Copyright 0 1988 by the Genetics Society of America

Effects of Amino Acid Substitutions atthe Active Site in Escherichia coli @-Galactosidase

Claire G. Cupples and Jeffrey H. Miller

Molecular Biology Institute and Department of Biology, University of Calqornia, Los Angeles, Calqornia 90024 Manuscript received April 2 1, 1988 Accepted July 23, 1988

ABSTRACT Forty-nine amino acid substitutions were made at four positions in the Escherichia coli enzyme p- galactosidase; three of the four targeted amino acids are thought to be part of the active site. Many of the substitutions were made by converting the appropriate codon in lacZ to an amber codon, and using one of 12 suppressor strains to introduce the replacement amino acid. Glu-461 and Tyr-503 were replaced, independently, with 13 amino acids. All 26 of the strains containing mutant enzymes are Lac-. Enzyme activity is reduced to less than 10% of wild type by substitutions at Glu-461 and to less than 1% of wild type by substitutions at Tyr-503. Many of the mutant enzymes have less than 0.1 % wild-type activity. His-464 and Met-3 were replaced with 1 1and 12 amino acids, respectively. Strains containing any one of these mutant proteins are Lac+. The results support previous evidence that Glu-46 1 and Tyr-503 areessential for catalysis, and suggest that His-464 is not part of the active site. Site-directed mutagenesis was facilitated by construction of an fl bacteriophage containing the complete lacz gene on i single ECORIfragment.

-GALACTOSIDASE (EC 3.2.1.23) is produced in and J. H. MILLER,unpublished data), we used ethyl- P Escherichia coli by the lacZ gene, one of the four methane sulfonate to individually convert 43 gluta- protein-coding genes which comprise the lactose (lac) mine(CAG) and 39 tryptophan(TGG) residues operon (see review by MILLERand REZNIKOFF1978). throughout lac2 to amber (TAG) codons. Nonsense The enzyme catalyzes the conversion of lactose into suppressorstrains were used to make 12 different glucose and galactose, allowing the organism to use amino acid substitutions at each of these 82 amber lactose as a carbon source. It is a multimeric enzyme, codons. Eighty-one of these residues could accept any composed of four identical subunits. Despite the fact substitution with minimal change in enzyme activity. that each of the subunitshas an independentcatalytic Since random alterations in the primary structure site, only the tetramer is biologically active (reviewed of &galactosidase have so little effecton enzymeactiv- by ZABIN and FOWLER1978). ity, we decidedto specifically changeamino acids The large size of the individual polypeptide chains which are thought to be partof the activesite. In this (1023 amino acids) may account for the fact that the paper, we report on the effects of amino acid substi- enzyme is very tolerant of changes in the primary tutions at three such residues. Twoof the aminoacids, sequence. LANCRIDCE(1974) selected nitrosoguani- the glutamate residue atposition 46 1 and the tyrosine dine-inducedmutants which had less than 50% of at 503, are probably involved in the catalytic reaction wild-type @-galactosidase activityand showed that72% (HERRCHENand LECLER,1984; SINNOTTand SMITH of those attributable to point mutations were nonsense1978; FOWLERet al. 1978). LECLERand HERRCHEN rather than missense mutations. Similarly, 93% of the (1983) and HERRCHENand LEGLER(1984) have sug- point mutations in lac2 which prevented growth on gested that a third residue, the histidine at position lactosewere nonsense mutations (LANGRIDCEand 464, may be involved in substrate binding. For com- CAMPBELL1969). These studies suggest that most parison, we have also made substitutions at methio- missense mutations have little effecton @-galactosidase nine 3, an amino acidwhich is in a part of the molecule activity. that is nonessential for enzyme activity(MULLER-HILL This hypothesis is supported by two studies on the and KANIA 1974; BRAKEet al. 1978). effects of amino acid substitutions in @-galactosidase. WELPLY,FOWLER and ZABIN (1981) used nonsense MATERIALS AND METHODS suppressionto produce amino acid substitutions at four sites in the LY portion of the molecule, a region Bacterial strains are listed in Table 1. Plasmids are main- known to beinvolved in tetramer formation (reviewed tained in p9Oc, phage in JM80l and episomes in s9Oc. Media have been described by MILLER (1972). All recombinant by ZABIN 1982). They found little or no decrease in DNA techniques are standard (MANIATIS,FRITSCH and SAM- enzyme activity. In a previous study (C. G. CUPPLES BROOK 1982; DAVIS, DIBNERand BATTEY 1986) unless

