DOCSLIB.ORG

Association Between the Ionotropic Glutamate Receptor Kainate 3

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Association Between the Ionotropic Glutamate Receptor Kainate 3 Molecular Psychiatry (2002) 7, 416–418 2002 Nature Publishing Group All rights reserved 1359-4184/02 $25.00 www.nature.com/mp ORIGINAL RESEARCH ARTICLE Association between the ionotropic glutamate receptor kainate 3 (GRIK3) ser310ala polymorphism and schizophrenia S Begni1, M Popoli2, S Moraschi1, S Bignotti3, GB Tura3 and M Gennarelli1 1Genetics Unit, IRCCS ‘S Giovanni di Dio’, Fatebenefratelli, 25123 Brescia, Italy; 2Center of Neuropharmacology, Institute of Pharmacological Sciences, University of Milan, 20133 Milan, Italy; 3Psychiatric Rehabilitation Unit, IRCCS ‘S Giovanni di Dio’, Fatebenefratelli, 25123 Brescia, Italy Keywords: association study; cSNP; expression; kainate through ionotropic glutamate receptors influences the receptor; neuronal plasticity regulation of transcriptional, translational and post- Schizophrenia is a severe psychiatric illness character- translational processes fundamental for the function of ised by disturbance of thought, hallucination and brain cells.3 delusions.1 Several studies have suggested that dys- One of the hypotheses about the molecular mech- functions in the glutamatergic transmission are linked anisms leading to schizophrenia is the presence of an to the pathogenesis of schizophrenia, and in particular excessive activation of glutamate receptors. An an excessive activation of glutamate receptors seems to increase in the basic metabolic activity along the gluta- be related to the disruption of neuronal ionic gradients matergic axons has been demonstrated by PET scan leading to excitotoxicity.2–7 Numerous findings sug- studies in the cingulate cortex and hippocampal region gested that the kainate ionotropic glutamate receptors 4,5 are primarily involved in this mechanism. Recently it of schizophrenic patients. It has been hypothesised has been demonstrated that the GRIK3 gene encoding that this may cause a progressive excitotoxic cell death for the ionotropic glutamate receptor kainate 3 contains through the disruption of ionic gradients and the a functional polymorphism (T928G) leading to the sub- increase of intracellular calcium concentration.6,7 stitution of a serine with an alanine in position 310 of Numerous findings suggested that ionotropic recep- the protein sequence.8–11 We performed an association tors of the kainate subtype, composed by the low affin- study between the ser310ala GRIK3 polymorphism and ity subunits GRIK1, GRIK2, GRIK3, and the high affinity schizophrenia in a sample of 99 schizophrenic patients subunits GRIK4 and GRIK5, are candidates involved in and 116 controls. We found a significant difference in the induction of excitotoxicity.6,8 The measurement of the genotype distribution and in particular considering expression levels of the ionotropic glutamate receptors the ala allele as dominant (P = 0.0105, odds ratio (OR) 2.031, 95% confidence interval (CI) 1.177–3.504). This in different brain areas from schizophrenic patients finding suggests a potential role for GRIK3 for suscepti- and healthy controls showed a general decrease of KA bility to schizophrenia. subtype expression, except for the GRIK3 subunit that Molecular Psychiatry (2002) 7, 416–418. DOI: 10.1038/ appears to be expressed at higher levels in schizo- sj/mp/4000987 phrenics than in controls.9 The GRIK3 subunit shares the same structural organ- Schizophrenia is a severe psychiatric illness character- isation of all ionotropic receptors, consisting in an ised by disturbance of thought, hallucinations and extracellular N-terminus, three transmembrane delusions. Family, twin and adoption studies strongly domains (TMDs) A, B and C, and an intracellular C- evidenced genetic susceptibility and a pattern of terminus. The pore-forming region is located between inheritance belonging to the class of multifactorial the TMDs A and B, and the ligand binding site com- complex disorders.1 Many hypotheses have been made prises two polypeptide segments (S1 and S2). S1 to explain the pathophysiology of schizophrenia and domain is located in the N-terminus upstream of the several studies suggest that dysfunctions in metab- TMD A and the S2 domain in the extracellular loop olism of neurotransmitters, such as dopamine, sero- that joins the TMDs B and C.10 tonin and glutamate, are directly implicated in the Kainate receptors have at least one gln/arg (Q/R) pathogenesis of this severe illness. A growing number post-transcriptional editing site and the change of the of studies focused the attention on dysfunctions in glu- glutamine in an arginine in the pore-forming region of tamatergic pathway as a major susceptibility factor the protein reduces calcium permeability. GRIK3 con- for schizophrenia.2 tains a gln/arg site in position 352 of the protein Glutamate receptors are widely expressed in the cen- sequence but it always remains unedited and it has tral nervous system and play a fundamental role in been recently demonstrated that a second putative edit- synaptic plasticity and in all the processes underlying ing site is in fact a genetic polymorphism (T928G) and learning and memory. In particular the calcium influx that the T→G variation leads to a serine→alanine Association between GRIK3 and schizophrenia S Begni et al 417 change in position 310 in the extracellular N-terminus These results and the relative stability of ala310 of the protein.8,11 Schiffer and colleagues have ana- allele could explain an increase of GRIK3 expression lysed the expression rates of the two GRIK3 allelic vari- found in schizophrenics brain. Furthermore it is poss- ants in different brain areas from heterozygous T/G ible that ala310 GRIK3 variant escapes the down-regu- healthy people and neuropsychiatric patients. In all the lation occurring to the kainate receptors in schizo- individuals there were large differences in the phrenics’ brain, and affects such functions as receptor expression levels, but in general the T allele was more desensitization or ligand binding with the same mech- frequently associated with lower expression levels and anism recently described for another ionotropic gluta- the G allele was expressed at higher rates. They con- mate receptor, where a single amino acid substitution cluded that to date this is the first example of a genetic acts as dominant by completely blocking the desensit- polymorphism that affects the primary structure of a ization of the entire receptor.13–15 However further human ionotropic glutamate receptor subunit.8 expression studies in vivo are required to clarify the We have assayed for functional differences in the function of these GRIK3 polymorphic variants. amino acidic sequence of the two GRIK3 isoforms by In conclusion, these findings confirm the involve- using the proteomics tools ProtParam, Prosite, ment of the ionotropic glutamate receptors in schizo- PREDATOR available on ExPASy web site phrenia and suggest a specific role of the GRIK3 gene (http://www.expasy.ch/) and the analysis showed no in the susceptibility to the disease. significant differences for almost all the biochemical- biophysical parameters. Only the analysis of the insta- Methods bility index (II) showed a difference, and we found that ala310 had an II value of 39.08, suggesting that the pro- Patients recruitment and clinical assessment tein is stable, and instead ser310 had a value of 40.26, Ninety-nine schizophrenic patients, recruited from the suggesting protein instability.12 Psychiatric Rehabilitation Centre IRCCS S Giovanni di To investigate the role of this polymorphism in Dio, Fatebenefratelli (Brescia, Italy), and 116 unrelated schizophrenia we have analysed in a case-control healthy controls gave written informed consent to par- association study the allele frequencies and the geno- ticipate in this study, as recommended by the Ethics type distributions in a population of 99 schizophrenic Committee of the Centre. All the individuals were Cau- patients and 116 unaffected controls. Allele fre- casoid living in Northern Italy. quencies, genotype distributions and the statistical All the patients met the