HIV-1 Latency As a Consequence of Chromatin Regulation

Home , Nature Chemical Biology

HIV-1 LATENCY AS A CONSEQUENCE OF

CHROMATIN REGULATION

JULIA H. FRIEDMAN

Submitted in partial fulfillment of the requirements

For the degree of Doctor of Philosophy

Dissertation Adviser: Dr. Jonathan Karn

Department of Molecular Biology and Microbiology

CASE WESTERN RESERVE UNIVERSITY

May, 2011

CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

______Julia Friedman______candidate for the Doctor of Philosophy degree *.

(signed)______Dr. David McDonald_____

(chair of the committee)

______Dr. Jonathan Karn______

______Dr. Hung-Ying Kao______

______Dr. Paul MacDonald_____

______

(date) _____January 20, 2010______

*We also certify that written approval has been obtained for any proprietary material

contained therein.

Table of Contents Table Legend ...... 6 Figure Legend ...... 6 Acknowledgements ...... 9 List of Abbreviations ...... 10 Chapter 1) Introduction ...... 17 1A HIV and AIDS ...... 17 1A.1 Towards an HIV Vaccine ...... 19 1A.2 The HIV-1 Genome and Life Cycle ...... 22 1A.2a Entry ...... 26 1A.2b Reverse Transcription ...... 28 1A.2c Nuclear Import and Integration ...... 32 1A.2d HIV Transcription and RNA export ...... 35 1A.2e Cellular Activation Signals Cooperate with Tat/TAR ...... 35 1A.2f HIV RNA export ...... 42 1A.2g Assembly, Release, and Maturation ...... 43 1B HIV Latency ...... 44 1B.1 Pre-integration Latency ...... 44 1B.2 Post-integration Latency ...... 46 1B.2a In vitro Models ...... 46 1B.2b Primary Cells ...... 48 1B.2c In vivo Models ...... 50 1B.4 Mechanisms of HIV Latency ...... 51 1B.4a Cellular Factors ...... 51 1B.4b Heterochromatic Restriction ...... 52 1C Hypothesis and Discussion...... 56 Chapter 2) Materials and Methods ...... 60 2A Cell lines and Tissue Culture Reagents...... 60 2B Cloning and Lentiviral infections ...... 60 2C ChIP analysis ...... 61 2D Western Blots ...... 62

2E Isolating the C22G Tat mutant clone...... 63 2F MNase Digest ...... 63 2G Isolation and Analysis of Mononucleosome Fragments ...... 64 2H Activations and shutdowns ...... 64 2G Viral outgrowth assays ...... 65 Chapter 3) The Histone Lysine Methyltransferase EZH2 Plays an Essential Role in Establishing and Maintaining HIV Latency...... 67 3A Abstract ...... 67 3B Introduction ...... 69 3C Results ...... 71 3C.1 A small scale shRNA screen for factors regulating HIV Latency ...... 71 3C.2 Knockdown of EZH2 leads to activation of HIV transcription ...... 72 3C.3 EZH2 and M3K27 are present at the LTR of Latent Proviruses ...... 78 3C.4 EZH2 knockdown sensitizes latent proviruses to cellular activation signals ... 82 3C.5 Reduction of EZH2 delays silencing of HIV transcription ...... 85 3C.6 Drug candidates to induce reactivation of HIV from latency ...... 86 3C.7 Treating latent cells with the HKMT inhibitor DZNep activates cells through inhibition of methylation ...... 89 3C.8 Other HKMT inhibitors exhibit little activation potential ...... 91 3C.9 DNA methylation plays an insignificant role in proviral silencing ...... 91 3C.10 Treatment with the HDACi SAHA and DZNep synergistically activate HIV transcription ...... 92 3C.11 Knockdown of histone lysine methyltransferases induces outgrowth of HIV from latently infected resting memory T-cells obtained from patients ...... 95 3D) Discussion ...... 98 3D.1 Epigenetic silencing of HIV by histone methylation ...... 98 3D.2 EZH2 and SUV39H1 play unique roles in the silencing of HIV ...... 99 3D.3 Therapeutic implications ...... 100 Acknowledgments ...... 101 Chapter 4) Nuc-1 Remodeling is Required for Activation of HIV-1 Transcription 102 4A Abstract ...... 102 4B Introduction ...... 104

4C Results ...... 106 4C.1 The C22G Tat mutant ...... 106 4C.2 NXS clones establish latency at a slower rate than their wild-type controls .. 107 4C.3 A novel nucleosome mapping approach ...... 112 4C.4 Brg-1 recruitment to the HIV promoter ...... 113 4D Discussion and Future Directions...... 116 4D.1 Nucleosomes as barriers to HIV transcription ...... 116 4D.2 The SWI/SNF complex and viral replication ...... 119 Chapter 5 Future Experiments ...... 122 5A Additional compounds inhibiting methylation may also reactivate HIV from latency ...... 122 5B Evaluating the impact of the Histone Demethylase JMJD3 ...... 122 5C Assessing the role of protein arginine methyltransferases (PRMTs) ...... 124 5D Investigating the Roles of SUZ12 and EED ...... 125 5E Determine if EZH2 is contributing to latency in primary cells ...... 125 Chapter 6 Discussion ...... 129 6A The irreversible nature of chromatin ...... 129 6B Conclusions ...... 131 Appendix ...... 132 References ...... 157

Table Legend

Table 1 –Stimulation of HIV outgrowth from patient cells by siRNA to EZH2 and

SUV39H1 ...... 97

Figure Legend

Figure 1 - The T cell response in controlling viremia...... 20

Figure 2 - The HIV genome, 5’LTR, and nucleosome occupancy ...... 23

Figure 3 - The Multiple Steps of HIV Entry...... 27

Figure 4 - The Reverse Transcription Reaction...... 30

Figure 5 - The dynamic properties of NF-κB signaling...... 37

Figure 6 - The ESCRT pathway and HIV budding...... 45

Figure 7 - The EZH2 histone methyltransferase ...... 59

Figure 8 - Integration site of the E4 clone...... 73

Figure 9 - Small scale shRNA screening for factors involved in HIV transcription...... 75

Figure 10 - Knockdown of EZH2 induces transcriptional activation of latently infected cells...... 76

Figure 11 - Western Blot analysis of shRNA infected cells...... 77

Figure 12 - Knockdown of EZH2 results in elevated levels of proteins associated with active transcription...... 79

Figure 13- ChIP analysis of the latent E4 clone...... 81

Figure 14 - EZH2 resides at the 5’LTR of the 2D10 clone...... 83

Figure 15- Knockdown of EZH2 activates HIV transcription through pathways independent of T cell signaling...... 84

Figure 16 - Depletion of EZH2 results in slower progression to re-establishing latency. 87

Figure 17 - The structure of methyltransferase inhibitors...... 90

Figure 18 - DZNep can activate HIV transcription through direct inhibition of M3K27. 93

Figure 19 - Other histone methyltransferase inhibitors are poor inducers of HIV transcription...... 94

Figure 20 - Cooperative proviral reactivation by SAHA and DZNep...... 96

Figure 21 - Fresh infection of Jurkat cells with wild-type or C22G Tat...... 108

Figure 22 - The 2B2D clone...... 109

Figure 23 - Infection of Jurkat cells with NXS virus...... 111

Figure 24 - Flow cytometry analysis of d2EGFP expression of clones ...... 114

Figure 25 - Analysis of multiple individual clones harboring NXS...... 115

Figure 26 - Mapping Nuc-1 along the HIV provirus...... 117

Figure 27 - ChIP assay of Brg-1...... 118

Figure 28 - Methylation inhibitors...... 126

Figure 29 - Analysis of knockdown of PRMT5...... 128

Acknowledgements

I would like to thank those who have continuously helped me develop as a scientist.

Specifically, Dr. Jonathan Karn, my mentor, who has always been a voice of reason and

guidance. Also, the members of my thesis committee, Dr. David McDonald, Dr. Hung-

Ying Kao, Dr. Paul MacDonald, I thank for their support and helpful insight. I thank the

Department of Molecular Biology and Microbiology at Case Western Reserve University

for creating a friendly and encouraging work environment.

On a more personal note, I would like to thank my family. I couldn’t have done

this without the constant encouragement that I have received from my parents, Carolyn

and Marvin Friedman, and my cousin, Karen Fragale. They have helped shaped me to be

the strong, confident person that was able to accomplish any task I set forth for myself.

Unfortunately, two of my biggest supporters, my maternal and paternal grandmothers,

Sybil and Toby, are not here to celebrate this moment with me. However, I would like to

say that they will always be remembered and loved. To my daughter and fiancée, Sadie

and Angelo, thank you for all the beautiful moments that you have given me. You have

both been the light in my dark moments. My friends, Heather Mason-Suares and Sarah

Busch, who have always helped me through tough times both scientifically and personally and have left me with some amazing and hilarious memories.

List of Abbreviations

AZT 3'azido-3'-deoxythymidine

5' Aza 5' azacytidine

5'AzaCdr 5'-aza 2'-deoxycytidine

AIDS Acquired Immune Deficiency Syndrom

ARV antiretrovirals

APC antigen presenting cell

ARD arginine rich domain

BAF Barrier-to-autointegration factor

BAF Brg-1 associated factor

CA capsid

CBP CREB binding protein

CENPP centromere protein P

ChIP chromatin immunoprecipitation cPPT central polypurine tract

CTD carboxy terminal domain

CTIP-2 COUP-TF interacting protein-2 d2EGFP destabilized enhanced green fluorescent protein

DDDP DNA-dependent DNA polymerase

DNMT DNA methyltransferase

DSIF DRB-sensitivity inducing factor

DZNep 3-deazaneplanocin

EBNA2 Epstein Barr nuclear antigen 2

Env envelope

ESS exonic splicing silencers

EZH2 enhancer of zeste 2 gp120 Glycoprotein 120 t1/2 Half life

HDAC histone deacetylase

HERV human endogenous retrovirus

HAART Highly-Active Antiretroviral Therapy

HIV Human Immunodeficiency Virus

HKMT histone lysine methyltransferase

HMBA hexamethylbisacetamide

HMG high-mobility group

HP1 heterochromatin protein 1

HPV Human Papilloma Virus

HTLV-1 Human T lymphotropic Virus type 1

HTLV-3 Human T lymphotropic Virus type 3

IKK IκB kinase

IL-12 interleukin-12

IL-2 interleukin-

IL-4 inter eukin-4

IN integrase

ITAM immunoreceptor tyrosine-based activation mo if

JMJD3 Jmj C domain containing protein 3

LAT linker for the activation of T cells

LAT latency associated transcr pt

L-Domain late domain

LEDGF/p75 lens epithelium-derived growth factor

LSD1 lysine specific demethylase 1

LTNP long-term non-progressor

LAT Lymphadenopathy Associated Virus

MA matrix

MHC major histocompatability complex

MMTV Mouse Mammary Tumor Virus

Mnase micrococcal nuclease

NC nucleocapsid ncRNA non-coding RNA

Nef negative factor

NELF negative elongation factor nAb Neutralizing antibodies

NFAT nuclear factor of activated T cells

NF-κB nuclear factor-κB

NLS nuclear localization signal

NPS nucleosome positioning sequence

Nuc-1 Nucleosom -1

NXS nucleosome exclusion sequence

PBAF polybromo associated factor

PBS Primer inding site

PCAF CBP-associated factor

PIC pre-integration complex

PIC pre-initiation complex

PMA phorbol 12-myristat 13-acetate

Pol polymerase

PPT polypurine tract

PR protease

PRC2 Polycomb-repressive complex-2

PRMT protein arginine methyltransferase

PTB polypyrimidine tract binding protein pTEFb positive transcription elongation factor b

PTK phosphotyrosine kinase

Rev regulation of expression of viral proteins

RHD Rel-homology domain

RRE rev-response element

RT reverse transcriptase

RTC reverse transcription complex

SAHA suberoylanilide hyroxamic acid

SAM S-adenosylmethionine

SCID severe-combined immunodeficiency

SH2 src-homology domain

SIV Simian Immunodeficiency Virus

SLP-77 SH2 domain-containing leukocyte phosphoprotein of 76 kDa ssDNA strong-stop DNA

STI Structured Treatment Interruption

TAD trans-activation domain

TAR trans-activating response element

Tat trans-activator

TCR T cell receptor

TGF-β transforming growth factor-β

TI transcriptional interference

TNFR tumor necrosis factor-α receptor

TNF-α tumor necrosis factor-α

TPX trapoxin

TSA trichostatin A

Tsg101 tumor susceptibility gene 101

UTX ubiquitously transcribed tetratricopeptide X

Vif viral infectivity factor

VLP viral-like particle

Vpr viral protein R

Vpu viral protein U

HIV-1 Latency as a Consequence of Chromatin Regulation

Abstract

JULIA H. FRIEDMAN

HIV-1 is one of the most devastating diseases to have emerged in the past century. We can treat HIV+ patients with combined antiretroviral therapy (HAART) that essentially restricts viral replication to below limits of detection using clinical assays and prolongs the lifespan of those infected. However, these patients must remain on therapy for the duration of their lives, as going off HAART results in rebound of viral replication and subsequent CD4+ T cell depletion. The rebounding virus is produced from latently infected cells. These latent cells are memory CD4+ T cells that, due to their quiescent state, are restrictive for productive viral replication. Although there are many differences that can account for latency in these quiescent cells, such as a lack of nuclear localization of transcriptional initiation and elongation factors, one possible contribution is the establishment of heterochromatin around the integrated provirus. In this thesis, we have attempted to determine the consequences of integration into the human chromosome; specifically, the regulation of chromatin and its effects on HIV latency. We have corroborated the finding that nucleosome remodeling is an important step in the processive transcription of the HIV genome. Based on this and other evidence suggesting that HIV transcription can be epigenetically regulated, we wanted to identify other cellular factors involved in this process. We began by screening other heterochromatin associated proteins in a small scale shRNA approach. In this manner, we found that latently infected cells that were superinfected with EZH2 shRNA would spontaneously

15 reactivate. EZH2 is a histone methyltransferase that can trimethylate lysine 27 on histone

H3 (M3K27). This epigenetic mark has been implicated in other epigenetic regulated processes such as X-inactivation and Hox gene silencing. It appears, from chromatin immunoprecipation assays, that EZH2 is also resident along the promoter region of HIV proviruses. Treating latent cells with a drug that can specifically inhibit the M3K27 modification, DZNep, results in activation of latent viruses. As such, our findings have implicated a novel route for reactivation of latent proviruses. Understanding the molecular mechanisms underlying viral transcriptional silencing is paramount in the development of a novel therapeutic approach in the treatment of HIV.

Chapter 1) Introduction

1A HIV and AIDS

In 1981, reports surfaced of rare, aggressive cases of Kaposi’s sarcoma,

Pneumocystis carinii Pneumonia, and oral mucosal Candida infections within several

patients who were, incidentally, homosexual (1, 2, 128). As the same unusual clinical

presentation spread throughout the gay community and reached widespread recognition,

the initial public perception was that this was a new “gay disease” and the proper course

of action was to ostracize and condemn those infected. The situation escalated when

intravenous (IV) drug users began to present the same symptoms at the end of that year

(200). However, by 1983, panic swept across the globe, as clinical presentation was no

longer limited to the gay community and IV drug users, but had reached heterosexuals

and hemophiliacs as well. As reality hit, tremendous pressure was placed on government

officials and the scientific community for answers.

Although no causative agent had been found, some speculated that the disease,

now termed acquired immune deficiency syndrome (AIDS), was caused by an infectious

agent within the blood. However, by May of 1983, the Montagnier group reported

isolating what they believed to be a new retrovirus, lymphadenopathy associated virus

(LAV), that was the causative agent of AIDS (19). Confirmation soon followed with

reports from the Gallo and Oshiro groups that a unique virus, termed HTLV-III, could be

isolated from cells obtained from patients with AIDS like symptoms (173, 242). Credit

was shared between Montagnier and Gallo for the discovery; however, it caused one of

the biggest and most publicized rivalries in scientific history. Indisputable evidence that

HTLV-III/LAV was the etiological agent responsible for AIDS came from case reports in

hemophiliacs who received blood transfusions and had no known risk factors, yet still

developed AIDS (85). Although as quickly as 1985 an HTLV-III antibody screening test

was commercially available, the challenge to halt the progression of this disease and stop

the emerging global pandemic would begin to seem almost insurmountable.

The first anti-retroviral drug, 3’-azido-3’-deoxythymidine (AZT), targeted HTLV-

III, now termed Human Immunodeficiency Virus-1 (HIV-1), reverse transcriptase enzyme and gained FDA approval in 1987 (197, 209). Not until December 1995 was the second class of anti-HIV drugs, protease inhibitors, developed. With the advent of antiretrovirals (ARV) came the promise of a cure. Upon studying viral decay kinetics in the presence of ARV’s, investigators found that initiation of treatment led to an initial exponential decay in plasma viral loads, followed by a second phase linear decay (122,

220, 286). It was hypothesized that the initial decay was from loss of actively replicating virus within activated T cells. The slower, more clinically problematic phase of viral decay was due to a population of latently infected cells or resident tissue macrophages or dendritic cells whose half-life (t1/2) was somewhere around 5 to 24 days. Using these kinetic parameters and assuming complete suppression of viremia, it was calculated that complete viral eradication while on therapy could be achieved within 2 to 3 years (220).

As refreshingly optimistic as this was, reports began to emerge that quickly dispelled this

hypothesis. Memory CD4+ T cells isolated from patients on prolonged combination therapy, now known as highly active anti-retroviral therapy (HAART), could be induced to produce replication competent virus (53, 88, 89, 294). Furthermore, this cell

population is extremely stable, with a t1/2 estimated to be around 44 months (88). While

HAART is extremely effective at eliminating virus replicating in activated T cells,

sustaining a patient on HAART for the duration of time it would take to deplete latent

cells, estimated to be around 50 years, is unfeasible (246). Alternative theories have been

proposed to account for the longevity of the latent pool. One such theory posits that there

is a low-level of ongoing viral replication that can replenish the latent pool. However,

several lines of evidence indicate that the source of residual viremia is a stable latent

reservoir rather than ongoing replication. Patients on structured treatment interruption

(STI) lacked genetic diversity in envelop sequences when comparing the rebounding

virus versus pretreatment virus (137). One would expect that ongoing viral replication

would result in continual propagation of viruses that acquire genetic variation.

Furthermore, intensification of drug regimens has little effect on reducing this low level

viremia (73). Thus, it has become clear that latency presents the most challenging obstacle in the clinical treatment of HIV. This fact reinforces the need for an effective

HIV vaccine.

1A.1 Towards an HIV Vaccine

Typical natural infection of HIV begins with high levels of viral replication.

Concomitant with increased plasma viremia, there is a significant decline of CD4+ T

cells. Rebound of CD4+ T cell numbers is visible within weeks as an HIV specific CD8+

T cell driven immune response begins to control viral replication (251) (Figure 1). The viral load detected after the initial immune response is generally referred to as the viral set point. Higher levels of the viral set point have been found to be associated with a more rapid progression to AIDS (251). As CD8+ T cells can control and reduce viral

Figure 1 - The T cell response in controlling viremia. Primary infection with HIV results in an acute phase of viral replication

detectable within the periphereal blood. After several weeks, replication subsides in

response to CD8+ HIV specific cytotoxic T lymophocytes (CTLs), and this is typically

classified as the asymptomatic phase of HIV progression. Total CD4+ T cells rebound;

however, they will always remain below pre-infection levels. The plasma viral load at this point is referred to as the viral set point, and is clinically significant as the levels of the viral set point are thought to correlate with disease progression. Reprinted with permission from Nature Publishing Group, Copyright 2006.

load in acute and chronic infections, efforts have shifted to the pursuit of vaccines that

will elicit such a response when the recipient is challenged with HIV (199).

Scientists are still faced with the same obstacles regarding vaccine development

that researchers faced nearly 25 years ago; namely, the heterogeneity of viral envelope

and selecting viral proteins that will elicit and enhance an immune response (90, 291).

There are several structural mechanisms that help HIV evade targeting of neutralizing antibodies (nAbs). One of the most problematic is the heavy glycosylation of the HIV envelope protein, glycoprotein 120 (gp120) (285). The N-linked glycosylation essentially creates a shield that can help the virus elude neutralizing antibodies. Interestingly, the neutralizing antibody 2G12, isolated from an HIV+ patient, can recognize a portion of the glycan shield and prevent HIV binding to co-receptor (24). A handful of other unique nAbs have been identified that potently neutralize virus, however, the challenge has been eliciting the same response through vaccination.

To date, three clinical trials have been completed testing the safety and efficacy using different HIV vaccine approaches. A clinical trial completed in 2003 testing HIV monomeric gp120 as an immunogen failed to elicit a neutralizing antibody response (92).

In an attempt to induce cellular immune responses, Merck developed an adenovirus based vector carrying the HIV clade B Gag, Pol, and Nef genes. However, the clinical trial was halted when it was determined that no significant protection was found in those who received the vaccine versus those who received placebo. Furthermore, data suggested an increase of HIV acquisition in those who received the vaccine with pre-existing adenovirus antibodies (270). Recently, a vaccine approach using a recombinant canarypox vector carrying Gag, Pol, and Nef genes (ALVAC-HIV vCP1521) as a prime

with a subunit gp120 boost (AIDSVAX B/E) has shown a modest reduction in HIV-1

infection in those vaccinated (230). Ultimately, we are still very far from a vaccine that

is capable of inducing both a cellular and humoral immune response.

What prospects lie in the future for treatment of HIV infected individuals?

Although a cure within the next several years seems highly unlikely, it is clear that much time and money is still dedicated to this cause. In 2009, the National Institutes of Health awarded $319 million dollars to HIV research (http://report.nih.gov/rcdc/categories/). In addition, there are numerous privately funded organizations devoted to sponsoring HIV research. The Bill and Melinda Gates foundation alone has donated approximately 2.2 billion dollars to date (http://www.gatesfoundation.org/hivaids/Documents/hiv-strategy-

overview.pdf). Efforts such as these are not without reward. While the number of

people living with HIV increases every year, the number of new infections is on the

decline, suggesting two things. One, we have made progress in the area of prevention,

and two, we are able to offer those infected a longer life.

1A.2 The HIV-1 Genome and Life Cycle

HIV-1 is a member of the retroviridae family of viruses. It is given this

classification as a consequence of its single stranded RNA genome requiring the enzyme

reverse transcriptase to make a double stranded DNA copy. HIV-1 is further classified

into the genus lentivirus for its ability to cause clinical latency and infect non-dividing

cells. Like all retroviruses, HIV-1 has coding regions for Gag, Pol (polymerase), and Env

(envelope). In addition, the HIV-1 genome codes for the accessory proteins Nef

(negative factor), Tat (transactivating factor), Rev (regulation of expression of viral

Figure 2 - The HIV genome, 5’LTR, and nucleosome occupancy A) The HIV genome has nine open reading frames that generate 15 different proteins. B)

The 5’LTR is composed of the U3, R, and U5 regions. Within these regions are multiple transcription factor binding sites. Within the U3 region lies the NF-κB binding sites. C)

The proposed nucleosome positioning within the 5’ LTR. Restriction enzyme digest or

Mnase digest resulted in cleavage of the hypersensitive (HS) HS2, HS3, and HS4 regions

(271, 274). The Nuc-1 site begins at the R region. Reprinted with permission from

proteins), Vif (viral infectivity factor), Vpu (viral protein u), and Vpr (viral protein r)

(Figure 2A)(4).

The Gag gene of HIV-1 encodes for the structural proteins MA (matrix), CA

(capsid), and NC (nucleocapsid), and contains two spacer peptides, SP1 and SP2, and the

L-domain p6. The myristoylated form of MA (p17) is localized to the cellular membrane

and can recruit the Gag and Gag-Pol fusion proteins for the formation of new virions

(227). Therefore, aside from providing the structural proteins of HIV, Gag is also

responsible for directing viral assembly and release. A more detailed discussion of viral

budding will be discussed later. Although Gag expression alone is enough to induce

viral-like particles (VLPs), they are uninfectious without Env expression (68). The Env

gene is the coding region for the envelope polyprotein gp160. gp160 becomes co-

translationally glycosylated and then cleaved in the endosomal reticulum to form the

envelope proteins gp120 and gp41 (72).

The Pol gene encodes for the HIV enzymes reverse transcriptase (RT), integrase

(IN), and protease (PR). RT ensures conversion of viral single-stranded RNA into double stranded DNA (16). The IN enzyme can insert the viral DNA into the host genome (61).

PR cleaves viral proteins to form fully mature viral particles (13). Together, Gag, Pol, and Env are the minimal requirements for production of infectious virions, however, HIV has several accessory proteins that enhance its virulence.

Tat and Rev are two regulatory proteins required for synthesis and export of viral

RNA from the nucleus, respectively. Loss of either protein results in the inability of HIV to produce viral progeny. Transcriptional elongation of HIV-1 is highly inefficient, and requires the need for the transactivator protein Tat (295). Tat and the cellular

transcription initiation factor NF-κB can synergistically activate HIV transcription (212).

The HIV-1 Rev protein is necessary for nuclear export of unspliced viral proteins (233).

A more comprehensive detail of HIV transcription will be discussed further in the text.

The effects of Vif, Vpr, Vpu, and Nef range from downregulation of important

cellular factors to counteracting innate anti-viral mechanisms. To date, multiple

functions have been ascribed to the accessory proteins. The best example of this would

be the membrane-associated protein Nef. It has been asserted that Nef contributes to

viral persistence and rapid disease progression. In macaques infected with Nef deleted

SIV strains, viral replication and disease progression were severely impaired, however,

the infected macaques do eventually develop AIDS-like symptoms (15, 148). Several

long-term non-progressors (LTNP’s), a clinical subset of patients infected with HIV that

maintain low copy number of viral RNA and high CD4+ T cell count without HAART,

were found to be infected with virus carrying defective Nef mutations (152, 236). Nef has been functionally linked to downregulation of CD4, MHCI, MHCII, and CD28, thereby impairing the ability of the immune system for antigen processing, presentation, and subsequent T cell activation (102, 243, 252, 256). Surprisingly, HIV-1 Nef is incapable of downregulating CD3. In contrast, SIV infection in the natural primate host, sooty mangabeys or African green monkeys, present with high viral loads, however never develop the hallmarks of immune failure that is seen with HIV-1 infection. The loss of this function with HIV-1 Nef has led some to suggest that chronic immune activation and

T cell apoptosis through lose of CD3 downregulation is the major cause of virulence in

HIV-1 versus SIV infections (240).

Vif is required to counteract the important cellular restriction factor, APOBEC3G.

In the absence of Vif, APOBEC3G is capable of extensive cytidine deamination of the nascent viral DNA. Vif-deficient virions are non-infectious (193, 312). Likewise, Vpu

has been shown to overcome the effects the cellular restriction factor tetherin (215). In

the absence of Vpu, tetherin is capable of blocking viral escape by “tethering” virions

directly to the cell surface (221). Lastly, the Vpr protein has been shown to cause G2 cell

cycle arrest, induce apoptosis, and perhaps have a role in nuclear import of HIV DNA

(98). Although viral proteins are obviously imperative for successful viral propagation, a

number of cellular genes have been identified as cofactors in the process. The number of cellular proteins associated with the viral replication cycle are too great to fully present in this thesis, however, for a comprehensive list, please refer to (32) and (314).

1A.2a Entry

Activated, CD4+ T cells and machrophages are the primary target for HIV-1. A

specialized type of dendritic cell (DC), Langerhans cells, were also thought to be

susceptible to HIV infection (31). However, recent evidence suggests that an alternative

and interesting role of mature DC’s in HIV spread is the capture of virions in surface

accessible compartments that allow for efficient transfer of virus to CD4+ T cells in a

process known as trans-infection (42, 307). Immature DC’s and other cells, such as

microglial cells in the brain, may also be potential reservoirs of HIV infection as they are

found, albeit in low frequency, to be productively infected (132, 300). HIV-1directly

targets CD4+ T cells and macrophages through engagement of the cellular receptors,

CD4 and the CCR5/CXCR4 coreceptors (70, 74, 75). The outer membrane of the virus is

studded with “spikes” composed of trimeric gp41, the transmembrane portion,

Figure 3 - The Multiple Steps of HIV Entry. Upon contact with a CD4+ T cell, gp120 undergoes a dramatic rearrangement that results in exposure of the bridging sheet and the V3 loop. At this point, the V3 loop is positioned to interact with the co-receptor CCR5 or CXCR4. This interaction results in further rearrangement of gp120 that expose the gp41 fusion peptide, resulting in insertion into the host cell membrane. The six-helix bundle, formed through HR1 and HR2 interactions, drives the viral and cellular membrane into close enough proximity for fusion to occur. Reprinted with permission from Elsevier, Copyright January 2010.

27 non-covalently associated with gp120 (182). gp120 is heavily glycosylated and is the main immunogen in natural infection; however, the antibodies generated fail to broadly neutralize (298). Upon contact with CD4, gp120 undergoes a conformational change that results in several distinct consequences (Figure 3). First, binding induces the formation of a minidomain composed of four beta sheets, known as the bridging sheet (45, 165). The structurally variable regions of Env, the

V1/V2 and V3 loops, become exposed, and the bridging sheet and V3 are in position to interact with coreceptor (125, 265). In early and intermediate pathogenesis, this is generally CCR5. After engagement of the coreceptor with gp120, gp41 inserts its fusion peptide into the cellular membrane, resulting in further conformational changes in gp41 allowing for the joining of cellular and viral membranes (Figure 3) (44, 288).