Genetics 120: 637-644 (No\ember. 1988) 638 C. G. Cupples a1 Id J. H. Miller

TABLE 1 MgCln (pH 7.4). Excess EcoRI was added and digestion was continued at 37" overnight. DNA was extracted with Bacterial strains phenol/chloroform and ethanol precipitated before ligation into theEcoRI site of R229. Phage containing the complete Strain Sex Genotype lacZ gene, without lad, were blue on LB plates containing P90c F- A(lacproB)ara thi 5-bromo-4-chloro-3-indolyl-@-~-galactoside(Xgal). s9oc F- A(1acproB)ara thi rpsL The lad-containing insert was cloned in both orientations into R229, so that single stranded template DNA could be JM8Ol Ffkan ara A(1acproB) thi rpsL XAlOl F- ara A(1acproB) gyrA metB argE-am prepared from both strands. rpoB supD thi Mutagenesis: Site-directed mutagenesis was done by a XA102 F- ara A(1acproB) gyrA metB argE-am variation of the technique of ZOLLER and SMITH(1982), rpoB supE thi using two primers. The mutagenic and secondary primers XA103 F- ara A(1acproB) gyrA metB argE-am are shown in Table 2. (Note that theMet-3 amber mutation rpoB supF thi was made on the opposite strand from the mutations at the XA105 F- ara A(1acproB) gyrA metB argE-am other three sites). DNA from the mutagenesis reaction was rpoB supG thi used to transform competent JM80l cells. Cells containing XA96 F- ara A(1acproB) gyrA argE-am rpoB phage with missense or nonsense mutations in lac2 formed thi supP pale blue or white plaques on plates containing Xgal. Single- and double-stranded DNA were isolated from these plaques JM802 F'lacl A(1acproB) supE thi proA+, B+ for sequencing and subcloning. CSH 13-20a F'lacZ A(1acproB) supE thi contain Transferring mutations from phage to episome: Each proA+,B+ progressivelylarger deletions in mutant lacZ gene was recombined onto an episome via a lacZ plasmid intermediate. Double-stranded DNA from mutant phage was digested with EcoRIand thefragment containing the lacZ gene was subcloned into pBR329. Plasmid-contain- otherwise specified. SDS-polyacrylamidegel electrophoresis ing cells were mated withcells which contained a lad-/ of bacterial proteins is described by SILHAVY,BERMAN and lacZf episome, and progeny were selected on minimal glu- ENQUIST(1984). In vitro @-galactosidaseassays were done cose plates containing tetracycline. Cells were grown over- using permeabilized whole cells, as described by MILLER night in LB medium containing tetracycline to allow recom- (19'72). bination between the episomal and plasmid lac2 genes. They Galactosides were purchased from Bachem (Torrance, were then crossed with s90c in order to separate episomes CA), and DNA restriction and modification enzymes and from plasmids. The progeny were selected on minimal glu- linkers from Pharmacia or IBI. Plasmids pBR322 and cose plates containing streptomycin and Xgal. Cells contain- pBR329 were obtained from New England Biolabs. ing an episome with a mutation in lac2 were white or pale Synthetic suppressors: In addition to the standard sup- blue. pressor strains (XA96, XA 10 1-XA 105) we used seven ad- Analysis: Episomes were transferred to deletion mapping ditional suppressor strains, inwhich the mutant tRNA is strains (CSH 13 to 20a) by plate mating techniques (MILLER carried on a multicopy plasmid. Details of the construction 1972). Finer mapping was done using an additional set of and use of these suppressors, with comprehensive documen- 22 deletion strains. Similarly, episomes which contain an tation of specificity and efficiency have been published amber mutation were transferred to suppressor strains for (NORMANLYet al.1986) or will be published elsewhere. analysis. @-Galactosidaseactivities were assayed in vivo on Briefly, it has been established that each suppressor inserts indicator plates containing Xgal. Enzyme levels were deter- the correct amino acid at least 90% of the time. Efficiency mined in vitro using o-nitrophenyl-@-D-galactoside(ONPG) of amber suppression varies between 5% and 100% and is as a substrate. Cells were assayed for the ability to grow on dependent in part on the site being suppressed. minimal lactose plates. Plasmid and phage construction:To provide a template for oligonucleotide-directed mutagenesis, theentire lac2 gene was cloned into an fl bacteriophage derivative, R229 RESULTS (BOEKE1981). Figure 1 illustrates the steps involved in the construction of this phage, fl-Z. The PstIIEcoRI fragment Construction of the fl-2phage: To produce single which contains the lad gene and part of the lacZ gene was stranded template for site-directed mutagenesis the subcloned from the plasmid pGMl1 (GALAS,CALOS and lac2 gene was cloned into R229, a filamentous M13 MILLER 1980). The six oligonucleotides used to construct the missing 53 bp of lacZ were synthesized, purified, phos- phage derivative which contains a single EcoRI site in phorylated and annealed as described previously (NOR- the intergenic region (BOEKE1981). Cloning lac2 as MANLY et al. 1986). To introduce an EcoRI site 5' of lacZ, an EcoRI fragment required that the single, internal the Hpalsite in lac1 wasconverted into an EcoRI site by the EcoRI site close to the 3' end of the genebe removed, addition of EcoRI linkers. Since the lac2 gene also contains and that newEcoRI sites be inserted on either sideof two HpaI sites, the following conditions were used to gen- erate partially digested DNA. One rg of pCCLac4 DNA the gene. This constructionis shown in Figure 1. was digested with 1 unit of HpaI at 37" in 100 PI. Aliquots Lacl (the lac repressor gene) and mostof lacZ were were withdrawn after 5,10, 15,20 and 30min. The reaction initially cloned as a PstIIEcoRI fragment (pCClac1 in was terminated by extracting the DNA with phenol/chlo- Figure 1). The missing portion of the lac2 gene was roform, andprecipitating it with ethanol. To add thelinkers, synthesized de novo as a small fragment which could the five aliquots were pooled and ligated overnight to phos- be ligated into the EcoRI site of pCClac 1. The EcoRI phorylated EcoRI linkers at a molar ratio of 1:50. The ligase was inactivated at 65" for 10 min and the salt conditions sites were not reformed during ligation; however the were adjusted to 100 mM Tris, 50 mM NaCl and 5 mM synthetic fragment itself contained an EcoRI site im- A ctive Site ,&Galactosidase Active 639