diagnostic criteria of DSM- analysis are shown in Table 1. Both the populations IV for schizophrenia as diagnosed by two psychiatrists were in Hardy–Weinberg equilibrium (P = 0.3556) and using the Structured Clinical Interview for DSM-IV the allelic frequencies in our controls did not differ Patient Edition (SCID-P). The Brief Psychiatric Rating from data previously reported (P = 0.7761).8 The allele Scale (BPRS) was used to evaluate symptoms. frequency came close to statistical significance (P = 0.0694) with an excess of ala allele in schizophrenic Sample collection patients. This excess was evidenced by the genotype A7–10 ml peripheral blood sample was collected from distribution that was significantly different (␹2 = 7.98, each individual and stored at −20°C before use. P = 0.019). Furthermore considering ala allele as domi- nant the difference in the distribution was even more Nucleic acid purification and PCR significant (P = 0.0105) with an OR = 2.031, 95% CI Genomic DNA was extracted from leukocytes accord- 1.177–3.504. This suggests that ser310ala dimorphism ing to a standard method (salting out). The GRIK3 in the GRIK3 gene is associated with schizophrenia (GenBank accession number U16127) single nucleotide with a potential role of ala310 allele. polymorphism T/G in position 928 was screened by a PCR amplification followed by digestion with a restric- tion endonuclease. The primers used for the PCR were Table 1 Allele and genotype frequencies of the GRIK3 GRIK3-F (forward) 5Ј ATTCCGGATTCTCAATGTGG 3Ј ser310ala polymorphism and GRIK3-R (reverse) 5Ј GGGAGTTCACGG TCATCTGT 3Ј. PCR conditions were denaturation at Patients Controls 94°C for 5 min followed by 35 cycles at 94°C for 30 s, = = (n 99) (n 116) 58°C for 30 s, 72°C for 30 s with a final elongation step at 72°C for 5 min. The PCR products were digested Allele frequency overnight at 25°C with 5 units of the restriction endo- ser allele 130 (0.65) 171 (0.737) nuclease SmaI (Promega, Madison, WI, USA) and elec- ala allele 68 (0.35) 61 (0.263) trophoresed on a 2% agarose gel (Gibco BRL, Life Tech- ␹2 = 3.297 (df = 1); P = 0.0694 nologies, Paisley, UK).
Load more

Recommended publications
  • Thyroid Hormone Influences Brain Gene Expression Programs And
    Molecular Psychiatry https://doi.org/10.1038/s41380-018-0281-4 ARTICLE Thyroid hormone influences brain gene expression programs and behaviors in later generations by altering germ line epigenetic information 1 2,3 1 1 1 M. Elena Martinez ● Christine W. Duarte ● J. Patrizia Stohn ● Aldona Karaczyn ● Zhaofei Wu ● 1 1,3,4 Victoria E DeMambro ● Arturo Hernandez Received: 30 March 2018 / Revised: 16 August 2018 / Accepted: 26 September 2018 © Springer Nature Limited 2018 Abstract Genetic factors do not fully account for the relatively high heritability of neurodevelopmental conditions, suggesting that non-genetic heritable factors contribute to their etiology. To evaluate the potential contribution of aberrant thyroid hormone status to the epigenetic inheritance of neurological phenotypes, we examined genetically normal F2 generation descendants of mice that were developmentally overexposed to thyroid hormone due to a Dio3 mutation. Hypothalamic gene expression profiling in postnatal day 15 F2 descendants on the paternal lineage of ancestral male and female T3-overexposed mice 1234567890();,: 1234567890();,: revealed, respectively, 1089 and 1549 differentially expressed genes. A large number of them, 675 genes, were common to both sets, suggesting comparable epigenetic effects of thyroid hormone on both the male and female ancestral germ lines. Oligodendrocyte- and neuron-specific genes were strongly overrepresented among genes showing, respectively, increased and decreased expression. Altered gene expression extended to other brain regions and was associated in adulthood with decreased anxiety-like behavior, increased marble burying and reduced physical activity. The sperm of T3-overexposed male ancestors revealed significant hypomethylation of CpG islands associated with the promoters of genes involved in the early development of the central nervous system.