1A.2b Reverse Transcription

After merger of the two membranes and deposition of viral RNA and proteins into the cytosol, reverse transcription must proceed to synthesize viral single-stranded RNA into double-stranded DNA. The reverse transcription complex (RTC) is composed of viral genomic RNA (gRNA), tRNALys3, RT, IN, MA, CA, and NC. In addition, a multitude of cellular proteins have been found to be important for the completion of reverse transcription. To form a mature reverse transcription complex, the viral core must be in a certain conformation that involves a delicate balance of CA shedding. If CA is lost too quickly or not lost at all, reverse transcription is impaired (283). The mature

RTC proceeds to the nucleus via the microtubule network in a dynein dependent process

(203).

The active enzyme in the reaction, reverse transcriptase (RT), is a heterodimer

composed of two subunits, p66 and p51. The p66 is the “active” subunit, as it contains an

RNase H domain and polymerase activity, while the p51 lends structural support to the

protein . The low fidelity of RT is one contribution to the high genetic variability found

in HIV-1 viruses (18).

Reverse transcription is a well-documented process that has been thoroughly catalogued since the discovery of an RNA-dependent DNA polymerase in 1970 by Temin and Baltimore (16, 260). Reverse transcription begins with the binding of a tRNALys3 to

the primer binding site (PBS) through complementary sequences in the 3’ end of the

tRNALys3 and 5’ end of the viral genome (Figure 4, Step 1) (121). The (-) strand viral

DNA is first to be synthesized through extension of the tRNA primer past the U5 and

repeat (R) region of HIV. The RNase H activity of RT concomitantly degrades the (+)

strand RNA after copying. The finished (-) strand DNA product is termed strong stop

DNA (ssDNA), and can hybridize to the second R region at the 3’ end of the viral RNA

(Step 2). Two molecules of HIV genomic RNA are packaged within one virion,

therefore, the hybridization can occur at either molecule, and each occurring at equal

frequencies (272). After hybridization, DNA synthesis continues and viral RNA is

degraded in the process, however, there are two regions of viral RNA, rich in purine

sequences, that are essentially resistant to degradation, termed polypurine tracts (PPT)

(Step 3). The 3’ PPT and central PPT (cPPT) are used as primers for the (+) strand DNA synthesis.

(+) strand synthesis is initiated from the 3’ end of the (-) strand DNA and the ppt’s and continues until the polymerase encounters the tRNA primer, from which it

Figure 4 - The Reverse Transcription Reaction. Reverse transcription is a process in which single-stranded RNA is converted into double stranded DNA. The reaction is catalyzed by the enzyme reverse transcriptase. The process starts with a cellular derived tRNA primer. The tRNA primer allows for

30 synthesis of (-) strand DNA. The first strand transfer event hybridizes the (-) strand DNA repeat (R) region with the complementary R region in the 3’ region of RNA. As the (-) strand DNA continues to be synthesized, the RNase H domain of RT degrades the viral

RNA template. However, a run of purine bases termed the polypurine tract (PPT) are spared from degradation and used to prime the synthesis of (+) strand DNA. The DNA- dependent DNA polymerase activity of RT can complete the reaction. When the transcribing RT encounters the cPPT, a DNA flap is generated. Reprinted with permission from Springer, Copyright 2010.

copies the first 18 nucleotides (Steps 4 and 5). The tRNA primer can then be degraded

through the RNase H domain, and the nascent DNA, ssDNA, is used as primer in next

strand transfer event.

The next strand transfer event occurs by hybridization of the PBS of the ssDNA to

the (-) strand DNA, while the U3, R, and U5 region of the (+) strand DNA can hybridize

to the complementary region in the (-) strand DNA, creating a circular genomic moiety

(Step 7). The DNA-dependent DNA polymerase activity (DDDP) activity of RT can

complete the reaction, and eventually, a full-length double stranded viral DNA product is

formed. In the process of replicating the (+) strand DNA, when the replicating (+) strand

DNA meets the DNA originating from the cPPT, a DNA “flap” is generated that is

speculated to be required for nuclear import of non-dividing cells and uncoating of the pre-integration complex (12, 310). However, some debate exists in the field as to whether the central DNA flap is required for nuclear import, as Zack and colleagues found that nuclear import in viruses lacking a central DNA flap remained pathogenic

(176, 196). A secondary role for the central DNA flap has recently been described, in which the flap promotes capsid uncoating around the nuclear periphery, thereby allowing for transport of the viral DNA into the nucleus (12).

1A.2c Nuclear Import and Integration

Integration of viral DNA into the host cell genome allows for production of nascent viral RNA to complete the HIV-1 life cycle. As hinted above, the question of how HIV-1, or lentiviruses in general, manage to circumvent the necessity for nuclear envelope breakdown, which other viruses require, has been a topic of thorough investigation. A large part of the attraction of this research comes from the implication

that lentiviral vectors are excellent candidates for gene therapy due to the ability to transduce non-dividing cells. The nuclear import and integration process requires a

multitude of viral and cellular factors. The viral pre-integration complex (PIC) consists of viral double stranded cDNA and the viral IN protein. In addition, the viral proteins

Vpr, MA, RT, and NC and the cellular proteins barrier-to-autointegration factor (BAF),

high-mobility group proteins (HMGs), and lens epithelium-derived growth factor

(LEDGF/p75) have been found to be contained within HIV-1 PICs (34, 82, 83, 177, 180,

204). This multi-component complex eliminates any possibility that nuclear entry is

mediated through passive diffusion, as the PIC is larger than the nuclear pore complex

(NPC) (255). Therefore, nuclear import is a process that involves the active transport of

the viral PIC by utilizing cellular nuclear import pathways.

Of the viral proteins that comprise the PIC, MA, IN, and Vpr have all been

proposed to assist in nuclear import. These proteins contain either a canonical nuclear

localization signal (NLS) or an atypical NLS (30, 110, 133). When ectopically

expressed, IN and Vpr have been shown to be localized to the nucleus, while MA,

although containing an NLS, has not (71, 183, 225). Furthermore, these candidate proteins all have been found to interact with one or more members in the importin-α protein family, or members of the nuclear pore complex, further strengthening the idea that they assist in nuclear import (8, 99, 100, 277). On the contrary, Yamashita et al. demonstrated that exchanging HIV-1 MA and IN with MoMLV MA and IN had no effect on nuclear import of non-dividing cells (303). Therefore, the answer as to what is responsible for nuclear import of HIV is still elusive, and one that deserves further investigation. Inhibiting nuclear import and integration of HIV would essentially stop

viral egress and thus is an attractive candidate for therapeutic intervention. In fact, a drug

developed in 2007, raltegravir, has been the first clinically approved HIV drug to inhibit

the HIV-1 IN protein (108). The recent discovery of the interaction of HIV-1 IN with the

cellular transcriptional co-activator LEDGF/p75 has propelled speculation that

researchers could further attenuate inhibition of HIV integration.

LEDGF/p75 was first reported to form nuclear complexes with IN, and

knockdown of LEDGF resulted in loss of these nuclear complexes and diffuse cellular

staining of IN (188). However, a more interesting role emerged for the contribution of

LEDGF to HIV integration. HIV-1 is preferentially targeted to actively transcribed

genes, and, as such, it was proposed that LEDGF is responsible for this specific targeting

effect (54, 208). It has been clearly established that LEDGF acts as a tether between

cellular chromatin and the viral IN protein (180). Innovative experimental approaches have shown that manipulating the LEDGF protein can redirect HIV integration (87).

Therapeutically, the implications are that we can redirect HIV integration to sites that are

non-permissive for transcription.

The integration reaction itself involves two specific reactions carried out by IN.

The first step takes place in the cytoplasm and requires the removal of two nucleotides on the 3’ end of the viral cDNA to expose a CA dinucleotide with a free 3’OH (61). Next,

IN utilizes the 3’OH in a nucleophilic attack of the target cellular DNA. Following the

strand transfer event, an intermediate complex is formed that requires the use of cellular

DNA ligases to complete proviral formation. Once HIV-1 integration is complete,

transcription is controlled through and dependent upon cellular factors.

1A.2d HIV Transcription and RNA export

Many positive and negative cellular factors have been found to influence HIV transcription, however, there are only two viral elements that are imperative for processive transcriptional elongation. These are the trans-activator (Tat) protein, and the trans-acting response (TAR) RNA element (216). The TAR element is approximately 59 nucleotides of RNA derived from the transcribed 5’ R region of HIV. TAR can form a stem-loop structure that is necessary for interacting with Tat (84). The Tat protein is essential for transcription and dramatically increases levels of HIV mRNA (295). The accumulation of elongated transcripts is only possible through Tat interacting with TAR

(144). In the absence of Tat, short transcripts accumulate immediately downstream of the promoter (144). The Tat/TAR interaction leads to several events that allow for processive transcriptional elongation.

1A.2e Cellular Activation Signals Cooperate with Tat/TAR

T cell activation can occur through interactions between the T cell receptor (TCR) and peptide loaded major histocompatability complex (MHC) on antigen presenting cells

(APC’s) followed by co-stimulation of CD28 on the T cell. The subject has been reviewed in many articles (143, 249, 282). The TCR is composed of integral membrane protein chains, α,β, which are always present as a single heterodimer and function mainly for peptide-MHC recognition, or δ,γ,ε,or ζ dimers, which generally function in intracellular signaling. The latter are composed of long cytoplasm tails that contain immunoreceptor tyrosine-based activation motifs (ITAMs). Following enGagement of the TCR and the co-stimulatory molecule CD28, a series of events follows that results in phosphorylation of ITAMs by a phosphotyrosine kinase (PTK), Lck. The phosphorylated

ITAMs function as docking sites for src-homology domain (SH2) containing proteins.

ZAP-70, and SH2 containing protein, is recruited to the phosphorylated ITAMs following

T cell activation. ZAP-70 in turn serves to support phosphorylation of two proteins critical in initiating massive downstream signaling events; the linker for the activation of

T cells (LAT) protein and the SH2 domain-containing leukocyte phosphoprotein of 76 kDa (SLP-76) (282) . The proceeding signaling cascade results in activation of multiple pathways that ultimately results in nuclear translocation of the transcription factors nuclear factor of activated T cells (NFAT) and nuclear factor-κB (NF-κB).

The contribution of NF-κB has been studied extensively since the discovery, in

1987 by Nabel and Baltimore, that it could synergistically activate HIV transcription in combination with Tat (212). This finding has allowed our labs and many others to control HIV transcription through stimulation with tumor necrosis factor-α (TNF-α).

TNF-α receptor (TNFR) stimulation results in activation of two pathways; one

controlling inflammation and cellular proliferation, and the other controlling lymphoid

organogenesis(Figure 5c) (123). The former (canonical) pathway proceeds through

activation of IκB-kinase (IKK) to phosphorylate the NF-κB inhibitory proteins IκBα,β,

or ε. Phosphorylation of the various forms of IκB results in ubiquitination and

proteasomal degradation, releasing NF-κB from the inhibitory complex. Initially, the

IκB complex was thought to retain NF-κB within the cytoplasm. However, that

paradigm is incomplete, as it has been demonstrated that the IκB/NF-κB complex can

shuttle between the cytoplasm and nucleus (136, 259).

The NF-κB/Rel family of proteins are derived from five human genes that code

for seven different proteins. These proteins, p105, p100, p52, p50, c-Rel, RelA(p65) and

Figure 5 - The dynamic properties of NF-κB signaling. A) Five human genes are transcribed and translated to produce seven different proteins

of the NF-κB family. The proteins commonly share a Rel-homology domain (RHD, pale

blue box) which is responsible for DNA binding and dimerization between the NF-κB In the context of HIV-1pNL4.3, a commonly used lab strain, the promoter region contains two

copies of NF-κB binding sites (Figure 2B). Mutations in these two sites, preventing NF-

κB binding, results in gross deficiency of HIV transcription (77, 178, 212). Furthermore,

p65 has been shown to support transcriptional elongation even in the absence of other

proteins B) The different dimer pairs of NF-κB proteins. Transcriptional activation can

occur when partners in the top four rows bind DNA. Transcriptional repression is

associated with the dimer pairs in the fifth row, and the last row cannot bind DNA. C)

Inflammatory stimulus can trigger the “canonical” NF-κB pathway through TNFR or

TLR signaling, resulting in degradation of IκB and release of NF-κB. In the non- canonical pathway, p100 can function as an IκB like inhibitor, and activation may cause the degradation of p100. Reprinted with permission from John Wiley and Sons,

RelB all contain a Rel homology domain (RHD) at the N-terminus, which is responsible for dimerization amongst Rel proteins (Figure 5A). Within the cell, Rel proteins exist as dimers, and different dimer pairs can elicit different transcriptional outcomes, i.e. repression or activation (Figure 5B) (261). In addition, the RHD can bind DNA and also interact with the inhibitory IκB proteins. The C-terminus of RelA, RelB, and c-Rel contain transactivation domains (TAD) that can interact with various transcription factors

(46). Since p50 and p52 lack these TADs, they can actually inhibit transcription when they homodimerize (46). Although each gene may require a different heterodimer of the

NF-κB proteins, the prototypical heterodimer is p50/p65 (46).

In the context of HIV-1pNL4.3, a commonly used lab strain, the promoter region

contains two copies of NF-κB binding sites (Figure 2B). Mutations in these two sites

preventing NF-κB binding, results in gross deficiency of HIV transcription (77, 178,

212). Furthermore, p65 has been shown to support transcriptional elongation even in the

absence of Tat (289). Generally speaking, however, the majority of HIV transcripts that

accumulate in the absence of Tat are short, abortive sequences (144). The minimal

amount of elongation made possible through NF-κB may allow sufficient Tat protein

production needed to kick-start trans-activation. The recruitment of NF-κB, therefore, results in the stepwise recruitment of additional factors that aide in a positive transcriptional feedback loop which results in Tat production and transcriptional elongation.

Once a threshold level of Tat has been reached, transcription becomes highly processive. This is due, in part, to the recruitment of elongation factors through the

Tat/TAR interaction. To begin with, Tat can recruit the positive transcriptional

elongation factor B (pTEFb) (63, 192, 284). The pTEFb complex is comprised of Cyclin

T1 and its kinase component, CDK9. CDK9 is responsible for enhancement of

transcriptional elongation through its ability to hyperphosphorylate the C-terminal

domain (CTD) of RNA polymerase II (145, 150). In addition to the CTD of RNA pol II,

CDK9 can phosphorylate negative factors that help to stall RNA pol II around the

promoter. Spt5, a subunit in the DRB-sensitivity inducing factor (DSIF) complex, and

the negative elongation factor (NELF) subunit E are phosporylated through CDK9 which

relieves the elongation block (29, 97).

In addition to NF-κB, the HIV promoter contains binding sites for additional transcription factors, including NFAT and Sp1 (Figure 2b). Although the role of NF-κB

has been well established, at least in cell lines, the contribution of other transcription

factors has been debatable. In particular, the role of NFAT in HIV transcription has been

less clearly defined.

Similar to NF-κB, NFAT is localized in the cytoplasm in T cells prior to TCR

stimulation, and subsequently translocated to the nucleus. In humans, there are five

NFAT proteins that have several splice variants. Most investigations have focused on

NFAT1 and NFAT2 (also referred to as NFATp/NFATc2 or NFATc/NFATc1,

respectively) for their contribution to HIV transcription (223). Not surprisingly, these are

also the most highly expressed forms in immune cells. Intracellular calcium signaling

can activate calcineurin, which in turn dephosphorylates NFAT (60). Dephosphorylation

of NFAT through calcineurin results in exposure of NFAT NLS’s that allow for nuclear

translocation (223).

One confounding problem with parsing the contribution of NFAT has been that one of the three purported binding sites within HIV overlaps with an NF-κB binding site

(62, 67). To distinguish between NF-κB or NFAT activation, Cron et al. treated primary

CD4+ T cells, transiently transfected with an HIV-LTR-Luc reporter plasmid, with inhibitors of NFAT, such as CsA, and found that activation was significantly inhibited

(62). Interestingly, the upstream NFAT binding site was proposed to be a negative regulatory element, and, in fact, deletion of this site moderately increased activation (62).

Multiple other reports have corroborated the importance of NFAT in HIV transcriptional activation through overexpression (20, 95, 214). The role of NF-κB and NFAT still remain somewhat controversial. Most reports that score the importance of NF-κB activation in HIV transcription have been done in cell lines. A fair amount of evidence suggests that NFAT may play a more crucial role in primary cells. For instance,

Robichaud et al found that increased expression of NFAT in CD45RO+ Jurkat cells, in an attempt to recapitulate the memory phenotype that robustly enhances HIV transcription in vivo, was responsible for increased transcription (231). Additionally, an ex vivo model of

HIV latency in primary human CD4+ T cells has found that NFAT is crucial of reactivation of HIV from latency (28). However, our lab has found that the role of either

NF-κB or NFAT may not be mutually exclusive. We have found that T cell receptor stimulation results in enhanced transcriptional elongation, and this may be due in part to the contribution of NFAT (Kim et al., in submission).

Lastly, HIV-1 contains binding sites for the transcription factor Sp1. The role of

Sp1 has been relatively vague, although many reports have indicated that Sp1 mostly functions by interacting with other transcription initiation factors to drive activation of

the HIV LTR (232). Recently, Jiang et al. have shown that Sp1, histone deacetylase 1

(HDAC1), and c-myc reside as a complex at the HIV LTR and function in transcriptional

repression (135). Thus, further examination of the activity of Sp1 at the HIV promoter is

warranted.

1A.2f HIV RNA export

As previously described, the HIV genome has 9 open reading frames that can

encode for 15 different proteins (Figure1). Generally, unspliced RNA is retained within

the nucleus; however, HIV is capable of exporting unspliced and partially spliced RNA

from the nucleus to the cytoplasm where it is used for gRNA or translation into structural

proteins. Therefore, the regulation of splicing plays a critical role in HIV pathogenesis

and egress. The cellular splicing machinery cooperates with splicing signals in HIV for

the process to occur, however, the most important HIV factor in this RNA shuttling

process is the Rev protein.

Rev is an 18 kD protein which contains and NLS, and NES, and an arginine-rich

domain (ARD) that binds a viral RNA stem-loop structure known as the Rev-response element (RRE) (55, 191). Binding of Rev to the RRE enables export of the viral RNA through the CRM1 nuclear export pathway (14, 64). The Rev protein itself is multiply spliced. Therefore, its early generation in viral transcription is critical for the proper export of the unspliced and partially spliced genes.

Similarly to cellular RNA splicing, HIV contains 5’ and 3’ splice sites that direct the splicing machinery to the nascent RNA. Attenuation of splicing can be regulated by the strength of the splice sites. For instance, exonic splicing silencers (ESSs) in the HIV genome provide an additional level of regulation. These sequences can repress weak 3’

42 splice sites and control the relative proportion of HIV mRNA’s within the cell (250).

1A.2g Assembly, Release, and Maturation

In HIV infected cells, the Gag polyprotein, Pr55Gag, is post-translationally modified at the N-terminus, resulting in a myristoylated MA protein. Importantly, myristoylation of MA targets the Gag protein to lipid rafts, which are specialized microdomains of the plasma membrane, and aides in Env incorporation into newly forming virions (227, 308). The NC protein of Gag can recruit viral genomic RNA, while CA can enhance Gag multimerization (96).

The newly formed virion is coated with plasma membrane and therefore could remain confined within the cell. HIV-1, along with other viruses, have found ways to manipulate cell sorting machinery to facilitate scission of new virions. The process of understanding viral budding began with studies of the C-terminal p6 domain of Gag.

Mutation of p6 produced virions that were retained to the cell surface and unable to bud

(105, 127). The term “late domain (L-domain)” developed as a description for the p6 domain, as it produced this specific phenotype seen in the last steps of the replication cycle. Multiple reports since these initial studies have shown that a PTAP motif found in the p6 L-domain can recruit tumor susceptibility gene 101 (Tsg101), a component of the

ESCRT-I complex (Figure 6) (69, 103, 278). This discovery implicated a novel role for

Tsg101, as it normally functions in the pinching off of membranes that are in late endosomes to form multivesicular bodies (MVBs). Therefore, HIV-1, and other viruses, have manipulated the ability of Tsg101 and other such proteins to form outward protrusions of membrane. As the cell sorting machinery is a complex multi-protein

43 network, many other proteins have been implicated in the HIV budding process, and is reviewed in (23).

Maturation of the viral particle results in cleavage of the Gag and Gag-Pol polyprotein to form new infectious virus. Recently, a new compound has been found that inhibits viral maturation, and this inhibition has been mapped to the interference of CA-

Sp1 cleavage (5). It will be interesting to see how this new class of compounds develops.

1B HIV Latency

Despite the tremendous amount of time, resources, money, and talent that has been devoted to the study of HIV, we are still without a cure. As a result of dedicated physicians and researchers, the prescribed treatment regimen, at least to those that can afford it, is outstanding. HAART can now eliminate circulating virus to below the limit of detection, and HIV+ patient’s survival rates are escalating. However, the cost, both literally and figuratively, is enormous. Patients on HAART usually experience a wide range of adverse side effects, and as a result, make drug adherence exceptionally hard

(41). Furthermore, to those people who are HIV+ in developing nations, the HAART regimen, although becoming increasingly more available through philanthropic efforts, is sometimes a limited option. The most simplistic answer to these problems remains to be a cure. However, latency remains the biggest obstacle. Until recently, there have been very few models that accurately recapitulate the in vivo situation. This is paramount if we are to develop novel approaches in tackling the disease. Recent advances in the general understanding of its pathogenesis have propelled the development of model systems.

Figure 6 - The ESCRT pathway and HIV budding. Normally, members of the ESCRT complex can bind ubiquitinated cargo proteins

destined for multi-vesicular body (MVB) formation. However, HIV has manipulated this

pathway by recruiting its members via the p6 L-domain. Sequences within the L-domain are able to bind and recruit the Tsg101 and Alix proteins. Recruitment results in efficient viral budding from the cellular membrane. Reprinted with permission from Elsevier,

1B.1 Pre-integration Latency

After infection, HIV can integrate within the host cell genome to establish a latent

infection. However, certain circumstances can preclude integration and instead favor the

development of a state known as pre-integration latency. This form of latency can exist

when HIV infects, for instance, a resting memory T cell. These cells are in a

metabolically inactive state, and thus may contain sub-optimal levels of dNTP’s and ATP needed for completion of reverse transcription or nuclear import, respectively (35, 101).

The labile nature of unintegrated HIV DNA diminishes its clinical relevance and supports

further research aimed at post-integration latency (224, 315).

1B.2 Post-integration Latency

1B.2a In vitro Models

Several cell-based models exist to study the various aspects of HIV pathogenesis.

This includes cell lines and primary T cells. Generally, some aspect of the virus or cell

has been manipulated to “assist” the virus to latency. However, the best models are those

in which the in vivo situation is as closely recapitulated as possible.

T he J -L at clones

Work done by Bisgrove et al. generated an assortment of Jurkat clones that were

infected with replication competent HIV-GFP and became transcriptionally silent (138).

Integration of the clones was found to be favored near heterochromatic sites such as alphoid repeat regions. Their cloning approach began by sorting the GFP- population immediately after infection. This population was induced for reactivation using TNF-α,

and the cells that became GFP+ were individually sorted and cloned. Although these

cells have become widely popular in HIV research, one criticism is their experimental

46 approach. To elaborate on this, one can speculate that isolating cells from an immediately silenced population is enriching for proviruses that have integrated into highly heterochromatic regions. In vivo, this is not the case, as most proviruses are found integrated within introns of actively transcribed genes (112) . In contrast, our lab has developed Jurkat clones using the pNL4.3 plasmid with a Gag deletion and destabilized enhanced green fluorescent protein (d2EGFP) in place of the Nef gene. After infection, cells were cloned from a GFP+ population and monitored for shutdown. We have found that the clones are easily reactivatable after entering latency, as opposed to the JLat clones, which are limited in their ability to be reactivated (219). Furthermore, in contrast to the J-Lat clones, these clones reside within introns of actively transcribed genes, however, upon shutdown they do acquire heterochromatic markers (219).

U1, J ∆K , and ACH-2 cells

The U1 cell line is a promonocytic cell line that has been utilized as a model for

HIV latency. It was originally isolated from a population of acutely infected U937 cells, and selected due to its low level of viral gene expression and ability to be reactivated by phorbol 12-myristate 13-acetate (PMA) (94). The U1 cell line contains two integrated copies of HIV. Later work by Emiliani et al. postulated that latency in this cell line was due to the fact that the integrated proviruses had two forms of Tat that were defective for trans-activation (80). One Tat cDNA lacked the necessary start codon ATG, while the other had an H13L mutation. Interestingly, they found that this mutation was defective for activation in transient transfection assays. However, our lab has found that this mutation reactivates with the same kinetics as wild-type, yet shuts down transcription at a quicker rate (219). It appears that our data is more consistent with the observations in the

U1 cell line; specifically, that it produces a low level of viral transcripts but can be easily

reactivated through stimulation. Likewise, the ACH-2 clones were generated through infection of the A3.01 T cell line (93). These cells are commonly used in HIV analysis.

However, latency in these cells may be the result of a point mutation in TAR (81). J∆K cells were originally cloned from a population of Jurkat cells infected with an HIV virus carrying mutations in the NF-κB binding sites (7).

1B.2b Primary Cells

As many people believe primary cells to be the closest in vitro system one can get to in vivo, multiple attempts have been made to establish latent primary CD4+ T cells in culture. The recreation of in vivo latency in primary cells is not trivial, as there are many complicating factors. Mainly, T cell survival in cultured conditions is not optimal. Cells must be stimulated for survival in culture, and, as a result, become apoptotic within a couple of weeks. Therefore, sustaining T cells long enough to become latent in culture has been the major obstacle. Despite this considerable challenge, several groups have developed novel methods to maintain T cells in culture long enough to establish latency.

The Cloyd lab found that maintaining primary CD4+ T cells on a feeder cell line increased cell survival after activation (235). After stimulating with anti-CD3 and maintaining in interleukin-2 (IL-2 ) for 2-3 weeks, cells, infected or control, were collected and co-cultured with a feeder layer of a brain tumor derived cell line, H80.

DNA analysis showed that these cells entered a quiescent state, yet, the majority still maintained the early activation marker CD69. Importantly, a small fraction of the T cells were able to produce infectious virus upon activation with prostratin, a drug that can induce HIV transcription without altering the phenotype of the T cell (155). Elaborating

upon this idea, our lab has utilized the same approach to analyze the contribution of

heterochromatin in this primary cell model (269). The relative success that we have had

using this approach validates that this will be an exceptional tool for future studies.

A completely different concept for increasing survival of T cells in culture was engineered by the Siliciano lab. To increase T cell survival, they transduced T cells with

cDNA of the antiapoptotic protein Bcl-2 (304). Lentiviral transduction of Bcl-2 resulted in an elongated lifespan of T cells that phenotypically became of the resting memory subtype. After activation using CD3, cells were infected with a modified pNL4.3 strain of HIV. This approach led to the establishment of latent cells, which they then used for

studying factors that can reactivate HIV without activating the T cells.

Most recently, Bosque and Planelles took advantage of current reports claiming that central memory T cells (TCM), a subset of T cells that can be differentiated by cell

surface markers, comprise the majority of latently infected T cells in vivo (49). Their

hypothesis was that this specific cell type was more amenable to recapitulating latency in

vitro. They induced the proliferation of non-polarized (NP) cells, which are

phenotypically similar to TCM, by stimulating the cells with transforming growth factor-β

(TGF-β), α-interleukin-12 (IL-12), and α-interleukin-4 (IL-4), infecting with a modified

HIV virus, and maintaining the cells in IL-2 (28). Reactivation using CD3/CD28 consistently showed these cells harbored latent proviruses. Although all of these models have the benefit of establishing transcriptionally silenced proviruses in primary cells, they

still lack fundamental features that would make them the gold standard model system.

First, in all cases, certain manipulations were made to maintain the primary cells in

culture. In doing so, although the cells were mostly phenotypically similar to resting

memory cells, there may be unaccounted for differences that make these in vitro derived cells distinct from in vivo. In addition, HIV is a pathogen that can elicit a profound, albeit inadequate, immune response. Therefore, any in vitro system will lack any contribution from the host’s immune system to the silencing of HIV. For these reasons and others, the penultimate model system of HIV latency is an in vivo model.

1B.2c In vivo Models

Although costly and raising some ethical dilemmas, animal models provide information that could not be obtained from current in vitro systems. The most widely used animal model is infection of rhesus macaques with simian immunodeficiency virus

(SIV), or with a chimeric SIV/HIV virus (SHIV). SHIVs are engineered such that the 5’

Gag portion of HIV is replaced with SIV (238). This model has generated a tremendous

amount of information on antibody response and vaccine design, however, the usefulness

is diminished due to the artificial use of SIV/SHIV infection. Recently, Hatziioannou et

al. developed a novel approach for infecting pig-tailed macaques with essentially a minimally modified HIV that results in aggressive infection of these target primates

(116). The infecting HIV virus was only altered in the Vif gene. The important part of this alteration is the minimal difference between the chimaera and HIV; therefore, this

model could provide infinite information on future vaccine design.

As previously mentioned, macaque models can be costly and difficult to obtain.

Therefore, a murine model was always an ideal compliment due to the lowered cost and

ease of maintenance compared to primates. The refractory nature of murine cells to HIV

would essentially make this model impossible to develop. However, in the severe

combined immunodeficiency (SCID) mouse, which are devoid of any immune cells,

Namikawa et al. implanted human fetal thymus or lymph node into the mouse (202).