TABLE 2 Mutagenic and secondaryprimers

A. Mutagenic primers:” Methionine 3 A m ber primer 5’-ATCACCmATTACGGAT-3’ primer Amber Wild type 3’-TACTGGTACTAATGCCTAAGTGACCGGCAG-5’ Glutamate 461 W ild type Wild 5’-ATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAATCAC-3’ Basic primer 3’-GCGACCCCTTA***TCACCGGTGCCGCG-5’ Histidine 464 Wild type 5’-CTGGGGAATGAATCAGGCCACGGCGCTAATCACGACGCG-3’ A mber primer Amber 3’-CTTAGTCCGECCGCGATTAG-5’ Tyrosine 503 W ild type Wild 5”ATTATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCC-3’ Basic primer 3’-CGGGCTAC***CGCGCGCACCTCCTTCTG-5’- B. Secondary primersb Z-COOH-4 3”ATGGTAATGGTCAACCAGACC-5’ Z-COOH-5 3’-GTCTGGTGTCAAAAATAATAAGAATTCTGCAGT-5’

a Sequence of the oligonucleotides used to introduce amber and missense mutations at Met-3, (3111-461, His-464 and Tyr-503. Each oligonucleotide is shown with its complementary wild-type strand. Note that the sequence of the Met-3 primer is that of the sense strand. Changes from the wild type are underlined. The mutations at Glu-461 and Tyr-503 are indicatedby *** since both nonsense and missense codons were introduced at these sites. Sequence of the secondary primers.The top onewas used in conjunction with the Glu-461, His-464 and Tyr-503 mutant oligonucleotides. The bottom one was used in the construction of the amber mutation at Met-3. Both oligonucleotides are from the set of six used to reconstruct the5’ end of lacZ (see Figure 1).

FIGURE 1.-Plasmid and phage con- structions. Vector sequences are shown Pst I HpaI HpaI HpaI Eco R I I II I by wavy lines, genesor parts of genesby lac11 H I I /acZ IH lacy Hlac.41 lac operon boxes and intergenic regionsby straight lines. The top diagram is aschematic map of the lac operon showing the rela- Pst I Eco RI tive positionsof the restriction sites used in the constructions. pCClac1 was made by cloning a Pstl/EcoRI fragment con- taining lacl and98% of lacZ into thePstl and EcoRI sites of pBR322. The EcoRI site is within lad. The missing portion AATTTCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAATAA~TGCAGT of lacZ was synthesized de novo from six AGTCGACTCGCGGCCAGCGATGGTAATGGTCAACCAGACCACAGTTTTTATTATTCTTAAGACGTCATTAA oligonucleotides. The sequence also con- tained a newEcoRI site (underlined) im- mediately 3’ of the lacZ termination co- dons. The boundaries of the individual oligonucleotides are indicated by vertical arrows. The synthetic double stranded pCClac4 fragment was ligated into theEcoRI site ofpCClac1 toproduce pCClac4. The EcoRI siteswere not reformed. The GGAATTCC HpaI site in the 3‘ end of lacl was con- CCTTAAGG verted into anEcoRI site by the addition of EcoRI linkers. Finally, flZ was pro- duced by subcloning the pCClac4EcoRI lac z fl-Z fragment containing the complete lacZ Eco R I EcuRI and small fragment oflac1 into theEcoRI site of R229. mediately 3‘ of the termination codons. pCClac4 con- lacI-/lacZ+ phageproduced dark blue plaques on tains the complete lacl and lac2 genes. plates containing Xgal. This bacteriophage, fl-2, has The second flanking EcoRI site was introduced into two advantages over the M 13 series for these experi- the lacl gene, a step which also detected 80% of the ments, @-galactosidaseexpression is constitutive, and lac repressor gene and allowed constitutive expression the entire lac2 gene is on a single fragment, thereby of lacZ. The site was produced by converting the HpaI avoiding the complications of alpha complementation. site in lacl into an EcoRI site, using EcoRI linkers. Production and identification of mutants: Single- With EcoRI sites on eitherside of lad,the gene could stranded fl-2 DNA was used as a template for site- then be ligated intothe EcoRI site of R229. The directed mutagenesis. Four oligonucleotides (Table 640 C. G. Cupples and J. H. Miller

