial tissues in the

382 ali1 mutants. In an effort to better assess direct effects of ali1-1, we performed RNA-seq using

383 RNA extracted from mutant and wild-type leaves at 15 days after planting (DAP), before any

384 phenotypes were visible (Fig. 2 E and Fig. S12 D). Again, more NPC genes were up-regulated

385 than down-regulated in ali1-1 as compared to wild type (32 of 47 expressed transcripts; χ2 p-

386 value = 0.0131; Fig. 3, Table S11, and Data table S10). However, only 16 genes were

387 significantly up-regulated and 40 genes down-regulated after a transcriptome-wide FDR

388 adjustment and this dropped to 9-up and 14-down when a two-fold expression difference

389 threshold was applied (Data table S3). This indicates that the weak ali1-1 allele triggered the

390 accumulation of transcripts encoding NPC components prior to visible effects on plant growth or

391 SMC division defects. Of the maize homologs of ALADIN interactors in human, only RANBP2-

392 L4 was differentially expressed (Table S11).

393 Discussion

394 The ali1 mutants, identify a member of the NPC complex as critical for asymmetric

395 division in plants. A similar effect on subsidiary cell asymmetric division was recently observed

396 for the mlks2 mutant in maize; which is a component of the LINKER OF NUCLEOSKELETON bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

397 AND CYTOSKELETON (LINC) protein complex that spans the nuclear envelope but is not

398 associated with the NPC (Gumber et al., 2019). The MLKS2 transcript was not differentially

399 accumulated in ali1-1 mutants, nor were any other members of the LINC complex, including

400 SUN- and KASH-domain transcripts (Data Table S2). The LINC complex also affects nuclear

401 shape in plants (Meier, Griffis, Groves, & Wagner, 2016; Moser, Kirkpatrick, Groves, & Meier,

402 2020; Newman-Griffis, Del Cerro, Charpentier, & Meier, 2019; Thorpe & Charpentier, 2017;

403 Zhou, Graumann, Evans, & Meier, 2012; Zhou, Graumann, & Meier, 2015; Zhou, Groves, &

404 Meier, 2015; Zhou & Meier, 2013) and effects on nuclear shape are observed in the mlks2

405 mutant (Gumber et al., 2019) but were not observed in ali1-1 mutant leaves. To date, only one

406 mutant in a nuclear pore component, Nup136 in Arabidopsis, controls the shape and size of

407 nuclei (Tamura & Hara-Nishimura, 2011). In addition to our observations of normal nuclear

408 shape in ali1-1, no other studies of ALADIN1 homologs in other species identified an effect on

409 nuclear morphology (Huebner et al., 2009; Huebner et al., 2006).

410 The aberrant cell divisions in the ali1 mutants suggest that the NPC can affect nuclear

411 localization or asymmetric phragmoplast assembly at the site of asymmetric divisions. Other

412 mutants of maize, in addition to mlks2, result in aberrant SMC divisions. Among these are

413 mutants in genes encoding components of the actin-like protein containing SCAR/WAVE

414 complex (Djakovic, Dyachok, Burke, Frank, & Smith, 2006; Facette et al., 2015; Frank,

415 Cartwright, & Smith, 2003). Interestingly, the SCAR/WAVE component BRK1 mRNA is

416 decreased in ali1 mutants. The brick1 mutant results in a loss of epidermal crenulation, which are

417 more evident in adult leaves, and aberrant SMC divisions. Similarly, PAN1 mRNA is decreased

418 in ali1 (Table). The PAN1 protein is localized via the SCAR/WAVE complex and, mutants of

419 pan1 are also affected in asymmetric division and produce aberrant SMC. Given the similar bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

420 impacts on SMC divisions and the gene expression effects, ali1 may link the SCAR/WAVE

421 complex, required for actin polymerization and cytoskeletal dynamics, to nuclear positioning and

422 asymmetric division control. Exploration of the relationship between ALI1 and cell division

423 dynamics awaits future experimentation in maize as well as in human where these processes may

424 contribute to the etiology of AAAS.

425 Identification of the weak loss of function ali1-1 allele and the stronger ali1-2 allele

426 allowed us to investigate the dosage-dependent effects on phenotypes. Plant height and SMC

427 division displayed variation in phenotypic expression across an allelic series. The ali1-1 and

428 ali1-2 alleles were completely recessive when in combination with the wild-type allele,

429 indicating that one wild-type copy was sufficient to maintain NPC function. The ali1-1/ali1-2

430 heterozygote was more severe, for both plant height and SMC asymmetric cell division, than

431 ali1-1/ali1-1 mutants indicating that ali1-1 was haploinsufficient with the ali1-2 allele. These

432 effects were more obvious in adult tissues, adult leaves and stems, and were consistent with an

433 increasing demand for ALI1 after phase change. The observed increase in other phenomena

434 affected by SCAR/WAVE action, such as leaf crenulation, after phase chance may indicate a

435 greater accumulation or role for this protein complex in epidermal development of adult leaves.

436 If this is the case, greater accumulation of ALI1 may be required for stoichiometric protein-

437 protein interactions. This has the capacity to create the threshold effect on SMC divisions at the

438 higher levels of ALI1 activity provided by the ali1-1 mutant homozygotes. Further investigation

439 into these allelic combinations at the protein level and their interactions with determinants of

440 nuclear positioning and the other members of the NPC are needed to test this hypothesis.

441 Substantial differences were observed for the weak ali1-1 mutant phenotype depending on

442 whether they were grown in the field or the greenhouse. In repeated seasons, and plantings, ali1- bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

443 1 was substantially suppressed and nearly indistinguishable from wild-type siblings when grown

444 in the greenhouse. Though we do not know the cause of this environmentally-contingent

445 phenotype expression in ali1-1 it is reasonable to propose light quality and day length as factors.

446 The dracula2 mutant in Arabidopsis encodes a NUP98 ortholog and is involved in shade-

447 avoidance regulated gene expression (Gallemi et al., 2016). Future investigation into the effects

448 of the shade-avoidance response for ali1 needs to be done.

449

450 In this study, we show that the ali1 mutant was encoded by the maize ortholog of the

451 human disease gene AAAS. The ali1-1 allele is encoded by mutation of the codon for the

452 tryptophan at position 430 of the maize protein to a stop. Remarkably, the same position in the

453 human protein (W474) encodes a known disease allele that is also the result of a nonsense

454 mutation (Houlden et al., 2002). The human and mouse genes encode a C-terminal extension

455 (Fig. S9) but no function of this region has been identified. Deletions of the C-terminal extension

456 after the homologous ali1-1 position that remove all (Q490*) or part (R493*; V497*; or R500*)

457 of the C-terminal extension did not alter protein localization; however, a R478* allele which

458 truncates fewer amino acids than the maize ali1-1 mutation, did result in mis-localized GFP-

459 ALADIN in human cells (Janet M. Cronshaw & Matunis, 2003), and resulted in human disease

460 phenotypes. In humans this allele has only been clinically observed in heterozygous condition

461 and results in relatively mild disease in combination with a more severe mutant allele. Given the

462 incomplete dominance observed between ali1-1 and ali1-2 mutants, this suggests that this allele

463 is also haploinsufficient in humans (Houlden et al., 2002). It is unclear if homozygotes at the

464 human W474* allele would exhibit weaker, perhaps even subclinical, phenotypes consistent with

465 AAAS. The dramatic phenotypic impacts, and allelic series, available in maize mirror the bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

466 situation in humans. Further investigation into the transcriptional and cell biological

467 consequences of ali1-1 and ali1-2 may help identification of the cellular mechanisms responsible

468 for the progressive deleterious effects of mutating ali1 and provide a model system for

469 understanding AAAS in human.

470 Previously identified Arabidopsis mutants defective in NPC subunits alter nuclear

471 transport (Parry, 2014). NPC members also influence gene expression via binding chromatin,

472 changing the chromatin localization in the nucleoplasm, affecting nuclear export of mRNA, and

473 shuttling of proteins (Parry, 2015). The increased accumulation of mRNA encoding NPC

474 subunits in ali1-1 mutants suggests the existence of an NPC surveillance mechanism that can

475 increase the abundance of multiple transcripts encoding NPC subunits when the complex was

476 compromised. This effect was visible in ali1-1 mutants at the juvenile stage prior to any visible

477 phenotypic effects suggesting that it was not a secondary response to altered cellular morphology

478 in the mutants. In addition, the lack of a phenotype in juvenile plants may be the result of this

479 compensatory change in NPC subunit expression. If so, a mutagenesis experiment should recover

480 enhancers of the ali1-1 phenotype when this process is disrupted. It remains to be tested if the

481 observed compensation in NPC subunit transcripts in ali1-1 are the result of monitoring for

482 aberrant transport processes, as nuclear shape was unaltered in ali1-1 (Fig. S10 and S11).

483 Acknowledgments and comments 484 Seeds of ali1-1 and ali1-2 are available at the Maize Genetics COOP. Raw sequence data is 485 available at the Short Read Archive under BioSample accession numbers: 486 SAMN06764664, SAMN06764861, SAMN06765376, and SAMN07187450. 487 This work was supported by funds from the National Science Foundation to BPD and GJ (PGRP 488 # 1444503), B.S. (CAREER #1054918), and CW (PGRP #1025976). Work by NBB 489 supported by USDA-NIFA fellowships to N.B.B (NIFA #2017-67011-26077; #2019- 490 67012-29655), from the U.S. Department of Agriculture, National Institute of Food and 491 Agriculture. 492 Mention of trade names or commercial products in this publication is solely for the purpose of 493 providing specific information and does not imply recommendation or endorsement by bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

494 the U.S. Department of Agriculture. The U.S. Department of Agriculture is an equal 495 opportunity provider and employer 496 We would like to thank Jim Beaty and the crew at the Purdue University ACRE for help with 497 field grown maize used in these studies. This paper is presented as a gift on the occasion 498 of Jim Beaty’s retirement from Purdue in thanks for his support of graduate student 499 research. We would also like to thank Rob Eddy and the crew at the Purdue University 500 Horticulture Growth Facilities with assistance for greenhouse grown maize used in these 501 studies. 502 503 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

504 505 Fig. 1. Morphological features of ali1 mutants. (A) Mature wild-type (+/ali1-1), (B) ali1-1/ ali1 - 506 1, (C) ali1 -1/ ali1 -2, (D and E), and ali1 -2/ali1-2 plants grown in the greenhouse. (F) Total 507 plant height measured to tip of tassel and (G) plant height measured to flag leaf collar at maturity 508 of wild-type (n=17), +/ali1-1 (n=16), +/ali1-2 (n=20), ali1-1/ali1-1 (n=15), and ali1-1/ali1-2 509 (n=14) grown in the field. (H) Internode lengths of field-grown wild-type (n=25) and ali1-1/ali1- 510 1 (n=17) plants. Internode one indicates the internode closest to the soil. (I) Tassel length, 511 including the peduncle and rachis, of wild-type (n=25) and ali1-1/ali1-1 (n=17) plants. (J) 512 Rachis length of wild-type (n=25) and ali1-1/ali1-1 (n=17) plants measured from the lowest 513 tassel branch to the tip of the rachis. (A-E) Scale bars represents 20cm. (F-G) Connecting letter 514 report determined by Student’s T-test with Bonferroni corrected p-value (p<0.005) for multiple 515 testing. (H-J) asterisks indicate Student’s T-test (p<0.01) for comparisons between wild-type and 516 ali1-1/ali1-1 at given internode. (F-J) Error bars are standard deviations. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