Innoculation with HIV led to widespread infection. Expanding upon this, Zack and colleagues utilized this system to generate latently infected cells (33). The main limitations to this model are the small quantities of latent cells found, and latent infection is primarily found within naïve thymocytes, contrary to the mature, resting T cells found in patients (244).

1B.4 Mechanisms of HIV Latency

1B.4a Cellular Factors

One of the current models for establishment of HIV latency postulates that during activation, CD4+ T cells are susceptible to infection. Those cells that were infected while activated and revert to a quiescent state can harbor latent proviruses (222). The supporting evidence for this model has come from the multiple studies indicating that specific differences in resting versus activated cells account for latency.

As previously described in this thesis, P-TEFb is the vital elongation factor

contributing to HIV transcription. However, resting T cells have low levels of expression

of CyclinT1 (253). Furthermore, P-TEFb can be sequestered into an inactive complex composed of 7SK snRNA and HEXIM1 (17, 253, 269, 305). Treating cells with hexmethylbisacetamide (HMBA) or suberoylanilide hydroxamic acid (SAHA) reverses inhibition of PTEFb by promoting formation of a small complex that lacks HEXIM/7SK snRNA (50, 57, 58). Also, NF-κB and NFAT are, for the most, part restricted to the cytoplasm. Therefore, a major contribution to HIV latency is a lack of active cellular transcription initiation and elongation factors in resting cells.

Resting cells also express factors that may repress HIV transcription or egress.

For instance, resting cells have been found to express lower levels of the polypyrimidine tract binding (PTB) protein (168). As a result, HIV multiply spliced RNA’s accumulate in the nucleus. Additionally, resting cells have been shown to be enriched for cellular miRNA’s that target HIV (126). In contrast, other reports have claimed that HIV can interfere with the cellular microRNA pathway in support of its own propagation (22,

264).

Transcriptional interference (TI) has been proposed to account for HIV latency

(106, 113, 172, 174). A transcribing polymerase from an upstream promoter was demonstrated to essentially displace important cellular transcription factors or an initiating polymerase at the 5’ LTR, thereby resulting in inefficient transcription and latency (106, 172). Discordant with these results, Han et al. found that an upstream polymerase in the same orientation as HIV could actually enhance transcription, and that only when the promoters were convergent was HIV transcription inhibited (113). TI is an interesting phenomenon to study on a basic science level. The current lack of a method that would alter this process, and the semi-randomness with which HIV integrates, makes this process of minimal clinical relevance.

1B.4b Heterochromatic Restriction

The fact that HIV can integrate within the host cell genome raises the possibility that it is also subject to epigenetic control through cellular components. The large amount of DNA resident within a nucleus forces the need for extreme compaction to fit within this limited space. The first level of compaction begins by wrapping 147 base pairs of DNA around a nucleosome, composed of an octamer of histones H2A, H2B, H3,

and H4 (185). Consequently, it has been shown that nucleosomes can have a negative impact on transcription due to their ability to make DNA inaccessible to the transcriptional machinery. Modification and/or displacement of the underlying nucleosome is required (184). The highly regulated process that allows for decompression of the nucleosome associated DNA is thought to be governed by the

“histone code”. This postulates that gene activity can be determined by different

modifications on histone tails that can in turn recruit specific protein factors (134). These

modifications sometimes exist as epigenetic marks, a term defined as “the inheritance of

variation (-genetics) above and beyond (epi-) changes in the DNA sequence” (27). The

term has been adapted over the years as more information constantly emerges about this

complex regulatory network.

Early work done by Eric Verdin determined that there is a nucleosome (Nuc-1)

that is deposited on the start site of transcription of the HIV-1 genome, and displacement

of this nucleosome is imperative for processive transcription (Figure 8A) (273, 274) .

Further studies elaborated on the restrictive role of Nuc-1. Acetylation, generally speaking, is an activation-associated epigenetic signal. This modification is thought to interrupt charge interactions between the histones and the phosphate backbone of the

DNA, thereby opening up the previously condensed chromatin structure. As Nuc-1

displacement is crucial for HIV transcription, is is not too suprising that acetylation of

Nuc-1 is also required for transcriptional activation (271). The HATs p300, p/CAF,

hGCN5, and CREB-binding protein (CBP) have all been found to be required for

transcriptional activation and can be recruited through Tat (21, 56, 198).

Tat or histone acetylation can also cause the localization of the SWI/SNF

chromatin remodeling complex to the site of transcription in HIV (78, 120, 189, 263).

The SWI/SNF chromatin remodeling complex contains ATPase activity, which drives the

rearrangement of nucleosomes. The Brg-1 associated factors (BAF) and polybromo

associated factors (PBAF) complexes are the two homologues of SWI/SNF found in

human cells. Brg-1 or Brm is the core ATPase subunit for the BAF complex, yet the

PBAF complex has only been found to use Brm for its enzymatic activity (248). There

has been an abundance of studies seeking to address how SWI/SNF is able to remodel

nucleosomes, yet no consensus exists. However, a popular theory suggests that

SWI/SNF can induce a torsional stress within DNA that results in accessibility of the

underlying DNA (179). Recently, an elegant experiment from the Bartholomew lab

demonstrated that on assembled dinucleosomes, SWI/SNF was capable of disassembling

a nucleosome in a step-wise fashion beginning with an H2A/H2B dimer (171). This is in

contrast to previous hypotheses that the disassembly property of SWI/SNF was

dependent on histone chaperone proteins. From these experiments, it seems that its

ability to dismantle nucleosomes is dependent on the presence of neighboring

nucleosomes. The model they propose has SWI/SNF bound to one nucleosome, pulling

the DNA from the adjacent nucleosome through its DNA translocase domain. The loss

of the DNA contact from the adjacent nucleosome results in rapid eviction of the

H2A/H2B dimer. The final, slower step pulls the remaining DNA off the histones,

freeing the H3/H4 tetramer. In summary, nucleosome remodeling and acetylation is the

general path to transcriptional activation and, likewise, is as crucially important for HIV

transcription as it is for cellular genes.

In latent proviruses, histone deacetylases have been found to be associated with the HIV 5’ LTR to silence transcription. The first such example of this is the binding of

LSF to the HIV promoter, which in turn can recruit YY1 and HDAC1 (59). Following this report, several other factors have been identified that can recruit HDAC1 to the promoter, including NF-κB p50, CBF-1, and AP-4 (129, 268, 290). Currently, the inhibition of HDACs has been shown to be a potential therapeutic opportunity for reactivation of latent proviruses and thus treatment of HIV.

Recently, the role of methylation, both DNA and histone, has began to emerge as a significant factor in establishing HIV latency. The histone lysine methyltransferase

(HKMT) SUV39H1, which can trimethylate lysine 9 of histone H3, can be recruited through its DNA binding partner HP1γ in latently infected cells (76). In microglial cells,

COUP-TF interacting protein-2 (CTIP-2) reportedly associated with SUV39H1 to induce heterochromatin formation via the M3K9 mark (194). Our lab has previously shown that as proviruses enter into latency, the characteristic heterochromatic marks M3K9 and

M3K27 accumulate (219). Very recently, Imai et al. found that the HKMT G9a, which can dimethylate H3K9, imparts epigenetic control of the HIV provirus (130).

Methylation of DNA can occur within repeated regions of cytosine-guanine residues (CpG). Short stretches of these dinucleotides can be found within promoter regions, and are referred to as CpG islands. Methylation of cytosine in the dinucleotide will result in an extremely stable form of silencing. One such example is X-chromosome inactivation (25). Recently, it has become more convincing that DNA methylation can work in conjunction with histone modifying enzymes to cooperatively silence genes (27).

In HIV, DNA methylation has recently been shown to silence HIV expression

(26, 146). Blazkova et al. demonstrated that the frequency of promoter methylation

within isolated resting cells increased in patient populations who had lower levels of

viremia (26). In contrast, those patients who had increased plasma viremia often had hypomethylated HIV promoters, suggesting that DNA methylation functions as a strong

barrier to “leaky” reactivation. In addition, the CpG-methyl binding protein-2 (MBD-2)

has been shown to associate with latent proviruses (146). However, studies in our lab

have not been able to conclude that methylation plays a significant role in silencing.

Using a variety of T cell lines and the promonocytic cell line U1, Fernandez et al. tested

the ability of 5’Aza-2’-deoxycytidine (5’AzaCdR) to reactivate, and found variability within cell lines (86). Further investigation on the use of this drug in the treatment of

HIV latency is warranted.

1C Hypothesis and Discussion

The work presented in this thesis aims to understand the mechanisms, specifically

chromatin related, which contribute to the silencing of HIV transcription that is seen in

latency. The evidence in the preceeding paragraphs suggests that chromatin restriction

plays a key role in the establishment of latency. Here, we have attempted to examine in

greater detail the contributions of Nuc-1 to inhibition of transcription. We hypothesize that if Nuc-1 could be displaced from the start site of transcription, its role as a

transcriptional impediment could be minimized. In addition, we sought to utilize a small

scale shRNA approach to identify factors that could contribute to HIV latency. In this

approach, our main goal was identify novel targets for the treatment of latency.

As it is quite clear that eradication of HIV will not be possible unless we find a

way to treat latency, many researchers have sought ways to deplete the latent reservoir.

One current proposal is to activate HIV transcription in the quiescent T cell without

inducing cellular proliferation and activation. The proposal is based on the idea that if

HIV transcription could be activated, the infected, latent cell would succumb to cell death

due to either cytopathic effects of the virus, or clearance through the host immune

system. Furthermore, if patients were on fully suppressive HAART, the resulting viral

spread could be halted. A much earlier version of this idea was tested when Prins et al.

attempted to treat HIV+ patients, receiving HAART, with an antibody to a portion of the

TCR, CD3, and IL-2 in hopes to activate HIV transcription from latent cells (226).

Although there was some outgrowth of virus, the toxicity of such excessive immune

activation makes this an unfeasible approach. Therefore, finding new methods to activate

HIV transcription by circumventing T cell activation is imperative. If heterochromatic

restriction is indeed responsible for latency, it presents a possible target for intervention.

An attractive candidate for epigenetic regulation of HIV transcription is the

Enhancer of Zeste 2 protein (EZH2). EZH2 is the HKMT responsible for M3K27 on

histone H3. EZH2 is a member of the polycomb repressive complex 2 (PRC2) in humans

that is also associated with RbAp48, EED, and SUZ12 (Figure 7)(247). EZH2 is the

catalytic subunit of this complex, as it contains a SET domain responsible for

methyltransferase activity (37, 162). Recruitment of the PRC2 complex results in stable

association to DNA through cell division, and thus provides a maintenance of the M3K27

mark (114). Until recently, it was thought that methylation of lysine residues on histone tails was a static post-translational modification (139). The discovery of histone lysine

demethylases challenged this notion. As histone methylation at lysine 9 and lysine 27

have already been implicated in silencing of HIV transcription, EZH2 was a logical

starting point for further investigation (76, 194, 219). Furthermore, since the recent discovery that demethylation of lysine 27 is also possible, it provides a possible mechanism to reactivate HIV from latency without activating the infected T cell.

Taken together, our results indicate that HIV transcription, and thus reactivation from latency, can be controlled through modulation of epigenetic control. As such, this provides a novel route in the treatment of HIV latency.

Figure 7 - The EZH2 histone methyltransferase A) EZH2 derives its catalytic activity from the SET domain, which can trimethylate histone H3 on lysine 27. A functional polycomb repressive complex 2 (PRC2) is composed of the subunit EZH2, EED, SUV12, and RbAp48. B) The domain organization of EZH2. In addition to the SET domain, the CXC domain is also required for methyltransferase activity. Reprinted with permission from Elsevier, Copyright 2010.

Chapter 2) Materials and Methods

2A Cell lines and Tissue Culture Reagents

Jurkat E4, G4, and 2D10 cells were cloned and characterized as described

previously (219). Cells were maintained in Hyclone RPMI medium with L-glutamine,

10% fetal bovine serum (FBS), penicillin (100 IU/ml), streptomycin (100 µg/ml) in 5%

o CO2 at 37 C. Cells used as the mixed population were obtained by infecting Jurkat clone

E6 with lentivirus made in 293T cells by co-transfection with VSV-G, pdR8.91, and pNL4.3 containing Nef and EGFP (213). Cells were maintained for one month after infection and loss of EGFP expression was followed. When cells had less than 5% EGFP expression, they were infected with negative, SUV39H1, EZH2, or EZH2 and SUV39H1 shRNA.

2B Cloning and Lentiviral infections

The[(G/C)3NN] sequence was amplified from plasmid pCCGNN24 (kindly

provided by Dr. Yuh-Hwa Wang) with primers (HindIII F) CCC AAG CTT ACC GAT

CCG AAC CGG ACC G and (HindIII R) CCC AAG CTT ATC GGA ACG GGC CGG

TGC G. The sequence was cloned into a pBluescript II KS(+) plasmid (Fermentas ) that

either contained a 5’ or 3’ LTR. After cloning the NXS into each LTR, the 5’LTR, now

containing the NXS sequence, was cut with the restriction enzymes ApaI and BssHII.

The 5’ LTR was subcloned into a pHR’-pNL4.3 retroviral vector. Subsequently, this

vector was cut with ApaI and XhoI, and ligated in to the 3’ LTR pBSII plasmid. Thus,

the final product contained the HIV sequence from the 5’LTR to the 3’LTR of a

pHR’NL4.3 plasmid, but was in a pBSII background. The control GAPDH sequence was

amplified from Jurkat nuclear extract using the primers (GAPF) TTA AGC TTG CCG

TTA GGA AAG CCT GCC GG and (GAPR) TTA AGC TTC ACA CCT CTG CGG

GGA GGG G and cloned in the same fashion.

Negative (cat RHS4080), SUV39H1 (clone ID TRCN0000150622), and EZH2

(clone ID TRCN0000040074) vectors were purchased from Open Biosystems using the

pLKO.1 backbone. For double infections with SUV39H1 and EZH2, a blasticidine

marker was subcloned into the pLKO.1 vector in place of the puromycin marker. The

blasticidine gene was amplified from the pcDNA6/V5-His ABC plasmid (Invitrogen cat.

# V22020) using the primers BlastF (AGGTCGACATGGCCAAGCCTTTG) containing

the restriction site HincII and BlastR (ATGGTACCTTAGCCCTCCCACAC) with a

KpnI restriction site. pLKO.1 EZH2 vector was cut with HincII and KpnI and the

backbone was religated with the blasticidine fragment.

Lentivirus was generated through triple transfection of 293T cells to yield

vesicular stomatitis virus G-pseudotyped virus (151). 1 x 106 Jurkat E4 cells were

infected with serial dilutions of the harvested supernatant overnight and washed twice

with PBS. Cells were resuspended in fresh RPMI medium containing 10% fetal bovine

serum (FBS), penicillin (100 IU/ml) and streptomycin (100 µg/ml). For shRNA

infections, three days later media was removed and replaced with the same media

containing either puromycin (2 µg/ml), blasticidine (10 µg/ml), or a combination of both.

Cell viability and d2EGFP expression was assessed via fluorescence-activated cell sorting (FACS).

2C ChIP analysis

Latent E4 Jurkat clones were activated for 0 or 30 minutes with 10ng/ml TNF-α at

2.5 million cells/ml. After fixation of cells with formaldehyde (0.5%),

immunoprecipatated DNA was prepared as previously described (151). The following

antibodies were used: RNA Polymerase II (sc-899, Santa Cruz), Brg-1 (sc-10768, Santa

Cruz), anti-histone H3, CT, pan, clone AS3(05-928, Millipore), anti-EZH2 (39639,

Active Motif), ChIPAb+ Trimethyl-Histone H3, Lys27 (17-622, Millipore), ChIPAb+

Trimethyl-Histone H3, Lys9 (17-625, Millipore), RNA polymerase II (sc-899, Santa

Cruz), and anti-acetyl-Histone H3 (06-599, Millipore). For shRNA infected cells, cells were prepared as previously mentioned nine days after treatment with selective marker media and immunoprecipitated with the same antibodies. 5 μL of DNA was added to

12.5 μL of SYBR green master mix (Quanta) and 1 μL of each primer to total 25 μL and analyzed through real-time PCR. The following primer sets were used: HIV (Nuc-0) -

390 F-ACA CAC AAG GCT ACT TCC CTG A, -283 R-TCT ACC TTA TCT GGC

TCA ACT GGT); HIV (promoter) -116 F- AGC TTG CTA CAA GGG ACT TTC C, +4

R- ACC CAG TAC AGG CAA AAA GCA G; HIV (Nuc-1 position) +30 F- CTG GGA

GCT CTC TGG CTA ACT A, +134 R- TTA CCA GAG TCA CAC AAC AGA CG; HIV

(Gag) +611 F-AGG CGT TAC TCG ACA GAG G, +770 R-AGG CGT TAC TCG ACA

GAG GA); HIV (env) +4078 F-AGC AGA AGA ACG GCA TCA AG, +4277 R-CTC

CAG CAG GAC CAT GTG AT; and GAPDH gene +1013 F-TGA GCA GAC CGG

TGT CAC TA, +1128-AGG ACT TTG GGA ACG ACT GA.

2D Western Blots

For whole cell extracts, .5 million E4 cells in 2 ml’s of RPMI media were treated for thirty minutes with 10ng/ml TNF-α, 1 day with 50 nM Chaetocin, 5 μM BIX01294, and 5 μM 5’ azacytidine (Fisher), or three days with equal amounts of DMSO and 10μM

DZNep. Cells were collected and washed twice with phosphate buffered saline (PBS)

and resuspended in 250 μL of RIPA buffer (20 mM Tris pH 7.5, 1% Triton X-100, 2 mM

EDTA, 20 mM Tris-HCl pH 8.1, 500 mM NaCl). Cells were lysed on ice for ten minutes and sonicated in a Bioruptor XL for 10 minutes, 30 seconds on and 30 seconds off. DNA was removed through centrifugation at 13,000 r.p.m. for 15 minutes. Protein was quantified using Bradford assay and 18 μg of total protein was loaded.

2E Isolating the C22G Tat mutant clone

Jurkat E6 cells were infected with pHR’NL4.3d2EGFP virus containing a C22G

Tat mutation. After infection, cells were expanded for one week. From the d2EGFP-

population, individual cells were isolated. Each clone was allowed to expand and grow

for one week. Following expansion, cells were activated overnight with 10ng/ml TNF-α,

and those cells that displayed a subtle shift in d2EGFP expression upon activation were

selected for analysis.

2F MNase Digest

5 x 107 Jurkat cells were washed twice with cold phosphate buffered saline (PBS)

and resuspended in 2 mL’s of Buffer A (10 mM Tris(pH7.4), 10 mM NaCl, 3 mM

MgCl2, and 0.3 M sucrose). Cells were kept on ice for five minutes in Buffer A. After

five minutes, and additional 2 mL’s of Buffer A/.2% NP40 was added. Cells were

incubated for an additional five minutes with intermittent pipetting. Nuclei were

harvested through centrifugation at 1000 r.p.m. for 10 mins. at 4⁰ C. Isolated nuclei were

resuspended in 1 mL of Buffer A/10 mM CaCl2.

Increasing concentrations of micrococcal nuclease were added while cells sat at

37⁰ C for 20 mins. The digestion was stopped by addition of 2x proteinase K buffer (100

mM Tris (pH 7.5), 200 mM NaCl, 2mM EGTA, and 1% SDS) with 20 mM EGTA.

Samples were solubilized at 50⁰ C for 1 hour. Samples were digested overnight with

20μg Proteinase K. After cooling, cells were incubated for one hour with 2.5 μg of

RNase A. DNA was extracted using Phenol/CCl3 and resuspended in H2O.

2G Isolation and Analysis of Mononucleosome Fragments

7 μg of MNase digest DNA were run through a 1% agarose gel.

Mononucleosome fragments were isolated and purified using Qiagen PCR purification kit

(28106). HIV-1 DNA was amplified through real-time PCR using primers -141 (6110F)

ACA GCC GCC TAG CAT TTC AT, (6201R) GGA AAG TCC CTT GTA GCA AGC

TC, -111 (6144F) GCT GCA TCC GGA GTA CTT CAA, (6226R) CAC GCC TCC

CTG GAA AGT, -48(6195F) ACT TTC CGC TGG GGA CTT TC, (6301R) AGA CCC

AGT ACA GGC AAA AAG C; +7(6251F) GAG CCC TCA GAT CCT GCA TAT AA,

(6356R) GTG GGT TCC CTA GTT AGC CAG A; and +29(6280F) GCT TTT TGC

CTG TAC TGG GTC T, (6370R) TTG AGG CTT AAG CAG TGG GTT C to amplify the area between Nuc-0 and Nuc-1.

2H Activations and shutdowns

To compare different activators of transcription, TNF-α (10 ng/ml), CD3 (0.125

µg/ml), CD3/CD28 (0.125 µg/ml, 1 µg/ml), trichostatin A (TSA, 500 nM), hexamethylbisacetamide (HMBA, 5 mM), or suberoylanilide hydroxamic acid (SAHA,

5mM) was added to shRNA infected cells overnight. The next day, cells were analyzed via FACS. The histone methylation inhibitors DZNep (synthesized by Dr. Chu) or

BIX01294 (Sigma, cat. # B9311) were added to E4 cells plated at 1 million/ml in a twelve well tissue culture plate overnight. Cells were maintained in compounds for either one or three days and analyzed for d2EGFP expression via FACS.

For shutdowns, cells were activated with 10 ng/ml of TNF-α for 21 hours one week after infection. Cells were washed twice with PBS and resuspended in selective marker containing media. FACS analysis was taken every three hours up until 12 hours.

Subsequently, samples were taken every 24 hours after removal of TNF-α.

2G Viral outgrowth assays

PBMCs were isolated from leukocytes obtained by continuous-flow leukopheresis by Ficoll gradient centrifuge and resting CD4+ T cells were further purified by negative magnetic bead selection (10). The purity of the isolated resting T-cells as determined by flow cytometry was routinely >98% CD4+, and < 0.5 % of the cells expressed activation

markers. Purified resting CD4+ T-cells were transfected using the Human T Cell

Nucleofection Kit V (Lonza; Basel, Switzerland) following the manufacturer’s protocol

for un-stimulated cells. Briefly, cells were resuspended in nucleofection solution

containing siRNA duplexes at a density of 10 million cells/100 µl. SUV39H1 siRNA

duplexes were obtained from Santa Cruz Biotechnology (sc-38463; Santa Cruz,

California, USA). The sense strand of the EZH2 siRNA duplex was

GAGGGAAAGUGUAUGAUAA [dT] [dT] and the non-specific siRNA sense strand

sequence was CGUACGCGGAAUACUUCGAUU [dT] [dT]. Resting CD4+ T cells

were nucleofected using program U-014 and placed into IMDM (Invitrogen; Carlsbad,

California, USA) cell culture media supplemented with 10% fetal bovine serum, 100

U/ml penicillin (Invitrogen), 100 µg/ml streptomycin (Invitrogen), and 20 U/ml interleukin-2. Following a rest period of 4 to 6 hours, 33.5 to 48.6 million resting CD4+ T

cells were plated in replicate dilutions of 2.5 million (12-18 cultures), 0.5 million (6

cultures) and 0.1 million (6 cultures) and incubated at 37°C under 5% CO2 for 19 days.

Over the course of the experiment, cells were fed twice with PHA-stimulated, CD8-

depleted PBMCs collected from a designated HIV-seronegative donor as previously

described (10). Culture supernatants were collected on day 15 and 19 and assayed for virus production by p24 antigen capture ELISA (Zeptometrix, Buffalo, NY). Cultures were scored as positive if p24 was detected at day 15 and was increased in concentration at day 19. A maximum likelihood method was used to calculate the infectious units per million (IUPM) of resting CD4+ T cells.

Chapter 3) The Histone Lysine Methyltransferase EZH2 Plays an Essential Role in

Establishing and Maintaining HIV Latency

3A Abstract

Long-term maintenance of HIV-1 infection is achieved through the virus’s ability to stably infect a subset of long-lived memory CD4+ T cells, and, as a consequence, presents an insurmountable barrier for current therapies targeting only actively replicating virus. However, new approaches have sought to purge the latent pool through viral activation, while maintaining the phenotype of the infected host cell. Previous reports have found that proviral DNA is subject to epigenetic control through deacetylation and methylation, and that attenuation of either of these processes leads to the re-emergence of

HIV-1 from latency. Here, we demonstrate that the histone lysine methyltransferase

(HKMT) EZH2 is the major HKMT responsible for maintaining transcriptional silencing

of HIV. Chromatin immunoprecipation experiments demonstrated that the HKMT

Enhancer of Zeste 2 (EZH2) was present at high levels at the LTR of silenced HIV

proviruses and was rapidly displaced following proviral reactivation. Knockdown of

individual HKMTs by shRNAs demonstrated that EZH2, which targets histone H3 lysine

27, is essential to maintain HIV latency. By contrast, knockdown of SUVH39H1, which

targets histone H3 lysine 9, only weakly induced latent proviruses. EZH2 knockdown

results in accumulation of positive transcriptional factors such as acetylated histones and

RNA polymerase II, and in addition are sensitized to activation through T cell receptor

stimulation. In resting memory cells isolated from HIV+ patients, EZH2 and SUV39H1

shRNA induced viral outgrowth. As a first attempt to evaluate whether EZH2 is a

promising drug target for use in therapies designed to force reactivation of the latent HIV

67 pool we tested the broad-spectrum HKMT inhibitor DZNep. Treating latently infected cells with DZNep leads to activation of silenced proviruses and a decrease in the H3K27 mark. These findings suggest that a new course of action for treatment of HIV latency may be through activation of latent cells through inhibition of histone methylation.

3B Introduction

After infection, HIV-1 can integrate within the host cell genome and establish a latent infection. Eliminating the latent reservoir is particularly challenging since the reservoir is established early during infection (51), is extremely stable, with an estimated half-life of

44 months (246), and can be replenished during episodes of viremia (52, 229) or by homeostatic replacement of latently infected cells (49). Intensification of these regimens has essentially no impact on eradicating this latent pool from the infected host, and forces the need for other forms of therapy to be developed (73). Therefore, the ongoing dilemma in HIV treatment is developing a method which will abolish the latent reservoir.

However, a multitude of factors influence HIV latency (167).

To begin, transcriptional elongation can only occur through the recruitment of the viral transactivating factor Tat. Sub-threshold levels of Tat result in abortive transcripts around the promoter and thus HIV latency (3).

However, the question still remains, what is the cause for loss of Tat expression?

The most convincing argument asserts that the formation of restrictive heterochromatin around proviral DNA is responsible for latency (219). Heterochromatin is a more compacted state of DNA in which transcription becomes less permissive, whereas euchromatin is a state in which DNA becomes relaxed allowing for processive transcription. Both states are associated with various post-translational modifications of histone tails. Integration within silenced heterochromatin might explain the virus’s ability to enter a transcriptionally dormant state to evade host immune responses. In fact,

Jordan et al. have found that integration in heterochromatic regions is favored in latently infected cell lines (138). Others have found that integration is found predominantly in

69 actively transcribed genes of latently infected cells, suggesting that integration within heterochromatin is an unlikely explanation for the silencing of transcription (112, 175,

180). However, extensive evidence suggests that the integrated provirus is subject to epigenetic regulation, and that removal of heterochromatic markers is necessary for productive viral transcription.

Activation of T cell lines harboring latent proviruses results in displacement of a nucleosome (nuc-1) positioned immediately downstream from the transcriptional start site (271, 274). Acetylation of this nucleosome is a prerequisite for transcriptional elongation after activation (186). The histone acetyl transferases (HATs) p300/CBP, p300,CBP-associated factor (PCAF) and hGCN5 have all been found to be recruited to proviral DNA after activation and are responsible for modification of this nucleosome

(21, 124, 198). In comparison, when a provirus has become transcriptionally silent, histone deacetylases (HDAC) occupy regions of the 5’ LTR, and treating latent cells with histone deacetylase inhibitors (HDACi) results in activation of viral gene transcription (9,

59, 147, 306). The importance of acetylation for activation of HIV transcription has become such a fundamental phenomenon it has led researchers to investigate therapeutic uses for some HDACi such as valproic acid and SAHA (79, 234).

Previous reports have shown that latent HIV proviruses carry methylated histone

H3 which has been either trimethylated on lysine 9 (H3K9me3) or lysine 27

(H3K27me3) (76, 194, 219) or dimethylated on lysine 9 (H3K9me2) (131). Each of these modified histones are considered to be repressive marks (156). SUV39H1, which is the histone lysine methyltransferase (HKMT) responsible for trimethylating Histone H3 at the K9 residue, has been indirectly implicated in maintaining HIV latency by acting as

a signal for the recruitment of CTIP-2 and HP1γ to the HIV LTR (76, 194). Knockdown

of either CTIP-2 or HP1γ proteins led to activation of HIV. Similarly, Imai et al. (131)

have proposed that the HKMT G9a, which is responsible for creating di-methyl H3K9,

can also contribute to the maintenance of HIV latency.