2B) introduced amber mutations at Met-3, Glu-461, TABLE 3 His-464 or Tyr-503. Fourteen additional oligonucle- Units of &galactosidase producedby nonsense suppression of otides introduced missense mutations at Glu-461 or amber mutations at Met-3 andHis464 Tyr-503. The efficiency of amber suppression is influ- enced by the identity of the base immediately 3' of Amino acid Met-3 His-464 the ambercodon (MILLERand ALBERTINI 1983;BOW Ser 719 480 1983). With a few exceptions, A and Gprovide a 260 Gln 704 better suppression context than U or C. Therefore 'Tyr 1263 964 the oligonucleotide which changed Glu-461 (GAA) to LY s 777 62 1 2762 2037Leu 2762 an amber codon (TAG) also changed the serine 462 Ala 258 1 2167 codon from TCA to ACT. For consistency, the same CYS 2143 2317 change was also made by all of the oligonucleotides 2177Glu 2947 which introduced missense mutations at Glu-46 1. GlY 2342 1224 His 2149 2562 Mutant phage formed white or pale blue plaques Phe 3964 4316 on plates containing Xgal, and DNA from these phage Pro 1623 1080 was sequenced to confirm that the mutation was pre- Wild type 4200 sent. Phage were also checked, as follows, to ensure Assays were done using permeabilized whole cells, and units of that there were no secondary mutations. Those con- activity were calculated as described by MILLER(1972). The strains taining nonsense mutationsproduced bright blue are listed in the same order asthey appear on the Xgal plates (Figure 2A). plaques when introduced into the suppressor strain which inserted the wild type amino acid. The missense sion. Table 4 (Glu-461) and Table 5 (Tyr-503) show mutations were reverted to theoriginal codon by site- the in vitro activity of the mutant enzymes, as meas- directed mutagenesis, and the resulting phage pro- ured by the hydrolysis of ONPG. The units of enzyme duced bright blue plaques. The mutant lac2 genes activity of the suppressed nonsense mutations are also were recombined onto anepisome via a plasmid inter- shown normalized for suppressor efficiency, so that mediate. Onceon the episome, each mutation was activity can be compared directly to that of the cor- checked to ensure that it mapped to the correct dele- responding missense mutations.In mostcases, the tion interval. activity of the missense and suppressed nonsense mu- The original lac2 gene cloned from pGMl1 has a tants differ by less than a factor of 3. In contrast, the weaker promoter(LS), whereas the episome has a activity of most of the mutant enzymes was 2 to 4 strong promoter (P'). Recombinants containing the orders of magnitude below that of the wild type P+ promoter have approximately 15-fold higher levels enzyme. None of the mutant proteins has sufficient of ,&galactosidase, increasing the sensitivity of subse- activity to allow the cells to use lactose as a carbon source (Lac-). quent enzyme assays. The drastic decreases in enzyme activity cannot be Effect of amino acid substitutions at His-464 and accounted for by increased degradation of the mutant Met-3: Table 3 shows the units of/3-galactosidase proteins. Protein extracts from wild-type and mutant produced by enzymes with twelve individual amino cells were analyzed by SDS-polyacrylamide gel elec- acid substitutions at His-464. The results are com- trophoresis; the amount of P-galactosidase was similar pared to those obtained from the same amino acid in all strains (data not shown). substitutions at Met-3. All of the substitutions at each Enzyme activity was also monitored in vivo by the site were made by nonsense suppression. The pattern intensity of the blue color produced by colonies grow- of enzyme activity is similar at the two sites. All 24 ing on plates containing Xgal. Figure 2B shows the strains grew on minimal lactose plates and produced results for substitutionsat Glu 46 1. Of thesuppressed medium to dark blue colonies on plates containing amber derivatives, only the glutamate and histidine Xgal after 24 h (Figure 2A). When the plates were substitutions produce a bluecolony; the others remain examined after a shorter incubation, the intensity of white even after prolonged incubation. The histidine, the color was clearly proportional tothe units of glycine and aspartate missense mutants are pale blue, enzyme activity determined in vitro. and the other missense mutants are white. Figure 2C Effect of amino acid substitutions at Glu-461 and shows the results for the Tyr-503 mutants. In contrast, Tyr-503: Thirteen different amino acids were substi- to the Glu-46 1 results, all of the cells containing Tyr- tuted, independently,for the glutamate at position 503 mutant enzymes produce blue colonies on Xgal 461 and the tyrosine at 503. At each site, 2 substitu- plates after 24 hrof incubation. tions were made by missense mutation, 6 by nonsense DISCUSSION suppression and 5 by both methods. The wild-type amino acids, glutamate and tyrosine respectively, were We have made a totalof 37 amino acid substitutions also reintroduced into the sites by nonsense suppres- atthree residues in E. coli enzyme &galactosidase /3-Galactosidase Active Site 64 1