517 518 Fig. 2. Aberrant stomatal complexes in ali1 mutants. (A-D) Leaf epidermal peels stained with 519 TBO of the 10th leaf of (A) wild-type, (B) ali1-1/ali1-1, (C) ali1-1/ali1-2, and (D) ali1-2/ali1-2 520 plants at V11 stage in the greenhouse. Black triangles indicate subsidiary cells of aberrant 521 stomata. Scale bars, 20µm. (E-G) The percentage of aberrant stomata in wild type (n=6), +/ali1- 522 1 (n=6), +/ali1-2 (n=6), ali1-1/ali1-1 (n=6), ali1-1/ali1-2 (n=6), and ali1-2/ali1-2 (n=6) from the 523 (E) 4th leaf at V5 stage or (F) 10th leaf at V11 stage grown in the greenhouse or (G) from the 8th 524 leaf at V9 stage grown in the field. (E-G) Error bars indicated standard deviation. Connecting 525 letter report indicating significance between genotypes determined by ANOVA and post-hoc 526 analysis using the Holm-Sidak algorithm. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

527 528 Fig. 3. NPC gene expression in ali1-1 mutants. Heatmap of NPC gene expression in ali1-1 529 tassels (left) and ali1-1 seedlings (right) as compared to respective wild type. Putative NPC 530 genes in maize were identified by BLASTP to NPC members from Arabidopsis (Kind et al. 531 2009; Tamura et al. 2010; Tamura and Hara-Nishimura 2013; Gu et al. 2016). Outlined gene 532 groups indicate sub-complexes within the NPC as relative location and structure is shown in the 533 middle figure. Gold color indicates down-regulation and blue indicates up-regulation of 534 respective transcript as indicated by the color key. Underlined transcripts (CG1, RAE1-L1, 535 NUP205, and CPR5-L2) were significant at genome-wide Benjamini-Hochberg corrected P < 536 0.05 for ali1-1 tassels (left). The observed and expected down-regulated and up-regulated 537 transcripts in the NPC, hypothesis test, and 2 p-value are shown below the color key and 538 histogram for both the tassel and seedling data. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

539 Supplementary Materials: 540 Figures S1-S12 541 Tables S1-S12 542 External Databases S1-S10 543 544 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

545 Literature Cited: 546 Anders, S., Pyl, P. T., & Huber, W. (2015). HTSeq--a Python framework to work with high- 547 throughput sequencing data. Bioinformatics, 31(2), 166-169. 548 doi:10.1093/bioinformatics/btu638 549 Best, N. B., Hartwig, T., Budka, J., Fujioka, S., Johal, G., Schulz, B., & Dilkes, B. P. (2016). 550 nana plant2 encodes a maize ortholog of the Arabidopsis brassinosteroid biosynthesis 551 gene DWARF1, identifying developmental interactions between brassinosteroids and 552 gibberellins. Plant Physiol, 171(4), 2633-2647. doi:10.1104/pp.16.00399 553 Binder, A., & Parniske, M. (2018). The Nuclear Pore Complex in Symbiosis and Pathogen 554 Defence. In Annual Plant Reviews online (pp. 229-254). 555 Bolger, A. M., Lohse, M., & Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina 556 sequence data. Bioinformatics, 30(15), 2114-2120. doi:10.1093/bioinformatics/btu170 557 Cheng, Y. T., Germain, H., Wiermer, M., Bi, D., Xu, F., Garcia, A. V., . . . Li, X. (2009). 558 Nuclear pore complex component MOS7/Nup88 is required for innate immunity and 559 nuclear accumulation of defense regulators in Arabidopsis. Plant Cell, 21(8), 2503-2516. 560 doi:10.1105/tpc.108.064519 561 Cingolani, P., Platts, A., Wang le, L., Coon, M., Nguyen, T., Wang, L., . . . Ruden, D. M. (2012). 562 A program for annotating and predicting the effects of single nucleotide polymorphisms, 563 SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 564 (Austin), 6(2), 80-92. doi:10.4161/fly.19695 565 Cronshaw, J. M., Krutchinsky, A. N., Zhang, W., Chait, B. T., & Matunis, M. J. (2002). 566 Proteomic analysis of the mammalian nuclear pore complex. Journal of Cell Biology, 567 158(5), 915-927. doi:10.1083/jcb.200206106 568 Cronshaw, J. M., & Matunis, M. J. (2003). The nuclear pore complex protein ALADIN is 569 mislocalized in triple A syndrome. Proceeedings of the National Academy of Science, 570 100(10), 5823-5827. doi:10.1073/pnas.1031047100 571 Djakovic, S., Dyachok, J., Burke, M., Frank, M. J., & Smith, L. G. (2006). BRICK1/HSPC300 572 functions with SCAR and the ARP2/3 complex to regulate epidermal cell shape in 573 Arabidopsis. Development, 133(6), 1091-1100. doi:10.1242/dev.02280 574 Dong, C. H., Hu, X., Tang, W., Zheng, X., Kim, Y. S., Lee, B. H., & Zhu, J. K. (2006). A 575 putative Arabidopsis nucleoporin, AtNUP160, is critical for RNA export and required for 576 plant tolerance to cold stress. Mol Cell Biol, 26(24), 9533-9543. 577 doi:10.1128/MCB.01063-06 578 Eggermont, K., Goderis, I. J., & Broekaert, W. F. (1996). High-throughput RNA extraction from 579 plant samples based on homogenisation by reciprocal shaking in the presence of a 580 mixture of sand and glass beads. Plant Molecular Biology Reporter, 14(3), 273-279. 581 doi:Doi 10.1007/Bf02671663 582 Facette, M. R., Park, Y., Sutimantanapi, D., Luo, A., Cartwright, H. N., Yang, B., . . . Smith, L. 583 G. (2015). The SCAR/WAVE complex polarizes PAN receptors and promotes division 584 asymmetry in maize. Nat Plants, 1, 14024. doi:10.1038/nplants.2014.24 585 Fiserova, J., Kiseleva, E., & Goldberg, M. W. (2009). Nuclear envelope and nuclear pore 586 complex structure and organization in tobacco BY-2 cells. Plant J, 59(2), 243-255. 587 doi:10.1111/j.1365-313X.2009.03865.x 588 Fournier, C., & Andrieu, B. (2000). Dynamics of the elongation of internodes in maize (Zea 589 mays L.): Analysis of phases of elongation and their relationships to phytomer 590 development. Annals of Botany, 86(3), 551-563. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

591 Frank, M. J., Cartwright, H. N., & Smith, L. G. (2003). Three Brick genes have distinct functions 592 in a common pathway promoting polarized cell division and cell morphogenesis in the 593 maize leaf epidermis. Development, 130(4), 753-762. doi:10.1242/dev.00290 594 Gallagher, K., & Smith, L. G. (2000). Roles for polarity and nuclear determinants in specifying 595 daughter cell fates after an asymmetric cell division in the maize leaf. Curr Biol, 10(19), 596 1229-1232. doi:10.1016/s0960-9822(00)00730-2 597 Gallemi, M., Galstyan, A., Paulisic, S., Then, C., Ferrandez-Ayela, A., Lorenzo-Orts, L., . . . 598 Martinez-Garcia, J. F. (2016). DRACULA2 is a dynamic nucleoporin with a role in 599 regulating the shade avoidance syndrome in Arabidopsis. Development, 143(9), 1623- 600 1631. doi:10.1242/dev.130211 601 Goodstein, D. M., Shu, S., Howson, R., Neupane, R., Hayes, R. D., Fazo, J., . . . Rokhsar, D. S. 602 (2012). Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res, 603 40(Database issue), D1178-1186. doi:10.1093/nar/gkr944 604 Gu, Y., Zebell, S. G., Liang, Z., Wang, S., Kang, B. H., & Dong, X. (2016). Nuclear pore 605 permeabilization is a convergent signaling event in effector-triggered immunity. Cell, 606 166(6), 1526-1538 e1511. doi:10.1016/j.cell.2016.07.042 607 Gumber, H. K., McKenna, J. F., Tolmie, A. F., Jalovec, A. M., Kartick, A. C., Graumann, K., & 608 Bass, H. W. (2019). MLKS2 is an ARM domain and F-actin-associated KASH protein 609 that functions in stomatal complex development and meiotic chromosome segregation. 610 Nucleus, 10(1), 144-166. doi:10.1080/19491034.2019.1629795 611 Houlden, H., Smith, S., Carvalho, M. d., Blake, J., Mathias, C., Wood, N. W., & Reilly, M. M. 612 (2002). Clinical and genetic characterization of families with triple A (Allgrove) 613 syndrome. Brain, 125, 2681-2690. 614 Huebner, A., Kaindl, A. M., Knobeloch, K. P., Petzold, H., Mann, P., & Koehler, K. (2009). The 615 Triple A syndrome is due to mutations in ALADIN, a novel member of the nuclear pore 616 complex. Endocrine Research, 30(4), 891-8999. doi:10.1081/ERC-200044138 617 Huebner, A., Mann, P., Rohde, E., Kaindl, A. M., Witt, M., Verkade, P., . . . Koehler, K. (2006). 618 Mice lacking the nuclear pore complex protein ALADIN show female infertility but fail 619 to develop a phenotype resembling human triple A syndrome. Mol Cell Biol, 26(5), 1879- 620 1887. doi:10.1128/MCB.26.5.1879-1887.2006 621 Kind, B., Koehler, K., Lorenz, M., & Huebner, A. (2009). The nuclear pore complex protein 622 ALADIN is anchored via NDC1 but not via POM121 and GP210 in the nuclear envelope. 623 Biochem Biophys Res Commun, 390(2), 205-210. doi:10.1016/j.bbrc.2009.09.080 624 Lamesch, P., Berardini, T. Z., Li, D., Swarbreck, D., Wilks, C., Sasidharan, R., . . . Huala, E. 625 (2012). The Arabidopsis Information Resource (TAIR): improved gene annotation and 626 new tools. Nucleic Acids Res, 40(Database issue), D1202-1210. doi:10.1093/nar/gkr1090 627 Langmead, B., & Salzberg, S. L. (2012). Fast gapped-read alignment with Bowtie 2. Nat 628 Methods, 9(4), 357-359. doi:10.1038/nmeth.1923 629 Li, H., & Durbin, R. (2009). Fast and accurate short read alignment with Burrows-Wheeler 630 transform. Bioinformatics, 25(14), 1754-1760. doi:10.1093/bioinformatics/btp324 631 Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., . . . Genome Project Data 632 Processing, S. (2009). The Sequence Alignment/Map format and SAMtools. 633 Bioinformatics, 25(16), 2078-2079. doi:10.1093/bioinformatics/btp352 634 Lin, D. H., Stuwe, T., Schilbach, S., Rundlet, E. J., Perriches, T., Mobbs, G., . . . Hoelz, A. 635 (2016). Architecture of the symmetric core of the nuclear pore. Science, 352(6283), 636 aaf1015. doi:10.1126/science.aaf1015 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