EZH2 is the mammalian homolog of the Drosophila E(Z) protein. It is one

protein component within a complex known as Polycomb Repressive Complex 2 (PRC2),

and its catalytically active SET domain is responsible for tri-methylation of lysine 27 on

histone H3 (37, 162). DNA methylation can be regulated by EZH2, as it serves as a

binding platform for DNA methyltransferases (DNMT’s) (275). EZH2 and its cross-

species counterparts have been functionally linked to Hox gene silencing, X inactivation,

maintenance of stem cell pluripotency, and cancer (38). In T cells, EZH2 has been found

to contribute to T cell differentiation and maintaining silencing of the IL4-IL13 gene

locus in TH1 primed cells (157, 228). Here, we demonstrate that EZH2 is found at the

HIV promoter along with the corresponding H3K27 tri-methylation marker. Knockdown of EZH2 with shRNA, or inhibition of EZH2 with chemical inhibitors, efficiently reactivates silenced proviruses indicating that EZH2 plays an essential role in maintaining HIV latency.

3C Results

3C.1 A small scale shRNA screen for factors regulating HIV Latency

To identify factors that play a relevant role in silencing of HIV transcription, the

Jurkat E4 clone was infected with a variety of shRNA’s purchased from Open

Biosystems. The HIV provirus in the E4 clone is inserted into the 4th intron of the

centromere protein P (CENPP) gene on chromosome 9 (219) and is orientated so that its

promoter transcribes the same strand as the CENPP gene (Figure 8). Extensive characterization of the E4 clone has shown that it is readily inducible by TNF-α and activation of the T-cell receptor (219).

As a representative experiment, the infection of E4 cells with HP1α, HP1γ and

EZH2 shRNA was assayed through FACS analysis (Figure 9). Heterochromatin protein

1 (HP1) proteins are known to contribute to heterochromatin formation through binding of trimethylated H3K9 and subsequent recruitment of HKMT’s (309). In addition, HP1γ has been implicated in silencing of HIV transcription (76). At least two different shRNA’s were tested at any time to ensure a target sequence that could efficiently knockdown expression. Interestingly, cells infected with one of the EZH2 shRNA’s had dramatically higher levels of d2EGFP+ cells prior to activation compared to the negative control (41.87% vs. 21.26%). Only a modest increase was seen with one of the HP1γ shRNA’s (33.16%), and HP1α shRNA infections had comparable numbers to the negative control. As it was a pilot experiment, cells were not assessed for amounts of target protein knockdown. However, the remarkable effect that was seen when cells were infected with EZH2 shRNA warranted a more rigorous inspection.

3C.2 Knockdown of EZH2 leads to activation of HIV transcription

To determine if removal of EZH2 leads to alleviation of transcriptional repression at the HIV provirus, we repeated the infection of the E4 Jurkat clone by superinfecting with a lentiviral construct carrying the shRNA against EZH2 that had the most dramatic effect in our initial screen. The SUV39H1 and negative pLK0.1 vectors were used as

Figure 8 - Integration site of the E4 clone. Within the centromere protein P gene lies an integrated copy of a modified HIV-NL4.3 provirus. The modified virus has a gag deletion, resulting in approximately a 5 kB loss of

HIV genome. The d2EGFP reporter is in place of the Nef gene. The provirus is situated such that its promoter and the promoter of the CENPP gene are in the same orientation.

controls, both positive and negative, respectively. The shRNA vectors carried either a

puromycin or blasticidine resistance gene to allow for positive selection.

Infection with EZH2 shRNA led to spontaneous reactivation in which 40.5% of

the cell population became d2EGFP positive, whereas the control population only had

8.2% (Figure 10). By contrast, cells infected with SUV39H1 shRNA showed only 16%

viral reactivation. Cells that were doubly infected with shRNA to EZH2 and SUV39H1,

were further de-repressed and approximately 51% of the latent proviruses became

reactivated.

To provide additional support that the activation effect was not clonally specific,

we tested the shRNA’s in two additional clones and one mixed population of cells

(Figure 10). The G4 clone carries a single integrated provirus similar in structure to the

provirus in E4 cells, whereas the 2C5 clone carries an integrated provirus expressing the

HIV Nef gene and carrying an attenuated H13L Tat gene (219). Finally we also studied a

mixed population of cells that became silenced after infection with the H13L Tat, Nef+

virus. In every cell line, knockdown of EZH2 led to a significant induction of proviral

expression. Furthermore, knockdown of EZH2 was always at least 2-fold more effective

at inducing proviral expression than knockdown of SUV39H1, and knockdown of both

SUV39H1 and EZH2 had an additive effective (Figure 10).

Western blot analysis revealed that EZH2 and SUV39H1 levels were significantly reduced due to the effect of the shRNA’s. However, neither protein was completely removed, and EZH2 knockdown also resulted in SUV39H1 reduction. Total cellular protein levels of EZH2 were reduced by 37%, and this resulted in a 65% reduction in

M3K27 levels (Figure 11). Unexpectedly, EZH2 knockdown also resulted in

Figure 9 - Small scale shRNA screening for factors involved in HIV transcription. Jurkat E4 cells were infected with the pLKO.1 vector carrying shRNA against the target proteins HP1α, HP1γ, or EZH2. Two different target sequences (1 and 2) were used to ensure efficient target protein knockdown. 3 days after puromycin selection and 9 days p.i., cells were assessed for d2EGFP+ cells through flow cytometry.

Figure 10 - Knockdown of EZH2 induces transcriptional activation of latently infected cells. A) The latently infected Jurkat E4, G4, or 2c5 clones or a mixed population of latently infected Jurkat cells harboring a Nef+ provirus and H13L Tat mutation were infected overnight with lentivirus carrying shRNA against negative, SUV39H1, EZH2, or negative combination of the two. Cells were washed the next day and 4 days post- infection (p.i.) were treated with either puromycin (for SUV39H1), blasticidine (for

EZH2), or both for double infections. Cells were assessed via FACS 6 days p.i.

Figure 11 - Western Blot analysis of shRNA infected cells. RIPA whole cell extract of E4 clone infected with the negative, SUV39H1, EZH2, or

both were used for western blot. 18 µg of total protein was loaded and probed with antibodies against EZH2, SUV39H1, histone H3 tri-methylated lysine 27, or GAPDH as a loading control. Western blot was quantified using Quantity One. Protein levels were normalized against the GAPDH control.

approximately 40% reduction in SUV39H1 levels. Likewise, SUV39H1 shRNA

infection led to 48% reduction in total cellular protein levels. Interestingly, EZH2 levels

were increased by 108% in this condition. A 62% reduction of EZH2 protein levels was

seen when cells were dually infected with vectors carrying shRNAs to EZH2 and

SUV39H1, and this resulted in a >95% loss of H3K27me3 (Figure 11).

To further strengthen the idea that EZH2 depletion results in relief of

transcriptional repression, ChIP assays were performed on E4 cells superinfected with the

EZH2 or negative shRNA (Figure 12). We detected higher basal levels of RNA

polymerase II across the provirus when infected with EZH2 shRNA versus the negative

control. In addition, EZH2 knockdowns had exceptional levels of polymerase at points

farther downstream, indicating that the transcriptional block at nuc-1 had been partially overcome (Figure 12). In addition, acetylated H3 levels were higher at the HIV promoter, but no difference was seen downstream, reinforcing the theory that promoter acetylation is essential in transcriptional activation.

We conclude that there is a strong correlation between the loss of EZH2 and

H3K27me3 and proviral induction. Knockdown of both SUV39H1 and EZH2 further enhances proviral reactivation, however, because EZH2 levels are also reduced in the presence of the SUV39H1 shRNA, it is difficult to determine whether the loss of

SUV39H1 is making a major contribution to proviral reactivation.

3C.3 EZH2 and M3K27 are present at the LTR of Latent Proviruses

To measure changes in chromatin structure before and after induction of transcription with TNF-α, we performed chromatin immunoprecipitation assays (ChIPs) on an established clonal cell line originally isolated from Jurkat cells infected with a

Figure 12 - Knockdown of EZH2 results in elevated levels of proteins associated with active transcription.

E4 cells superinfected with EZH2 or negative shRNA were assessed for RNA Pol II levels and acetylation of histone H3 along the HIV provirus. Cells were stimulated for 30 mins. with TNF-α and isolated nuclei were precipitated with antibodies to RNA Pol II or

AcH3 and prepared as previously described (219).

79 pNL4.3-d2EGFP reporter virus (219). As expected, 30 minutes of stimulation with TNF-

α led to significant increases at the promoter and nuc-1 region of the HIV provirus

(Figure 13). However, because Tat levels are still limiting at this point, elongation, and thus RNA Pol II levels at the downstream region were low. As a control, polymerase levels at the GAPDH promoter remain constant. RNAP II levels at the control GAPDH promoter remained constant under these conditions. Total histone H3 levels at the HIV

LTR and the control GAPDH gene were comparable and relatively constant before and after TNF-α induction. However, as noted before (147, 219), the HIV LTR of latent proviruses carries deacetylated histones with acetylated histone H3 levels 6 to 10-fold lower than seen on the GAPDH gene. Similarly, there was only a modest increase in histone H3 acetylation levels after activation by TNF-α.

Remarkably, EZH2 and its corresponding histone mark, M3K27, are found at high levels at the HIV provirus in the E4 clone. An abundance of EZH2 is found at the promoter and nuc-1 region, however, it is barely detectable at the GAPDH gene. In addition, TNF-α stimulation results in loss of signal, suggesting that EZH2 acts as a repressive factor. As anticipated, the M3K27 is found at significantly high levels within the HIV provirus. M3K27 levels are more than twice as high on the HIV LTR as on the

GAPDH gene and there is a 60% decrease in M3K27 at Nuc-1 following TNF-α treatment. By contrast, M3K9 levels are comparable to those seen at the GAPDH promoter, and there is no significant decrease in M3K9 levels following TNF-α treatment.

Figure 13- ChIP analysis of the latent E4 clone.

E4 cells were stimulated for 0 or 30 minutes with 10 ng/ml TNF-α. Cross-linked nuclei were immunoprecipitated with RNA polymerase II (RNA PolII), Total Histone H3 (Total

H3), Total acetylated histone H3 (AcH3), EZH2, Histone H3 tri-methylated lysine 27

(H3K27), or Histone H3 trimethylated lysine9 (H3K9) according to the procedure outlined in Materials and Methods. Recovered DNA was assessed using the primers given in Materials and Methods. The GAPDH promoter was used as a control. DNA was quantified by making a five-fold serial dilution of 10% total input DNA.

To further confirm the presence of EZH2 along latent proviruses, 2D10 cells were

activated for 30 minutes with TNF-α. These cells contain an H13L Tat variant, which

shutdown as faster kinetics than wild-type; however, they are able to be reactivated efficiently (219). After 30 minutes of stimulation, 2D10 cells showed a nearly two-fold increase in RNA Pol II levels at the promoter, and to a much lesser extent the Nuc-0 region (Figure 14). Activation also resulted in loss of EZH2 at both Nuc-0 and the promoter. Taken together this data suggests that presence of EZH2 and H3K27me3 correlates with the silencing at the HIV promoter in multiple clones.

3C.4 EZH2 knockdown sensitizes latent proviruses to cellular activation signals

Since HIV silencing arises because of multiple epigenetic blocks, it seems likely

that reductions in EZH2 that are insufficient to induce proviral reactivation might

nonetheless make silenced proviruses more responsive to cellular activation pathways.

We therefore compared the extent of proviral reactivation in the control E4 and G4 cell

lines and in the corresponding cell lines in which SUV39H1 and EZH2 were knocked

down by shRNA (Figure 15).

As shown in Figure 15a, stimulation of E4 cells through the T-cell receptor (TCR)

using α-CD3 mAb (15% d2EGFP+ cells) or a combination of α-CD3 and α-CD28 mAbs

(29% d2EGFP+ cells) resulted in only partial proviral reactivation. Similar activation

levels were seen in cells in which SUV39H1 was knocked down (Figure 15b). However,

in cells where EZH2 was knocked down, the basal activation level increased to 30.1%

d2EGFP+ cells. Stimulation of the EZH2 knockout cells with α-CD3 mAb resulted in

activation of 75.1% of the latent proviruses while stimulation with α-CD3 and α-CD28 mAbs resulted in activation of 85.1% of the latent proviruses (Figure 15c).

Figure 14 - EZH2 resides at the 5’LTR of the 2D10 clone. 2D10 cells were stimulated for 30 mins. with 10 ng/ml TNF-α. Cross-linked nuclei were

immunoprecipitated with RNA polymerase II (RNA PolII) or EZH2 antibodies according

to the procedure outlined in Materials and Methods. Recovered DNA was assessed using

the primers given in Materials and Methods. The GAPDH promoter was used as a

control. DNA was quantified by making a five-fold serial dilution of 10% total input

DNA.

Figure 15- Knockdown of EZH2 activates HIV transcription through pathways independent of T cell signaling. Flow cytometric analysis of the latent E4 clone infected with A) negative, B) SUV39H1, or C) EZH2 shRNA’s and stimulated overnight with 10 ng/ml TNF-α, 1 µg/ml CD3, or

CD3/CD28 (1µg/ml, .125 µg/ml). Summary of activation potential of the D) E4 or E) G4 clone infected with the various shRNA’s and stimulated overnight with TNF-α, CD3, and

CD3/CD28 as in Figure 4A and additionally with HMBA and TSA.

Knockdown of EZH2 and SUV39H1 also potentiated proviral reactivation in cells treated

with a wide variety of other stimuli (Figure 15d). Activation of cells with TNF-α, which

is typically more potent than activation through the TCR, resulted in 68.3% reactivation

of the proviruses in control E4 cells and 91.6% and 93% reactivation of the proviruses in

cells in which SUV39H1 and EZH2 were knocked down respectively. Activation of E4

cells with hexamethylbisacetamide (HMBA), which is believed to activate HIV

transcription by enhancing the release of P-TEFb from the inactive 7SK RNP complex

(57), resulted in activation of 21.8% of the silenced proviruses in E4 cells. However, following knockdown of SUV39H1, 33.6% of the proviruses were activated under these conditions. Knockdown of EZH2 resulted in reactivation of 55.3% of the latent proviruses in response to HMBA. Finally, treatment of cells with the HDAC inhibitor trichostatin A (TSA), resulted in 56% proviral reactivation in E4 cells, but more than

86.3% reactivation in cells where EZH2 was knocked down. Nearly identical patterns of sensitization of proviral reactivation following SUV39H1 and EZH2 knockdown were observed in the G4 cell line (Figure 15e).

Thus, removal of epigenetic blocks at silenced HIV proviruses by reduction in

HKMT levels with shRNA potentiates viral reactivation in response to a wide variety of stimuli. Although knockdown of both SUV39H1 and EZH2 are able to sensitize the cells, knockdown of EZH2 is always more effective than knockdown of SUV39H1.

3C.5 Reduction of EZH2 delays silencing of HIV transcription

In order to determine if EZH2 contributes to the silencing of HIV transcription,

E4 or G4 clones harboring negative, SUV39H1, and EZH2 shRNA were activated with

TNF-α for 21 hours. After removal of stimulation, cells were monitored via FACS for

d2EGFP expression as they reverted to latency. As already noted, the decline in d2EGFP

follows a biphasic pattern (219). In all three cases, the initial decline of d2EGFP is rapid,

corresponding to loss of NF-κB and thus Tat (Figure 16). However, the second phase is

kinetically slower, occurring between 12 and 72 hours after removal of TNF-α, and

highlights the difference in reversion to latency in EZH2 versus SUV39H1 shRNA

infected cells. Clearly, EZH2 shRNA shows a marked delay in loss of d2EGFP

expression, whereby d2EGFP levels were nearly the same at the 12 and 72 hour time

points, and nearly double the levels of d2EGFP seen in the control cells. In comparison,

knockdown of SUV39H1 somewhat reduced the rate at which cells reverted to latency,

but the effect was much smaller than that seen with the EZH2 knockdowns. Similar

results were observed in both the E4 and G4 cell lines (Figure 16). Thus, histone

methylation stimulated by EZH2 appears to be essential in order to achieve full proviral

silencing.

3C.6 Drug candidates to induce reactivation of HIV from latency

The broad spectrum HKMT inhibitor 3-deazaneplanocin A (DZNep) has been previously tested as an anti-HIV therapeutic agent, as DZNep is structurally similar to a nucleoside, and thus tested as a possible chain terminator in reverse transcription (Figure

10a) (104, 201). Therefore, testing this drug in viral outgrowth assays is incompatible,

and limited to only single round infections in cultured cell lines. It has been shown that

DZNep is capable of downregulating several cellular HKMT’s and EZH2 (207). In

addition, DZNep has the potential to be of therapeutic use as an anti-cancer agent, as

overexpression of EZH2 has been implicated in many cancers (247). DZNep is a S-

Figure 16 - Depletion of EZH2 results in slower progression to re-establishing latency. E4 or G4 clones infected with the shRNA’s were activated for 21 hours with 10 ng/ml

TNF-α. Cells were washed and resuspended in fresh media and assessed via FACS at 0,

3, 6, 9, 12, 24, 48, and 72 hours after removal of stimulation. Shutdown profiles of

Negative (A) or EZH2 (B) shRNA after TNF-α removal. Quantification of loss of d2EGFP expression following removal of TNF-α stimulation as measured by mean fluorescent intensity in the E4 (C) and G4 (D) clonal cells. Mean fluorescent intensity

(MFI) of each sample was normalized against the starting MFI. Curves were fitted to an biphasic equation

adenosylhomocysteine hydrolase inhibitor (AdoHcyase), and as such, could theoretically

exert its effects on other methylation targets (Figure 17a) (48). In vivo, methylation

occurs through the reaction of an enzyme, a methyltransferase, transferring a methyl

group from the donor, S-adenosylmethionine (AdoMet), to the target protein. In the

process, AdoMet is converted into S-adenosylhomocysteine (AdoHcy). AdoHcyase is

responsible for converting the byproduct, AdoHcy, to the breakdown products adenosine

and homocysteine. Inhibition of this enzyme results in a build-up of AdoHcy, which in

turn results in lowered intracellular levels of the methyl donor, AdoMet, and thus

decreased methylation of target proteins (154). Therefore, one could see that it is

possible to disrupt a wide spectrum of targets through this mode of action.

The inhibitor of G9a, BIX01294, is a noncompetitive inhibitor of AdoMet (158).

Its appears to be specific for inhibition of the M2K9 mark, with concomitant increase in

M3K9 reported (158). Structurally, BIX01294 is a small molecule inhibitor that is

similar in structure to bunazosin, an α-adrenozosin receptor antagonist (Figure 17b)

(287).

Chaetocin is known to inhibit the HKMT SUV39H1(107). It is a fungal

mycotoxin that is structurally categorized as a 3-6 epidithio-diketopiperazine (Figure

17c). Mechanistically, it is thought to be a competitive inhibitor of the AdoMet cofactor

(107).

5’azacytidine (5’Aza) and its deoxy derivitive, 5’aza-2’-deoxycytidine

(5’AzaCdr) are known to inhibit de novo methylation of cytosine bases (Figure 17d).

Currently, active clinical trials are pursuing the use of these drugs for the treatment of many cancers, as hypermethylation of tumor suppressor genes has been validated in

many cancer types (160). As it is functionally equivalent to cytosine, azacytidine is

thought to be incorporated into newly synthesized DNA and entrap DNA methyl

transferase I (DNMTI) by forming stable adducts, thus preventing methylation (237,

292).

3C.7 Treating latent cells with the HKMT inhibitor DZNep activates cells through

inhibition of methylation

Treatment of E4 cells with 5 or 10 µM DZNep led to induction of 32% of the latent

proviruses (Figure 18A). The effects of DZNep are progressive with maximal proviral

induction seen after treatment for 3 days. Western blots show that 10 µM of DZNep led

to a global reduction in H3K27me3 (44% reduction) and H3K9me2 (70% reduction) levels (Figure18B). There was a slight reduction in EZH2 levels (21 % reduction).

Surprisingly, DZNep strongly induced SUV39H1 leading to a doubling of the cellular protein levels, but it did not increase global H3K9me3 levels.

In breast cancer cells, it has been demonstrated that DZNep is capable of inducing expression of the TNF-α gene. As TNF-α induction results in nuclear accumulation of p65, and thus, activation of HIV transcription, we wanted to ensure that the effect was specific. To determine that the activation effect seen is from its inhibition of methylation, and not a secondary effect of activating other genes, we blotted for p65 in nuclear extracts of DZNep treated cells (Figure 18c). No nuclear induction of p65 occurred upon

3 day treatment of E4 cells with 10 µM of DZNep in comparison to the TNF-α cells, suggesting the observed effect was due to the primary mode of action of DZNep, inhibition of methylation.

Figure 17 - The structure of methyltransferase inhibitors. The chemical structure of A) DZNep B) G9a C) Chaetocin and D) azacytidine.

3C.8 Other HKMT inhibitors exhibit little activation potential

We also tested inhibitors to other HKMT’s in addition to DZNep. Two inhibitors

of the HKMT’s SUV39H1 and G9a, both of which have been reported to maintain

silencing in latently infected cells, showed little effect on activation of the latent provirus

in the E4 clones (76, 130). At concentrations up to 200 nM, chaetocin did not

significantly activate latent HIV proviruses, and in addition caused massive cell death

(Figure 19B). Western blots (Figure 18B) demonstrated that under these conditions

chaetocin reduced SUV39H1 levels in the cells by 53% but did not significantly alter the global levels of H3K9me3 (7% reduction). Similarly, BIX01294 was a comparatively poor inducer of latent proviruses and was only able to induce 21.1% of the latent proviruses in the E4 cell line after overnight exposure to the drug (Figure 19A). Western blots demonstrated that BIX01294 reduced cellular H3K9me2 levels by 66% and EZH2 levels by 50% but did not significantly reduce cellular H3K27me3 levels (10% reduction) or SUV39H1 levels (12% reduction). Because both chaetocin and BIX01294 were highly toxic to the cells it was not possible to evaluate the effects of these drugs during time periods longer than an overnight exposure.

3C.9 DNA methylation plays an insignificant role in proviral silencing

Recent reports have suggested that DNA methylation is responsible for maintaining a transcriptionally silent provirus and that treatment with the DNA methylation inhibitor 5-aza-2’-deoxycytidine (5’-AzaCdR) leads to re-emergence of virus

(26, 146). Three day treatment of latent E4 cells with 5’-AzaCdR shows slight transcriptional activation, approximately 12%, but with the consequence of extensive cell

death (Figure 19C). E4 cells were treated for three days with suboptimal concentrations

to avoid secondary effects from cell death.

3C.10 Treatment with the HDACi SAHA and DZNep synergistically activate HIV

transcription

The histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) has been shown to be a potent activator of HIV transcription and is a promising new therapeutic agent considering it is currently FDA approved under the name Vorinostat (11, 36).

SAHA works primarily as a histone deacetylase inhibitor, although a recent report

suggests that it may also enhance release of functional P-TEFb from the 7SK RNP complex (58). Since SAHA acts by a distinct mechanism of action from DZNep we decided to test whether the two compounds to cooperate in the activation of latent HIV proviruses. E4 cells were treated for two days with 5 µM DZNep and then treated with

increasing concentrations of SAHA between 0.5 µM and 5 µM (Figure 20). Treatment of

cells with 0.5 µM of SAHA is suboptimal and did not significantly increase proviral

reactivation compared to control cells (4.2% d2EGFP+ cells). Nonetheless at this drug

concentration, SAHA increased DZNep activation of proviruses from 15.3% to 29.3%.

Similar additive effects were seen using 1.0 µM and 5.0 µM SAHA. For example, 1.0

µM SAHA induced 11.7% of the latent proviruses and 5 µM DZNep induced 15.3% of

the proviruses, whereas the two drugs combined were able to induce 40.8%.

In conclusion, DZNep effectively reduces the levels of H3K27me3 at HIV proviruses and

partially activates the silenced viral population making them more sensitive to activation

by histone deacetylase inhibitors such as SAHA. In comparison to other HKMT and

DNMT inhibitors, DZNep is extremely potent.

Figure 18 - DZNep can activate HIV transcription through direct inhibition of

M3K27.

A) The E4 clonal cells were incubated for three days with DMSO, 5 μM DZNep, or 10

μM DZNep B)Western blot of RIPA extracts of E4 cells treated with 10 μM DZNep, 5

μM BIX01294, and 50 nM Chaetocin. C) Nuclear extract of E4 cells stimulated with

10ng/ml TNF-α for 0 or 30 minutes, or treated with 10μM DZNep or DMSO for three

days.

Figure 19 - Other histone methyltransferase inhibitors are poor inducers of HIV transcription. The E4 clone was treated overnight with increasing concentrations of A)BIX01294 or

B)chaetocin. E4 cells were treated for three days with increasing concentrations of

5’Azacytidine.

3C.11 Knockdown of histone lysine methyltransferases induces outgrowth of HIV

from latently infected resting memory T-cells obtained from patients

In order to test whether HKMTs help maintain the latent reservoir found in

HAART treated patients, we treated CD4+ resting memory T-cells with siRNA directed against either EZH2 or SUV39H1 and monitored viral outgrowth (Table 1). In two separate patients we found that both siRNAs were able to significantly stimulate viral outgrowth over the levels seen in cells treated with control siRNA. Thus, in contrast to

Jurkat cells, where EZH2 silencing is the dominant HKMT restriction, both HKMTs contribute to HIV silencing in primary resting memory T-cells.

Figure 20 - Cooperative proviral reactivation by SAHA and DZNep. E4 cells were treated for two days with 5 μM DZNep and then treated overnight with 0.5,

1, or 5 μM SAHA in the indicated combinations. Note that at every SAHA concentration tested, DZNep was able to enhance proviral reactivation.

Table 1 - Stimulation of HIV outgrowth from patient cells by siRNA to EZH2 and

SUV39H1. Isolated resting memory CD4+ T cells from HIV+ patients were isolated and transformed with siRNA duplexes targeting EZH2 and SUV39H1. Cells were maintained and grown for 19 days post-transformation, and at days 15 and 19 post- transformation, p24 levels were assessed though ELISA. (Experiment performed by K.

Keedy and N. Archin)

Infectious Units per 106 Resting CD4+ T cells Nonspecific siRNA EZH2 siRNA SUV39H1 siRNA Patient A 0.50 0.77 0.68 Patient B 0.90 1.27 1.18

3D Discussion 3D.1 Epigenetic silencing of HIV by histone methylation

Extensive genome wide analyses have shown that histone methylation can lead to either the activation or repression of genes, depending on which histone lysine residues are modified and whether they are mono-, di- or trimethylated. In general,

transcriptionally active genes carry H3K4me3 and H3K36me3, whereas repressed genes

found in heterochromatic structures contain H3K9me3, H3K27me3 and H4K20me3.

Heterochromatin can be either constitutive or facultative. Constitutive heterochromatin is composed of genes that are permanently silenced and carry the H3K9me3 and

H4K20me3 histone modifications and are enriched in the linker histone H1, whereas facultative heterochromatin carries temporarily silenced genes identified by the

H3K27me3 mark (266).

The data presented here demonstrates that EZH2, which carries a catalytically active SET domain that is responsible for the formation of H3K27me3 (161), plays an essential role in establishing and maintaining transcriptional silencing of HIV.

Knockdown of EZH2 not only induces latent HIV proviruses, but it also sensitizes latent proviruses to stimulation by exogenous signals and limits transcriptional silencing.

There is increasing evidence that epigenetic silencing, mediated by EZH2, and leading to the creation of facultative heterochromatin, is an important feature of intrinsic immunity to a wide range of viral infections. Recent work has demonstrated that epigenetic silencing is critical for the induction of latency in Kaposi Sarcoma-Associated

Herpesvirus (KSHV) infected cells (109, 181, 262). Soon after infection, there is widespread deposition of H3K27me3 across the KSHV genome, but the H3K9-me3 mark

98 is largely absent. Subsequently, additional silencing through DNA methylation was observed (109). Similarly, induction of latency of Herpes SimplexVirus 1 is also associated with the deposition H3K27me3, which is used to restrict the synthesis of the latency-associated transcript (LAT) (164).

3D.2 EZH2 and SUV39H1 play unique roles in the silencing of HIV

Previous studies have found that SUV39H1 and HP1 help to maintain a transcriptionally repressed provirus in microglial cells and in fibroblasts (47, 76, 194).

Our results confirm that SUV39H1 can make a contribution to HIV latency in T-cells but it appears to be much less effective than EZH2 in the T-cell clones that we have studied.

For instance, we found that knockdown of SUV39H1 only induced 5% of the latent proviruses and only produced a subtle delay in reversion to latency upon removal of exogenous stimuli, whereas knockdown of EZH2 can induce up to 40% of latent proviruses. These findings are consistent with the idea that H3K27me3 is the dominant repressive histone mark on silenced HIV proviruses in the Jurkat cell system. By contrast, in latently infected resting memory T-cells obtained from patients on HAART, knockdown of either EZH2 or SUV39H1 by siRNA can induce viral outgrowth.

We propose, by analogy to well-documented examples of herpes virus silencing

(109, 181, 262), that heterochromatic silencing of HIV is a multi-step process in which hierarchical modifications are progressively introduced. The initial silencing events probably involve the recruitment of HDACs leading to histone deacetylation (59, 147,

219, 268). This is probably followed by EZH2 recruitment and H3K27me3 deposition, as shown here. In addition to its enzymatic activity, EZH2 acts as a component of the

Polycomb Repressive Complex 2 (PRC2) and can serve as a binding platform for the

DNA methyltransferase-1 (DNMT1) (276). Since DNA methylation has been shown to

repress the transcription of HIV, recruitment of DNMT1 could be an additional function

of EZH2 that further enhances HIV latency (26, 146, 276). Consistent with this idea, we

have found that the relief of DNA methylation in the E4 clone by 5-Aza-CdR treatment led to partial, albeit low, proviral reactivation (Figure 6).