. . ,.

FIGURE2.-&plactosidase activity on plates contain- ing Xgal, after 24 hr of incubation. A, Met-3 amber mutation (rows 2 and 3) and His-464 mutation (rows 4 and 5) in the following suppressor strains: row 2 and 5: serine, glutamine, tyrosine, lysine and leucine; rows 3 and 4: alanine, cysteine, glutamate, glycine, histidine, phen- ylalanine and proline. The wild-type strain is in row 1. B, Glu-461: Colonies in rows 1 and 3 contain the amber mutation in the suppressor strains. The inserted amino acids inrow 1 are: serine, glutamine, tyrosine, lysine, leucine and alanine; in row 2: cysteine, glutamate, glycine, histidine, phenylalanine and proline. The missense mu- tants, or wild type, are directly underneath theappropri- ate suppressed amber (rows 2 and 4). Row 5 contains the asparate and valine missense mutants. C, Tyr 503: Colo- nies in rows 1 and 3 contain the amber mutation in the suppressor strains. The order is the same as in B. The missense mutations, or wild-type (rows 2 and 4) are un- derneath the appropriate suppressor strain. Row 5 con- tains the asparagine and isoleucine missense mutants.

which have been postulated to be part of the active FOWLERet al. 1978; SINNOTTand SMITH1978). His- site. Glu-461 and Tyr-503 are thought to be directly 464 is not directly involved in catalysis, but LEGLER involved in catalysis (HERRCHENand LECLER1984; and HERRCHEN(1983) have suggested that it may be 642 C. G. Cupples and J. H. Miller

TABLE 4 stitution. Simply changing the original codon to an Units of @-galactosidaseproduced by the mutants with amino amber (TAG) codon and expressing the gene in a acid substitutionsat Glu.461 variety of amber suppressor strains allowed the pro- duction of a family of mutant proteins, each with a Suppressed amber different amino acid substitution. This approach to Amino Missense acid Absolute Normalized (or wild type) protein engineering has been employed previously, using five of the naturally occurring amber suppres- Ser 4.7 28.2 - Gln 0.23 1.41 4.3 sors (MILLER et al. 1979; SMITHet al. 1986). The TYr 0.06 0.21 - addition of seven synthetic suppressors allowed us to Lys 1.2 6.67 0.025 make 12 amino acid substitutions at each site. Leu 3.0 4.69 - Methionine 3: Since Met-3 is in a part of the mol- Ala 1.8 3.01 27.8 ecule not required forenzyme activity (MULLER-HILL c ys 4.7 9.47 - Glu 1664 2437 32 17 (wild type) and KANIA1974; BRAKEet al. 1978), it can probably G’Y 11.8 21.7 42.6 be replaced by any amino acid without significantly His 168 99.8 1 28 affecting enzyme activity. The activity of mutant pro- Phe 0.31 0.31 - teinsmade using the12 suppressorstrains should, - Pro 0.05 0.20 therefore, reflect suppressorefficiencies. As expected, ASP - - 1.04 Val - - 0.45 the results shown in Table 3 arecomparable with previous dataon relativesuppressor efficiency a- = missense mutation was not made or there was no amber suppressor available to insert that amino acid. The strains are listed (MILLERand ALBERTINI1983; NORMANLYet al. 1986; in the same order as they appear on the Xgal plates (Figure 2B). L. G. KLEINAand J. H. MILLER, unpublished data). We therefore used the percentageof wild-type activity TABLE 5 at this site to normalize the units of enzyme activity Units of @-galactosidaseproduced by the mutants withamino obtained for amino acid substitutions at Glu-461 and acid substitutionsat Tyr-503 Tyr-503. Histidine 464: Since the His-464 mutants give com- Suppressed amber Amino Missense parable results to Met-3 mutants, it seems probable acid Absolute Normalized (or wild type) that enzyme activity is reflecting suppressor efficiency Ser 0.09 0.7 0.39 at this site also. This lackof aunique suppression Gln 0.096 1.5 - pattern, combined with the fact that all of the amino Tyr 659 2710 4073 (wild type) acid substitutions at His-464 result in a Lac+ pheno- LYS 4.2 26.8 0.3 type, indicates that this residue is probably not part Leu 0.52 1.0 - Ala 0.17 0.3 - of the active site. CYS 10.2 17.5 0.53 Glutamate 461: The only amino acid substitution 0.25 0.5Glu 0.25 - at Glu-46 1 which results in an enzyme with more than GlY 0.42 1.4 - 5% of wild-type activity is histidine. All of the other 4.9 9.0 His 4.9 4.9 substitutions, whether introduced by missense muta- Phe 0.55 0.55 4.32 1.47 3.6Pro 1.47 - tion or nonsense suppression, result in enzyme activi- Asn - - 0.45 ties of less than 1%. None of the enzymes, including Ile - - 0.18 the histidine mutants, has sufficient biological activity