637 Liu, H. L., De Souza, C. P., Osmani, A. H., & Osmani, S. A. (2009). The three fungal 638 transmembrane nuclear pore complex proteins of Aspergillus nidulans are dispensable in 639 the presence of an intact An-Nup84-120 complex. Mol Biol Cell, 20(2), 616-630. 640 doi:10.1091/mbc.E08-06-0628 641 Love, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and 642 dispersion for RNA-seq data with DESeq2. Genome Biol, 15(12), 550. 643 doi:10.1186/s13059-014-0550-8 644 Meier, I., Griffis, A. H., Groves, N. R., & Wagner, A. (2016). Regulation of nuclear shape and 645 size in plants. Curr Opin Cell Biol, 40, 114-123. doi:10.1016/j.ceb.2016.03.005 646 Michelmore, R. W., Paran, I., & Kesseli, R. V. (1991). Identification of Markers Linked to 647 Disease-Resistance Genes by Bulked Segregant Analysis - a Rapid Method to Detect 648 Markers in Specific Genomic Regions by Using Segregating Populations. Proceedings of 649 the National Academy of Sciences of the United States of America, 88(21), 9828-9832. 650 doi:DOI 10.1073/pnas.88.21.9828 651 Moser, M., Kirkpatrick, A., Groves, N. R., & Meier, I. (2020). LINC-complex mediated 652 positioning of the vegetative nucleus is involved in calcium and ROS signaling in 653 Arabidopsis pollen tubes. Nucleus, 11(1), 149-163. doi:10.1080/19491034.2020.1783783 654 Neff, M. M., Neff, J. D., Chory, J., & Pepper, A. E. (1998). dCAPS, a simple technique for the 655 genetic analysis of single nucleotide polymorphisms: experimental applications in 656 Arabidopsis thaliana genetics. Plant J, 14(3), 387-392. doi:10.1046/j.1365- 657 313x.1998.00124.x 658 Neumann, N., Jeffares, D. C., & Poole, A. M. (2006). Outsourcing the nucleus: nuclear pore 659 complex genes are no longer encoded in nucleomorph genomes. Evolutionary 660 Bioinformatics, 2, 23-34. 661 Newman-Griffis, A. H., Del Cerro, P., Charpentier, M., & Meier, I. (2019). Medicago LINC 662 Complexes Function in Nuclear Morphology, Nuclear Movement, and Root Nodule 663 Symbiosis. Plant Physiol, 179(2), 491-506. doi:10.1104/pp.18.01111 664 Nofrini, V., Di Giacomo, D., & Mecucci, C. (2016). Nucleoporin genes in human diseases. Eur J 665 Hum Genet, 24(10), 1388-1395. doi:10.1038/ejhg.2016.25 666 O'Brien, K. P., Remm, M., & Sonnhammer, E. L. (2005). Inparanoid: a comprehensive database 667 of eukaryotic orthologs. Nucleic Acids Res, 33(Database issue), D476-480. 668 doi:10.1093/nar/gki107 669 Parry, G. (2014). Components of the Arabidopsis nuclear pore complex play multiple diverse 670 roles in control of plant growth. J Exp Bot, 65(20), 6057-6067. doi:10.1093/jxb/eru346 671 Parry, G. (2015). The plant nuclear envelope and regulation of gene expression. J Exp Bot, 66(6), 672 1673-1685. doi:10.1093/jxb/erv023 673 Pryor, A. (1993). Transposon tagging of a rust resistance gene in maize. (E. W. N. a. D. P. S. 674 Verma Ed. In Advances in Molecular Genetics of Plant-Microbe Interaction ed. Vol. 2). 675 Dordrecht,The Netherlands: Kluwer Academic Publisher. 676 Rasala, B. A., Orjalo, A. V., Shen, Z. X., Briggs, S., & Forbes, D. J. (2006). ELYS is a dual 677 nucleoporin/kinetochore protein required for nuclear pore assembly and proper cell 678 division. Proceedings of the National Academy of Sciences of the United States of 679 America, 103(47), 17801-17806. doi:10.1073/pnas.0608484103 680 Reichelt, R., Holzenburg, A., Buhle, E. L., Jarnik, M., Engel, A., & Aebi, U. (1990). Correlation 681 between Structure and Mass-Distribution of the Nuclear-Pore Complex and of Distinct bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

682 Pore Complex Components. Journal of Cell Biology, 110(4), 883-894. doi:DOI 683 10.1083/jcb.110.4.883 684 Roth, C., & Wiermer, M. (2012). Nucleoporins Nup160 and Seh1 are required for disease 685 resistance in Arabidopsis. Plant Signal Behav, 7(10), 1212-1214. doi:10.4161/psb.21426 686 Rout, M. P., Aitchison, J. D., Suprapto, A., Hjertaas, K., Zhao, Y., & Chait, B. T. (2000). The 687 yeast nuclear pore complex: composition, architecture, and transport mechanism. Journal 688 of Cell Biology, 148(4), 635-651. doi:10.1083/jcb.148.4.635 689 Sakuma, S., & D'Angelo, M. A. (2017). The roles of the nuclear pore complex in cellular 690 dysfunction, aging and disease. Semin Cell Dev Biol, 68, 72-84. 691 doi:10.1016/j.semcdb.2017.05.006 692 Sanger, F., Nicklen, S., & Coulson, A. R. (1977). DNA sequencing with chain-terminating 693 inhibitors. Proc Natl Acad Sci U S A, 74(12), 5463-5467. doi:10.1073/pnas.74.12.5463 694 Sarkar, K. R., & Coe, E. H. (1966). A genetic analysis of the origin of maternal haploids in 695 maize. Genetics, 54(2), 453-464. Retrieved from 696 https://www.ncbi.nlm.nih.gov/pubmed/17248321 697 Stuwe, T., Bley, C. J., Thierbach, K., Petrovic, S., Schilbach, S., Mayo, D. J., . . . Hoelz, A. 698 (2015). Architecture of the fungal nuclear pore inner ring complex. Science, 350(6256), 699 56-64. doi:10.1126/science.aac9176 700 Tamura, K., Fukao, Y., Iwamoto, M., Haraguchi, T., & Hara-Nishimura, I. (2010). Identification 701 and characterization of nuclear pore complex components in Arabidopsis thaliana. Plant 702 Cell, 22(12), 4084-4097. doi:10.1105/tpc.110.079947 703 Tamura, K., & Hara-Nishimura, I. (2011). Involvement of the nuclear pore complex in 704 morphology of the plant nucleus. Nucleus, 2(3), 168-172. doi:10.4161/nucl.2.3.16175 705 Tamura, K., & Hara-Nishimura, I. (2013). The molecular architecture of the plant nuclear pore 706 complex. J Exp Bot, 64(4), 823-832. doi:10.1093/jxb/ers258 707 Tatusova, T. A., & Madden, T. L. (1999). BLAST 2 Sequences, a new tool for comparing 708 protein and nucleotide sequences. FEMS Microbiol Lett, 174(2), 247-250. 709 doi:10.1111/j.1574-6968.1999.tb13575.x 710 Thorpe, S. D., & Charpentier, M. (2017). Highlight on the dynamic organization of the nucleus. 711 Nucleus, 8(1), 2-10. doi:10.1080/19491034.2016.1243634 712 Weil, C. F. (2009). TILLING in grass species. Plant Physiol, 149(1), 158-164. 713 doi:10.1104/pp.108.128785 714 Wiermer, M., Cheng, Y. T., Imkampe, J., Li, M., Wang, D., Lipka, V., & Li, X. (2012). Putative 715 members of the Arabidopsis Nup107-160 nuclear pore sub-complex contribute to 716 pathogen defense. Plant J, 70(5), 796-808. doi:10.1111/j.1365-313X.2012.04928.x 717 Yamazumi, Y., Kamiya, A., Nishida, A., Nishihara, A., Iemura, S., Natsume, T., & Akiyama, T. 718 (2009). The transmembrane nucleoporin NDC1 is required for targeting of ALADIN to 719 nuclear pore complexes. Biochem Biophys Res Commun, 389(1), 100-104. 720 doi:10.1016/j.bbrc.2009.08.096 721 Zhang, Y., & Li, X. (2005). A putative nucleoporin 96 Is required for both basal defense and 722 constitutive resistance responses mediated by suppressor of npr1-1,constitutive 1. Plant 723 Cell, 17(4), 1306-1316. doi:10.1105/tpc.104.029926 724 Zhou, X., Graumann, K., Evans, D. E., & Meier, I. (2012). Novel plant SUN-KASH bridges are 725 involved in RanGAP anchoring and nuclear shape determination. Journal of Cell 726 Biology, 196(2), 203-211. doi:10.1083/jcb.201108098 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

727 Zhou, X., Graumann, K., & Meier, I. (2015). The plant nuclear envelope as a multifunctional 728 platform LINCed by SUN and KASH. J Exp Bot, 66(6), 1649-1659. 729 doi:10.1093/jxb/erv082 730 Zhou, X., Groves, N. R., & Meier, I. (2015). Plant nuclear shape is independently determined by 731 the SUN-WIP-WIT2-myosin XI-i complex and CRWN1. Nucleus, 6(2), 144-153. 732 doi:10.1080/19491034.2014.1003512 733 Zhou, X., & Meier, I. (2013). How plants LINC the SUN to KASH. Nucleus, 4(3), 206-215. 734 doi:10.4161/nucl.24088 735 736 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

737 Supplementary Materials for: 738 739 Mutation of the nuclear pore complex component, aladin1, disrupts asymmetric 740 division in Zea mays (maize) 741 Norman B. Best, Charles Addo-Quaye, Bong-Kuk Kim, Clifford F. Weil, Burkhard Schulz, Guri 742 Johal, Brian P. Dilkes. 743 744 correspondence to: [email protected] 745 746 747 This file includes: 748 749 Figs. S1 to S12 750 Tables S1 to S12 751 Captions for databases S1 to S10 752 753 Other Supplementary Materials for this manuscript includes the following: 754 755 Data table S1 to S10 as zipped archives: 756 B73_Mo17_SNPs_CDS.zip 757 DESEQ2_ALI_TASSEL.zip 758 DESEQ2_ALI_15DAP.zip 759 ALI1_REP1_RNA_CALLSNPs.zip 760 ALI1_REP2_RNA_CALLSNPs.zip 761 WT_REP1_RNA_CALLSNPs.zip 762 WT_REP2_RNA_CALLSNPs.zip 763 ALI1_DNA_CALLSNPs.zip 764 INTEREST_TASSEL.zip 765 INTEREST_15DAP.zip 766 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

767

768 Fig. S1 769 Gel image of genotyping of ali1-1 allele. After restriction digest of the PCR product using TaqI 770 the wild-type and ali1-1 mutant bands could clearly be distinguished when run at 95 volts for 771 two hours on a 3% agarose gel. A hyperladder IV standard is shown for size reference (left) with 772 wild-type (left center), ali1-1 homozygote (right center), and heterozygous (right) PCR product 773 with TaqI digest is shown. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