3D.3 Therapeutic implications

Strategies designed to purge the latent proviral pool require non-toxic activator molecules to induce transcription of latent HIV proviruses and target their host cells for destruction. The strongest existing candidate molecules for this role are HDAC inhibitors such as SAHA and valproic acid (11, 169, 306). Unfortunately, HDAC inhibitors are relatively nonspecific and can activate multiple cellular genes. Here we have demonstrated that silencing of HIV proviruses is highly dependent on formation of the repressive histone mark H3K27me3 by the HKMT EZH2. This suggests that targeting

H3K27me3 formation might prove to be a more selective method to induce latent proviruses. In support of this idea we have demonstrated here that the broad spectrum histone methyltransferase inhibitor DZNep can activate transcription from latent HIV

proviruses.

Although elegant work from Kauder et al. and Blazkova et al. have shown that

CpG methylation plays an instrumental role in silencing, it is still unclear that azacytidine

may prove useful as a new therapeutic strategy. As azacytidine is thought to work by

inhibiting de novo methylation, it is questionable the effects it could exert on quiescent cells such as memory T cells. Indeed, the preceeding experiments demonstrated that azacytidine produces little activation in latently infected cells. This may be due to the

100 hypothesis from Kauder et al. that cells that are not easily reactivatable are generally enriched for this mark. Recent work, however, has shown that azacytidine may work by inhibiting reverse transcription, in which case it could be a novel antiretroviral (65).

Further experiments are necessary to exploit the usefulness of this drug.

In comparison to chaetocin, an inhibitor of the HKMT SUV39H1, and BIX12094, an inhibitor of the HKMT G9a, DZNep shows little cell toxicity and increased potency.

These encouraging results suggest that a new generation of inhibitors of H3K27me3 formation might be developed to act as selective inducers latent HIV proviruses.

Acknowledgments

I would like to thank my collaborators, Dr. David Chu, Dr. David Margolis, Kara

Keedy, and Nancie Archin for help in the preceeding experiments. Also, I would like to thank past and present members of the Karn laboratory: Richard Pearson, Julian Wong,

Mudit Tyagi, Kara Lassen, Hongxia Mao, Michael Greenberg, Amy Graham, Won

Kyung Cho and Julie Jadlowsky for gifts of materials, help and useful discussions. This work was supported by grants from the National Institutes of Health, R01-AI067093 and

DP1-DA028869 to JK, R01-AI025899 to CKC, and U19-AI082608 to DM. JF was supported in part by the Cell and Molecular Biology training grant (T32-GM08056). We also thank the CWRU/UH Center for AIDS Research (P30-AI036219) for provision of flow cytometry services.

101

Chapter 4) Nuc-1 Remodeling is Required for Activation of HIV-1 Transcription 4A Abstract

Despite the potency of combination anti-retroviral therapy, HIV persists in a small

pool of resting memory CD4+ T cells. The ability of HIV to integrate into the host’s cell

genome ensures the maintenance of the virus throughout the life of the infected host. A

number of molecular mechanisms have been proposed to account for latency, including

the presence of inhibitory chromatin structures and heterochromatic markers, a lack of

cellular factors such as NF-κB and PTEFb, and transcriptional interference. Critically, a

nucleosome positioned precisely at the start site of transcription, Nuc-1, must be displaced in order for transcriptional elongation to occur. Although Nuc-1 acetylation generally occurs proceeding transcriptional activation, it is not necessary. Rather, remodeling of Nuc-1 is the imperative step in elongation. To further understand the contribution that Nuc-1 makes to inhibiting transcription, and thus its contribution to latency, we inserted a nucleosome exclusion sequence (NXS) into the Nuc-1 region. In some proviruses that harbored the NXS sequence, initial shutdown was delayed in comparison to wild-type. However, examination of a mixed population of cells harboring both wild-type and NXS proviruses seemed to show very little difference in shutdown.

This could be accounted for by inability of the sequence to exclude the nucleosome. A novel nucleosome mapping approach was undertaken to determine specific placement of nucleosomes in the wild-type and NXS background. Because of the necessity for Nuc-1 to be remodeled, we analyzed the recruitment of the chromatin remodeling complex

SWI/SNF to the HIV promoter. We found that after TNF-α induction, Brg-1 is recruited

102 to the promoter and +283 region of HIV, suggesting the nucleosome remodeling is an important pre-requisite for transcriptional elongation.

103

4B Introduction

A transcriptional elongation defect at the promoter proximal region of HIV is a

general mechanism thought to contribute to HIV latency. To overcome this defect, the

viral transactivator protein Tat is required (144). The Tat/TAR interaction greatly

enhances transcriptional elongation partly through its ability to recruit the essential

elongation factor PTEFb (63, 284). The accumulation of short transcripts around the

promoter in latently infected cells, or those cells lacking Tat, is thought to be due to the

repressive effects of negative factors or a block imposed by Nuc-1 (274, 279, 301, 302).

At the level of chromatin, nucleosomes can act as barriers for productive

elongation (239). Nucleosome positioning within the 5’ LTR of latently infected cell

lines was mapped, and, interestingly, Nuc-1 was found to sit precisely at the start site of transcription (273, 274). Treating latently infected cells with histone deacetylase inhibitors (HDACi) trichostatin A (TSA) or trapoxin (TPX) results in disruption and hyperacetylation of this nucleosome, along with re-emergence of HIV from latency (271,

274). Although hyperacetylation is generally regarded as a mark necessary to make chromatin associated DNA accessible, it is not always the case. For instance, treating latent cells with HMBA or retinoic acid resulted in activation and remodeling of nucleosome-1 without acetylation (149, 153).

To assess whether the block to transcription is absolute due to Nuc-1, we have

inserted a proposed nucleosome exclusion sequence (NXS) into the Nuc-1 spanning region (281). This sequence was a tandem repeat of [(G/C)3NN]. As the number of

repeats increased, the stronger the signal became for excluding nucleosomes on

reconstituted templates. Using a similar approach, Zhang et al. found in yeast that

104 disrupting the nucleosome positioning within the core promoter of the RNR3 gene enhanced recruitment of pre-initiation complex (PIC) formation (311). Not surprisingly, the chromatin remodeling complex SWI/SNF became dispensable for processive transcription.

The 2 MDa human SWI/SNF complex is an ATP dependent chromatin remodeler which is highly conserved among different species. The complex is composed of multiple subunits that assemble in a cell specific manner. Of these subunits, Brm or Brg-

1, two closely related proteins, may function as the catalytic subunit of SWI/SNF (280).

Many mechanisms have been proposed to account for SWI/SNF’s ability to remodel nucleosomes (179). Ini1, another subunit of SWI/SNF, was the first subunit to be identified to interact with HIV through integrase (140). Later studies showed that the viral pre-integration complex could induce translocation of Ini1 from the nucleus to the cytoplasm (267). Although it was originally suggested that Ini1 works at the level of integration, the need for chromatin remodeling at the HIV LTR prompted some to speculate that the SWI/SNF complex may be involved in remodeling during HIV transcription. Unfortunately, reports have been inconclusive as to which catalytic subunit is actually involved. Initial studies found that one of the catalytic subunits of SWI/SNF,

Brg-1, enhanced transcription from an HIV reporter that was stably integrated into Jurkat

T cells (120). Further work from the Verdin and Emiliani labs concluded that either Brg-

1 or Brm respectively, is recruited to the HIV promoter in a Tat-dependent manner, and recruitment was dependent on acetylation of Tat at lysine 50 (189, 263). Confirming the importance of Tat acetylation to the recruitment of SWI/SNF, Easley et al. found that the

PBAF complex, structurally distinguishable by the presence of the BAF200 subunit,

105 aides in Tat activated transcription and elongation (78). Specifically, Brg-1 had the most pronounced effect.

In this study, we sought to examine, in more detail, the influence that nucleosomes, specifically Nuc-1, have to restricting transcription at an HIV provirus. We have found that inserting a G/C rich sequence that was reported to displace nucleosomes led to a delay in silencing of HIV transcription in Jurkat clones. Furthermore, the

SWI/SNF subunit, Brg-1, is found recruited to the promoter after TNF-a induction. These results imply that nucleosomes do in fact play a restrictive role in HIV transcription, and that this block must be overcome through the recruitment of nucleosome remodeling complexes.

4C Results

4C.1 The C22G Tat mutant

Studies on transcriptional elongation of HIV require the Tat protein to increase basal transcription. Some studies, specifically those that look at recruitment mediated by

Tat, fail to include an important Tat negative control. Therefore, we developed a Tat clone that is defective for elongation. The 2B2D clone was originally isolated from a mixed population of cells that were infected with an HIV lentiviral vector carrying a

C22G point mutation in Tat (Figure 21). This mutation abolishes the ability of Tat to bind TAR, thus inhibiting processive elongation (80). Initial infection of the population results in nearly a ten-fold decrease in d2EGFP+ cells compared to the wild-type control, highlighting the dependence of Tat on early transcription (Figure 21).

However, when the 2B2D clone is shutdown and stimulated overnight with TNF-

α, only a slight shift in d2EGFP expression is seen (Figure 22b). In contrast, the E4

106

clone can be reactivated efficiently, where nearly 80% of the cells become d2EGFP+

(Figure 22a). Interestingly, the 2B2D clone can be slightly more activated using the

HDACi TSA, suggesting that overcoming the heterochromatic rearrangements is crucial.

4C.2 NXS clones establish latency at a slower rate than their wild-type controls Several studies have shown that remodeling of Nuc-1 is necessary and sufficient

for reactivation of HIV from latency (149, 153, 271, 274). We wanted to test the

hypothesis that removal of Nuc-1 would prevent HIV from establishing latency. To do

this, we inserted a previously validated sequence shown to enhance the exclusion of

nucleosomes on reconstituted nucleosome templates (281). The site of insertion was

around 80 nucleotides upstream from the start site of transcription, where a HindIII

restriction enzyme site lies.

Initial infection of Jurkat cells using VSV-G pseudotyped lentivirus made from a

pNL4.3 plasmid containing this sequence showed decrease infectivity compared to wild-

type control (Figure 23). After infection with wild-type virus, 44.71% of cells become

d2EGFP+. However, with the NXS sequence, only 8.12% of cells are d2EGFP+. This

suggests that viral infectivity may be affected by this sequence. The sequence could

possibly interfere with packaging signals found within the 5’LTR that lead to production

of new virus. However, for our purposes a low level of infection is sufficient as we were

interested in monitoring individual clones for shutdown. From the d2EGFP+ population,

individual cells were sorted, expanded, and assessed bi-weekly for loss of d2EGFP expression. In comparison to the wild-type clones, the NXS clones, 2c7 and 2e8, maintain dramatically higher levels of d2EGFP expression 12 weeks post-infection

(Figure 24). The 2c7 and 2e8 clones have 98% and 95%, respectively, of the total cell

107

Figure 21 - Fresh infection of Jurkat cells with wild-type or C22G Tat. Flow cytometry of newly infected cells. Forty-eight hours after single-round infection of

Jurkat E6 cells with lentiviral vectors carrying a wild-type or C22G Tat mutant, cells were assessed for d2EGFP by flow cytometry. Experiment performed by R. Pearson,

108

Figure 22 - The 2B2D clone. Clones were plated and activated for 16 hours with either 10 ng/mL TNF-α (red line) or

500 mM TSA (green line). A) The wild-type Tat E4 clone B) The C22G Tat mutant clone

2B2D. Experiment performed by R. Pearson. Reprint permission granted by American

109 population expressing d2EGFP. However, the wild-type clones, 1h8 and 2b3, are gradually shutting down. The two wt clones are dramatically differently kinetically, yet both are losing d2EGFP+ cells, with only 60.5% d2EGFP+ and 15.8% d2EGFP+, respectively. Importantly, 1h8 was selected as a control as it was a clone that maintained higher levels of d2EGFP above the rest. Therefore, in comparison to even the slowest wild-type clone to shutdown, the NXS clones appear to be resistant to establishing latency.

The clone data was an excellent preliminary analysis on the differences in shutdown between the NXS containing proviruses, however, it fails to validate the generality of the approach. To confirm that this was a repeatable, non-clonally specific phenomenon, we once again infected cells with the NXS and wild-type virus. In addition, an important control was introduced. A sequence from the GAPDH gene that was predicted to have no preclusion towards nucleosomes was inserted into the same region as the NXS (187). As infectious titers were low in the NXS virus, individual cells were cloned for analysis.

Although it appeared that the NXS clones maintained higher levels of expression

9 weeks p.i. versus the WT and GAPDH control, the difference was not significant

(Figure 25). A two-tailed t test of NXS versus WT had a non-significant p value of .5750, while NXS versus GAPDH control had a slightly lower p value of .2875. The experiment was complicated by the fact that the wild-type clones were taking an unusually long time to shutdown, which is sometimes seen with the wild-type Tat.

Additionally, a conclusion cannot be drawn without first determining if, in fact, the

110

Figure 23 - Infection of Jurkat cells with NXS virus. Jurkat E6 cells were infected overnight with VSV-G pseudotyped wild-type (green line) or NXS (black line) containing virus. 48 hours post-infection, d2EGFP expression was analyzed through flow cytometry analysis.

111

clones have a displaced Nuc-1. However, it is also possible that our initial approach may

have just selected some unusual clones that take an extended period to shutdown. This

seems unlikely as our lab has developed many clones over the years and, in general, none

have expressed the same levels of d2EGFP 3 months post-infection as compared to initial infection levels. For these reasons, it is imperative to determine if the nucleosome had been displaced or moved in any manner using this sequence. A new approach to mapping nucleosomes was developed for this reason, which will be discussed further in the text.

4C.3 A novel nucleosome mapping approach

To determine if the nucleosome had been displaced from the start site of

transcription in the NXS clones, a novel nucleosome mapping approach was developed.

First, cells were lysed and the nuclear pellet was isolated and digested with micrococcal

nuclease (MNase/S7 nuclease). MNase is an enzyme that will digest single stranded or

double stranded DNA or RNA. Digestion results in a nucleosome ladder that is the result

of generating discrete nucleosome particles. We proposed that isolation of DNA arising

from single nucleosome protection would enable us to detect what regions are being

protected through real-time PCR. If a specific region had been protected, it would result

in PCR amplification. However, if that region were unprotected, we would see loss of

the signal.

To begin, the 2D10 clone, containing an H13L Tat, was activated for 30 minutes

with TNF-α. Activation with TNF-α has been shown to result in displacement of Nuc-1

(274). Treatment of isolated nuclear pellets with MNase resulted in a typical nucleosome

ladder (Figure 26a). Here, we show that after MNase digest, amplification of the Nuc-1

112

region is lost after TNF-α treatment (Figure 26b). Prior to activation we see an

increasing PCR signal as we approach the proposed Nuc-1 region. To further validate

this approach, we extended the primers used to span further upstream from the Nuc-1

region. Preliminary studies have suggested that Nuc-0 is also displace, perhaps to an

even higher degree than Nuc-1.

4C.4 Brg-1 recruitment to the HIV promoter

Recent reports have supported the idea that the chromatin remodeling complex

SWI/SNF is recruited to the HIV provirus following activation (78, 120, 189, 263). The

Verdin group has provided evidence that Brg-1 is the enzymatically active SWI/SNF

subunit recruited via Tat. However, Treand et al. support the conclusion that Brm is

recruited (263). Further analysis from the Kashanchi group demonstrated that the PBAF complex, the SWI/SNF complex that contains Brg-1 as its ATPase subunit, supports Tat transactivation in cell lines and primary cells (78). Therefore, our focus was to either validate or dispel these findings in our latently infected cells lines.

In Jurkat T cells, western blot analysis of Brg-1 reveals that protein levels are significantly high (Figure 27b). To assess occupancy of SWI/SNF at the HIV provirus,

ChIP experiments were performed. Following 30 minutes of TNF-α induction, RNA Pol

II was recruited to the promoter and +283 region, where +1 is the start site of transcription (Figure 27a). Strikingly, Brg-1 was also efficiently recruited to the HIV promoter and the +283 region. This data supports the idea that Brg-1, and not Brm, is critical in remodeling nucleosomes following TNF-α induction.

113

Figure 24 - Flow cytometry analysis of d2EGFP expression of clones The E6 Jurkat cell was infected with pNL4.3 virus containing either a wild-type or NXS near the nuc-1 site. After infection, individual clones were sorted from the d2EGFP+ population and maintained in culture for up to 2 months. Individual clones were monitored for shutdown through flow-cytometric analysis. FACS profiles of A) 2c7 nxs

B) 2e8 nxs C) 2b3 wt D) 1h8 WT either 4 weeks (red), 8 weeks (black), or 12 weeks

(green) post infection.

114

Figure 25 - Analysis of multiple individual clones harboring NXS. As in Figure 24, a population of Jurkat E6 cells were infected with pseudotyped virus containing either wild-type, NXS, or a GAPDH control sequence. Individual cells from the d2EGFP+ population were sorted from the initial infection and each clone was monitored for shutdown. Results depict the average of seven clones mean fluorescence intensity 9 weeks post-infection.

115

4D Discussion and Future Directions 4D.1 Nucleosomes as barriers to HIV transcription

The packaging of DNA into chromatin necessitates the use of chromatin remodeling complexes and histone chaperone proteins to allow access of transcription factors to the underlying DNA. It has been well documented that five nucleosomes are precisely positioned within the 5’ LTR of HIV, and that Nuc-1 positioning, in particular,

has the most detrimental effect to HIV transcription (271, 274). However, the positioning

of nucleosomes within HIV is not surprising, as other retroviruses have been documented to mirror the same phenomenon. For example, nucleosome deposition along the Mouse

Mammary Tumor Virus (MMTV) LTR results in exclusion of transcription factors to their cognate binding sites within the MMTV promoter and thus inhibition of transcription (119). Activation with glucocorticoid hormone results in remodeling of

Nucleosome B and subsequent transcription factor binding. Likewise, human T-cell leukemia virus (HTLV-1) Tax has been shown to overcome repressive nucleosome architecture (170).

Here, we have demonstrated, as previously reported, that HIV becomes hypersensitive to MNase at distinct regions after TNF-α induction (Figure 4).

Interestingly, the Nuc-0 region also became sensitive after induction. Based on this and the previous findings, it was of interest to determine if latency could be prevented using a

NXS. Although the initial clone studies provided some evidence that latency could be delayed or prevented with insertion of this sequence, further inspection of additional clones led us to conclude that the difference in shutdown rates was not significant. This may be due in part to the inability of wildtype virus to shutdown in a kinetically

116

Figure 26 - Mapping Nuc-1 along the HIV provirus. A) The 2D10 latent clone was activated for 30 minutes with 10 ng/mL TNF-α. Nuclei

were isolated and digested with MNase and ran through a 1% agarose gel. B) MNase

digested, purified, mononucleosome associated DNA was amplified by real-time PCR using HIV 5’ LTR primers. The diagram below indicates the relative position of nucleosomes in relation to the primers on the graph above.

117

Figure 27 - ChIP assay of Brg-1. A) Jurkat 2D10 cells were stimulated for 30 minutes with 10 ng/ml TNF-α and isolated nuclei were precipitated with antibodies to RNA Pol II or Brg-1 and prepared as previously described. B) 7 μg of protein from nuclear extracts were analysed through western blot for expression levels of Brg-1.

118 consistent manner. However, it is hard to speculate without knowing whether the nucleosome was actually displaced. As an alternative and interesting approach, a nucleosome positioning sequence (NPS) could be inserted near the NF-κB sites in the promoter. One would suspect that transcription would be shutdown almost instantaneously. Much like the approach by Osipovich et al., engineering a GAL4-Brg-1 fusion protein, along with cloning GAL4 sites in the promoter region, would allow us to determine the extent to which a nucleosome can restrict HIV transcription (217).

Additonally, it would confirm the relevance of SWI/SNF to nucleosome remodeling of

HIV.

4D.2 The SWI/SNF complex and viral replication

SWI/SNF is a multiprotein complex that can generate accessibility of nucleosome associated DNA in an ATP dependent fashion. In latency, viral DNA replication becomes governed by cellular transcriptional machinery. The requirement of SWI/SNF for replication of other viruses has been established, however, results are equally discordant. For example, in human papillomavirus (HPV), Ini1/SNF5, Brm, and the Brg-

1 subunits have been found to drive E2 dependent transcription of HPV episomal DNA

(43, 159). Additionally, the Epstein-Barr nuclear antigen 2 (EBNA2) protein associates with Ini1/SNF5, in the context of EBV infection (296). The association targets SWI/SNF to the EBNA-responsive element, however, the recruitment is not strictly dependent on

EBNA2 (297). EBV episomes lacking a TATA element failed to recruit SWI/SNF.

Taken together, this supports the strong dependence of viral transcription on cellular machinery such as SWI/SNF.

119

Although several reports have claimed that SWI/SNF is necessary for HIV

transcription, no cohesive story has emerged regarding the specific catalytic subunits that are involved. Recently, Mizutani et al. demonstrated that in resting CD4+ T cells, Brm and Brg-1 levels were low (210). Upon activation with α-CD3/CD28 antibody, Brm levels were significantly increased in comparison to Brg-1 levels in two healthy donor samples. However, studies on mouse lymphocytes revealed that Brg-1 became tightly associated with the nucleus following T cell signaling (313). Ultimately, a more thorough investigation of SWI/SNF dynamics in the human cells targeted for HIV infection, CD4+ T cells, needs to be undertaken.

As a first attempt, we sought to detect which catalytic subunit of the SWI/SNF complex gets recruited to the HIV provirus following TNF-α induction. Here, we have found that Brg-1 levels are essentially zero in the absence of activation. Following treatment, there is a dramatic increase of Brg-1 levels along with RNA Pol II. Cellular levels of Brg-1 are high in Jurkat cells. Thus, further inspection of levels of either Brg-1 or Brm in multiple donors is warranted.

The data presented here suggests that nucleosome remodeling is an essential step in reactivating viral gene expression. Manipulation of this process could result in either activation or complete restriction of HIV transcription. In theory, an approach to combating HIV is purging latent cells so that the virus can cytopathically eliminate any resting cells harboring HIV. Therefore, this approach could help develop novel therapeutic methods.

120

Acknowledgements

I would like to thank Richard Pearson, Young-Kyeung Kim, and Amy Graham for help with the preceding experiments. Part of this work was funded by the Cellular and

Molecular Biology Training Grant, (T32-GM08056).

121

Chapter 5) Future Experiments 5A Additional compounds inhibiting methylation may also reactivate HIV from

latency

Currently, DZNep has been tested as a potential therapeutic agent in the treatment

for several cancers, including breast cancer, acute myeloid leukemia, glioblastoma multiforme, and multiple myeloma (91, 117, 141, 254). As the data in this thesis supports the idea that DZNep can reactivate HIV from latency, it will be of interest to determine if there is a clinical application of DZNep in HIV treatment. In the meantime, development of this class of drugs should be further investigated to enhance its activity.

Our collaborator, Dr. David Chu, has been working on raising the efficacy of this compound. Testing the two inhibitors JJ2-75-25 and JHC-VI-8525, we have found that they are also able to reactivate HIV from latency, albeit to a lesser degree (Figure 1).

Investigating further compounds therefore is of paramount interest in defining the role these compounds may have in the therapeutic treatment of HIV.

5B Evaluating the impact of the Histone Demethylase JMJD3

Unlike the well defined dynamics of histone acetylation/deacetylation, the reversible nature of protein methylation has only somewhat recently begun to be appreciated. The discovery of the first demethylase wasn’t until 2004, when the lysine specific demethylase 1 (LSD1) was shown to be able to demethylate lysine 4 of histone

H3 (245). Later, the discovery of the demethylases JmjC domain containing protein 3

(JMJD3) and ubiquitously transcribed tetratricopeptide X (UTX) revealed that histone H3 lysine 27 was subject to demethylation as well (6, 66, 166). As we have shown here,

HIV latency can be controlled, in part, by methylation of histone H3K27. Therefore, it

122

would be of further interest to determine if the JMJD3 protein is involved in regulating

HIV transcription. We would suspect that upon activation, JMJD3 recruitment would be

required to demethylate K27. Therefore, if we took the same approach to knockdown

JMJD3 using shRNA, we would anticipate that the cells would have a severe defect in

reactivation. Currently, there are no commercially available JMJD3 inhibitors; however,

a recent study developed inhibitors of the JMJD2 class of demethylases (111).

Ultimately, what would be the advantage of developing a drug that

could inhibit viral reactivation? If viral reactivation were completely inhibited, the

spread of virus within the infected host could be prevented. Therefore, we propose that

the JMJD3 protein is a transcriptional activator of HIV that works by de-repressing heterochromatin at the provirus. Recently, an alternative role for the JMJD3 protein has arisen that may help to support the idea that JMJD3 is needed for transcriptional activation.

The T-box family of proteins has been shown to be important in developmental regulation. Most importantly, in the context of HIV, the transcription factor T-bet, a T-

box family member, has been demonstrated to be required for differentiation of naïve

CD4+ T cells into Th1 cells (257, 258). T-bet was later shown to control demethylation

of H3K27 through interactions with JMJD3 in the EL4 (murine) T cell line (205). Using

the same model of transcriptional activation, Miller et al. have demonstrated that JMJD3

is required for co-immunoprecipitation of T-bet with the Brg-1 subunit of SWI/SNF

(206). Functionally, this enables the T-bet regulated gene to undergo chromatin remodeling, and thus provides an alternative mechanism for JMJD3 in chromatin

123 alteration. As we and others have shown that Brg-1 is recruited to the HIV provirus, this data strengthens the hypothesis that JMJD3 plays a role in HIV transcription.

5C Assessing the role of protein arginine methyltransferases (PRMTs)

Protein methylation is not limited to lysine residues. The methylation mark can also occur on the amino acids arginine, histidine, and proline (293). The proteins that catalyze methylation on arginine are referred to as protein arginine methyltransferases

(PRMTs). Currently, there are 11 PRMT proteins identified to be expressed in mammalian cells (293). The PRMT enzymes can be classified into two groups; type I and type II PRMTs. While both types can monomethylate arginines, type I can also asymmetrically dimethylate and type II will symmetrically dimethylate. Kwak et al. found that Spt5, an important component of HIV transcription discussed earlier, has been found to be regulated by both the type I PRMT1 and type II PRMT5 (163). Interestingly, the same study showed that both PRMT1 and PRMT5 inhibited Tat transactivation in

HeLa cells, suggesting a negative regulatory role for both proteins. In contrast to this,

Hassa et al. found that PRMT1 could enhace transcription (115). Therefore, the role of

PRMT’s in HIV transcription is still relatively undefined.

To explore whether PRMT5 is an inhibitor or activator of HIV transcription, we infected cells with PRMT5 shRNA. The shRNA infection resulted in efficient knockdown of the protein (Figure 3). Cells that were infected with two different PRMT5 target shRNA’s both shutdown quicker after removal of stimulation (Figure 3b).

Surprisingly, both shutdown profiles of each shRNA were able to overlay, indicating this effect is reproducible and specific.

124

These preliminary findings imply that PRMT5 might have a positive role in HIV

transcription. It would be necessary to analyze which protein is the target for PRMT5,

i.e. is it Spt5 as previously reported, or something else? More studies are warranted to

determine the effects of arginine methylation on HIV transcription.

5D Investigating the Roles of SUZ12 and EED

As previously mentioned, EZH2 associates with SUZ12, EED, and RbAp46/48, in what is known as the polycomb repressive complex 2 (PRC2). The ability of EZH2 to methylate histones is dependent upon the presence and integrity of SUZ12 and EED (39,

211, 218). Furthermore, a recent study has demonstrated that EED is capable of recognizing the M3K27 mark on Histone H3 and imparting specificity to the PRC2 complex (299). Therefore, it would be of interest to repeat the approach we have taken with EZH2; however, this time we would target EED and SUZ12 using our shRNA. If knockdown of EED leads to reactivation of latent cells, as was the case with EZH2, it would be important to determine if this relationship could be attenuated to benefit HIV treatment. For example, since it has recently been discovered that EED can recognize the

M3K27 mark, could we develop a drug that inhibits this interaction, thus leading to loss of the PRC2 complex at the latent HIV provirus.

5E Determine if EZH2 is contributing to latency in primary cells

Several models of latency have been established in primary human CD4+ T cells.

Currently, our lab is trying to improve upon several of these models and obtain a greater proportion of latent T cells than those acquired in some of these approaches. The benefits of this would allow us to have enough latent primary cells to do multiple ChIP experiments and knockdowns using siRNA.

125

Figure 28 - Methylation inhibitors. The compounds JJ-2-75-25 and JHC-VI-85-25 are analogs of DZNep. They were added at increasing concentrations to E4 Jurkat clone. d2EGFP expression was analyzed through flow cytometry three days after treatment.

126

Currently, we are trying to produce latent cells by isolating CD4+ T cells from uninfected donors and expanding the cells with CD3/CD28 beads. After expansion, the cells are infected with pseudotyped pNL4.3 d2EGFP virus and maintained in either IL-2 or IL-7 and IL-15. d2EGFP+ cells are sorted and monitored for shutdown through flow cytometry. We have had moderate success thus far with this approach. However, a number of experiments need to be performed and repeated to ensure that we have a latent population.

Once this model is established, we would like to treat these cells with siRNA against EZH2 and see if the cells can reactivate. In addition, the ChIP experiments can be repeated in these cells to further validate the importance of EZH2.