    [Show full text]
  • Downloaded from the National Database for Autism Research (NDAR)
    International Journal of Molecular Sciences Article Phenotypic Subtyping and Re-Analysis of Existing Methylation Data from Autistic Probands in Simplex Families Reveal ASD Subtype-Associated Differentially Methylated Genes and Biological Functions Elizabeth C. Lee y and Valerie W. Hu * Department of Biochemistry and Molecular Medicine, The George Washington University, School of Medicine and Health Sciences, Washington, DC 20037, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-202-994-8431 Current address: W. Harry Feinstone Department of Molecular Microbiology and Immunology, y Johns Hopkins Bloomberg School of Public Health, Baltimore, MD 21205, USA. Received: 25 August 2020; Accepted: 17 September 2020; Published: 19 September 2020 Abstract: Autism spectrum disorder (ASD) describes a group of neurodevelopmental disorders with core deficits in social communication and manifestation of restricted, repetitive, and stereotyped behaviors. Despite the core symptomatology, ASD is extremely heterogeneous with respect to the severity of symptoms and behaviors. This heterogeneity presents an inherent challenge to all large-scale genome-wide omics analyses. In the present study, we address this heterogeneity by stratifying ASD probands from simplex families according to the severity of behavioral scores on the Autism Diagnostic Interview-Revised diagnostic instrument, followed by re-analysis of existing DNA methylation data from individuals in three ASD subphenotypes in comparison to that of their respective unaffected siblings. We demonstrate that subphenotyping of cases enables the identification of over 1.6 times the number of statistically significant differentially methylated regions (DMR) and DMR-associated genes (DAGs) between cases and controls, compared to that identified when all cases are combined. Our analyses also reveal ASD-related neurological functions and comorbidities that are enriched among DAGs in each phenotypic subgroup but not in the combined case group.
    [Show full text]
  • A Guide to Glutamate Receptors
    A guide to glutamate receptors 1 Contents Glutamate receptors . 4 Ionotropic glutamate receptors . 4 - Structure ........................................................................................................... 4 - Function ............................................................................................................ 5 - AMPA receptors ................................................................................................. 6 - NMDA receptors ................................................................................................. 6 - Kainate receptors ............................................................................................... 6 Metabotropic glutamate receptors . 8 - Structure ........................................................................................................... 8 - Function ............................................................................................................ 9 - Group I: mGlu1 and mGlu5. .9 - Group II: mGlu2 and mGlu3 ................................................................................. 10 - Group III: mGlu4, mGlu6, mGlu7 and mGlu8 ............................................................ 10 Protocols and webinars . 11 - Protocols ......................................................................................................... 11 - Webinars ......................................................................................................... 12 References and further reading . 13 Excitatory synapse pathway
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Kainate Receptors in Health and Disease
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Neuron Review Kainate Receptors in Health and Disease Juan Lerma1,* and Joana M. Marques1 1Instituto de Neurociencias, CSIC-UMH, San Juan de Alicante, 03550 Spain *Correspondence: [email protected] http://dx.doi.org/10.1016/j.neuron.2013.09.045 Our understanding of the molecular properties of kainate receptors and their involvement in synaptic phys- iology has progressed significantly over the last 30 years. A plethora of studies indicate that kainate receptors are important mediators of the pre- and postsynaptic actions of glutamate, although the mechanisms under- lying such effects are still often a topic for discussion. Three clear fields related to their behavior have emerged: there are a number of interacting proteins that pace the properties of kainate receptors; their activity is unconventional since they can also signal through G proteins, behaving like metabotropic recep- tors; they seem to be linked to some devastating brain diseases. Despite the significant progress in their importance in brain function, kainate receptors remain somewhat puzzling. Here we examine discoveries linking these receptors to physiology and their probable implications in disease, in particular mood disorders, and propose some ideas to obtain a deeper understanding of these intriguing proteins. A Historical Overview The absence of specific antibodies against different KAR Most excitatory synapses in the brain use the amino acid gluta- subunits has been a significant limitation in terms of exploring re- mate as a neurotransmitter. Since the excitatory properties of ceptor distribution. Thus, most of the information regarding their glutamate were postulated nearly 40 years ago, an extraordinary tissue expression comes from in situ hybridization studies that, wealth of data has accumulated on the types of synaptic re- although informative, cannot reveal the subcellular distribution sponses triggered by this neurotransmitter.