774 775 Fig. S2 776 Allele frequency for replicate one of wild-type pools of F2 plants of ali1-1/ali1-1 crossed with 777 Mo17. Allele frequencies of non-overlapping bins of 100 coding sequence SNPs between B73 778 reference (value of “1” on y-axis) and Mo17 (value of “0” on y-axis) for all 10 maize 779 chromosomes. A cubic spline curve with lambda 0.05 is shown on each plot. 780 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

781 782 Fig. S3 783 Allele frequency for replicate two of wild-type pools of F2 plants of ali1-1/ali1-1 crossed with 784 Mo17. Allele frequencies of non-overlapping bins of 100 coding sequence SNPs between B73 785 reference (value of “1” on y-axis) and Mo17 (value of “0” on y-axis) for all 10 maize 786 chromosomes. A cubic spline curve with lambda 0.05 is shown on each plot. 787 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

788 789 Fig. S4 790 Allele frequency for replicate one of ali1-1 pools of F2 plants of ali1-1/ali1-1 crossed with 791 Mo17. Allele frequencies of non-overlapping bins of 100 coding sequence SNPs between B73 792 reference (value of “1” on y-axis) and Mo17 (value of “0” on y-axis) for all 10 maize 793 chromosomes. A cubic spline curve with lambda 0.05 is shown on each plot. 794 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

795 796 Fig. S5 797 Allele frequency for replicate two of ali1-1 pools of F2 plants of ali1-1/ali1-1 crossed with 798 Mo17. Allele frequencies of non-overlapping bins of 100 coding sequence SNPs between B73 799 reference (value of “1” on y-axis) and Mo17 (value of “0” on y-axis) for all 10 maize 800 chromosomes. A cubic spline curve with lambda 0.05 is shown on each plot. 801 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

802 803 Fig. S6 804 Mapping of the ali1 gene. SNP allele frequency averages on chromosome 10 from two replicates 805 of pooled (A) phenotypical wild-type siblings and (B) ali1-1/ali1-1. SNP allele frequency of ali1 806 mapped region from (C) phenotypical wild-type sibling pools and (D) ali1-1/ali1-1 pools. Allele 807 frequencies are plotted on the y-axis for pools of F2 progeny from an ali11/ali1-1;B73 x Mo17 808 self. The y-axis corresponds to the reference genotype frequency in non-overlapping bins of 100 809 coding sequence SNP per point. The x-axis indicates physical position on chromosome 10. A 810 cubic spline curve with lambda 0.05 is shown. (B and D) The ali1 physical position is marked by 811 a red arrow. 812 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

813

814 Fig. S7 815 Gene structure of the maize ali1 gene and phylogenetic tree of ali1 genes from 32 plant taxa. (A) 816 Gene structure of ali1 and the position of mutations affecting the ali1-1 and ali1-2 alleles are 817 shown as dashed lines. Both alleles result in a premature termination codon, as indicated above 818 the allele designations. Exons are represented by white boxes and the introns as grey lines. (B) A 819 consensus maximum likelihood, Bayesian Markov chain Monte Carlo, phylogenetic tree of 820 nucleotide coding sequences derived from the ali1 genes identified within 32 plant genome 821 assemblies in Phytozome. The scale bar indicates the number of codon changes per orthologous 822 site. Posterior probabilities for selected nodes are indicated. The lycophyte species, Selaginella 823 moellendorffii, and bryophyte species, Physcomitrella patens, were used as an out-group. The 824 maize ali1 gene is indicated by bold text. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

825 826

827 Fig. S8 828 Gene structure of (A) ali1 locus (GRMZM2G180205). Thick portions indicate exons. IGV tracks 829 for RNA reads of WT 15d SAM and surrounding tissue samples (B) one, (C) two, and (D) three. 830 IGV tracks for RNA reads of ali1-1 SAM samples for replicates (E) one, (F) two, and (G) three. 831 Gray peaks indicate RNA reads aligned to B73 reference genome. (E-G) Green peak in the 14th 832 exon of ali1-1 samples indicates causative mutation. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

833

834 Fig. S9 835 Multiple sequence alignment of the maize ali1 protein sequence with orthologous sequences. 836 Black background indicates identity conservation of ≥85%, grey specifies conservation of ≥50%, 837 and white background indicates ≤50% conservation. The location of the termination codon in bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

838 ali1-1 and ali1-2 are shown by a red asterisk above the multiple sequence alignment, with the 839 tryptophan codon for ali1-1 being highlighted in red. The location of previously studied 840 nonsense mutations in Homo sapiens and their effects on localization of the ALADIN1 protein 841 are indicated by a blue asterisk below the multiple sequence alignment. Periods designate gaps in 842 the alignment. Zm, Zea mays (GRMZM2G180205); Sb, Sorghum bicolor (Sobic. 008G017200); 843 Oz, Oryza sativa (LOC_Os12g03540); Oz*, Oryza sativa (LOC_Os11g03794); Si, Setaria 844 italica (Seita.7G310400); Si*, Setaria italica (Seita.8G003800); At, Arabidopsis thaliana 845 (AT3G56900); Pt, Populus trichocarpa (Potri.016G030400); Tc, Theobroma cacao 846 (Thecc1EG024170); Gm, Glycine max (Glyma.19G125000); Gm*, Glycine max 847 (Glyma.03G120400); Pp, Physcomitrella patens (Pp3c11_18220); Sm, Selaginella moellendorfii 848 (146571); Sm*, Selaginella moellendorfii (136772); Mm, Mus musculus (uc007xvl.2); Hs, Homo 849 sapiens (uc001scr.5). 850 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

851

852 Fig. S10

853 Microscopy of wild-type epidermal cells with 4′, 6-diamidino-2-phenylindole (DAPI) staining to 854 show nuclear morphology. Five replications of wild-type epidermal peels stained with DAPI 855 solution (1 µg/1ml in 1xPBS, pH 8.0) for overnight in dark. DAPI stained epidermal cells were 856 imaged with a Zeiss 880 upright laser scanning confocal microscope. DAPI was excited at 358 857 nm and visualized with a 461 nm band pass emission filter channel (A-E). Images from each 858 individual sample were also observed with a chlorophyll-a channel (F-J), photomultiplier tube 859 (PMT) channel (K-O), and all three channels merged (P-T). Red scale bars represent 20 µm (A- 860 T). bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

861

862 Fig. S11

863 Microscopy of ali1-1/ali1-1 epidermal cells with 4′, 6-diamidino-2-phenylindole (DAPI) staining 864 to show nuclear morphology. Five replications of ali1-1/ali1-1 epidermal peels stained with 865 DAPI solution (1 µg/1ml in 1xPBS, pH 8.0) for overnight in dark. DAPI was excited at 358 nm 866 and visualized with a 461 nm band pass emission filter channel (A-E). Images from each 867 individual sample were also observed with a chlorophyll-a channel (F-J), photomultiplier tube 868 (PMT) channel (K-O), and all three channels merged (P-T). Scale bar represents 20 µm (A-T). bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

869

870 Fig. S12 871 Aberrant stomatal complexes and abnormal cell morphology phenotypes of ali1 mutants. (A-F) 872 Epidermal peels from the 4th leaf abaxial surface at V5 stage of (A) WT, (B) +/ali1-1, (C) 873 +/ali1-2, (D) ali1-1/ali1-1, (E) ali1-1/ali1-2, and (F) ali1-2/ali1-2 plants grown in the 874 greenhouse. (G-L) Epidermal imprints from the 8th leaf abaxial surface at V9 stage of (G) WT, 875 (H) +/ali1-1, (I) +/ali1-2, (J) ali1-1/ali1-1, (K) ali1-1/ali1-2, and (L) ali1-2/ali1-2 plants grown 876 in the field. (A-L) Black triangles indicate subsidiary cells of aberrant stomata. Scale bar, 20µm. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

877 Table S1. 878 Primers used in this study. Primer Name Primer Sequence- 5’ to 3’ ZmALI_FOR-1027 GAAATCATCCAGGGTAGGGGTG ZmALI_FOR-522 AGATTGTGCGGGCTCCTGC ZmALI_FOR-97 GCTGCCTCGTGTACTGGTCG ZmALI_FOR+328 TTGCAGGGGATGGTGTTCG ZmALI_REV+480 CTGAAGAAGTCGGATATGGTGGCT ZmALI_FOR+627 TGCTGTTCACATTGGATTGTCCT ZmALI_REV+719 GCGGGTATCTCTGGGGACAA ZmALI_FOR+1244 CATTGCTTAGCATTCGTGTCTGG ZmALI_REV+1314 CGATCTTACCTGAGTCCTCAAAGT ZmALI_REV+2014 TCGGTTAGTCGGTTATTAGGTTGT ZmALI_FOR+2215 TGGGAAATTTCAACGGTTGAAG ZmALI_FOR+2799 TGGCAACACAAATAATGTGCCC ZmALI_FOR+2980 ATCGAAGCCACCATCTTTAGGTA ZmALI_REV+3003 TACCTAAAGATGGTGGCTTCGAT ZmALI_FOR+3222 (3243) TTGCACGCTAATTTTGGCTGT ZmALI_REV+3243 ACAGCCAAAATTAGCGTGCAA ZmALI_FOR+3445 GATTCCGCTGTCTGCTGTCG ZmALI_FOR+3663 AATGTACCGTGGCCTGATCG ZmALI_REV+3791 TGGTGATTACGGAAAGTCAATGGA ZmALI_REV+4119 GAGAACTAGTCAATACGGACGGAGG DCali-1_FOR (TaqI) GGTTCTGACCGTTTACGCAGTGTCG DCali-2_FOR (HindIII) GGAGCAAATTGGGACCCAGAAGCT

879 880 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

881 Table S2. 882 High through-put sequencing information and statistics. Number of Sample Alignment Rate/ SRA ID Study ID File IDa Paired-end Type Gen. Cov. (v3.30) Reads SRR5456942 SRP104197 RNA 002020_DMX-NODE-1 38,441,721 76.19% SRR5456941 SRP104197 RNA 002021_DMX-NODE-2 31,509,362 75.62% SRR5456940 SRP104197 RNA 002022_WT-NODE-1 72,857,776 78.22% SRR5456939 SRP104197 RNA 002023_WT-NODE-2 45,613,402 79.72% SRR5456961 SRP104197 RNA 017790_B73_1 14,484,422 75.59% SRR5456960 SRP104197 RNA 017791_B73_2 19,216,994 74.66% SRR5456959 SRP104197 RNA 017792_B73_3 19,963,921 75.61% SRR5456964 SRP104197 RNA 017793_dmx_1 18,185,254 74.95% SRR5456963 SRP104197 RNA 017794_dmx_2 14,716,352 75.70% SRR5456962 SRP104197 RNA 017795_dmx_3 15,621,657 74.95% SRR5456956 SRP104197 DNA 008071_35-1A 35,105,044 1.036X SRR5456955 SRP104197 DNA 008072_36-1A 42,763,612 1.259X SRR5456954 SRP104197 DNA 008073_37-1A 43,364,082 1.274X SRR5456953 SRP104197 DNA 008074_38-1A 23,554,606 0.693X SRR5456952 SRP104197 DNA 008075_39-1A 40,063,272 1.180X SRR5456951 SRP104197 DNA 008076_40-1A 47,697,986 1.406X SRR5456950 SRP104197 DNA 008077_41-1A 39,155,920 1.160X SRR5456949 SRP104197 DNA 008078_48-1A 90,616,224 2.668X SRR5456948 SRP104197 DNA 008079_49-1A 36,790,062 1.088X SRR5641250 SRP108453 DNA 011512_Mo17 361,019,136 7.014X 883 a“DMX/dmx” indicates mutant ali1-1 RNA samples. 884 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