127

Figure 29 - Analysis of knockdown of PRMT5. The E4 Jurkat clone was superinfected with multiple shRNA’s containing different sequences targeting knockdown of PRMT5. Cells were infected, activated overnight with 10 ng/ml TNF-α, and washed. After removal of stimulation, cells were monitored for loss of d2EGFP expression through flow cytometry every 3 hours. 15 μg of RIPA whole cell extracts of PRMT5 shRNA infected cells were analyzed for PRMT5 expression levels.

128

Chapter 6) Discussion

The work presented in this thesis sought to explore the mechanisms by which

HIV becomes and remains transcriptionally inactive after primary infection. Here we have shown that, like other latent viruses, methylation and nucleosome positioning play a pivotal role in maintaining silencing of HIV. Recent work has explored the idea of reactivating HIV from latency through mechanisms that avoid T cell activation, such as

HDACi or treatment with SAHA or HMBA (57, 58, 306). Along these lines, inhibition of methylation could also prove to be a novel and useful method for reactivating HIV from latency. Thus, investigating EZH2, and its contribution to latency, is an excellent starting point to investigate novel clinical possibilities.

The implication that EZH2 may act as a repressor of HIV transcription is not completely surprising. EZH2 mediated silencing is a well studied process, and many of the factors proposed to be involved have been implicated as elements in HIV shutdown as well. For instance, although it is not clear how EZH2 can be recruited to target genes, one suggestion is that the yin and yang 1 (YY1) protein is responsible for this (40).

Interestingly, YY1 is also a known repressor of HIV transcription through its ability to recruit HDAC1 (59, 118, 195). One could therefore propose that YY1 represses HIV transcription not only through its ability to recruit HDAC1, but also due to recruitment of

EZH2.

6A The irreversible nature of chromatin

Although once considered a static mark associated with highly repressed genes, trimethylation on H3K27 is beginning to be appreciated as a dynamic process. However,

129

mammalian, and other, cell types maintain the ability to permanently silence specific

regions of chromosomes. For example, X-inactivation is governed, in part, through the

non-coding RNA (ncRNA) Xist. One of the functions of Xist in maintaining silencing of

the inactive X-chromosome is recruiting proteins responsible for heterochromatin

formation, such as the PRC2 complex (142). Therefore, H3K27 trimethylation does

provide help in maintaining permanent silencing of genes. In addition, human

endogenous retroviruses (HERVs), if expressed, can have deleterious effects to the cell.

For example, in certain cancers, expression of HERV’s is found to correlate with loss of promoter methylation (241). Heterochromatin formation is one approach eukaryotic cells have taken to silence HERVs (190). It seems clear that the eukaryotic cell has devised multiple mechanisms to permanently silence genes. If this is the case, could HIV also be permanently silenced, thus becoming a HERV?

To answer this question, researchers must first begin to understand the complex layer of events that occurs to permanently silence a gene. HIV is an excellent tool for this type of analysis. For example, upon initial infection, there are d2EGFP+ and d2EGFP- populations. Although the d2EGFP- population could be due to uninfected cells, it may also represent a population of cells that were shut down immediately. The J-

Lat clones seem to exemplify this phenomenon (138). Recently, Blazkova et al. demonstrated that promoter methylation was a late event in HIV latency (26).

Furthermore, latent proviruses that were hypermethylated tended to be more resistant to activation stimuli. Taken together, this suggests that there may be a step-wise process that could ultimately lead to permanent silencing.

130

Expanding upon the approach of Blazkova et al., an iterative cell-sorting scheme could be set up in which multiple d2EGFP- populations are isolated. From these populations, a thorough analysis of the contributions of different heterochromatin associated proteins could be assessed. One would suspect that if there is a hierarchical scheme, it would be detectable through this iterative process. For example, if one were to isolate the d2EGFP- population and assess for Protein A (a hypothetical heterochromatin associated protein), we would suspect that the third iteration would lead to the

accumulation of Protein A and Protein B and so forth throughout. Not only would this

give a detailed analysis of the shutdown process of HIV, but it would also enlighten the

scientific community as to the steps necessary for permanent, if possible, silencing.

6B Conclusions

In this thesis, we have demonstrated that silencing of HIV transcription is

governed, in part, by the negative effects of chromatin and heterochromatin formation.

Understanding the mechanisms that result in latency is of vital importance in the

development of novel approaches to treat HIV+ patients. This specific investigation has

led to the discovery that EZH2 is important in maintaining latency of the HIV provirus.

Thus, with this, came the additional finding that a chemical inhibitor of EZH2 can be

used to induce reactivation of latent cells. As such, our investigation developed an idea

that inhibiting histone methylation could induce transcriptional activation of latent HIV

proviruses and thus could be an attractive approach for the treatment of this disease.

131

Appendix

Figure 1 Order Details Licensee: Julia H Friedman License Date: Dec 01, 2010 License Number: 2560510161363 Publication: Immunology and Cell Biology Title: Acutely dysregulated, chronically disabled by the enemy within: T-cell responses to HIV-1 infection Type Of Use: Thesis / Dissertation Total: $0.00

Figure 3 Order Details Licensee: Julia H Friedman License Date: Nov 29, 2010 License Number: 2558501178012 Publication: Antiviral Research Title: Entry inhibitors in the treatment of HIV-1 infection Type Of Use: reuse in a thesis/dissertation Total: 0.00 USD

Figure 4 Order Details Licensee: Julia H Friedman License Date: Nov 22, 2010 License Number: 2554501193448 Publication: Cellular and Molecular Life Sciences Title: Retroviral reverse transcriptases Type Of Use: Thesis/Dissertation Total: 0.00 USD

Figure 5 Order Details Licensee: Julia H Friedman License Date: Nov 06, 2010 License Number: 2543151395580 Publication: Immunological Reviews Title: Circuitry of nuclear factor ÎºB signaling Type Of Use: Dissertation/Thesis Total: 0.00 USD

Figure 7 Order Details Licensee: Julia H Friedman License Date: Nov 22, 2010 License Number: 2554311343507 Publication: Mutation Research/Fundamental and Molecular Mechanisms of

132

Mutagenesis Title: Roles of the EZH2 histone methyltransferase in cancer epigenetics Type Of Use: reuse in a thesis/dissertation Total: 0.00 USD

Figure 17 Order Details Licensee: Julia H Friedman License Date: Nov 23, 2010 License Number: 2554811464895 Publication: Molecular Cell Title: Reversal of H3K9me2 by a Small-Molecule Inhibitor for the G9a Histone Methyltransferase Type Of Use: reuse in a thesis/dissertation Total: 0.00 USD

Figure 17 Order Details Licensee: Julia H Friedman License Date: Nov 23, 2010 License Number: 2554821354543 Publication: Nature Chemical Biology Title: Identification of a specific inhibitor of the histone methyltransferase SU(VAR)3-9 Type Of Use: Thesis / Dissertation Total: $0.00

Figure 21 and 22 Order Details Licensee: Julia H Friedman License Date: Dec 02, 2010 License Number: 2560910851934 Publication: Journal of Virology Title: Epigenetic Silencing of Human Immunodeficiency Virus (HIV) Transcription by Formation of Restrictive Chromatin Structures at the Viral Long Terminal Repeat Drives the Progressive Entry of HIV into Latency Type Of Use: Presentation Material/Handout/Poster Total: 0.00 USD

133

References

1. 1981. Kaposi's Sarcoma and Pneumocystis Pneumonia among Homosexual Men-New York City and California. MMWR Weekly 30:305-308. 2. 1981. Pneumocystis Pneumonia-Los Angeles. MMWR Weekly 30:1-3. 3. Adams, M., L. Sharmeen, J. Kimpton, J. M. Romeo, J. V. Garcia, B. M. Peterlin, M. Groudine, and M. Emerman. 1994. Cellular latency in human immunodeficiency virus-infected individuals with high CD4 levels can be detected by the presence of promoter-proximal transcripts. Proc. Natl. Acad. Sci. U S A 91:3862-3866. 4. Adamson, C. S., and E. O. Freed. 2010. Novel approaches to inhibiting HIV-1 replication. Antiviral Research 85:119-141. 5. Adamson, C. S., M. Sakalian, K. Salzwedel, and E. O. Freed. 2010. Polymorphisms in Gag spacer peptide 1 confer varying levels of resistance to the HIV-1 maturation inhibitor bevirimat. Retrovirology 7:1-8. 6. Agger, K., P. A. C. Cloos, J. Christensen, D. Pasini, S. Rose, J. Rappsilber, I. Issaeva, E. Canaani, A. E. Salcini, and K. Helin. 2007. UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature 449:731-735. 7. Antoni, B. A., A. B. Rabson, A. Kinter, M. Bodkin, and G. Poli. 1994. NF- kappa B-dependent and -independent pathways of HIV activation in a chronically infected T cell line. Virology 202:684-694. 8. Ao, Z., K. Danappa Jayappa, B. Wang, Y. Zheng, S. Kung, E. Rassart, R. Depping, M. Kohler, E. A. Cohen, and X. Yao. 2010. Importin alpha3 interacts with HIV-1 integrase and contributes to HIV-1 nuclear import and replication. Journal of Virology 84:8650-8663. 9. Archin, N., Keedy, KS, Espeseth, A., Dang, H., Hazuda, DJ., Margolis, DM. 2009. Expression of latent human immunodeficiency type 1is induced by novel and selective histone deacetylase inhibitors. AIDS 23:1799-1806. 10. Archin, N. M., J. J. Eron, S. Palmer, A. Hartmann-Duff, J. A. Martinson, A. Wiegand, N. Bandarenko, J. L. Schmitz, R. J. Bosch, A. L. Landay, J. M. Coffin, and D. M. Margolis. 2008. Valproic acid without intensified antiviral therapy has limited impact on persistent HIV infection of resting CD4+ T cells. . AIDS 22:1131–1135. 11. Archin, N. M., A. Espeseth, D. Parker, M. Cheema, D. Hazuda, and D. M. Margolis. 2009. Expression of latent HIV induced by the potent HDAC inhibitor suberoylanilide hydroxamic acid. AIDS Res. Hum. Retroviruses 25:207-12. 12. Arhel, N. J., S. Souquere-Besse, S. Munier, P. Souque, S. Guadagnini, S. Rutherford, M. C. Prevost, T. D. Allen, and P. Charneau. 2007. HIV-1 DNA Flap formation promotes uncoating of the pre-integration complex at the nuclear pore. EMBO J 26:3025-3037. 13. Ashorn, P., T. J. McQuade, S. Thaisrivongs, A. G. Tomasselli, W. G. Tarpley, and B. Mosss. 1990. An inihibitor of the protease block maturation

134

of human and simian immunodeficiency viruses and spread of infection. Proc. Natl. Acad. Sci. U S A 87:7472-7476. 14. Askjaer, P., T. H. Jensen, J. Nilsson, L. Englmeier, and J. Kjems. 1998. The specificity of the CRM1-Rev nuclear export signal interaction is mediated by RanGTP. J. Biol. Chem. 273:33414-33422. 15. Baba, T. W., V. Liska, A. H. Khimani, N. B. Ray, P. J. Dailey, D. R. Penninck, R. Bronson, M. F. Greene, H. M. McClure, L. N. Martin, and R. M. Ruprecht. 1999. Live attenuated, multiply deleted simian immunodeficiency virus causes AIDS in infant and adult macaques. Nature Medicine 5:194-203. 16. Baltimore, D. 1970. RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature 226:1209-1211. 17. Barboric, M., J. Kohoutek, J. P. Price, D. Blazek, D. H. Price, and B. M. Peterlin. 2005. Interplay between 7SK snRNA and oppositely charged regions in HEXIM1 direct the inhibition of P-TEFb. EMBO J. 24:4291-303. 18. Barbour, J. D., and R. M. Grant. 2005. The Role of Viral Fitness in HIV pathogenesis. Current HIV/AIDS Reports 2:29-34. 19. Barre-Sinoussi, F., J.-C. Chermann, F. Rey, M. T. Nugeyre, S. Chamaret, J. Gruest, C. Dauguet, C. Axler-Blin, F. Brun-Vezinet, C. Rouzioux, W. Rozenbaum, and L. Montagnier. 1983. Isolation of a T-Lymphotrophic retrovirus from a patient at risk for Acquired Immune Deficiency Syndrome (AIDS). Science 220:868-871. 20. Bassuk, A. G., R. T. Anandappa, and J. M. Leiden. 1997. Physical interactions between Ets and NF-κB/NFAT Proteins Play an important role in Their cooperative activation of the human immunodeficiency virus enhancer in T cells. J. Virol. 71:3563–3573. 21. Benkirane, M., R. F. Chun, H. Xiao, V. V. Ogryzko, B. H. Howard, Y. Nakatani, and K.-T. Jeang. 1998. Activation of integrated provirus requires histone acetyltransferase: p300 and p/CAF are coactivators for HIV-1 Tat. J. Biol. Chem. 273:24989-24905. 22. Bennasser, Y., S. Y. Le, M. Benkirane, and K. T. Jeang. 2005. Evidence that HIV-1 encodes an siRNA and a suppressor of RNA silencing. Immunity 22:607-19. 23. Bieniasz, P. D. 2006. Late budding domains and host proteins in enveloped virus release. Virology 344:55-63. 24. Binley, J. M., S. Ngo-Abdalla, P. Moore, M. Bobardt, U. Chatterji, P. Gallay, D. R. Burton, I. A. Wilson, J. H. Elder, and A. de Parseval. 2006. Inhibition of HIV Env binding to cellular receptors by monoclonal antibody 2G12 as probed by Fc-tagged gp120. Retrovirology 3:39. 25. Bird, A. 2002. DNA methylation patterns and epigenetic memory. Genes and Development 16:6-21. 26. Blazkova, J., K. Trejbalova, F. Gondois-Rey, P. Halfon, P. Philibert, A. Guiguen, E. Verdin, D. Olive, C. Van Lint, J. Hejnar, and I. Hirsch. 2009. CpG methylation controls reactivation of HIV from latency. PLoS Pathog. 5:e1000554. 27. Bonasio, R., S. Tu, and D. Reinberg. 2010. Molecular signals of epigenetic states. Science 330:612-616. 135

28. Bosque, A., and V. Planelles. 2009. Induction of HIV-1 latency and reactivation in primary memory CD4+ T cells. Blood 113:58-65. 29. Bourgeois, C. F., Y. K. Kim, M. J. Churcher, M. J. West, and J. Karn. 2002. Spt5 cooperates with Tat by preventing premature RNA release at terminator sequences. Mol. Cell. Biol. 22:1079-1093. 30. Bouyac-Bertoia, M., J. D. Dvorin, R. A. Fouchier, Y. Jenkins, B. E. Meyer, L. I. Wu, M. Emerman, and M. H. Malim. 2001. HIV-1 infection requires a functional integrase NLS. Molecular Cell 7:1025-1035. 31. Braathen, L. R., G. Ramirez, R. O. Kunze, and H. Gelderblom. 1987. Langerhans cells as primary target cells for HIV infection. Lancet 2:1094. 32. Brass, A. L., D. M. Dykxhoorn, Y. Benita, N. Yan, A. Engelman, R. J. Xavier, J. Lieberman, and S. J. Elledge. 2008. Identification of host proteins required for HIV infection through a functional genomic screen. Science 319:921-6. 33. Brooks, D. G., S. G. Kitchen, C. M. Kitchen, D. D. Scripture-Adams, and J. A. Zack. 2001. Generation of HIV latency during thymopoiesis. Nat. Med. 7:459- 64. 34. Bukrinsky, M. I., N. Sharova, T. L. McDonald, T. Pushkarskaya, W. G. Tarpley, and M. Stevenson. 1993. Association of integrase, matrix and reverse transcriptase antigens of human immunodeficiency virus type 1 with viral nucleic acids following acute infection. Proc. Natl. Acad. Sci. U S A 90:6125-6129. 35. Bukrinsky, M. I., T. L. Stanwick, M. P. Dempsey, and M. Stevenson. 1991. Quiescent T lymphocytes as an inducible virus reservoir in HIV-1 infection. Science 254:423–427. 36. Burnett, J. C., K.-i. Lim, A. Calafi, J. J. Rossi, D. V. Schaffer, and A. P. Arkin. 2010. Combinatorial Latency Reactivation for HIV-1 Subtypes and Variants. Journal of Virology. 37. Cao, R., L. Wang, H. Wang, L. Xia, H. Erdjument-Bromage, P. Tempst, R. S. Jones, and Y. Zhang. 2002. Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 298:1039-1043. 38. Cao, R., and Y. Zhang. 2004. The functions of E(Z)/EZH2-mediated methylation of lysine 27 in histone H#. Current Opinion in Genetics and Development 14:155-164. 39. Cao, R., and Y. Zhang. 2004. SUZ12 is required for both the histone methyltransferase activity and the silencing function of the EED-EZH2 complex. Molecular Cell 15:57-67. 40. Caretti, G., M. Di Padova, B. Micales, G. E. Lyons, and V. Sartorelli. 2004. The Polycomb Ezh2 methyltransferase regulates muscle gene expression and skeletal muscle differentiation. Genes and Development 18:2627-2638. 41. Carr, A. 2003. Toxicity of antiretroviral therapy and implications for drug development. Nature Reviews Drug Discovery 2:624-634. 42. Cavrois, M., J. Neidleman, J. F. Kreisberg, and W. C. Greene. 2007. In vitro derived dendritic cells trans-infect CD4 T cells primarily with surface-bound HIV-1 virions. PLoS Pathog. 3:e4.

136

43. Cha, S., and T. Seo. 2010. hSNF5 is Required for Human Papillomavirus E2- Driven Transcriptional Activation and DNA Replication. Intervirology 54:66- 77. 44. Chan, D. C., D. Fass, J. M. Berger, and P. S. Kim. 1997. Core structure of gp41 from the HIV envelope glycoprotein. Cell 89:263-273. 45. Chen, B., E. M. Vogan, H. Gong, J. J. Skehel, D. C. Wiley, and S. C. Harrison. 2005. Structure of an unliganded simian immunodeficiency virus gp120 core. Nature 433:834-41. 46. Chen, L. F., and W. C. Greene. 2004. Shaping the nuclear action of NF- kappaB. Nat. Rev. Mol. Cell. Biol. 5:392-401. 47. Cherrier, T., S. Suzanne, L. Redel, M. Calao, C. Marban, B. Samah, R. Mukerjee, C. Schwartz, G. Gras, B. E. Sawaya, S. L. Zeichner, D. Aunis, C. Van Lint, and O. Rohr. 2009. p21(WAF1) gene promoter is epigenetically silenced by CTIP2 and SUV39H1. Oncogene 28:3380-9. 48. Chiang, P. K., and G. L. Cantoni. 1979. Perturbation of biochemical transmethylations by 3-dezazadenosine in vivo. Biochemical Pharmacology 28:1897-1902. 49. Chomont, N., M. El-Far, P. Ancuta, L. Trautmann, F. A. Procopio, B. Yassine-Diab, G. Boucher, M. R. Boulassel, G. Ghattas, J. M. Brenchley, T. W. Schacker, B. J. Hill, D. C. Douek, J. P. Routy, E. K. Haddad, and R. P. Sekaly. 2009. HIV reservoir size and persistence are driven by T cell survival and homeostatic proliferation. Nat. Med. 15:893-900. 50. Choudhary, S. K., N. M. Archin, and D. M. Margolis. 2008. Hexamethylbisacetamide and disruption of human immunodeficiency virus type 1 latency in CD4(+) T cells. J. Infect. Dis. 197:1162-70. 51. Chun, T.-W., D. Engel, M. M. Berrey, T. Shea, L. Corey, and A. S. Fauci. 1998. Early establishment of a pool of latently infected, resting CD4(+) T cells during primary HIV-1 infection. Proc. Natl. Acad. Sci. U S A 95:8869-73. 52. Chun, T.-W., D. C. Nickle, J. S. Justement, D. Large, A. Semerjian, M. E. Curlin, M. A. O’Shea, C. W. Hallahan, M. Daucher, D. J. Ward, S. Moir, J. I. Mullins, C. Kovacs, and A. S. Fauci. 2005. HIV-infected individuals receiving effective antiviral therapy for extended periods of time continually replenish their viral reservoir. The Journal of Clinical Investigation 115:3250-3255. 53. Chun, T. W., L. Stuyver, S. B. Mizell, L. A. Ehler, J. A. Mican, M. Baseler, A. L. Lloyd, M. A. Nowak, and A. S. Fauci. 1997. Presence of an inducible HIV-1 latent reservoir during highly active antiretroviral therapy. Proc. Natl. Acad. Sci. U S A 94:13193-7. 54. Ciuffi, A., M. Llano, E. Poeschla, C. Hoffmann, J. Leipzig, P. Shinn, J. R. Ecker, and F. Bushman. 2005. A role for LEDGF/p75 in targeting HIV DNA integration. Nat. Med. 11:1287-9. 55. Cochrane, A., R. Kramer, S. Ruben, J. Levine, and C. A. Rosen. 1989. The human immunodeficiency virus Rev protein is a nuclear phosphoprotein. Virology 171:264-266. 56. Col, E., C. Caron, D. Seigneurin-Berny, J. Gracia, A. Favier, and S. Khochbin. 2001. The histone acetyltransferase, hGCN5, interacts with and

137

acetylates the HIV transactivator, Tat. Journal of Biological Chemistry 276:28179-28184. 57. Contreras, X., M. Barboric, T. Lenasi, and B. M. Peterlin. 2007. HMBA releases P-TEFb from HEXIM1 and 7SK snRNA via PI3K/Akt and activates HIV transcription. PLoS Pathog. 3:1459-69. 58. Contreras, X., M. Schweneker, C. S. Chen, J. M. McCune, S. G. Deeks, J. Martin, and B. M. Peterlin. 2009. Suberoylanilide hydroxamic acid reactivates HIV from latently infected cells. J. Biol. Chem. 284:6782-9. 59. Coull, J. J., F. Romerio, J. M. Sun, J. L. Volker, K. M. Galvin, J. R. Davie, Y. Shi, U. Hansen, and D. M. Margolis. 2000. The human factors YY1 and LSF repress the human immunodeficiency virus type 1 long terminal repeat via recruitment of histone deacetylase 1. J. Virol. 74:6790-9. 60. Crabtree, G. R. 1999. Generic Signals and Specific Outcomes: Signaling through Ca2+, Calcineurin, and NF-AT. Cell 96:611-614. 61. Craigie, R. 2001. HIV integrase, a brief overview from chemistry to therapeutics. J. Biol. Chem. 276:23213-23216. 62. Cron, R. Q., S. R. Bartz, A. Clausell, S. J. Bort, S. J. Klebanoff, and D. B. Lewis. 2000. NFAT1 enhances HIV-1 gene expression in primary human CD4 T cells. Clin. Immunol. 94:179-191. 63. Cujec, T. P., H. Okamoto, K. Fujinaga, J. Meyer, H. Chamberlin, D. O. Morgan, and B. M. Peterlin. 1997. The HIV trans-activator Tat binds to the CDK-activating kinase and activates the phosphorylation of the carboxy- terinal domain of RNA polymerase II. Genes Dev. 11:2645-2657. 64. Daelemans, D., E. Afonina, J. Nilsson, G. Werner, J. Kjems, E. De Clercq, G. N. Pavlakis, and A. M. Vandamme. 2002. A synthetic HIV-1 Rev inhibitor interfering with the CRM1-mediated nuclear export. Proceedings of the National Academy of Sciences 99:14440-14445. 65. Dapp, M. J., C. L. Clouser, S. Patterson, and L. M. Mansky. 2009. 5- Azacytidine can induce lethal mutagenesis in human immunodeficiency virus type 1. Journal of Virology 83:11950-11958. 66. De Santa, F., M. G. Totaro, E. Prosperini, S. Notarbartolo, G. Testa, and G. Natoli. 2007. The Histone H3 Lysine-27 Demethylase Jmjd3 Links Inflammation to Inhibition of Polycomb-Mediated Gene Silencing. Cell 130:1083-1094. 67. Demarchi, F., P. D'Agaro, A. Falaschi, and M. Giacca. 1992. Probing protein-DNA interactions at the long terminal repeat of human immunodeficiency virus type 1 by in vivo footprinting. J. Virol. 66:2514- 2518. 68. Demi, L., C. Speth, M. P. Dierich, H. Wolf, and R. Wagner. 2005. Recombinant HIV-1 Pr55gag virus-like particles: potent stimulators of innate and acquired immune responses. Molecular Immunology 42:259-277. 69. Demirov, D. G., A. Ono, J. M. Orenstein, and E. O. Freed. 2002. Overexpression of the N-terminal domain of TSG101 inhibits HIV-1 budding by blocking late domain function. Proceedings of the National Academy of Sciences 99:955-960.

138

70. Deng, H., L. Rong, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. D. Marzio, S. Marmon, R. E. Sutton, C. M. Hill, C. B. Davis, S. C. Peiper, T. J. Schall, D. R. Littman, and N. R. Landau. 1996. Identification of a major co- receptor for primary isolates of HIV-1. Nature 381:661-666. 71. Depienne, C., P. Roques, C. Creminon, F. L., R. Casseron, D. Dormont, C. Dargemont, and S. Benichou. 2000. Cellular distribution and karyophilic properties of matrix, integrase, and Vpr proteins from the human and simian immunodeficiency viruses. Experimental Cell Research 260:387-395. 72. Dewar, R. L., M. B. Vasudevachari, V. Natarajan, and N. P. Salzman. 1989. Biosynthesis and processing of human immunodeficiency virus type 1 envelope glycoproteins: Effects of monensin on glycosylation and transport. J. Virol. 63:2452-2456. 73. Dinoso, J. B., S. Y. Kim, A. M. Wiegand, S. E. Palmer, S. J. Gange, L. Cranmer, A. O'Shea, M. Callender, A. Spivak, T. Brennan, M. F. Kearney, M. A. Proschan, J. M. Mican, C. A. Rehm, J. M. Coffin, J. W. Mellors, R. F. Siliciano, and F. Maldarelli. 2009. Treatment intensification does not reduce residual HIV-1 viremia in patients on highly active antiretroviral therapy. Proc. Natl. Acad. Sci. U S A 106:9403-8. 74. Doranz, B. J., J. Rucker, Y. Yi, R. J. Smyth, M. Samson, S. C. Peiper, M. Parmentier, R. G. Collman, and R. W. Doms. 1996. A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR- 3, and CKR-2b as fusion cofactors. Cell 85:1149-1158. 75. Dragic, T., V. Litwin, G. P. Allaway, S. R. Martin, Y. Huang, K. A. Nagasima, C. Cayanan, P. J. Maddon, R. A. Koup, J. P. Moore, and W. A. Paxton. 1996. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR- 5. Nature 381:667-673. 76. du Chene, I., E. Basyuk, Y. L. Lin, R. Triboulet, A. Knezevich, C. Chable- Bessia, C. Mettling, V. Baillat, J. Reynes, P. Corbeau, E. Bertrand, A. Marcello, S. Emiliani, R. Kiernan, and M. Benkirane. 2007. Suv39H1 and HP1gamma are responsible for chromatin-mediated HIV-1 transcriptional silencing and post-integration latency. EMBO J. 26:424-35. 77. Duh, E. J., W. J. Maury, T. M. Foks, A. S. Fauci, and A. B. Rabson. 1989. Tumor necrosis factor alpha activates human immunodeficiency virus type 1 through induction of nuclear factor binding to the NF-kappa B sites in the long terminal repeat. Proceedings of the National Academy of Sciences 86:5974-5978. 78. Easley, R., L. Carpio, L. Dannenberg, S. Choi, D. Alani, R. Van Duyne, I. Guendel, Z. Klase, E. Agbottah, K. Kehn-Hall, and F. Kashanchi. 2010. Transcription through the HIV-1 nucleosomes: Effects of the PBAF complex in Tat activated transcription. Virology 405:322-333. 79. Edelstein, L. C., S. Micheva-Viteva, B. D. Phelan, and J. P. Dougherty. 2009. Short communication: activation of latent HIV type 1 gene expression by suberoylanilide hydroxamic acid (SAHA), an HDAC inhibitor approved for use to treat cutaneous T cell lymphoma. AIDS Res. Hum. Retroviruses 25:883-7.