0- = missense mutation was not made or there was no amber to allow the cells to use lactose as a carbon source. suppressor available to insert that amino acid. The strains are listed This data supportsprevious biochemical evidence that in the same order as they appear on the Xgal plates (Figure 2C). Glu-461 is involved in catalysis. Preliminary kinetic part of the active site. For comparison, we have also data on the mutant proteins provides confirmation made 12 amino acid substitutions at Met-3, a residue (R. E. HUBER andC. G. CUPPLES,unpublished data). which is not necessary for enzyme activity (MULLER- It is interesting that the histidine substitution gives HILLand KANIA,1974; BRAKEet al. 1978). the highest activity of any of the mutant proteins. In Predicting the probable effects of amino acid sub- the currently accepted model for &galactosidase ca- stitutions at Glu-461,His-464 and Tyr-503 onbiolog- talysis, theglutamate residue provides a negative ical activity was complicated by the fact that there is charge to stabilize the positively charged, galactosyl- no crystallographic data available for 0-galactosidase. enzymeintermediate (reviewed by SINNOTT1987). Therefore, in order tomake as many mutant proteins Clearly, although histidine can function as a proton as possible, we made use of bacterial nonsense sup- acceptor, it cannot provide a negative charge per se. pressorstrains to individually insert twelve amino An alternate possibility is the formation ofa covalent acids at each site. This eliminated the necessityof bond between the enzyme and the intermediate, a producing individual missense mutations for each sub- possibility that has been discussed previously (SINNOTT @-GalactosidaseActive Site 643