885 Table S3. 886 Morphometric analysis of B73, ali1-1/ali1-1, and ali1-1/ali1-2 grown in the spring of 2016 in 887 greenhouse. 888 ear flag leaf tassel tassel Genotype tassel lengtha heighta heighta heighta branchesa B73 (+/+) 92.4±8.0 a 219.0±6.7 a 261.4±6.9 a 54.6±1.8 a 7.6±1.5 a ali1-1/ali1-1 78.8±8.3 a 177.8±8.2 b 211.0±7.5 b 43.3±5.8 b 5.4±1.7 ab ali1-1/ali1-2 93.3±16.2 a 172.4±14.4 b 194.3±14.1 c 29.5±6.0 c 3.8±1.3 b

889 aUnits are in cm ± SD. Lowercase letters indicate connecting letter report as determined by 890 ANOVA with posthoc analysis using the Holm-Sidak algorithm with P < 0.05. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

891 Table S4. 892 Plant height of ali1-1 was suppressed in the greenhouse when grown in the winter of 2015 as 893 compared to field-grown plants. 894 n flag leaf height ± SDa B73 in greenhouseb 5 240.8 ±12.28 a B73 in fieldc 16 239.5 ±6.54 a ali1-1/ali1-1 in greenhouseb 18 234.4 ±14.02 a ali1-1/ali1-1 in fieldc 46 157.0 ±19.03 b 895 aUnits are in cm, lowercase letters indicate connecting letter report as determined by ANOVA 896 with post hoc analysis using the Holm-Sidak algorithm with p<0.05. 897 bPlants were grown in greenhouse in winter of 2015. 898 cPlants were grown in field in summer of 2015 in WL. 899 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

900 Table S5. 901 Phenotypic segregation ratios of the progeny of (+/ali1-1; +/Rp1-D21) crossed with (ali1-1/ali1- 902 1; +/+) showing linkage disequilibrium between loci. ali1-1; Ear Wild Type ali1-1 Rp1-D21 Total 2 P-value Rp1-D21 WL15_81 0 8 8 1 17 0.0039 WL15_82 1 6 8 1 16 0.0233 WL15_83 0 3 10 0 13 0.0001 WL15_84 0 3 6 1 10 0.0384 WL15_85 0 4 8 0 12 0.0021 WL15_87 2 10 6 1 19 0.0136 WL15_89 1 6 4 1 12 0.1116 WL15_90 0 9 6 1 16 0.0037 WL15_91 0 10 7 1 18 0.0016 WL15_92 0 4 12 0 16 2.5E-05 WL15_93 1 7 7 0 15 0.0098 WL15_94 0 5 8 1 14 0.0084 WL15_95 2 6 6 0 14 0.0523 WL15_96 0 7 8 1 16 0.0059 WL15_97 0 7 9 0 16 0.0009 WL15_99 0 8 7 1 16 0.0059 WL15_100 2 5 6 1 14 0.1826 WL15_101 2 9 3 1 15 0.0159 WL15_102 0 7 8 0 15 0.0017 WL15_103 0 9 6 0 15 0.0010 WL15_104 0 7 9 0 16 0.0009 WL15_107 0 4 3 0 7 0.0633 Total 11 144 155 12 322 3.6E-51 903 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

904 Table S6. 905 BLASTn results of GRMZM2G180205 genomic sequence against NCBI expression tag 906 sequence database Accession Expect value Percent Number identity DR828860.1 2.00E-171 100.00% DV511867.1 7.00E-122 100.00% DV543542.1 3.00E-105 97.40% FL135742.1 2.00E-102 99.53% DV029942.1 4.00E-99 100.00% FL135740.1 2.00E-97 97.63% DR964374.1 7.00E-97 100.00% DR828976.1 1.00E-93 100.00% DR817074.1 1.00E-93 100.00% EC905516.2 9.00E-91 98.48% EB407248.1 9.00E-91 100.00% EE156325.2 3.00E-90 99.47% EB641592.1 3.00E-90 100.00% EB165604.1 3.00E-90 99.47% DV523800.1 3.00E-90 99.47% DR969589.1 3.00E-90 99.47% CO468963.1 3.00E-90 99.47% DN215222.1 3.00E-90 99.47% CF244328.1 3.00E-90 100.00% JK507524.1 1.00E-89 95.85% DR968632.1 1.00E-88 98.94% CO528041.1 2.00E-87 99.46% EB816327.1 7.00E-87 100.00% DR821933.1 2.00E-86 99.45% DV172761.1 9.00E-86 98.40% FL135749.1 7.00E-82 100.00% FL135748.1 7.00E-82 100.00% FL135745.1 7.00E-82 100.00% FL135744.1 7.00E-82 100.00% FL135739.1 7.00E-82 100.00% EB819544.1 7.00E-82 100.00% EB401216.1 7.00E-82 100.00% DY232620.1 7.00E-82 100.00% CO533759.1 7.00E-82 100.00% DR828975.1 7.00E-82 100.00% CD527602.1 7.00E-82 100.00% AW157956.1 7.00E-82 100.00% CD441233.1 9.00E-81 97.31% bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

CD440373.1 9.00E-81 96.83% FM185777.1 3.00E-80 99.42% FL135747.1 3.00E-80 99.42% FL135738.1 2.00E-77 98.27% CN845482.1 7.00E-77 98.26% FL135746.1 9.00E-76 97.66% FL135741.1 9.00E-76 97.70% FL135737.1 4.00E-74 97.08% DY534608.1 2.00E-73 97.62% FL135743.1 4.00E-69 95.35% FL477397.1 3.00E-65 98.01% FL435533.1 3.00E-65 98.01% EE156324.2 3.00E-65 100.00% EB819543.1 3.00E-65 100.00% EB165603.1 3.00E-65 100.00% DY232619.1 3.00E-65 100.00% CO533758.1 3.00E-65 100.00% DV543541.1 3.00E-65 100.00% DV511866.1 3.00E-65 100.00% DV172760.1 3.00E-65 100.00% DV029941.1 3.00E-65 100.00% DR969588.1 3.00E-65 100.00% DR968631.1 3.00E-65 100.00% DR964373.1 3.00E-65 100.00% DR960331.1 3.00E-65 100.00% DR817073.1 3.00E-65 100.00% CD527601.1 3.00E-65 100.00% EB641591.1 2.00E-63 99.29% DN560261.1 7.00E-62 98.58% DY401342.1 2.00E-58 95.36% DV494472.1 2.00E-58 97.16% CF634947.1 2.00E-58 97.16% BU037925.1 2.00E-58 95.36% BQ833798.1 2.00E-58 95.36% EE010860.1 4.00E-54 95.07% BQ703828.1 7.00E-52 94.41% EB401215.1 9.00E-51 97.58% EB816326.1 3.00E-50 99.15% CD964905.1 7.00E-47 95.28% DV523799.1 2.00E-33 98.85% 907 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

908 Table S7. 909 Stomatal indices and densities of ali1-1 and wild-type B73 grown in the greenhouse. Data is 910 presented as means with standard deviation of 5 biological replicates measured at V10 stage of 911 the widest portion of leaf 9 of greenhouse grown plants. Letters indicate connecting letter report 912 as determined by Student’s t-test (P < 0.05). Genotype SI abaxiala SD abaxialb SI adaxiala SD adaxialb RSc B73 (+/+) 20.0 ±1.9 a 119.3 ±13.5 a 16.4 ±0.8 a 72.86 ±5.4 a 0.82 a ali1-1/ali1-1 18.7 ±1.9 a 134.3 ±12.5 a 14.7 ±1.7 a 73.57 ±5.4 a 0.79 a 913 aSI, stomatal index 914 bSD, stomatal density 915 cRS, ratio of stomata adaxial/abaxial 916 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

917 Table S8. 918 Stomatal indices and densities of B73, +/ali1-1, +/ali1-2, ali1-1/ali1-1, ali1-1/ali1-2, and ali1- 919 2/ali1-2 grown in the field. Data is presented as means with SD of 6 biological replicates 920 measured at V9 stage of the widest portion of leaf 8 of greenhouse grown plants. Letters indicate 921 connecting letter report as determined by ANOVA with posthoc analysis using the Holm-Sidak 922 algorithm (P < 0.05). Genotype SI abaxiala SD abaxialb B73 (+/+) 24.2 ±1.7 a 206.5 ±18.8 a +/ali1-1 24.6 ±1.0 a 212.2 ±12.7 a +/ali1-2 25.1 ±0.5 a 216.6 ±13.6 a ali1-1/ali1-1 24.2 ±0.7 a 214.0 ±16.0 a ali1-1/ali1-2 24.1 ±0.6 a 222.5 ±17.8 a ali1-2/ali1-2 23.7 ±1.4 a 216.6 ±10.7 a 923 aSI, stomatal index 924 bSD, stomatal density 925 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