139

80. Emiliani, S., W. Fischle, M. Ott, C. van Lint, C. A. Amella, and E. Verdin. 1998. Mutations in the Tat gene are responsible for human immunodeficiency virust type 1 postintegration latency in the U1 cell line. J. Virol. 72:1666-1670. 81. Emiliani, S., C. van Lint, W. Fischle, P. J. Paras, M. Ott, J. Brady, and E. Verdin. 1996. A point mutation in the HIV-1 Tat responsive element is associated with postintegration latency. Proc. Natl. Acad. Sci. U S A 93:6377- 6381. 82. Farnet, C. M., and F. D. Bushman. 1997. HIV-1 cDNA integration: requirement of HMG I(Y) protein for function of preintegration complexes in vitro Cell 88:483-492. 83. Farnet, C. M., and W. A. Haseltine. 1991. Determination of viral proteins present in the human immunodeficiency virus type 1 preintegration complex. J. Virol. 65:1910-1915. 84. Feng, S., and E. C. Holland. 1988. HIV-1 Tat trans-activation requires the loop sequence within TAR. Nature 334:165-168. 85. Feorinio, P. M., V. S. Kalyanaraman, and H. W. Haverkos. 1984. Lymphadenopathy associated virus infection of a blood donor-recipient pair with acquired immunodeficiency syndrome. Science 225:69-72. 86. Fernandez, G., and S. L. Zeichner. 2010. Cell line-dependent variability in HIV activation employing DNMT inhibitors. Virology Journal 7:266. 87. Ferris, A. L., X. Wu, C. M. Hughes, C. Stewart, S. J. Smith, T. A. Milne, G. G. Wang, M. C. Shun, C. D. Allis, A. Engelman, and S. H. Hughes. 2010. Lens epithelium-derived growth factor fusion proteins redirect HIV-1 DNA integration. Proceedings of the National Academy of Sciences 107:3135- 3140. 88. Finzi, D., J. Blankson, J. D. Siliciano, J. B. Margolick, K. Chadwick, T. Pierson, K. Smith, J. Lisziewicz, F. Lori, C. Flexner, T. C. Quinn, R. E. Chaisson, E. Rosenberg, B. Walker, S. Gange, J. Gallant, and R. F. Siliciano. 1999. Latent infection of CD4+ T cells provides a mechanism for lifelong persistence of HIV-1, even in patients on effective combination therapy. Nat. Med. 5:512-7. 89. Finzi, D., M. Hermankova, T. Pierson, L. M. Carruth, C. Buck, R. E. Chaisson, T. C. Quinn, K. Chadwick, J. Margolick, R. Brookmeyer, J. Gallant, M. Markowitz, D. D. Ho, D. D. Richman, and R. F. Siliciano. 1997. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science 278:1295-300. 90. Fischinger, P. J., W. G. Robey, H. Koprowski, R. C. Gallo, and D. P. Bolognesi. 1985. Current Status and Strategies for Vaccines against Diseases Induced by Human T-Cel Lymphotropic Retroviruses (HTLV-I,-II,III). Cancer Research 45:4694s-4699s. 91. Fiskus, W., Y. Wang, A. Sreekumar, K. M. Buckley, H. Shi, A. Jillella, C. Ustun, R. Rao, P. Fernandez, J. Chen, R. Balusu, S. Koul, P. Atadja, V. E. Marquez, and K. N. Bhalla. 2009. Combined epigenetic therapy with the histone methyltransferase EZH2 inhibitor 3-deazanoplanocin A and the

140

histone deacetylase inhibitor panobinostat against human AML cells. Blood 114:2733-2743. 92. Flynn, N. M., D. N. Forthal, C. D. Harro, F. N. Judson, K. H. Mayer, and M. F. Para. 2005. Placebo-controlled phase 3 trial of a recombinant glycoprotein 120 vaccine to prevent HIV-1 infection. Journal of Infectious Disease 191:654-665. 93. Folks, T. M., K. A. Clouse, J. Justement, A. B. Rabson, E. J. Duh, J. H. Kehrl, and A. S. Fauci. 1989. Tumor necrosis factor alpha induces expression of human immunodeficiency virus in a chronically infected T-cell clone. Proceedings of the National Academy of Sciences 86:2365-2368. 94. Folks, T. M., J. Justement, A. Kinter, S. Schnittman, J. Orenstein, G. Poli, and A. S. Fauci. 1988. Characterization of a Promonocyte Clone Chronically Infected with Hiv and Inducible by 13-Phorbol-12-Myristate Acetate. Journal of Immunology 140:1117-1122. 95. Fortin, J. F., B. Barbeau, G. A. Robichaud, M. E. Pare, A. M. Lemieux, and M. J. Tremblay. 2001. Regulation of nuclear factor of activated T cells by phsophotyrosyl-specific phosphatase activity: a positive effect on HIV-1 long terminal repeat-driven transcription and a possible implication of SHP-1. Blood 97:2390-2400. 96. Fujii, K., J. H. Hurley, and E. O. Freed. 2007. Beyond Tsg101: the role of Alix in 'ESCRTing' HIV-1. Nature Reviews Microbiology 5:912-916. 97. Fujinaga, K., D. Irwin, Y. Huang, R. Taube, T. Kurosu, and B. M. Peterlin. 2004. Dynamics of human immunodeficiency virus transcription: P-TEFb phosphorylates RD and dissociates negative effectors from the transactivation response element. Mol. Cell. Biol. 24:787-795. 98. Fujita, M., M. Otsuka, M. Nomaguchi, and A. Adachi. 2010. Multifaceted activity of HIV Vpr/Vpx proteins: the current view of their virological functions. Reviews in Medical Virology 20:68-76. 99. Gallay, P., T. Hope, D. Chin, and D. Trono. 1997. HIV-1 infection of nondividng cells through the recognition of integrase by the importin/karyopherin pathway. Proceedings of the National Academy of Sciences 94:9825-9830. 100. Gallay, P., V. Stitt, C. Mundy, M. Oettinger, and D. Trono. 1996. Role of the karyopherin pathway in human immunodeficiency virus type 1 nuclear import. Journal of Virology 70:1027-1032. 101. Gao, W. Y., A. Cara, R. C. Gallo, and F. Lori. 1993. Low levels of deoxynucleotides in peripheral blood lymphocytes: a strategy to inhibit human immunodeficiency virus type 1 replication. Proceedings of the National Academy of Sciences 90:8925-8928. 102. Garcia, J. V., and A. D. Miller. 1991. Serine phosphorylation-independent downregulation of cell-surface CD4 by nef. Nature 350:508-511. 103. Garrus, J. E., U. K. von Schwelder, O. W. Pornillos, S. G. Morham, K. H. Zavitz, H. E. Wang, D. A. Wettstein, K. M. Stray, M. Cote, R. L. Rich, D. G. Myszka, and W. I. Sundquist. 2001. Tsg101 and the vacuolar protein sorting pathway are essential for hiv-1 budding. Cell 107:55-65.

141

104. Gordon, R. K., K. Ginalski, W. R. Rudnicki, L. Rychlewski, M. C. Pankaskie, J. M. Bujnicki, and P. K. Chiang. 2003. Anti-HIV-1 activity of 3-deazaadenosine analogs: Inhibition of S-adenosylhomocysteine hydrolase and nucleotide congeners. European Journal of Biochemistry 270. 105. Gottlinger, H. G., T. Dorfman, J. G. Sodroski, and W. A. Haseltine. 1991. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences 88:3195-3199. 106. Greger, I. H., F. Demarchi, M. Giacca, and N. J. Proudfoot. 1998. Transcriptional interference perturbs the binding of Sp1 to the HIV-1 promoter. Nucleic Acids Research 26:1294-1301. 107. Greiner, D., T. Bonaldi, R. Eskeland, E. Roemer, and A. Imhof. 2005. Identification of a specific inhibitor of the histone methyltransferase SU(VAR)3-9. Nature Chemical Biology 1:143-145. 108. Grinsztejn, B., B.-Y. Nguyen, C. Katlama, J. M. Gatell, A. Lazzarin, D. Vittecoq, C. J. Gonzalez, J. Chen, C. Harvey, and R. D. Isaacs. 2007. Safety and efficacy of the HIV-1integrase inhibitor raltegravir (MK-0518) in treatment-experienced patients with multidrug-resistant virus: a phase II randomised controlled trial. The Lancet 369:1261-1269. 109. Gunther, T., and A. Grundhoff. 2010. The epigenetic landscape of latent Kaposi sarcoma-associated herpesvirus genomes. PLoS Pathog. 6:e1000935. 110. Haffar, O. K., S. Popov, L. Dubrovksy, I. Agostini, H. Tang, T. Pushkarsky, S. G. Nadler, and M. Bukrinsky. 2000. Two nuclear localization signals in the HIV-1 matrix protein regulate nuclear import of the HIV-1 preintegration complex. Journal of Molecular Biology 299:359-368. 111. Hamada, S., T. Suzuki, K. Mino, K. Koseki, F. Oehme, I. Flamme, H. Ozasa, Y. Itoh, D. Ogasawara, H. Komaarashi, A. Kato, H. Tsumoto, H. Nakagawa, M. Hasegawa, R. Sasaki, T. Mitzukami, and N. Miyata. 2010. Design, synthesis, enzyme-inhibitory activity, and effect on human cancer cells of a novel series of jumonji doman-containing protein 2 histone demethylse inhibitors. Journal of Medicinal Chemistry 53:5629-5638. 112. Han, Y., K. Lassen, D. Monie, A. R. Sedaghat, S. Shimoji, X. Liu, T. C. Pierson, J. B. Margolick, R. F. Siliciano, and J. D. Siliciano. 2004. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. J. Virol. 78:6122-33. 113. Han, Y., Y. B. Lin, W. An, J. Xu, H. C. Yang, K. O'Connell, D. Dordai, J. D. Boeke, J. D. Siliciano, and R. F. Siliciano. 2008. Orientation-dependent regulation of integrated HIV-1 expression by host gene transcriptional readthrough. Cell Host Microbe 4:134-46. 114. Hansen, K. H., A. P. Bracken, D. Pasini, N. Dietrich, S. S. Gehani, A. Monrad, J. Rappsilber, M. Lerdrup, and K. Helin. 2008. A model for transmission of the H3K27me3 epigenetic mark. Nature Cell Biology 10:1291-1300. 115. Hassa, P. O., M. Covic, M. T. Bedford, and M. O. Hottiger. 2008. Protein arginine methyltransferase 1 coactivates NF-κB-dependent gene expression 142

synergistically with CARM1 and PARP1. Journal of Molecular Biology 377:668-678. 116. Hatziioannou, T., Z. Ambrose, N. P. Chung, M. Piatak Jr., F. Yuan, C. M. Trubey, V. Coalter, R. Kiser, D. Schneider, J. Smedley, R. Pung, M. Gathuka, J. D. Estes, R. S. Veazey, V. N. KewalRamani, J. D. Lifson, and P. D. Bieniasz. 2009. A macaque model of HIV-1 infection. Proceedings of the National Academy of Sciences 106:4425-4429. 117. Hayden, A., P. W. Johnson, G. Packham, and S. J. Crabb. 2010. S- adenosylhomocysteine hydrolase inhibition by 3-deazaneplanocin A analogues induces anti-cancer effects in breast cancer cell lines and synergy with both histone deacetylase and HER2 inhibition. Breast Cancer Research and Treatment. 118. He, G., and D. M. Margolis. 2002. Counterregulation of chromatin deacetylation and histone deacetylase occupancy at the integrated promoter of human immunodeficiency virus type 1 (HIV-1) by the HIV-1 repressor YY1 and HIV-1 activator Tat. Mol. Cell. Biol. 22:2965-73. 119. Hebbar, P. B., and T. K. Archer. 2003. Chromatin remodeling by nuclear receptors. Chromosoma 111:495-504. 120. Henderson, A., A. Holloway, R. Reeves, and D. J. Tremethick. 2004. Recruitment of SWI/SNF to the human immunodeficiency virus type 1 promoter. Mol. Cell. Biol. 24:389-97. 121. Herschhorn, A., and A. Hizi. 2010. Retroviral reverse transcriptases. Cellular and Molecular Life Sciences 67:2717-2747. 122. Ho, D. D., A. U. Neumann, A. S. Perelson, W. Chen, J. M. Leonard, and M. Markowitz. 1995. Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature 373:123-126. 123. Hoffmann, A., and D. Baltimore. 2006. Circuitry of nuclear factor kappaB signaling. Immunol. Rev. 210:171-86. 124. Hottiger, M. O., and G. J. Nabel. 1998. Interaction of human immunodeficiency virus type 1 Tat with the transcriptional coactivators p300 and CREB binding protein. J. Virol. 72:8252-8256. 125. Huang, C. C., M. Tang, M. Y. Zhang, S. Majeed, E. Montabana, R. L. Stanfield, D. S. Dimitrov, B. Korber, J. Sodroski, I. A. Wilson, R. Wyatt, and P. D. Kwong. 2005. Structure of a V3-containing HIV-1 gp120 core Science 310:1025-1028. 126. Huang, J., F. Wang, E. Argyris, K. Chen, Z. Liang, H. Tian, W. Huang, K. Squires, G. Verlinghieri, and H. Zhang. 2007. Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes. Nat. Med. 13:1241-7. 127. Huang, M., J. M. Orenstein, M. A. Martin, and E. O. Freed. 1995. p6Gag is required for particle production from full-length human immunodeficiency virus type 1 molecular clones expressing protease. Journal of Virology 69:6810-6818. 128. Hymes, K. B., J. B. Greene, A. Marcus, D. C. William, T. Cheung, N. S. Prose, H. Ballard, and L. J. Laubenstein. 1981. Kaposi's Sarcoma in Homosexual Men-A Report of Eight Cases. The Lancet 318:598-600.

143

129. Imai, K., and T. Okamoto. 2006. Transcriptional repression of human immunodeficiency virus type 1 by AP-4. Journal of Biological Chemistry 281:12495-12505. 130. Imai, K., H. Togami, and T. Okamoto. 2010. Involvement of H3 Lysine 9 (H3K9) methyl transferase G9a in the maintenance of HIV-1 latency and its reactivation by BIX01294. Journal of Biological Chemistry. 131. Imai, K., H. Togami, and T. Okamoto. 2010. Involvement of Histone H3 Lysine 9 (H3K9) Methyltransferase G9a in the Maintenance of HIV-1 Latency and Its Reactivation by BIX01294. J. Biol. Chem. 285:16538-45. 132. Izquierdo-Useros, N., M. Naranjo-Gomez, I. Erkizia, M. C. Puertas, F. E. Borras, J. Blanco, and J. Martinez-Picado. 2010. HIV and Mature Dendritic Cells: Trojan Exosomes Riding the Trojan Horse? PLoS Pathogens 6:e1000740. 133. Jenkins, Y., M. McEntee, K. Weis, and W. C. Greene. 1998. Characterization of HIV-1 Vpr nuclear import: analysis of signals and pathways. Journal of Cell Biology 143:875-885. 134. Jenuwein, T., and C. D. Allis. 2001. Translating the histone code. Science 293:1074-1080. 135. Jiang, G., A. Espeseth, D. J. Hazuda, and D. M. Margolis. 2007. c-Myc and Sp1 contribute to proviral latency by recruiting histone deacetylase 1 to the human immunodeficiency virus type 1 promoter. J. Virol. 81:10914-23. 136. Johnson, C., D. Van Antwerp, and T. J. Hope. 1999. An N-terminal nuclear export signal is required for the nucleocytoplasmic shuttling of IkappaBalpha. EMBO J. 18:6682-93. 137. Joos, B., M. Fischer, H. Kuster, S. K. Pillai, J. K. Wong, J. Boni, B. Hirschel, R. Weber, A. Trkola, and H. F. Gunthard. 2008. HIV rebounds from latently infected cells, rather than from continuing low-level replication. Proc. Natl. Acad. Sci. U S A 105:16725-30. 138. Jordan, A., D. Bisgrove, and E. Verdin. 2003. HIV reproducibly establishes a latent infection after acute infection of T cells in vitro. EMBO J. 22:1868- 1877. 139. Justin, N., V. De Marco, R. Aasland, and S. Gamblin. 2010. Reading, writing, and editing methylated lysines on histone tails: new insights from recent structural studies. Current Opinion in Structural Biology 20:730-738. 140. Kalpana, G. V., S. Marmon, W. Wang, G. R. Crabtree, and S. P. Goff. 1994. Binding and stimulation of HIV-1 integrase by a human homolog of yeast transcription factor SNF5. Science 266:2002-2006. 141. Kalushkova, A., M. Fryknas, M. Lemaire, C. Fristedt, P. Agarwal, M. Eriksson, S. Deleu, P. Atadja, A. Osterborg, K. Nilsson, K. Vanderkerken, F. Oberg, and H. Jernberg-Wiklund. 2010. Polycomb target genes are silenced in multiple myeloma. PLoS One 5:e11483. 142. Kanduri, C., J. Whitehead, and F. Mohammad. 2009. The long and the short of it: RNA-directed chromatin asymmetry in mammalian X-chromosome inactivation. FEBS Letter 583:857-864. 143. Kane, L. P., J. Lin, and A. Weiss. 2000. Signal transduction by the TCR for antigen. Current Opinion in Immunology 12:242-249.

144

144. Kao, S.-Y., A. F. Calman, P. A. Luciw, and B. M. Peterlin. 1987. Anti- termination of transcription within the long terminal repeat of HIV-1 by Tat gene product. Nature 330:489-493. 145. Karn, J. 1999. Tackling Tat. J. Mol. Biol. 293:235-254. 146. Kauder, S. E., A. Bosque, A. Lindqvist, V. Planelles, and E. Verdin. 2009. Epigenetic regulation of HIV-1 latency by cytosine methylation. PLoS Pathog. 5:e1000495. 147. Keedy, K. S., N. M. Archin, A. T. Gates, A. Espeseth, D. J. Hazuda, and D. M. Margolis. 2009. A limited group of class I histone deacetylases act to repress human immunodeficiency virus type-1 expression. J. Virol. 83:4749-4756. 148. Kestler, H. W. I., D. J. Ringler, K. Mori, D. L. Panicalli, P. K. Sehgal, M. D. Daniel, and R. C. Desrosiers. 1991. Importance of the nef gene for maintaince of high virus loads and for development of AIDS. Cell 65:651-662. 149. Kiefer, H. L., T. M. Hanley, J. E. Marcello, A. G. Karthik, and G. A. Viglianti. 2004. Retinoic acid inhibition of chromatin remodeling at the human immunodeficiency virus type 1 promoter. Uncoupling of histone acetylation and chromatin remodeling. J. Biol. Chem. 279:43604-13. 150. Kim, Y. K., C. F. Bourgeois, C. Isel, M. J. Churcher, and J. Karn. 2002. Phosphorylation of the RNA polymerase II carboxyl-terminal domain by CDK9 is directly responsible for human immunodeficiency virus type 1 Tat- activated transcriptional elongation. Mol. Cell. Biol. 22:4622-4637. 151. Kim, Y. K., C. F. Bourgeois, R. Pearson, M. Tyagi, M. J. West, J. Wong, S. Y. Wu, C. M. Chiang, and J. Karn. 2006. Recruitment of TFIIH to the HIV LTR is a rate-limiting step in the emergence of HIV from latency. EMBO J. 25:3596- 604. 152. Kirchhoff, F., T. C. Greenough, D. B. Brettler, J. L. Sullivan, and R. C. Desrosiers. 1995. Absence of intact nef sequences in a long-term, nonprogressing survivor of HIV-1 infection. New England Journal of Medicine 332:228-232. 153. Klichko, V., N. Archin, R. Kaur, G. Lehrman, and D. Margolis. 2006. Hexamethylbisacetamide remodels the human immunodeficiency virus type 1 (HIV-1) promoter and induces Tat-independent HIV-1 expression but blunts cell activation. J. Virol. 80:4570-9. 154. Kloor, D., and H. Osswald. 2004. S-Adenosylhomocysteine hydrolase as a target for intracellular adenosine action. Trends in Pharmacological Sciences 25:294-297. 155. Korin, Y. D., D. G. Brooks, S. Brown, A. Korotzer, and J. A. Zack. 2002. Effects of prostratin on T-cell activation and human immunodeficiency virus latency. J. Virol. 76:8118-23. 156. Kouzarides, T. 2002. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12:198-209. 157. Koyanagi M, B. A., Martens J, Margueron R, Jenuwein T, Bix M. 2005. EZH2 and Histone 3 Trimethyl Lysine 27 Associated with Il4 and Il13 Gene Silencing in Th1 Cells. The Journal of Biological Chemistry 280:31470-31477. 158. Kubicek, S., R. J. O'Sullivan, E. M. August, E. R. Hickey, Q. Zhang, M. L. Teodoro, S. Rea, K. Mechtler, J. A. Kowalski, C. A. Homon, T. A. Kelly, and

145

T. Jenuwein. 2007. Reversal of H3K9me2 by a Small-Molecule Inhibitor for the G9a Histone Methyltransferase Molecular Cell 25:473-481. 159. Kumar, R. A., S. R. Naidu, X. Wang, A. N. Imbalzano, and E. J. Androphy. 2007. Interaction of Papillomavirus E2 Protein with the Brm Chromatin Remodeling Complex Leads to Enhanced Transcriptoinal Activation. Journal of Virology 81:2213-2220. 160. Kurkjian, C., S. Kummar, and A. J. Murgo. 2008. DNA Methylation: Its Role in Cancer Develpment and Therapy. Current Problems in Cancer 332:187- 235. 161. Kuzmichev, A., K. Nishioka, H. Erdjument-Bromage, P. Tempst, and D. Reinberg. 2002. Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev. 16:2893-905. 162. Kuzmichev A, N. K., Erdjument-Bromage H, Tempst P, Reinberg D. 2002. Histone methyltransferase activity associated with a human mulitprotein complex containing the Enhancer of Zeste protein. Genes and Development 16:2893-2905. 163. Kwak, Y. T., J. Guo, S. Prajapati, K. J. Park, R. M. Surabhi, B. Miller, P. Gehrig, and R. B. Gaynor. 2003. Methylation of SPT5 regulates its interaction with RNA polymerse II and transcriptional elongation properties. Molecular Cell 11:1055-1066. 164. Kwiatkowski, D. L., H. W. Thompson, and D. C. Bloom. 2009. The polycomb group protein Bmi1 binds to the herpes simplex virus 1 latent genome and maintains repressive histone marks during latency. J. Virol. 83:8173-81. 165. Kwong, P. D., R. Wyatt, J. Robinson, R. W. Sweet, J. Sodroski, and W. A. Hendrickson. 1998. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature 393:648-659. 166. Lan, F., P. E. Bayliss, J. L. Rinn, J. R. Whetstine, J. K. Wang, S. Chen, S. Iwase, R. Alpatov, I. Issaeva, E. Canaani, T. M. Roberts, H. Y. Chang, and Y. Shi. 2007. A histone H3 lysine 27 demethylase regulates animal posterior development. Nature 449:689-694. 167. Lassen, K., Y. Han, Y. Zhou, J. Siliciano, and R. F. Siliciano. 2004. The multifactorial nature of HIV-1 latency. Trends Mol. Med. 10:525-31. 168. Lassen, K. G., K. X. Ramyar, J. R. Bailey, Y. Zhou, and R. F. Siliciano. 2006. Nuclear retention of multiply spliced HIV-1 RNA in resting CD4+ T cells. PLoS Pathog. 2:e68. 169. Lehrman, G., I. B. Hogue, S. Palmer, C. Jennings, C. A. Spina, A. Wiegand, A. L. Landay, R. W. Coombs, D. D. Richman, J. W. Mellors, J. M. Coffin, R. J. Bosch, and D. M. Margolis. 2005. Depletion of latent HIV-1 infection in vivo: a proof-of-concept study. Lancet 366:549-55. 170. Lemasson, I., N. J. Polakowski, P. J. Laybourn, and J. K. Nyborg. 2006. Tax- dependent displacement of nucleosomes during transcriptional activation of human T-cell leukemia virus type 1. Journal of Biological Chemistry 281:13075-13082.

146

171. Lemma Dechassa, M., A. Sabri, S. Pondugula, S. R. Kassabov, N. Chatterjee, M. P. Kladde, and B. Bartholomew. 2010. SWI/SNF has Intrinsic Nucleosome Disassembly Activity that is Dependent on Adjacent Nucleosomes. Molecular Cell 38:590-602. 172. Lenasi, T., X. Contreras, and B. M. Peterlin. 2008. Transcriptional interference antagonizes proviral gene expression to promote HIV latency. Cell Host Microbe 4:123-33. 173. Levy, J. A., A. D. Hoffman, S. M. Kramer, J. A. Landis, J. M. Shimabukuro, and L. S. Oshiro. 1984. Isolation of lyphocytopathic retroviruses from San Francisco patients with AIDS. Science 225:840-842. 174. Lewinski, M. K., D. Bisgrove, P. Shinn, H. Chen, C. Hoffmann, S. Hannenhalli, E. Verdin, C. C. Berry, J. R. Ecker, and F. D. Bushman. 2005. Genome-wide analysis of chromosomal features repressing human immunodeficiency virus transcription. J. Virol. 79:6610-9. 175. Lewinski, M. K., M. Yamashita, M. Emerman, A. Ciuffi, H. Marshall, G. Crawford, F. Collins, P. Shinn, J. Leipzig, S. Hannenhalli, C. C. Berry, J. R. Ecker, and F. D. Bushman. 2006. Retroviral DNA integration: viral and cellular determinants of target-site selection. PLoS Pathog. 2:e60. 176. Limon, A., N. Nakajima, R. Lu, H. Z. Ghory, and A. Engelman. 2002. Wild- type levels of nuclear localization and human immunodeficiency virus type 1 replication in teh absence of the central DNA flap. Journal of Virology 76:12078-12086. 177. Lin, C. W., and A. Engelman. 2003. The barrier-to-autointegration factor is a component of functional human immunodeficiency virus type 1 preintegration complexes. Journal of Virology 77:5030-5036. 178. Liu, J., N. D. Perkins, R. M. Schmid, and G. J. Nabel. 1992. Specific NF-κB subunits act in concert with tat to stimulate human immunodeficiency virus type 1 transcription. J. Virol. 66:3883-3887. 179. Liu, N., A. Balliano, and J. J. Hayes. 2010. Mechanism(s) of SWI/SNF- Induced Nucleosome Mobilization. Chembiochem epub. 180. Llano, M., D. T. Saenz, A. Meehan, P. Wongthida, M. Peretz, W. H. Walker, W. Teo, and E. M. Poeschla. 2006. An essential role for LEDGF/p75 in HIV integration. Science 314:461-4. 181. Lu, F., W. Stedman, M. Yousef, R. Renne, and P. M. Lieberman. 2010. Epigenetic regulation of Kaposi's sarcoma-associated herpesvirus latency by virus-encoded microRNAs that target Rta and the cellular Rbl2-DNMT pathway. J. Virol. 84:2697-706. 182. Lu, M., S. Blackow, and P. Kim. 1995. A trimeric structural domain of the HIV-1 transmembrane glycoprotein. Nature Structural Biology 2:1075-1082. 183. Lu, Y. L., P. Spearman, and L. Ratner. 1993. Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions. Journal of Virology 67:6542-6550. 184. Luger, K. 2006. Dynamic nucleosomes. Chromosome Research 14:5-16. 185. Luger, K., A. W. Mader, R. K. Richmond, D. F. Sargent, and T. J. Richmond. 1997. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389:251-260. 147

186. Lusic, M., A. Marcello, A. Cereseto, and M. Giacca. 2003. Regulation of HIV- 1 gene expression by histone acetylation and factor recruitment at the LTR promoter. EMBO J. 22:6550-6561. 187. Luykx, P., I. Bajic, and S. Khuri. 2006. NXSensor web tool for evaluating DNA for nucleosome exclusion sequences and acessibility to binding factors. Nucleic Acids Research 34. 188. Maertens, G., P. Cherepanov, W. Pluymers, K. Busschots, E. De Clercq, Z. Debyser, and Y. Engelborghs. 2003. LEDGF/p75 is Essentail for Nuclear and Chromosomal Targeting of HIV-1 Integrase in Human Cells. The Journal of Biological Chemistry 278:33528-33539. 189. Mahmoudi, T., M. Parra, R. G. Vries, S. E. Kauder, C. P. Verrijzer, M. Ott, and E. Verdin. 2006. The SWI/SNF chromatin-remodeling complex is a cofactor for tat transactivation of the HIV promoter. J. Biol. Chem. 281:19960-8. 190. Maksakova, I. A., D. L. Mager, and D. Reiss. 2008. Keeping active endogenous retroviral-like elements in check: the epigenetic perspective. Cellular and Molecular Life Sciences 65:3329-3347. 191. Malim, M. H., S. Böhnlein, J. Hauber, and B. R. Cullen. 1989. Functional dissection of the HIV-1 Rev trans-activator: Derivation of a trans-dominant repressor of Rev function. Cell 58:205-214. 192. Mancebo, H. S. Y., G. Lee, J. Flygare, J. Tomassini, P. Luu, Y. Zhu, J. Peng, C. Blau, D. Hazuda, D. Price, and O. Flores. 1997. p-TEFb kinase is required for HIV Tat transcriptional activation in vivo and in vitro. Genes Dev. 11:2633-2644. 193. Mangeat, B., P. Turelli, G. Caron, M. Friedli, L. Perrin, and D. Trono. 2003. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature 424:99-103. 194. Marban, C., S. Suzanne, F. Dequiedt, S. de Walque, L. Redel, C. Van Lint, D. Aunis, and O. Rohr. 2007. Recruitment of chromatin-modifying enzymes by CTIP2 promotes HIV-1 transcriptional silencing. EMBO J. 26:412-23. 195. Margolis, D. M., M. Somasundaran, and M. R. Green. 1994. Human transcription factor YY1 represses human immunodeficiency virus type 1 transcription and virion production. J. Virol. 68:905-910. 196. Marsden, M. D., and J. A. Zack. 2007. Human immunodeficiency virus bearing a disrupted central DNA flap is pathogenic in vivo. Journal of Virology 81:6146-6150. 197. Marx, J. L. 1986. AIDS drug shows promise in preliminary clinical trial. Science 231:1504-5. 198. Marzio, G., M. Tyagi, M. I. Gutierrez, and M. Giacca. 1998. HIV-1 Tat transactivator recruits p300 and CREB-binding protein histone acetyltransferases to the viral promoter. Proc. Natl. Acad. Sci. U S A 95:13519–13524. 199. Masopust, D. 2008. Developing an HIV cytotoxic T-lymphocyte vaccine: issues of CD8 T-cell quantity, quality, and location. Journal of Internal Medicine 265:125-137.