1978). Kinetic studiescurrently in progressshould the His-461 missense mutantproduces almost 300 clarify this point. units of @-galactosidaseand is Lac-. Either ONPG is Aspartate is nota good substitute for glutamate a better substrate for the mutant protein thanit is for despite its negative charge, perhaps because the side the wild type, or lactose is a poorer substrate for the group does not extend far enough intothe active site. mutant protein than for thewild type. Aspartate was found to be a poor substitute for the The relative intensity of the blue color produced glutamate residue in the active site of triosphosphate by manyof themutants on Xgal plates doesnot isomerase, also (STRAUSet al. 1985). correlate with the levelsof @-galactosidaseactivity Tyrosine 503: The 7 amino acid substitutions pro- measured with ONPG. Forexample, the Ala-461 duced by introducing missense mutations at Tyr-503 missense mutant produces 28 units of activity com- reducethe number of units of enzyme activity to pared with the 1 unit produced by Asp-461 mutant below 0.1 %. The substitutions produced by nonsense but the latter is blue and the former remains white suppression show a similar reduction in enzyme activ- even after prolonged incubation. This is in contrast ity. The dramatically decreased activity of the mutant to our experience with lac2 mutationsoutside the proteins strongly supports previous, indirectevidence active site; for these, we have consistently found that that Tyr-503 is the active site tyrosine (FOWLERet al. the intensity of the blue color on Xgal plates is an 1978; SINNOTTand SMITH1978). accurate reflection of the units of @-galactosidase Phenylalanine and histidine are the best replace- measured with ONPG (J. H. MILLER, unpublished ments fortyrosine in the collection of mutant enzymes results). The unusual behavior of the active site mu- produced by missense mutation. Phenylalanine is tants probably reflects variations in the efficiency of identical to tyrosine with the exception of the hy- interaction between the mutant enzymes and the two droxyl group on thetyrosine phenolic ring. Since it is substrates, Xgal andONPG. The relative levelsof this group which would provide the proton for catal- activity of two mutant enzymes may not remain the ysis, it is unlikely that phenylalanine has any catalytic same from substrate to substrate. activity per se. However, if the phenylalanine causes In contrast to the Glu-461 mutants, all of the cells minimal disruption of the active site, the substrate will containing Tyr-503 missense mutants produce blue still be able to bind and theGlu-46 1 carboxylategroup colonies even when the number of units of @-galacto- can still function effectively to break the glycosyl sidase activity is fourto five orders of magnitude bond. The absence of an acid catalyst simply reduces below that of the wild type. This may indicate that the rate of the reaction. Either the size or the charge ONPG is a poor substrate, compared to Xgal, for all of the histidine, or both, may make it one of the better of the Tyr-503 mutantenzymes. Alternatively, it may substitutions for tyrosine. be that measuring the hydrolysis of ONPG in vitro is Cysteine and lysine substitutions produced by non- a less sensitive assay for low levels of enzyme activity sense suppression also produce relatively high levels than detecting the hydrolysis of Xgal in vivo. of enzyme activity. However, the corresponding mis- Conclusions: The datapresented in this paper sense mutants have very low activities. Other workers clearly show that most, if not all, amino acid substitu- have found levels ofactivity for lysine 503 andcysteine tions at either Glu-461 or Tyr-503 result in greatly 503 mutants which are comparable to our missense decreased levels of enzyme activity. While we cannot mutants (M. RING and R. E. HUBER, personal com- rule out the possibility that the replacements are pro- munication), indicating that the levels produced by ducing subtle structural changes in the mutant en- the missense mutants are the correct ones. We are zymeswhich interfere with activity indirectly, the unable to account for the discrepancy between the results do agree with previous biochemical data on activities of the suppressed nonsense and the missense the roles of these two residues incatalysis. Kinetic mutants. One possibility is mischarging of the sup- analysis of the mutant proteinsshould provide confir- pressors with tyrosine, at such a low level (less than mation. 1%) that we are unable to detect it by protein sequenc- The suppressor screening system has proven to be ing. Whatever the explanation,the relative differ- very useful for rapidly producing and screening mul- ences in activity between the suppressed nonsense tiple @-galactosidasemutants. The major advantages mutations and the missense mutations are minor in of the system are particularly well illustrated in the comparison with the very large decrease in activity of case of the histidine substitution at Glu-461. There the mutant proteins comparedwith the wild type. was no a priori reason to construct ahistidine missense Possible alteration of substrate specificity: Levels mutant since the current schemes for @-galactosidase of more than 100 units of wild-type @-galactosidase catalysis require a negatively charged amino acid at activity correlate with a Lac+ phenotype(SILHAVY, this site. The suppressor screening system allowed us BERMAN andENQUIST, 1984; SIMONS,HOUMAN and to quickly and easily test the effects of a substitution KLECKNER1987; our unpublisheddata). However, which we would otherwisenot have tried. Further 644 C. G. Cupples and J. H. Miller analysis of the histidine mutant may help to clarify the sequence on the suppression of nonsense codons. J. Mol. Biol. role of Glu-461 in catalysis. 