926 Table S9. 927 NPC gene expression in ali1-1 compared to wild type from the tassel node just before emergence 928 from the leaf whorl. Gene Name Maize ID Mean Exp. Mean Exp. log2FC p-val. Genome (ali1-1) (wild type) wide FDRa ALADIN1 GRMZM2G180205 651.432 700.118 -0.1044 0.7105 0.8244 RAE1-L1 GRMZM2G180815 1188.697 468.662 1.3435 2.3E-06 1.6E-06* RAE1-L2 GRMZM2G058498 2472.891 2235.171 0.1456 0.4998 0.6664 CG1 GRMZM2G089050 1131.622 593.728 0.9296 0.0001 0.0018* NUP98a GRMZM2G059015 7423.819 5070.035 0.5500 0.0125 0.0629 NUP98b GRMZM2G344924 3221.206 2210.279 0.5431 0.0100 0.0541 NUP62-L1 GRMZM2G061043 724.381 718.645 0.0130 0.9604 0.9778 NUP62-L2 GRMZM2G162329 38.097 17.248 0.5121 0.0905 0.7635 NUP214 AC155434.2_FG004 1981.954 1277.143 0.6325 0.0400 0.1344 NUP58-L1 GRMZM2G024775 701.122 450.021 0.6363 0.0566 0.1663 NUP58-L2 GRMZM2G134508 1990.325 1683.229 0.2409 0.3906 0.5701 NUP58-L3 GRMZM2G345582 19.622 23.126 -0.2317 0.7876 0.8752 NUP54 GRMZM2G104258 1477.189 1422.909 0.0538 0.8163 0.8945 NUP136-L1 GRMZM2G329300 2538.364 1647.225 0.6229 0.0308 0.1136 NUP136-L2 GRMZM5G867767 160.087 63.308 1.3265 0.1269 0.2793 NUP136-L3 GRMZM5G839512 2484.673 1423.370 0.8024 0.0387 0.1315 NUP50a GRMZM2G157317 11872.288 11422.341 0.0559 0.7992 0.8828 NUP50b GRMZM5G823017 2036.197 1906.090 0.0961 0.6916 0.8123 NUP160-L1 GRMZM2G322493 439.143 121.458 1.8523 0.2707 0.4518 NUP160-L2 GRMZM2G167741 922.473 800.318 0.2051 0.4184 0.5949 NUP133-L1 GRMZM2G058374 1168.932 1212.249 -0.0515 0.8279 0.9019 NUP133-L2 GRMZM2G358877 489.717 221.616 1.1426 0.4034 0.5817 NUP107 GRMZM2G348675 507.382 237.073 1.0921 0.0602 0.1731 NUP96-L1 AC149829.2_FG003 494.911 525.444 -0.0847 0.7531 0.8531 NUP96-L2 GRMZM5G861959 0.653 1.585 -1.3320 0.7531 NA NUP96-L3 AC207628.4_FG003 250.497 190.698 0.3968 0.2334 0.4137 NUP75 GRMZM2G409430 1714.633 1678.873 0.0307 0.8932 0.9410 NUP43 GRMZM2G063188 1358.505 1066.045 0.3491 0.1250 0.2765 SEH1 GRMZM2G057853 2077.787 1837.090 0.1776 0.4015 0.5801 SEC13-L1 GRMZM2G007021 5306.593 6597.602 -0.3138 0.2197 0.3980 SEC13-L2 GRMZM2G102795 37.129 30.643 0.2650 0.7080 0.8229 SEC13-L3 GRMZM2G127850 0 0 0 NA NA SEC13-L4 GRMZM5G871980 0 0 0 NA NA SEC13-L5 GRMZM6G700127 9415.549 10154.197 -0.1090 0.5966 0.7436 SEC13-L6 GRMZM2G074567 3956.764 4057.775 -0.0364 0.8580 0.9199 NUP205 GRMZM2G056661 2014.200 1022.617 0.9761 0.0069 0.0424* NUP188 GRMZM2G134985 1186.793 812.309 0.5454 0.0634 0.1791 NUP155 GRMZM2G077576 0 0 0 NA NA NUP93b GRMZM5G874366 0 0 0 NA NA NUP35-L1 AC187157.4_FG002 1364.433 1749.168 -0.3573 0.1821 0.3530 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

NUP35-L2 GRMZM2G084477 480.147 463.916 0.0474 0.8934 0.9411 NUP88/MOS7 GRMZM2G156174 2394.141 1598.607 0.5825 0.0154 0.0717 GP210-L1 GRMZM2G331533 765.072 233.323 1.7115 0.1276 0.2805 GP210-L2 GRMZM2G476810 236.117 64.308 1.8731 0.2980 0.4803 GP210-L3 GRMZM2G098622 1199.732 1004.025 0.2570 0.2666 0.4476 NDC1 GRMZM2G528010 662.933 479.523 0.4648 0.0974 0.2358 CPR5-L1 GRMZM2G032447 1307.000 876.772 0.5744 0.0392 0.1325 CPR5-L2 GRMZM2G158811 620.545 297.668 1.0570 0.0001 0.0024* ELYS/HOS1 GRMZM2G312738 1568.485 1176.953 0.4136 0.0776 0.2043 GLE1-L1 AC210013.4_FG008 666.967 335.970 0.9844 0.0096 0.0527 GLE1-L2 GRMZM2G417217 498.377 280.314 0.8252 0.0150 0.0703 TPR/NUA-L1 GRMZM2G439339 4034.087 2716.838 0.5706 0.0190 0.0821 TPR/NUA-L1 GRMZM2G118403 2835.980 1968.341 0.5261 0.0343 0.1220 929 aGenes that are significantly differentially expressed at a FDR<0.05 is indicated by an asterisk. 930 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

931 Table S10.

932 Expression data from tassel tissue of known interactors with the Homo sapiens AAAS gene. Gene Name Maize ID e-valuea Mean Exp. Mean Exp. log2FC p-val. Genome (ali1-1) (wild type) wide FDRb CTDNEP1-L1 GRMZM2G162347 5.0E-36 2043.420 1471.093 0.4738 0.0347 0.1229 CTDNEP1-L2 GRMZM2G068690 6.7E-36 934.978 906.122 0.0445 0.8578 0.9198 CTDNEP1-L3 GRMZM2G122362 4.1E-30 711.489 395.701 0.8442 0.0017 0.0159* CTDNEP1-L4 GRMZM2G124179 1.2E-28 809.385 950.248 -0.2304 0.3693 0.5492 CTDNEP1-L5 GRMZM2G347623 1.7E-28 2874.310 2159.466 0.4120 0.0815 0.2104 CUL7-L1 GRMZM2G054247 2.1E-05 789.579 778.669 0.0182 0.9463 0.9705 CUL7-L2 GRMZM2G174971 5.0E-05 262.896 256.503 0.0356 0.9097 0.9504 EGFR-L1 GRMZM2G459854 6.8E-33 899.183 956.565 -0.0891 0.6992 0.8172 EGFR-L2 GRMZM2G164242 2.5E-32 46.117 35.624 0.3600 0.5904 0.7388 EGFR-L3 GRMZM2G104658 2.1E-31 796.178 791.762 0.0067 0.9783 0.9864 EGFR-L4 GRMZM5G814851 3.4E-31 416.335 331.573 0.3259 0.2678 0.4486 EGFR-L5 GRMZM2G160922 8.5E-31 903.125 479.683 0.9114 0.0007 0.0084* EGFR-L6 GRMZM2G152889 8.9E-31 786.123 685.958 0.1956 0.4417 0.6166 EGFR-L7 GRMZM2G059671 7.1E-30 1610.035 1152.459 0.4808 0.1362 0.2926 EGFR-L8 GRMZM2G465833 1.4E-29 1477.344 1102.161 0.4224 0.0656 0.1831 EGFR-L9 GRMZM2G028709 1.4E-29 349.509 225.136 0.6304 0.0729 0.1965 EGFR-L10 GRMZM2G140612 3.0E-27 3679.858 3997.683 -0.1195 0.6211 0.7616 EGFR-L11 GRMZM2G002531 6.2E-27 130.670 91.644 0.5104 0.2139 0.3917 EGFR-L12 GRMZM2G102088 6.3E-27 2345.473 1803.048 0.3787 0.1310 0.2849 GNAI3-L1 GRMZM2G064732 6.7E-65 1269.870 1307.991 -0.0426 0.8468 0.9136 GNAI3-L2 GRMZM2G429113 1.5E-26 1591.688 1210.338 0.3948 0.1582 0.3220 GNAI3-L3 GRMZM2G016858 4.2E-24 2492.487 1544.867 0.6889 0.0211 0.0885 ISG15-L1 GRMZM2G116292 1.1E-14 14409.560 17367.044 -0.2693 0.1798 0.3505 ISG15-L2 GRMZM2G118637 6.5E-14 789.086 457.364 0.7838 0.0059 0.0382 ISG15-L3 GRMZM2G409726 6.9E-14 89823.173 98792.619 -0.1373 0.5664 0.7201 ISG15-L4 GRMZM2G419891 6.9E-14 71907.360 86975.489 -0.2744 0.2363 0.4174 KPNB1-L1 GRMZM2G138419 1.2E-168 4630.167 4926.032 -0.0894 0.6984 0.8167 KPNB1-L2 GRMZM2G066650 2.5E-168 2405.976 2023.540 0.2497 0.2629 0.4440 KPNB1-L3 GRMZM2G084767 8.8E-165 5674.799 4418.220 0.3611 0.1123 0.2578 KPNB1-L4 GRMZM2G010452 2.6E-154 2054.219 1486.692 0.4658 0.0847 0.2159 NTRK1-L1 GRMZM2G059671 4.1E-32 1610.035 1152.459 0.4808 0.1362 0.2926 NTRK1-L2 GRMZM2G104658 2.1E-31 796.178 791.762 0.0067 0.9783 0.9864 NTRK1-L3 GRMZM2G098187 3.4E-30 68.441 63.817 0.0979 0.8521 0.9168 NTRK1-L4 GRMZM2G140612 2.5E-29 3679.858 3997.683 -0.1195 0.6211 0.7616 NTRK1-L5 GRMZM2G102088 6.3E-29 2345.473 1803.048 0.3787 0.1310 0.2849 NTRK1-L6 GRMZM2G156013 1.0E-28 4418.520 4280.745 0.0456 0.8326 0.9051 NUP107 GRMZM2G348675 1.4E-23 507.382 237.073 1.0921 0.0602 0.1731 NUP98a GRMZM2G344924 1.1E-26 3221.206 2210.279 0.5431 0.0100 0.0541 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

NUP98b GRMZM2G059015 2.6E-26 7423.819 5070.035 0.5500 0.0125 0.0629 RANBP2-L1 GRMZM2G162388 7.6E-62 1.848 4.481 -1.3048 0.5340 NA RANBP2-L2 GRMZM2G326111 8.7E-62 184823.555 221183.684 -0.2591 0.3017 0.4834 RANBP2-L3 GRMZM2G170397 3.6E-57 3570.407 4783.672 -0.4217 0.0846 0.2157 RANBP2-L4 GRMZM2G063244 1.5E-55 134.970 193.615 -0.5148 0.2181 0.3962 RANBP2-L5 GRMZM2G084521 1.5E-54 9097.711 16212.309 -0.8334 0.0011 0.0117* RANBP2-L6 GRMZM2G087570 2.1E-54 2461.095 3539.270 -0.5238 0.0163 0.0742 RANBP2-L7 GRMZM2G076544 1.8E-54 1961.014 3085.905 -0.6534 0.0075 0.0445* RANBP2-L8 GRMZM2G329306 2.1E-50 1695.318 1624.009 0.0614 0.7868 0.8747 RANBP2-L9 GRMZM2G401848 5.5E-50 104.215 180.941 -0.7941 0.0499 0.1540 RCC1-L1 GRMZM2G003565 1.1E-29 2636.331 3191.605 -0.2751 0.3210 0.5033 RCC1-L2 GRMZM2G134313 8.1E-22 619.386 448.857 0.4630 0.1818 0.3528 RCC1-L3 GRMZM2G030542 1.2E-20 1488.168 1270.110 0.2287 0.3017 0.4834 RCC1-L4 GRMZM2G095562 4.2E-20 1916.540 1804.316 0.0868 0.6880 0.8091 RCC1-L5 GRMZM2G135770 1.3E-19 2237.379 2500.630 -0.1612 0.5042 0.6704 SEH1 GRMZM2G057853 1.2E-33 2077.787 1837.090 0.1775 0.4015 0.5801 SLC39A4 GRMZM2G001803 5.0E-12 2083.655 1693.033 0.2986 0.2388 0.4196 UBE2I-L1 GRMZM2G070047 2.4E-73 4552.211 7914.500 -0.7977 0.0029 0.0234* UBE2I-L2 GRMZM2G063931 1.1E-72 567.859 849.088 -0.5797 0.0466 0.1474 UBE2I-L3 GRMZM2G163398 5.0E-72 3078.124 3305.415 -0.1029 0.6185 0.7599 UBE2I-L4 GRMZM2G312693 4.3E-70 2421.918 2586.496 -0.0944 0.6833 0.8056 UBE2I-L5 GRMZM2G341089 4.7E-60 185.864 287.349 -0.6254 0.0623 0.1771 UBE2I-L6 GRMZM2G038851 5.5E-60 123.724 201.594 -0.6983 0.0895 0.2234 UBE2I-L7 GRMZM2G007260 2.7E-34 3478.337 3976.460 -0.1927 0.3970 0.5760 XPO1-L1 GRMZM2G022258 0.0E+00 1554.759 1327.549 0.2277 0.2968 0.4791 XPO1_L2 GRMZM2G167031 0.0E+00 2414.678 1803.881 0.4212 0.0519 0.1577 EFNB2 No Hits NA NA NA NA NA NA IFI16 No Hits NA NA NA NA NA NA LYPD3 No Hits NA NA NA NA NA NA NUP153 No Hits NA NA NA NA NA NA OBSL1 No Hits NA NA NA NA NA NA POPDC2 No Hits NA NA NA NA NA NA REL No Hits NA NA NA NA NA NA TCTN2 No Hits NA NA NA NA NA NA TCTN3 No Hits NA NA NA NA NA NA