    [Show full text]
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Sex Differences in Glutamate Receptor Gene Expression in Major Depression and Suicide
    Molecular Psychiatry (2015) 20, 1057–1068 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp IMMEDIATE COMMUNICATION Sex differences in glutamate receptor gene expression in major depression and suicide AL Gray1, TM Hyde2,3, A Deep-Soboslay2, JE Kleinman2 and MS Sodhi1,4 Accumulating data indicate that the glutamate system is disrupted in major depressive disorder (MDD), and recent clinical research suggests that ketamine, an antagonist of the N-methyl-D-aspartate (NMDA) glutamate receptor (GluR), has rapid antidepressant efficacy. Here we report findings from gene expression studies of a large cohort of postmortem subjects, including subjects with MDD and controls. Our data reveal higher expression levels of the majority of glutamatergic genes tested in the dorsolateral prefrontal cortex (DLPFC) in MDD (F21,59 = 2.32, P = 0.006). Posthoc data indicate that these gene expression differences occurred mostly in the female subjects. Higher expression levels of GRIN1, GRIN2A-D, GRIA2-4, GRIK1-2, GRM1, GRM4, GRM5 and GRM7 were detected in the female patients with MDD. In contrast, GRM5 expression was lower in male MDD patients relative to male controls. When MDD suicides were compared with MDD non-suicides, GRIN2B, GRIK3 and GRM2 were expressed at higher levels in the suicides. Higher expression levels were detected for several additional genes, but these were not statistically significant after correction for multiple comparisons. In summary, our analyses indicate a generalized disruption of the regulation of the GluRs in the DLPFC of females with MDD, with more specific GluR alterations in the suicides and in the male groups.
    [Show full text]
  • Chapter Chapter 2
    Chapter Chapter 2 Attenuated AMPA receptor expression allows glioblastoma cell survival in glutamate-rich environment Dannis G. van Vuurden, Maryam Yazdani, Ingeborg Bosma, Richard A.J.F. Broekhuizen, Tjeerd J. Postma, Jan J. Heimans, Paul van der Valk, Eleonora Aronica, Bakhos A. Tannous, Thomas Würdinger, Gertjan J. L. Kaspers, Jacqueline Cloos PLoS ONE 2009; 4(6): e5953 23 Proefschrift1.indd 23 24-04-14 13:54 ABSTRACT Background: Glioblastoma multiforme (GBM) cells secrete large amounts of glutamate that can trigger AMPA-type glutamate receptors (AMPARs). This commonly results in Na+ and Ca2+-permeability and thereby in excitotoxic cell death of the surrounding neurons. Here we investigated how the GBM cells themselves survive in a glutamate-rich environment. Methods and Findings: In silico analysis of published reports shows down-regulation of all ionotropic glutamate receptors in GBM as compared to normal brain. In vitro, in all GBM samples tested, mRNA expression of AMPAR subunit GluR1, 2 and 4 was relatively low compared to adult and fetal total brain mRNA and adult cerebellum mRNA. These findings were in line with primary GBM samples, in which protein expression patterns were down- regulated as compared to the normal tissue. Furthermore, mislocalized expression of these receptors was found. Sequence analysis of GluR2 RNA in primary and established GBM cell lines showed that the GluR2 subunit was found to be partly unedited. Conclusions: Together with the lack of functional effect of AMPAR inhibition by NBQX our results suggest that down-regulation and non-functionality of AMPARs, enable GBM cells to survive in a high glutamate environment without going into excitotoxic cell death themselves.