148

200. Masur, H., M. A. Michelis, J. B. Greene, I. Onorato, R. A. Stouwe, R. S. Holzman, G. Wormser, L. Brettman, M. Lange, H. W. Murray, and S. Cunningham-Rundles. 1981. An Outbreak of community acquired Pneumocystis carinii pneumonia: initial manifestation of cellular immune dysfunction. The New England Journal of Medicine 305:1431-1438. 201. Mayers, D. L., J. A. Mikovits, B. Joshi, I. K. Hewlett, J. S. Estrada, A. D. Wolfe, G. E. Garcia, B. P. Doctor, D. S. Burke, R. K. Gordon, J. R. Lane, and P. K. Chiang. 1995. Anti-human immunodeficiency virus 1 (HIV-1) activities of 3-deazaadenosine analogs: Increased potency against 3'-azido-3'- deoxythymidine-resistant HIV-1 strains. Proceedings of the National Academy of Sciences 92:215-219. 202. McCune, J. M., R. Namikawa, H. Kaneshima, L. D. Schultz, M. Lieberman, and I. L. Weissman. 1988. The SCID-hu mouse: Murine model for the analysis of human hematolymphoid differentiation and function. Science 241:1632-1639. 203. McDonald, D., M. A. Vodicka, G. Lucero, T. M. Svitkina, G. G. Borisy, M. Emerman, and T. J. Hope. 2002. Visualization of the intracellular behavior of HIV in living cells. J. Cell Biol. 159:441-452. 204. Miller, M. D., C. M. Farnet, and F. D. Bushman. 1997. Human immunodeficiency virus type 1 preintegration compelxes: studies of organization and composition. Journal of Virology 71:5382-5390. 205. Miller, S. A., A. C. Huang, M. M. Miazgowicz, M. M. Brassil, and A. S. Weinmann. 2008. Coordinated but physically separable interaction with H3K27-demethylase and H3K4-methyltransferase activites are required for T-box protein-mediated activation of developmental gene expression. Genes and Development 22:2980-2993. 206. Miller, S. A., S. E. Mohn, and A. S. Weinmann. 2010. Jmjd3 and UTX Play a Demethylase-Indepedent Role in Chromatin Remodeling to Regulate T-Box Family Member-Dependent Gene Expression. Molecular Cell 40:594-605. 207. Miranda TB, C. C., Yoo CB, Liang G, Abe M, Kelly TK, Marquez VE, Jones PA. 2009. DZNep is a global histone methylation inhibitor that reactivates developmental genes not silenced by DNA methylation. Molecular Cancer Therapeutics 8:1579-1588. 208. Mitchell, R. S., B. F. Beitzel, A. R. Schroder, P. Shinn, H. Chen, C. C. Berry, J. R. Ecker, and F. D. Bushman. 2004. Retroviral DNA integration: ASLV, HIV, and MLV show distinct target site preferences. PLoS Biol. 2:E234. 209. Mitsuya, H., K. J. Weinhold, P. A. Furman, M. H. St. Clair, S. N. Lehrman, R. C. Gallo, D. P. Bolognesi, D. W. Barry, and S. Broder. 1985. 3'-Azido-3'- deoxythymidine (BW A509U): an antiviral agent that inhibits the infectivity and cytopathic effect of human T-lymphotropic virus type III/lymphadenopathy-associated virus in vitro. Proceedings of the National Academy of Sciences 82:7096-7100. 210. Mizutani, T., A. Ishizaka, M. Tomizawa, T. Okazaki, N. Yamamichi, A. Kawana-Tachikawa, A. Iwamoto, and H. Iba. 2009. Loss of the Brm-Type SWI/SNF Chromatin Remodeling Complex Is a Strong Barrier to the Tat-

149

Independent Transcriptional Elongation of Human Immunodeficiency Virus Type 1 Transcripts. Journal of Virology 83:11569-11580. 211. Montgomery, N. D., D. Yee, A. Chen, S. Kalantry, S. J. Chamberlain, A. P. Otte, and T. Magnuson. 2005. The murine polycomb group protein Eed is required for global histone H3 lysine-27 methylation. Current Biology 15:942-947. 212. Nabel, G., and D. A. Baltimore. 1987. An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature 326:711-713. 213. Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M. Verma, and D. Trono. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263-267. 214. Navarro, J., C. Punzon, J. L. Jimenez, E. Fernandez-Cruz, A. Pizarro, M. Fresno, and M. A. Munoz-Fernandez. 1998. Inhibition of phsophodiesterase type IV suppresses human immunodeficiency virus type1 replication and cytokine production in primary T cells: involvement of NF- kappaB and NFAT. Journal of Virology 72:4712-4720. 215. Neil, S. J., T. Zang, and P. D. Bieniasz. 2008. Tetherin inhibits retrovirus release and is antagonized by HIV-1 Vpu. Nature 451:425-30. 216. Okamoto, T., and F. Wong-Staal. 1986. Demonstration of virus-specific transcriptional activator(s) in cells infected with HTLV-III by an in vitro cell- free system. Cell 47:29-35. 217. Osipovich, O., R. Milley Cobb, K. J. Oestreich, S. Pierce, P. Ferrier, and E. M. Oltz. 2007. Essential function for SWI-SNF chromatin-remodeling complexes in the promoter-directed assembly of Tcrb genes. Nature Immunology 8:809-816. 218. Pasini, D., A. P. Bracken, M. R. Jensen, E. Lazzerini Denchi, and K. Helin. 2004. Suz12 is essential fo rmouse development and for EZH2 histone methyltransferase activity. EMBO J 23:4061-4071. 219. Pearson, R., Y. K. Kim, J. Hokello, K. Lassen, J. Friedman, M. Tyagi, and J. Karn. 2008. Epigenetic silencing of human immunodeficiency virus (HIV) transcription by formation of restrictive chromatin structures at the viral long terminal repeat drives the progressive entry of HIV into latency. J. Virol. 82:12291-303. 220. Perelson, A. S., P. Essunger, Y. Cao, M. Vesanen, A. Hurley, K. Saksela, M. Markowitz, and D. D. Ho. 1997. Decay characteristics of HIV-1-infected compartments during combination therapy. Nature 387:188-191. 221. Perez-Caballero, D., T. Zang, A. Ebrahimi, M. W. McNatt, D. A. Gregory, M. C. Johnson, and P. D. Bieniasz. 2009. Tetherin inhibits HIV-1 release by directly tethering virions to cells. Cell 139:499-511. 222. Persaud, D., Y. Zhou, J. M. Siliciano, and R. F. Siliciano. 2003. Latency in human immunodeficiency virus type 1 infection: no easy answers. J. Virol. 77:1659-65. 223. Pessler, F., and R. Q. Cron. 2004. Reciprocal regulation of the nuclear factor of activated T cells and HIV-1. Genes Immun. 5:158-167.

150

224. Pierson, T. C., Y. Zhou, T. L. Kieffer, C. T. Ruff, C. Buck, and R. F. Siliciano. 2002. Molecular characterization of preintegration latency in human immunodeficiency virus type 1 infection. J. Virol. 76:8518-31. 225. Pluymers, W., P. Cherapanov, D. Schols, E. De Clercq, and Z. Debyser. 1999. Nuclear localization of human immunodeficiency virus type 1 integrase expressed as a fusion protein with green fluorescent protein. Virology 258. 226. Prins, J. M., S. Jurriaans, R. M. van Praag, H. Blaak, R. van Rih, P. T. Schellekens, t. B. I.J., S. L. Yong, C. H. Fox, M. T. Roos, F. de Wolf, J. Goudsmit, H. Schuitemaker, and J. M. Lange. 1999. Immuno-activation with anti-CD3 and recombinant human IL-2 in HIV-1 infected patients on potent antiretroviral therapy. AIDS 13:2405-2410. 227. Provitera, P., R. El-Maghrabi, and S. Scarlata. 2006. The effect of HIV-1 Gag myristoylation on membrane binding. Biophysical Chemistry 119:23-32. 228. Raaphorst FM, O. A., van Kemenade FJ, Blokzijl T, Fieret E, Hamer KM, Satijn DPE, Meijer CJLM. 2001. Distinct BMI-1 and EZH2 Expression Patterns in Thymocytes and Mature T Cells Suggest a Role for Polycomb Genes in Human T Cell Differentiation. The Journal of Immunology 166:5925-5934. 229. Ramratnam, B., J. E. Mittler, L. Zhang, D. Boden, A. Hurley, F. Fang, C. A. Macken, A. S. Perelson, M. Markowitz, and D. D. Ho. 2000. The decay of the latent reservoir of replication-competent HIV-1 is inversely correlated with the extent of residual viral replication during prolonged anti-retroviral therapy. Nat. Med. 6:82-5. 230. Rerks-Ngarm, S., P. Pitisuttithum, S. Nitayaphan, J. Kaewkungwal, J. Chiu, R. Paris, N. Premsri, C. Namwat, M. de Souza, E. Adams, M. Benenson, S. Gurunathan, J. Tartaglia, J. G. McNeil, D. P. Francis, D. Stablein, D. L. Birx, S. Chunsuttiwat, C. Khamboonruang, P. Thongcharoen, M. L. Robb, N. L. Micheal, P. Kunasol, and J. H. Kim. 2009. Vaccination with ALVAC and AIDSVAX to Prevent HIV-1 infection in Thailand. The New England Journal of Medicine 361:2209-2220. 231. Robichaud, G. A., B. Barbeau, J.-F. Fortin, D. M. Rothstein, and M. J. Tremblay. 2002. Nuclear factor of activated T cells is a driving force for preferential productive HIV-1 infection of CD45RO-expressing CD4+ T cells. J. Biol. Chem. 277:23733-23741. 232. Rohr, O., C. Marban, D. Aunis, and E. Schaeffer. 2003. Regulation of HIV-1 gene transcription: from lymphocytes to microglial cells. Journal of Leukocyte Biology 74:736-749. 233. Rosen, C. A., E. Terwilliger, A. I. Dayton, J. G. Sodrowski, and W. A. Haseltine. 1988. Intragenic cis-acting art-responsive sequences of the human immunodeficiency virus. Proc. Natl. Acad. Sci. U S A 85:2071-2075. 234. Routy, J. P. 2005. Valproic acid: a potential role in treating latent HIV infection. Lancet 366:523-4. 235. Sahu, G. K., K. Lee, J. Ji, V. Braciale, S. Baron, and M. W. Cloyd. 2006. A novel in vitro system to generate and study latently HIV-infected long-lived normal CD4+ T-lymphocytes. Virology 355:127-37.

151

236. Salvi, A., R. Garbuglia, A. Di Caro, S. Pulciani, F. Montella, and A. Benedetto. 1998. Grossly defective nef gene sequences in a human immunodeficiency virus type 1-seropositive long-term nonprogressor. Journal of Virology 72. 237. Santi, D. V., C. E. Garrett, and P. J. Barr. 1983. On the mechanism of inhibition of DNA-cytosine methyltransferase by cytosine analogs. Cell 33:9- 10. 238. Sato, S., and W. Johnson. 2007. Antibody-Mediated Neutralization and Simian Immunodeficiency Virus Models of HIV/AIDS. Current HIV Research 5:594-607. 239. Saunders, A., L. J. Core, and J. T. Lis. 2006. Breaking barriers to transcription elongation. Nat. Rev. Mol. Cell Biol. 7:557-67. 240. Schindler, M., J. Munch, O. Kutsch, H. Li, M. L. Santiago, F. Bibollet-Ruche, M. C. Muller-Trutwin, F. J. Novembre, M. Peeters, V. Courgnaud, E. Bailes, P. Roques, D. L. Sodora, G. Silvestri, P. M. Sharp, B. H. Hahn, and F. Kirchhoff. 2006. Nef-mediated suppression of T cell activation was lost in lentiviral lineage that gave rise to HIV-1. Cell 125:1055-1067. 241. Schulz, W. A., C. Steinhoff, and A. R. Florl. 2006. Methylation of Endogenous Human Retroelements in Health and Disease. Current Topics in Microbiology and Immunology 310:211-250. 242. Schupbach, J., R. V. Popovic, M. A. Gilden, M. Gonda, G. Sarngadharan, and R. C. Gallo. 1984. Serological analysis of a subgroup of human T- lymphotropic retroviruses (HTLV-III) associated iwth AIDS. Science 224:503-505. 243. Schwartz, O., V. Marechal, S. Le Gall, F. Lemonnier, and J. Heard. 1996. Endocytosis of major histocompatibility complex class I molecules is induced by the HIV-1 Nef protein. Nature Medicine 2:338-342. 244. Shen, A., M. C. Zink, J. L. Mankowski, K. Chadwick, J. B. Margolick, L. M. Carruth, M. Li, J. E. Clements, and R. F. Siliciano. 2003. Resting CD4+ T lymphocytes but not thymocytes provide a latent viral reservoir in a simian immunodeficiency virus-Macaca nemestrina model of human immunodeficiency virus type 1-infected patients on highly active antiretroviral therapy. J. Virol. 77:4938-49. 245. Shi, Y., F. Lan, C. Matson, P. Mulligan, J. R. Whetstine, P. A. Cole, R. A. Casero, and Y. Shi. 2004. Histone Demethylation Mediated by the Nuclear Amine Oxidase Homolog LSD1. Cell 119:941-953. 246. Siliciano, J. D., J. Kajdas, D. Finzi, T. C. Quinn, K. Chadwick, J. B. Margolick, C. Kovacs, S. J. Gange, and R. F. Siliciano. 2003. Long-term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells. Nat. Med. 9:727-8. 247. Simon, J. A., and C. A. Lange. 2008. Roles of the EZH2 histone methyltransferase in cancer epigenetics. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 647:21-29. 248. Simone, C. 2006. SWI/SNF: The Crossroads Where Extracellular Signaling Pathways Meet Chromatin. Journal of Cellular Physiology 207:309-314.

152

249. Smith-Garvin, J. E., G. A. Koretzky, and M. S. Jordan. 2009. T Cell Activation. Annual Reviews of Immunology 27:591-619. 250. Stoltzfus, C. M., and J. M. Madsen. 2006. Role of Viral Splicing Elements and Cellular RNA Binding Proteins in Regulation of HIV-1 Alternative RNA Splicing. Current HIV Research 4:43-55. 251. Streeck, H., and D. F. Nixon. 2010. T Cell Immunity in Acute HIV-1 Infection. Journal of Infectious Diseases 202:S302-S308. 252. Stumptner-Cuvelette, P., S. Morchoisne, M. Dugast, S. Le Gall, G. Raposo, O. Schwartz, and P. Benaroch. 2001. HIV-1 Nef impairs MHC class II antigen presenation and surface expression. Proceedings of the National Academy of Sciences 98:12144-12149. 253. Sung, T. L., and A. P. Rice. 2006. Effects of prostratin on Cyclin T1/P-TEFb function and the gene expression profile in primary resting CD4+ T cells. Retrovirology 3:66. 254. Suva, M. L., N. Riggi, M. Janiszewska, I. Radovanovic, P. Provero, J. C. Stehle, K. Baumer, M. A. Le Bitoux, D. Marino, L. Cironi, V. E. Marquez, V. Clement, and I. Stamenkovic. 2009. EZH2 is essential for glioblastoma cancer stem cell maintenance. Cancer Research 69:9211-9218. 255. Suzuki, Y., and R. Craigie. 2007. The road to chromatin-nuclear entry of retroviruses. Nature Reviews Microbiology 5:187-196. 256. Swigut, T., N. Shohdy, and J. Skowronski. 2001. Mechanism for downregulation of CD28 by Nef. EMBO Journal 20:1593-1604. 257. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, and L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655-669. 258. Szabo, S. J., B. M. Sullivan, C. Stemmann, A. R. Satoskar, B. P. Sleckman, and L. H. Glimcher. 2002. Distinct effects of T-bet in Th1 lineage commitment and IFN-γ production in CD4 and CD8 T cells. Science 295:338- 342. 259. Tam, W. F., L. H. Lee, L. Davis, and R. Sen. 2000. Cytoplasmic sequestration of rel proteins by IkappaBalpha requires CRM1-dependent nuclear export. Molecular and Cellular Biology 20:2269-2284. 260. Temin, H. M., and S. Mizutani. 1970. RNA-dependent RNA polymerase in virions of Rous sarcoma virus. Nature 226:1211-1213. 261. Tergaonkar, V. 2006. NF-κB pathway: A good signaling paradigm and therapeutic target. The Internation Journal of Biochemistry and Cell Biology 38:1647-1653. 262. Toth, Z., D. T. Maglinte, S. H. Lee, H. R. Lee, L. Y. Wong, K. F. Brulois, S. Lee, J. D. Buckley, P. W. Laird, V. E. Marquez, and J. U. Jung. 2010. Epigenetic analysis of KSHV latent and lytic genomes. PLoS Pathog. 6:e1001013. 263. Treand, C., I. du Chene, V. Bres, R. Kiernan, R. Benarous, M. Benkirane, and S. Emiliani. 2006. Requirement for SWI/SNF chromatin-remodeling complex in Tat-mediated activation of the HIV-1 promoter. EMBO J. 25:1690- 9.

153

264. Triboulet, R., B. Mari, Y.-L. Lin, C. Chable-Bessia, Y. Bennasser, K. Lebrigand, B. Cardinaud, T. Maurin, P. Barbry, V. Baillat, J. Reynes, P. Corbeau, K.-T. Jeang, and M. Benkirane. 2007. Suppression of MicroRNA- Silencing Pathway by HIV-1 During Virus Replication. Science 315:1579- 1582. 265. Trkola, A., T. Dragic, J. Arthos, J. M. Binlay, W. C. Olson, G. P. Allaway, C. Cheng-Meyer, J. Robinson, P. J. Maddon, and J. P. Moore. 1996. CD-4 dependent, antibody-sensitive interactions betwen HIV-1 and its co-receptor CCR-5. Nature 384:184-187. 266. Trojer, P., and D. Reinberg. 2007. Facultative heterochromatin: is there a distinctive molecular signature? Mol. Cell 28:1-13. 267. Turelli, P., E. Craig, B. Mangeat, N. Klages, R. Evans, G. Kalpana, and D. Trono. 2001. Cytoplasmic recruitment of INI1 and PML on incoming HIV preintegration complexes: Interference with early steps of viral replication. Molecular Cell 7:1245-1254. 268. Tyagi, M., and J. Karn. 2007. CBF-1 promotes transcriptional silencing during the establishment of HIV-1 latency. EMBO J. 26:4985-95. 269. Tyagi, M., R. J. Pearson, and J. Karn. 2010. Establishment of HIV latency in primary CD4+ cells is due to epigenetic transcriptional silencing and P-TEFb restriction. Journal of Virology 84:6425-6437. 270. Uberla, K. 2008. HIV Vaccine Development in the Aftermath of the STEP Study: Re-Focus on Occult HIV infection? PLoS Pathogens 4:1-3. 271. Van Lint, C., S. Emiliani, M. Ott, and E. Verdin. 1996. Transcriptional activation and chromatin remodeling of the HIV-1 promoter in response to histone acetylation. EMBO J. 15:1112-1120. 272. van Wamel, J. L., and B. Berkhout. 1998. The first strand transfer during HIV-1 reverse transcription can occur either intramolecularly or intermolecularly. Virology 244:245-251. 273. Verdin, E. 1991. DNase I-hypersensitive sites are associated with both long terminal repeats and with the intragenic enhances of integrated human immunodeficiency virus type 1. J. Virol. 65:6790-6799. 274. Verdin, E., P. J. Paras, and C. Van Lint. 1993. Chromatin disruption in the promoter of human immunodeficiency virus type 1 during transcriptional activation. EMBO J. 12:3249-3259. 275. Vire E, B. C., Deplus R, Blanchon L, Fraga M, Didelot C, Morey L, Van Eynde A, Bernard D, Vanderwinden JM, Bollen M, Esteller M, Di Croce L, de Launoit Y, Fuks F. 2006. The Polycomb group protein EZH2 directly controls DNA methylation. Nature 439:871-874. 276. Vire, E., C. Brenner, R. Deplus, L. Blanchon, M. Fraga, C. Didelot, L. Morey, A. Van Eynde, D. Bernard, J. M. Vanderwinden, M. Bollen, M. Esteller, L. Di Croce, Y. de Launoit, and F. Fuks. 2006. The Polycomb group protein EZH2 directly controls DNA methylation. Nature 439:871-4. 277. Vodicka, M. A., D. M. Koepp, P. A. Silver, and M. Emerman. 1998. HIV-1 Vpr interacts with the nuclear transport pathway to promote macrophage infection. Genes and Development 12:175-185.

154

278. von Schwedler, U. K., M. Stuchell, B. Müller, D. M. Ward, H.-Y. Chung, E. Morita, H. E. Wang, T. Davis, G.-P. He, D. M. Cimbora, A. Scott, H.-G. Kräusslich, J. Kaplan, S. G. Morham, and W. I. Sundquist. 2003. The protein network of HIV budding. Cell 114:710-713. 279. Wada, T., T. Takagi, Y. Yamaguchi, A. Ferdous, T. Imai, S. Hirose, S. Sugimoto, K. Yano, G. A. Hartzog, F. Winston, S. Buratowski, and H. Handa. 1998. DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs. Genes Dev. 12:343-356. 280. Wang, W., J. Cote, Y. Xue, S. Zhou, P. Khavari, S. Biggar, C. Muchardt, G. Kalpana, S. P. Goff, M. Yaniv, J. L. Workman, and G. R. Crabtree. 1996. Purification and biochemical heterogeneity of the mammalian SWI/SNF complex. EMBO J 15:5370-5383. 281. Wang, Y.-H., and J. Griffith. 1996. The [(G/C)3NN]n motif: A common DNA repeat that excludes nucleosomes. Proceedings of the National Academy of Sciences 93:8863-8867. 282. Wange, R. L. 2000. LAT, the linker for activation of T cells: a bridge between T cell-specific and general signaling. Science's STKE 63:re1. 283. Warrilow, D., G. Tachedjian, and D. Harrich. 2009. Maturation of the HIV reverse transcription complex: putting the jigsaw together. Reviews in Medical Virology 19:324-337. 284. Wei, P., M. E. Garber, S.-M. Fang, W. H. Fischer, and K. A. Jones. 1998. A novel cdk9-associated c-type cyclin interacts directly with HIV-1 Tat and mediates its high-affinity, loop specific binding to TAR RNA. Cell 92:451-462. 285. Wei, X., J. M. Decker, S. Wang, H. Hui, J. C. Kappes, X. Wu, J. F. Salazar- Gonzalez, M. G. Salazar, J. M. Kilby, M. S. Saag, N. L. Komarova, M. A. Nowak, B. H. Hahn, P. D. Kwong, and G. M. Shaw. 2003. Antibody neutralization and escape by HIV-1. Nature 422:307-312. 286. Wei, X., S. K. Ghosh, M. E. Taylor, V. A. Johnson, E. A. Emini, P. Deutsch, J. D. Lifson, S. Bonhoeffer, M. A. Nowak, B. H. Hahn, M. S. Saag, and G. M. Shaw. 1995. Viral dynamics in human immunodeficiency virus type 1 infection. Nature 373:117-122. 287. Weidinger, G. 1995. Pharmacolkinetic and pharmacodynamic properties and therapeutic use of bunazosin in hypertension. A review. Arzneimittelforschung 45:1166-1171. 288. Weissenhorn, W., A. Dessen, S. C. Harrison, J. J. Skehel, and D. C. Wiley. 1997. Atomic structure of teh ectodomain from HIV-1 gp41. Nature 387:426- 430. 289. West, M. J., A. D. Lowe, and J. Karn. 2001. Activation of human immunodeficiency virus transcription in T cells revisited: NF-kappaB p65 stimulates transcriptional elongation. J. Virol. 75:8524-37. 290. Williams, S. A., L. F. Chen, H. Kwon, C. M. Ruiz-Jarabo, E. Verdin, and W. C. Greene. 2006. NF-kappaB p50 promotes HIV latency through HDAC recruitment and repression of transcriptional initiation. EMBO J. 25:139-149. 291. Wilson, N. A., and D. I. Watkins. 2009. Is an HIV vaccine possible? Brazilian Journal of Infectious Diseases 13:304-310.

155

292. Wilson, V. L., and P. A. Jones. 1983. Inhibiton of DNA methylation by chemical carcinogens in vitro. Cell 32:239-246. 293. Wolf, S. S. 2009. The protein arginine methyltransferase family: an update about function, new perspectives and the physioogical role in humans. Cellular and Molecular Life Sciences 66:2109-2121. 294. Wong, J. K., M. Hezareh, H. F. Gunthard, D. V. Havlir, C. C. Ignacio, C. A. Spina, and D. D. Richman. 1997. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 278:1291-1295. 295. Wright, C. M., B. K. Felber, H. Paskalis, and G. N. Pavlakis. 1986. Expression and characterization of the trans-activator of HTLV-III/LAV virus. Science 234:988-992. 296. Wu, D. Y., G. V. Kalpana, S. P. Goff, and W. H. Schubach. 1996. Epstein-Barr virus nuclear protein 2 (EBNA2) binds to a component of the human SNF- SWI complex, hSNF5/Ini1. Journal of Virology 70:6020-6028. 297. Wu, D. Y., A. Krumm, and W. H. Schubach. 2000. Promoter-specific targeting of human SWI-SNF complex by Epstein-Barr virus nucelar protein 2. Journal of Virology 74:8893-8903. 298. Wyatt, R., and J. G. Sodroski. 1998. The HIV-1 envelope glycoproteins: fusogens, antigens, and immunogens. Science 280:1884-1888. 299. Xu, C., C. Bian, W. Yang, M. Galka, H. Ouyang, C. Chen, W. Qiu, H. Liu, A. E. Jones, F. MacKenzie, P. Pan, S. S.-C. Li, H. Wang, and J. Min. 2010. Binding of different histone marks differentially regulates the activity and specificity of polycomb repressive ocmplex 2 (PRC2). PNAS 107:19266-19271. 300. Yadav, A., and R. G. Collman. 2009. CNS Inflammation and Macrophage/Microglial Biology Associated with HIV-1 Infection. Journal of Neuroimmune Pharmacology 4. 301. Yamaguchi, Y., N. Inukai, T. Narita, T. Wada, and H. Handa. 2002. Evidence that negative elongation factor represses transcription elongation through binding to a DRB sensitivity-inducing factor/RNA polymerase II complex and RNA. Mol. Cell. Biol. 22:2918-27. 302. Yamaguchi, Y., T. Takagi, T. Wada, K. Yano, A. Furuya, S. Sugimoto, J. Hasegawa, and H. Handa. 1999. NELF, a multisubunit complex containing RD, cooperates with DSIF to repress RNA polymerase II elongation. Cell 97:41-51. 303. Yamashita, M., and M. Emerman. 2005. The Cell Cycle Independence of HIV Infections Is Not Determined by Known Karyophilic Viral Elements. PLoS Pathog. 1:e18. 304. Yang, H. C., S. Xing, L. Shan, K. O'Connell, J. Dinoso, A. Shen, Y. Zhou, C. K. Shrum, Y. Han, J. O. Liu, H. Zhang, J. B. Margolick, and R. F. Siliciano. 2009. Small-molecule screening using a human primary cell model of HIV latency identifies compounds that reverse latency without cellular activation. J. Clin. Invest. 305. Yik, J. H., R. Chen, R. Nishimura, J. L. Jennings, A. J. Link, and Q. Zhou. 2003. Inhibition of P-TEFb (CDK9/Cyclin T) kinase and RNA polymerase II transcription by the coordinated actions of HEXIM1 and 7SK snRNA. Mol. Cell 12:971-82.

156

306. Ylisastigui, L., N. M. Archin, G. Lehrman, R. J. Bosch, and D. M. Margolis. 2004. Coaxing HIV-1 from resting CD4 T cells: histone deacetylase inhibition allows latent viral expression. Aids 18:1101-8. 307. Yu, H. J., M. A. Reuter, and D. McDonald. 2008. HIV traffics through a specialized, surface-accessible intracellular compartment during trans- infection of T cells by mature dendritic cells. PLoS Pathogens 4:e1000134. 308. Yu, X., X. Yuan, Z. Matsuda, T. H. Lee, and M. Essex. 1992. The matrix protein of human immunodeficiency virus type 1 is required for incorporation of viral envelope protein into mature virions. Journal of Virology 66:4966-4971. 309. Zeng, W., A. R. Ball Jr., and K. Yokomori. 2010. HP1: heterochromatin binding proteins working teh genome. Epigenetics 5:287-292. 310. Zennou, V., C. Petit, D. Guetard, U. Nerhbass, L. Montagnier, and P. Charneau. 2000. HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 101:173-85. 311. Zhang, H., and J. C. Reese. 2007. Exposing the core promoter is sufficient to activate transcription and alter coactivator requirement at RNR3. Proceedings of the National Academy of Sciences 104:8833-8838. 312. Zhang, M. H., B. Yang, R. J. Pomerantz, C. Zhang, S. C. Arunachalam, and L. Gao. 2003. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature 424:94-98. 313. Zhao, K., W. Wang, O. J. Rando, Y. Xue, K. Swiderek, A. Kuo, and G. R. Crabtree. 1998. Rapid and Phosphoinositol-Dependent Binding of the SWI/SNF-like BAF Complex to Chromatin after T Lymphocyte Receptor Signaling. Cell 95:625-636. 314. Zhou, H., M. Xu, Q. Huang, A. T. Gates, X. D. Zhang, J. C. Castle, E. Stec, M. Ferrer, B. Strulovici, D. J. Hazuda, and A. S. Espeseth. 2008. Genome-scale RNAi screen for host factors required for HIV replication. Cell Host Microbe 4:495-504. 315. Zhou, Y., H. Zhang, J. D. Siliciano, and R. F. Siliciano. 2005. Kinetics of human immunodeficiency virus type 1 decay following entry into resting CD4+ T cells. J. Virol. 79:2199-210.

157