933 ae-value score for protein BLAST of Homo sapiens AAAS gene interactors against maize 934 genome. 935 bGenes that are significantly differentially expressed at a FDR<0.05 is indicated by an asterisk. 936 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

937 Table S11. 938 NPC gene expression in ali1-1 compared to wild type from SAM and surrounding tissue of 15 939 DAP plants. Gene Name Maize ID Mean Exp. Mean Exp. log2FC p-val. Genome (ali1-1) (wild-type) wide FDRa ALADIN1 GRMZM2G180205 85.880 86.389 -0.0134 0.9493 0.9928 RAE1-L1 GRMZM2G180815 132.748 107.678 0.3083 0.0987 0.9928 RAE1-L2 GRMZM2G058498 179.270 175.135 0.0345 0.8262 0.9928 CG1 GRMZM2G089050 128.650 124.765 0.0457 0.7986 0.9928 NUP98a GRMZM2G059015 1032.689 966.776 0.0968 0.4091 0.9928 NUP98b GRMZM2G344924 448.852 440.665 0.0288 0.8402 0.9928 NUP62-L1 GRMZM2G061043 80.448 91.601 -0.1937 0.4052 0.9928 NUP62-L2 GRMZM2G162329 1.322 0.905 0.5121 0.7635 NA NUP214 AC155434.2_FG004 696.087 666.125 0.0649 0.6729 0.9928 NUP58-L1 GRMZM2G024775 83.994 84.228 0.0077 0.9703 0.9928 NUP58-L2 GRMZM2G134508 397.645 395.540 0.0089 0.9430 0.9928 NUP58-L3 GRMZM2G345582 0 0 0 NA NA NUP54 GRMZM2G104258 255.346 245.191 0.0565 0.6903 0.9928 NUP136-L1 GRMZM2G329300 587.544 584.512 0.0086 0.9579 0.9928 NUP136-L2 GRMZM5G867767 52.643 65.325 -0.3062 0.2465 0.9928 NUP136-L3 GRMZM5G839512 677.007 752.203 -0.1522 0.2407 0.9928 NUP50a GRMZM2G157317 3098.730 3250.666 -0.0689 0.5149 0.9928 NUP50b GRMZM5G823017 591.142 578.312 0.0327 0.7682 0.9928 NUP160-L1 GRMZM2G322493 102.597 76.986 0.4082 0.0584 0.9928 NUP160-L2 GRMZM2G167741 99.336 84.917 0.2262 0.2826 0.9928 NUP133-L1 GRMZM2G058374 313.158 294.686 0.0894 0.5435 0.9928 NUP133-L2 GRMZM2G358877 155.892 150.023 0.0545 0.7620 0.9928 NUP107 GRMZM2G348675 98.614 75.535 0.3843 0.1011 0.9928 NUP96-L1 AC149829.2_FG003 126.646 157.401 -0.3165 0.0679 0.9928 NUP96-L2 GRMZM5G861959 0 0 0 NA NA NUP96-L3 AC207628.4_FG003 28.342 27.779 0.0188 0.9507 0.9928 NUP75 GRMZM2G409430 261.269 266.402 -0.0309 0.8275 0.9928 NUP43 GRMZM2G063188 170.235 160.168 0.0813 0.6278 0.9928 SEH1 GRMZM2G057853 316.914 331.955 -0.0664 0.6431 0.9928 SEC13-L1 GRMZM2G007021 777.514 816.527 -0.0709 0.4846 0.9928 SEC13-L2 GRMZM2G102795 1.022 0.287 1.7280 0.4606 NA SEC13-L3 GRMZM2G127850 0 0 0 NA NA SEC13-L4 GRMZM5G871980 0 0 0 NA NA SEC13-L5 GRMZM6G700127 2148.770 2064.830 0.0582 0.5255 0.9928 SEC13-L6 GRMZM2G074567 665.871 710.720 -0.0941 0.3593 0.9928 NUP205 GRMZM2G056661 319.553 293.978 0.1222 0.4681 0.9928 NUP188 GRMZM2G134985 389.555 354.999 0.1359 0.3537 0.9928 NUP155 GRMZM2G077576 0 0 0 NA NA NUP93b GRMZM5G874366 0 0 0 NA NA NUP35-L1 AC187157.4_FG002 235.179 244.111 -0.0532 0.7073 0.9928 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

NUP35-L2 GRMZM2G084477 45.326 32.765 0.4643 0.1475 0.9928 NUP88/MOS7 GRMZM2G156174 373.742 386.135 -0.0500 0.6983 0.9928 GP210-L1 GRMZM2G331533 225.572 197.771 0.1942 0.3136 0.9928 GP210-L2 GRMZM2G476810 84.224 80.400 0.0707 0.7948 0.9928 GP210-L3 GRMZM2G098622 248.775 219.502 0.1862 0.2458 0.9928 NDC1 GRMZM2G528010 165.804 145.485 0.1885 0.2767 0.9928 CPR5-L1 GRMZM2G032447 345.891 380.366 -0.1351 0.3326 0.9928 CPR5-L2 GRMZM2G158811 85.185 80.471 0.0864 0.6871 0.9928 ELYS/HOS1 GRMZM2G312738 480.723 487.181 -0.0190 0.8928 0.9928 GLE1-L1 AC210013.4_FG008 154.212 163.482 -0.0902 0.6098 0.9928 GLE1-L2 GRMZM2G417217 60.343 55.063 0.1201 0.6690 0.9928 TPR/NUA-L1 GRMZM2G439339 564.725 512.543 0.1402 0.2931 0.9928 TPR/NUA-L1 GRMZM2G118403 1556.200 1525.120 0.0290 0.8387 0.9928 940 aGenes that are significantly differentially expressed at a FDR<0.05 is indicated by an asterisk. 941 942 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

943 Table S12.

944 Expression data from SAM and surrounding tissue of 15 DAP plants of known interactors with 945 the Homo sapiens AAAS gene. Gene Name Maize ID e-valuea Mean Exp. Mean Exp. log2FC p-val. Genome (ali1-1) (wild type) wide FDRb CTDNEP1-L1 GRMZM2G162347 5.0E-36 398.216 452.914 -0.1855 0.1712 0.9928 CTDNEP1-L2 GRMZM2G068690 6.7E-36 324.369 312.716 0.0517 0.7100 0.9928 CTDNEP1-L3 GRMZM2G122362 4.1E-30 103.158 105.684 -0.0281 0.8951 0.9928 CTDNEP1-L4 GRMZM2G124179 1.2E-28 75.992 77.952 -0.0425 0.8494 0.9928 CTDNEP1-L5 GRMZM2G347623 1.7E-28 592.198 616.130 -0.0559 0.6855 0.9928 CUL7-L1 GRMZM2G054247 2.1E-05 111.490 99.127 0.1718 0.3864 0.9928 CUL7-L2 GRMZM2G174971 5.0E-05 15.337 18.212 -0.2342 0.6088 0.9928 EGFR-L1 GRMZM2G459854 6.8E-33 112.242 108.420 0.0443 0.8195 0.9928 EGFR-L2 GRMZM2G164242 2.5E-32 8.381 8.377 0.0058 0.9916 0.9942 EGFR-L3 GRMZM2G104658 2.1E-31 72.114 82.302 -0.1831 0.4253 0.9928 EGFR-L4 GRMZM5G814851 3.4E-31 59.450 60.970 -0.0427 0.8613 0.9928 EGFR-L5 GRMZM2G160922 8.5E-31 64.362 85.270 -0.4004 0.0773 0.9928 EGFR-L6 GRMZM2G152889 8.9E-31 18.395 25.295 -0.4498 0.2771 0.9928 EGFR-L7 GRMZM2G059671 7.1E-30 244.731 245.410 -0.0090 0.9499 0.9928 EGFR-L8 GRMZM2G465833 1.4E-29 202.065 188.554 0.0970 0.5394 0.9928 EGFR-L9 GRMZM2G028709 1.4E-29 80.695 62.130 0.3638 0.1424 0.9928 EGFR-L10 GRMZM2G140612 3.0E-27 494.580 527.403 -0.0941 0.3999 0.9928 EGFR-L11 GRMZM2G002531 6.2E-27 18.967 16.370 0.2095 0.6340 0.9928 EGFR-L12 GRMZM2G102088 6.3E-27 346.351 304.206 0.1891 0.1563 0.9928 GNAI3-L1 GRMZM2G064732 6.7E-65 217.423 224.307 -0.0463 0.7604 0.9928 GNAI3-L2 GRMZM2G429113 1.5E-26 188.580 191.180 -0.0152 0.9214 0.9928 GNAI3-L3 GRMZM2G016858 4.2E-24 437.160 460.890 -0.0732 0.5647 0.9928 ISG15-L1 GRMZM2G116292 1.1E-14 3790.695 4405.852 -0.2171 0.0119 0.7992 ISG15-L2 GRMZM2G118637 6.5E-14 11.371 6.424 0.8137 0.1967 0.9928 ISG15-L3 GRMZM2G409726 6.9E-14 14699.069 14465.199 0.0232 0.7818 0.9928 ISG15-L4 GRMZM2G419891 6.9E-14 14048.299 13172.773 0.0929 0.2508 0.9928 KPNB1-L1 GRMZM2G138419 1.2E-168 833.922 770.270 0.1156 0.2802 0.9928 KPNB1-L2 GRMZM2G066650 2.5E-168 524.880 470.798 0.1571 0.2606 0.9928 KPNB1-L3 GRMZM2G084767 8.8E-165 1434.872 1311.594 0.1299 0.2961 0.9928 KPNB1-L4 GRMZM2G010452 2.6E-154 581.225 574.221 0.0187 0.8933 0.9928 NTRK1-L1 GRMZM2G059671 4.1E-32 244.731 245.410 -0.0090 0.9499 0.9928 NTRK1-L2 GRMZM2G104658 2.1E-31 72.114 82.302 -0.1831 0.4253 0.9928 NTRK1-L3 GRMZM2G098187 3.4E-30 27.966 20.572 0.4375 0.2496 0.9928 NTRK1-L4 GRMZM2G140612 2.5E-29 494.580 527.403 -0.0941 0.3999 0.9928 NTRK1-L5 GRMZM2G102088 6.3E-29 346.351 304.206 0.1891 0.1563 0.9928 NTRK1-L6 GRMZM2G156013 1.0E-28 525.072 507.690 0.0483 0.6644 0.9928 NUP107 GRMZM2G348675 1.4E-23 98.614 75.535 0.3843 0.1011 0.9928 bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