    [Show full text]
  • Gene Expression Studies in Depression Development and Treatment
    Mariani et al. Translational Psychiatry (2021) 11:354 https://doi.org/10.1038/s41398-021-01469-6 Translational Psychiatry REVIEW ARTICLE Open Access Gene expression studies in Depression development and treatment: an overview of the underlying molecular mechanisms and biological processes to identify biomarkers Nicole Mariani 1, Nadia Cattane2,CarminePariante 1 and Annamaria Cattaneo 2,3 Abstract A combination of different risk factors, such as genetic, environmental and psychological factors, together with immune system, stress response, brain neuroplasticity and the regulation of neurotransmitters, is thought to lead to the development of major depressive disorder (MDD). A growing number of studies have tried to investigate the underlying mechanisms of MDD by analysing the expression levels of genes involved in such biological processes. These studies have shown that MDD is not just a brain disorder, but also a body disorder, and this is mainly due to the interplay between the periphery and the Central Nervous System (CNS). To this purpose, most of the studies conducted so far have mainly dedicated to the analysis of the gene expression levels using postmortem brain tissue as well as peripheral blood samples of MDD patients. In this paper, we reviewed the current literature on candidate gene expression alterations and the few existing transcriptomics studies in MDD focusing on inflammation, neuroplasticity, neurotransmitters and stress-related genes. Moreover, we focused our attention on studies, which have investigated 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; mRNA levels as biomarkers to predict therapy outcomes. This is important as many patients do not respond to antidepressant medication or could experience adverse side effects, leading to the interruption of treatment.
    [Show full text]
  • Supplementary Material
    Supplementary Material Table S1: Significant downregulated KEGGs pathways identified by DAVID following exposure to five cinnamon- based phenylpropanoids (p < 0.05). p-value Term: Genes (Benjamini) Cytokine-cytokine receptor interaction: FASLG, TNFSF14, CXCL11, IL11, FLT3LG, CCL3L1, CCL3L3, CXCR6, XCR1, 2.43 × 105 RTEL1, CSF2RA, TNFRSF17, TNFRSF14, CCNL2, VEGFB, AMH, TNFRSF10B, INHBE, IFNB1, CCR3, VEGFA, CCR2, IL12A, CCL1, CCL3, CXCL5, TNFRSF25, CCR1, CSF1, CX3CL1, CCL7, CCL24, TNFRSF1B, IL12RB1, CCL21, FIGF, EPO, IL4, IL18R1, FLT1, TGFBR1, EDA2R, HGF, TNFSF8, KDR, LEP, GH2, CCL13, EPOR, XCL1, IFNA16, XCL2 Neuroactive ligand-receptor interaction: OPRM1, THRA, GRIK1, DRD2, GRIK2, TACR2, TACR1, GABRB1, LPAR4, 9.68 × 105 GRIK5, FPR1, PRSS1, GNRHR, FPR2, EDNRA, AGTR2, LTB4R, PRSS2, CNR1, S1PR4, CALCRL, TAAR5, GABRE, PTGER1, GABRG3, C5AR1, PTGER3, PTGER4, GABRA6, GABRA5, GRM1, PLG, LEP, CRHR1, GH2, GRM3, SSTR2, Chlorogenic acid Chlorogenic CHRM3, GRIA1, MC2R, P2RX2, TBXA2R, GHSR, HTR2C, TSHR, LHB, GLP1R, OPRD1 Hematopoietic cell lineage: IL4, CR1, CD8B, CSF1, FCER2, GYPA, ITGA2, IL11, GP9, FLT3LG, CD38, CD19, DNTT, 9.29 × 104 GP1BB, CD22, EPOR, CSF2RA, CD14, THPO, EPO, HLA-DRA, ITGA2B Cytokine-cytokine receptor interaction: IL6ST, IL21R, IL19, TNFSF15, CXCR3, IL15, CXCL11, TGFB1, IL11, FLT3LG, CXCL10, CCR10, XCR1, RTEL1, CSF2RA, IL21, CCNL2, VEGFB, CCR8, AMH, TNFRSF10C, IFNB1, PDGFRA, EDA, CXCL5, TNFRSF25, CSF1, IFNW1, CNTFR, CX3CL1, CCL5, TNFRSF4, CCL4, CCL27, CCL24, CCL25, CCL23, IFNA6, IFNA5, FIGF, EPO, AMHR2, IL2RA, FLT4, TGFBR2, EDA2R,
    [Show full text]
  • Identification of Key Genes and Pathways Involved in Response To