164 59-7 1. MILLER,J. H., and W. S. REZNIKOFF,1978 The Operon. Cold This work was supported by a grant from the National Science Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Foundation (DMB-8417353) to J.H.M. C.G.C. was supported by a MILLER, J.H., C. COULONDRE, M. HOFER,U. SCHMEISSNER,H. fellowship fromthe Natural Sciences and Engineering Research SOMER,A. SCHMITZ andP. Lu, 1979 Genetics studies of the Council of Canada. We thank THOMASSUTHERLAND for synthesiz- lac repressor IX. Generation of altered proteinsby the suppres- ing the oligonucleotides, IRVINGZABIN for critical comments on sion of nonsense mutations. J. Mol. Biol. 131: 191-222. the manuscript, and R.E. HUBER foruseful discussions. KIM-TRANG MULLER-HILL,B., and J. KANIA, 1974 Lac repressor can be fused PHAM,ANITA PAKRASI, KATHRYNMAYER, SHARON RODMAN and to 0-galactosidase. Nature 249: 561-563. NGUYETBut provided invaluable technical assistance. NORMANLY,J., J.". MASON, L. G. KLEINA,J. ABELSONand J. H. MILLER,1986 Construction oftwo Escherichia coli amber suppressor genes: tRNA:';', and tRNA!%*. Proc. Natl. Acad. LITERATURECITED Sci. USA 83: 6548-6552. BOEKE,T. D., 1981One and two codon insertion mutants of SILHAVY,T. J., M. L.BERMAN and L. W. ENQUIST, 1984 bacteriophage fl. Mol. Gen. Genet. 181: 288-291. Experiments with Gene Fusions.Cold Spring Harbor Laboratory, Bossr, L., 1983Context effects: translation of UAGcodon by Cold Spring Harbor, N.Y. suppressor tRNA is affected by the sequence following UAG SIMONS,R. W., F. HOUMANand N. KLECKNER,1987 Improved in the message. J. Mol. Biol. 164: 73-87. single and multicopy lac-based cloning vectors for protein and BRAKE,A. J., A. V. FOWLER, I.ZABIN, J. KANIA andB. MULLER- operon fusions. Gene 53: 85-96. HILL, 1978 fi-Galactosidase chimeras: primary structure of a SINNOTT,M. L., 1978 Ions, ion-pairs, and catalysis by the lac2 @- lac repressor-&galactosidase protein. Proc.Natl. Acad. Sci. galactosidase of Escherichia coli. FEBS Lett. 94: 1-9. USA 75: 4824-4827. SINNOTT,M. L., and P. J. SMITH, 1978 Affinity labelling with a DAVIS,L. G., M. D. DIBNERand J. F. BATTY,1986 Basic Methods deaminatively generated carboniumion. Biochem.J. 175: 528- in Molecular Biology. Elsevier, New York. 538. FOWLER,A. V., I. ZABIN,M. L. SINNOTTand P. J.SMITH, SMITH,K. A,, S. F. KNOWLAN,S. A. MIDDLETON,C. O'DONOVAN 1978 Methionine 500, the site of covalent attachment of an and E. A. KANTROWITZ,1986 Involvement of tryptophan active site-directed reagent of &galactosidase. J. Biol. Chem. 209 in the allosteric interactions of Escherichia coli aspartate 253: 5283-5285. transcarbamylase using single amino acid substitution mutants. GALAS,D. J., M. P. CALOSand J. H.MILLER, 1980 Sequence J. Mol. Biol. 189: 227-238. analysis of Tn9 insertions in the lac2 gene. J. Mol. Biol. 144: STRAWS,D., R. RAINES, E. KAWASHIMA,J. R. KNOWLESand W. 19-41. GILBERT,1985 Active site of triosephosphate isomerase: In HERRCHEN,M., and G. LEGLER, 1984Identification ofan essential uitro mutagenesis and characterization of an altered enzyme. carboxylate group at theactive site oflac2 @-galactosidasefrom Proc. Natl. Acad. Sci. 82: 2272-2276. Escherichia coEi. Eur. J. Biochem. 138: 527-53 1. WELPLY,J. K., A. V. FOWLERand I. ZABIN, 1981 @-Galactosidase LANGRIDGE,J., 1974 Mutation spectra and the neutrality of mu- a-complementation: effect of single amino acid substitutions. tations. Aust. J. Biol. Sci. 27: 309-320. J. Biol. Chem. 256: 6811-6816. LANGRIDCE,J., and J. H. CAMPBELL,1969 Classification and in- ZABIN, I., 1982 0-Galactosidase a-complementation. A model for tragenic position of mutations in the P-galactosidase gene of protein-protein interaction. Mol. Cell. Biochem. 49: 87-96. Escherichia coli. Mol. Gen. Genet. 103: 339-347. ZABIN,I., and A. V. FOWLER,1978 @-Galactosidase, the lactose LEGLER,G., and M. HERRCHEN,1983 N-Substituted D-gdlaCt0- pernlease protein, and thiogalactoside transacetylase. pp. 89- sylamines as probes for the active site of P-galactosidase from 121. In: The Operon, Edited by J. H. MILLERand W. S. REZNI- Escherichia coli. Carbohydr. Res. 116: 95-103. KOFF. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. MANIATIS,T., E. F. FRITSCHand J. SAMBROOK,1982 Molecular ZOLLER,M. J.. and M. SMITH, 1982. Oligonucleotide-directed mu- Cloning, A Laboratory Manual.Cold Spring Harbor Laboratory, tagenesis using M 13-derived vectors: an efficient and general Cold Spring Harbor, N.Y. procedure for the production of point mutations in any frag- MILLER,J. H., 1972 Experiments in Molecular Genetics. Cold Spring ment of DNA. Nucleic Acids Res. 10: 6487-6500. Harbor Laboratory, Cold Spring Harbor, N.Y. MILLER,J. H., andA. M. ALBERTINI, 1983Effects of surrounding Communicating editor: D. BOTSTEIN