NUP98a GRMZM2G344924 1.1E-26 448.852 440.665 0.0288 0.8402 0.9928 NUP98b GRMZM2G059015 2.6E-26 1032.689 966.776 0.0968 0.4091 0.9928 RANBP2-L1 GRMZM2G162388 7.6E-62 0.000 0.000 NA NA NA RANBP2-L2 GRMZM2G326111 8.7E-62 27011.304 24675.444 0.1305 0.2741 0.9928 RANBP2-L3 GRMZM2G170397 3.6E-57 558.475 559.491 -0.0034 0.9810 0.9928 RANBP2-L4 GRMZM2G063244 1.5E-55 29.214 3.030 3.2057 1.0E-8 1.2E-5* RANBP2-L5 GRMZM2G084521 1.5E-54 764.391 842.285 -0.1414 0.2007 0.9928 RANBP2-L6 GRMZM2G087570 2.1E-54 87.778 78.412 0.1621 0.4985 0.9928 RANBP2-L7 GRMZM2G076544 1.8E-54 129.139 136.861 -0.0856 0.6552 0.9928 RANBP2-L8 GRMZM2G329306 2.1E-50 256.530 255.727 -0.0012 0.9900 0.9940 RANBP2-L9 GRMZM2G401848 5.5E-50 26.657 24.633 0.1294 0.7660 0.9928 RCC1-L1 GRMZM2G003565 1.1E-29 276.773 250.599 0.1464 0.3568 0.9928 RCC1-L2 GRMZM2G134313 8.1E-22 61.855 53.814 0.1922 0.4553 0.9928 RCC1-L3 GRMZM2G030542 1.2E-20 180.800 215.980 -0.2577 0.0953 0.9928 RCC1-L4 GRMZM2G095562 4.2E-20 286.505 268.633 0.0946 0.4772 0.9928 RCC1-L5 GRMZM2G135770 1.3E-19 102.769 102.948 0.0003 0.9551 0.9928 SEH1 GRMZM2G057853 1.2E-33 316.914 331.955 -0.0664 0.6431 0.9928 SLC39A4 GRMZM2G001803 5.0E-12 154.190 170.973 -0.1509 0.3716 0.9928 UBE2I-L1 GRMZM2G070047 2.4E-73 687.319 705.759 -0.0399 0.7139 0.9928 UBE2I-L2 GRMZM2G063931 1.1E-72 145.395 155.929 -0.1002 0.5592 0.9928 UBE2I-L3 GRMZM2G163398 5.0E-72 560.292 617.744 -0.1427 0.2175 0.9928 UBE2I-L4 GRMZM2G312693 4.3E-70 328.941 383.686 -0.2227 0.0775 0.9928 UBE2I-L5 GRMZM2G341089 4.7E-60 46.832 50.660 -0.1217 0.6782 0.9928 UBE2I-L6 GRMZM2G038851 5.5E-60 2.071 3.989 -0.9445 0.3792 NA UBE2I-L7 GRMZM2G007260 2.7E-34 321.966 350.489 -0.1228 0.3694 0.9928 XPO1-L1 GRMZM2G022258 0.00 181.209 162.481 0.1637 0.3514 0.9928 XPO1_L2 GRMZM2G167031 0.00 337.647 285.456 0.2434 0.0641 0.9928 EFNB2 No Hits NA NA NA NA NA NA IFI16 No Hits NA NA NA NA NA NA LYPD3 No Hits NA NA NA NA NA NA NUP153 No Hits NA NA NA NA NA NA OBSL1 No Hits NA NA NA NA NA NA POPDC2 No Hits NA NA NA NA NA NA REL No Hits NA NA NA NA NA NA TCTN2 No Hits NA NA NA NA NA NA TCTN3 No Hits NA NA NA NA NA NA

946 ae-value score for protein BLAST of Homo sapiens AAAS gene interactors against maize 947 genome. 948 bGenes that are significantly differentially expressed at a FDR<0.05 is indicated by an asterisk. bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

949 Additional Data table S1 (separate file) 950 Coding sequence single nucleotide polymorphisms (SNP) between maize inbred B73 and maize 951 inbred Mo17. Column 1 is chromosome number and columns 2 and 3 are SNP positions. 952 (B73_Mo17_SNPs_CDS.bed) 953 954 Additional Data table S2 (separate file) 955 DESeq2 results of mRNA differential expression of ali1-1 tassels before emergence from leaf 956 whorl as compared to wild type. Column 1 is maize identification number, column 2 is the 957 baseMean for all samples, column 3 is the log2 fold change (negative indicates lower expression 958 in ali1-1 mutant and positive indicates higher expression in ali1-1 mutant as compared to wild 959 type), column 4 is log2 fold change SE, column 5 is Wald statistic, column 6 is Wald test P- 960 value, and column 7 is Benjamini-Hochberg multiple testing adjusted P-value. 961 (DESEQ2_ALI_TASSEL.csv) 962 963 Additional Data table S3 (separate file) 964 DESeq2 results of mRNA differential expression of ali1-1 15 DAP SAM and surrounding tissue 965 as compared to wild type. Column 1 is the maize identification number, column 2 is the 966 baseMean for all samples, column 3 is the log2 fold change (negative indicates lower expression 967 in ali1-1 mutant and positive indicates higher expression in ali1-1 mutant as compared to wild 968 type), column 4 is the log2 fold change SE, column 5 is the Wald statistic, column 6 is Wald test 969 P-value, and column 7 is the Benjamini-Hochberg multiple testing adjusted P-value. 970 (DESEQ2_ALI_15DAP.csv) 971 972 Additional Data table S4 (separate file) 973 Filtered list of single nucleotide polymorphisms (SNP) in replicate 1 of ali1-1 RNA-sequencing 974 mutant pool. Column 1 is chromosome number, column 2 is SNP position, column 3 is reference 975 nucleotide, column 4 is non-reference nucleotide, column 5 is forward strand reference read 976 count, column 6 is reverse strand reference read count, column 7 is forward strand non-reference 977 read count, column 8 is reverse strand non-reference read count, column 9 is snpEff annotation 978 of the SNP, column 10 is highest Arabidopsis BLASTP hit, column 11 is e-value score for 979 BLAST, and column 12 is Arabidopsis annotation. (ALI1_REP1_RNA_CALLSNPs.tsv) 980 981 Additional Data table S5 (separate file) 982 Filtered list of single nucleotide polymorphisms (SNP) in replicate 2 of ali1-1 RNA-sequencing 983 mutant pool. Column 1 is chromosome number, column 2 is SNP position, column 3 is reference 984 nucleotide, column 4 is non-reference nucleotide, column 5 is forward strand reference read 985 count, column 6 is reverse strand reference read count, column 7 is forward strand non-reference 986 read count, column 8 is reverse strand non-reference read count, column 9 is snpEff annotation 987 of the SNP, column 10 is highest Arabidopsis BLASTP hit, column 11 is e-value score for 988 BLAST, and column 12 is Arabidopsis annotation. (ALI1_REP2_RNA_CALLSNPs.tsv) 989 990 Additional Data table S6 (separate file) bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423105; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

991 Filtered list of single nucleotide polymorphisms (SNP) in replicate 1 of wild-type RNA- 992 sequencing pool. Column 1 is chromosome number, column 2 is SNP position, column 3 is 993 reference nucleotide, column 4 is non-reference nucleotide, column 5 is forward strand reference 994 read count, column 6 is reverse strand reference read count, column 7 is forward strand non- 995 reference read count, column 8 is reverse strand non-reference read count, column 9 is snpEff 996 annotation of the SNP, column 10 is highest Arabidopsis BLASTP hit, column 11 is e-value 997 score for BLAST, and column 12 is Arabidopsis annotation. (WT_REP1_RNA_CALLSNPs.tsv) 998 999 Additional Data table S7 (separate file) 1000 Filtered list of single nucleotide polymorphisms (SNP) in replicate 2 of wild-type RNA- 1001 sequencing pool. Column 1 is chromosome number, column 2 is SNP position, column 3 is 1002 reference nucleotide, column 4 is non-reference nucleotide, column 5 is forward strand reference 1003 read count, column 6 is reverse strand reference read count, column 7 is forward strand non- 1004 reference read count, column 8 is reverse strand non-reference read count, column 9 is snpEff 1005 annotation of the SNP, column 10 is highest Arabidopsis BLASTP hit, column 11 is e-value 1006 score for BLAST, and column 12 is Arabidopsis annotation. (WT_REP2_RNA_CALLSNPs.tsv) 1007 1008 Additional Data table S8 (separate file) 1009 Filtered list of single nucleotide polymorphisms (SNP) in 9 individual ali1-1; BC1 F2 plants of 1010 DNA-sequencing. Column 1 is chromosome number, column 2 is SNP position, column 3 is 1011 reference nucleotide, column 4 is non-reference nucleotide, column 5 is forward strand reference 1012 read count, column 6 is reverse strand reference read count, column 7 is forward strand non- 1013 reference read count, column 8 is reverse strand non-reference read count, column 9 is snpEff 1014 annotation of the SNP, column 10 is highest Arabidopsis BLASTP hit, column 11 is e-value 1015 score for BLAST, and column 12 is Arabidopsis annotation. (ALI1_DNA_CALLSNPs.zip) 1016 1017 Additional Data table S9 (separate file) 1018 Selected gene list of DESeq2 results of mRNA differential expression of ali1-1 tassels before 1019 emergence from leaf whorl as compared to wild type. Column 1 is maize identification number, 1020 column 2 is the baseMean for all samples, column 3 is the log2 fold change (negative indicates 1021 lower expression in ali1-1 mutant and positive indicates higher expression in ali1-1 mutant as 1022 compared to wild type), column 4 is log2 fold change SE, column 5 is Wald statistic, column 6 is 1023 Wald test P-value, and column 7 is Benjamini-Hochberg multiple testing adjusted P-value. 1024 (INTEREST_TASSEL.csv) 1025 1026 Additional Data table S10 (separate file) 1027 Selected gene list of DESeq2 results of mRNA differential expression of ali1-1 15 DAP SAM 1028 and surrounding tissue as compared to wild type. Column 1 is the maize identification number, 1029 column 2 is the baseMean for all samples, column 3 is the log2 fold change (negative indicates 1030 lower expression in ali1-1 mutant and positive indicates higher expression in ali1-1 mutant as 1031 compared to wild type), column 4 is the log2 fold change SE, column 5 is the Wald statistic, 1032 column 6 is Wald test P-value, and column 7 is the Benjamini-Hochberg multiple testing 1033 adjusted P-value. (INTEREST_15DAP.csv)