    Deng et al. Biol Res (2018) 51:25 https://doi.org/10.1186/s40659-018-0174-7 Biological Research RESEARCH ARTICLE Open Access Identifcation of key genes and pathways involved in response to pain in goat and sheep by transcriptome sequencing Xiuling Deng1,2†, Dong Wang3†, Shenyuan Wang1, Haisheng Wang2 and Huanmin Zhou1* Abstract Purpose: This aim of this study was to investigate the key genes and pathways involved in the response to pain in goat and sheep by transcriptome sequencing. Methods: Chronic pain was induced with the injection of the complete Freund’s adjuvant (CFA) in sheep and goats. The animals were divided into four groups: CFA-treated sheep, control sheep, CFA-treated goat, and control goat groups (n 3 in each group). The dorsal root ganglions of these animals were isolated and used for the construction of a cDNA= library and transcriptome sequencing. Diferentially expressed genes (DEGs) were identifed in CFA-induced sheep and goats and gene ontology (GO) enrichment analysis was performed. Results: In total, 1748 and 2441 DEGs were identifed in CFA-treated goat and sheep, respectively. The DEGs identi- fed in CFA-treated goats, such as C-C motif chemokine ligand 27 (CCL27), glutamate receptor 2 (GRIA2), and sodium voltage-gated channel alpha subunit 3 (SCN3A), were mainly enriched in GO functions associated with N-methyl- D-aspartate (NMDA) receptor, infammatory response, and immune response. The DEGs identifed in CFA-treated sheep, such as gamma-aminobutyric acid (GABA)-related DEGs (gamma-aminobutyric acid type A receptor gamma 3 subunit [GABRG3], GABRB2, and GABRB1), SCN9A, and transient receptor potential cation channel subfamily V member 1 (TRPV1), were mainly enriched in GO functions related to neuroactive ligand-receptor interaction, NMDA receptor, and defense response.
    [Show full text]
  • Transcriptomic Profiling of Ca Transport Systems During
    cells Article Transcriptomic Profiling of Ca2+ Transport Systems during the Formation of the Cerebral Cortex in Mice Alexandre Bouron Genetics and Chemogenomics Lab, Université Grenoble Alpes, CNRS, CEA, INSERM, Bâtiment C3, 17 rue des Martyrs, 38054 Grenoble, France; [email protected] Received: 29 June 2020; Accepted: 24 July 2020; Published: 29 July 2020 Abstract: Cytosolic calcium (Ca2+) transients control key neural processes, including neurogenesis, migration, the polarization and growth of neurons, and the establishment and maintenance of synaptic connections. They are thus involved in the development and formation of the neural system. In this study, a publicly available whole transcriptome sequencing (RNA-Seq) dataset was used to examine the expression of genes coding for putative plasma membrane and organellar Ca2+-transporting proteins (channels, pumps, exchangers, and transporters) during the formation of the cerebral cortex in mice. Four ages were considered: embryonic days 11 (E11), 13 (E13), and 17 (E17), and post-natal day 1 (PN1). This transcriptomic profiling was also combined with live-cell Ca2+ imaging recordings to assess the presence of functional Ca2+ transport systems in E13 neurons. The most important Ca2+ routes of the cortical wall at the onset of corticogenesis (E11–E13) were TACAN, GluK5, nAChR β2, Cav3.1, Orai3, transient receptor potential cation channel subfamily M member 7 (TRPM7) non-mitochondrial Na+/Ca2+ exchanger 2 (NCX2), and the connexins CX43/CX45/CX37. Hence, transient receptor potential cation channel mucolipin subfamily member 1 (TRPML1), transmembrane protein 165 (TMEM165), and Ca2+ “leak” channels are prominent intracellular Ca2+ pathways. The Ca2+ pumps sarco/endoplasmic reticulum Ca2+ ATPase 2 (SERCA2) and plasma membrane Ca2+ ATPase 1 (PMCA1) control the resting basal Ca2+ levels.
    [Show full text]