Molecular Psychiatry (2002) 7, 416–418 2002 Nature Publishing Group All rights reserved 1359-4184/02 $25.00 www.nature.com/mp ORIGINAL RESEARCH ARTICLE Association between the ionotropic glutamate receptor kainate 3 (GRIK3) ser310ala polymorphism and schizophrenia S Begni1, M Popoli2, S Moraschi1, S Bignotti3, GB Tura3 and M Gennarelli1 1Genetics Unit, IRCCS ‘S Giovanni di Dio’, Fatebenefratelli, 25123 Brescia, Italy; 2Center of Neuropharmacology, Institute of Pharmacological Sciences, University of Milan, 20133 Milan, Italy; 3Psychiatric Rehabilitation Unit, IRCCS ‘S Giovanni di Dio’, Fatebenefratelli, 25123 Brescia, Italy Keywords: association study; cSNP; expression; kainate through ionotropic glutamate receptors influences the receptor; neuronal plasticity regulation of transcriptional, translational and post- Schizophrenia is a severe psychiatric illness character- translational processes fundamental for the function of ised by disturbance of thought, hallucination and brain cells.3 delusions.1 Several studies have suggested that dys- One of the hypotheses about the molecular mech- functions in the glutamatergic transmission are linked anisms leading to schizophrenia is the presence of an to the pathogenesis of schizophrenia, and in particular excessive activation of glutamate receptors. An an excessive activation of glutamate receptors seems to increase in the basic metabolic activity along the gluta- be related to the disruption of neuronal ionic gradients matergic axons has been demonstrated by PET scan leading to excitotoxicity.2–7 Numerous findings sug- studies in the cingulate cortex and hippocampal region gested that the kainate ionotropic glutamate receptors 4,5 are primarily involved in this mechanism. Recently it of schizophrenic patients. It has been hypothesised has been demonstrated that the GRIK3 gene encoding that this may cause a progressive excitotoxic cell death for the ionotropic glutamate receptor kainate 3 contains through the disruption of ionic gradients and the a functional polymorphism (T928G) leading to the sub- increase of intracellular calcium concentration.6,7 stitution of a serine with an alanine in position 310 of Numerous findings suggested that ionotropic recep- the protein sequence.8–11 We performed an association tors of the kainate subtype, composed by the low affin- study between the ser310ala GRIK3 polymorphism and ity subunits GRIK1, GRIK2, GRIK3, and the high affinity schizophrenia in a sample of 99 schizophrenic patients subunits GRIK4 and GRIK5, are candidates involved in and 116 controls. We found a significant difference in the induction of excitotoxicity.6,8 The measurement of the genotype distribution and in particular considering expression levels of the ionotropic glutamate receptors the ala allele as dominant (P = 0.0105, odds ratio (OR) 2.031, 95% confidence interval (CI) 1.177–3.504). This in different brain areas from schizophrenic patients finding suggests a potential role for GRIK3 for suscepti- and healthy controls showed a general decrease of KA bility to schizophrenia. subtype expression, except for the GRIK3 subunit that Molecular Psychiatry (2002) 7, 416–418. DOI: 10.1038/ appears to be expressed at higher levels in schizo- sj/mp/4000987 phrenics than in controls.9 The GRIK3 subunit shares the same structural organ- Schizophrenia is a severe psychiatric illness character- isation of all ionotropic receptors, consisting in an ised by disturbance of thought, hallucinations and extracellular N-terminus, three transmembrane delusions. Family, twin and adoption studies strongly domains (TMDs) A, B and C, and an intracellular C- evidenced genetic susceptibility and a pattern of terminus. The pore-forming region is located between inheritance belonging to the class of multifactorial the TMDs A and B, and the ligand binding site com- complex disorders.1 Many hypotheses have been made prises two polypeptide segments (S1 and S2). S1 to explain the pathophysiology of schizophrenia and domain is located in the N-terminus upstream of the several studies suggest that dysfunctions in metab- TMD A and the S2 domain in the extracellular loop olism of neurotransmitters, such as dopamine, sero- that joins the TMDs B and C.10 tonin and glutamate, are directly implicated in the Kainate receptors have at least one gln/arg (Q/R) pathogenesis of this severe illness. A growing number post-transcriptional editing site and the change of the of studies focused the attention on dysfunctions in glu- glutamine in an arginine in the pore-forming region of tamatergic pathway as a major susceptibility factor the protein reduces calcium permeability. GRIK3 con- for schizophrenia.2 tains a gln/arg site in position 352 of the protein Glutamate receptors are widely expressed in the cen- sequence but it always remains unedited and it has tral nervous system and play a fundamental role in been recently demonstrated that a second putative edit- synaptic plasticity and in all the processes underlying ing site is in fact a genetic polymorphism (T928G) and learning and memory. In particular the calcium influx that the T→G variation leads to a serine→alanine Association between GRIK3 and schizophrenia S Begni et al 417 change in position 310 in the extracellular N-terminus These results and the relative stability of ala310 of the protein.8,11 Schiffer and colleagues have ana- allele could explain an increase of GRIK3 expression lysed the expression rates of the two GRIK3 allelic vari- found in schizophrenics brain. Furthermore it is poss- ants in different brain areas from heterozygous T/G ible that ala310 GRIK3 variant escapes the down-regu- healthy people and neuropsychiatric patients. In all the lation occurring to the kainate receptors in schizo- individuals there were large differences in the phrenics’ brain, and affects such functions as receptor expression levels, but in general the T allele was more desensitization or ligand binding with the same mech- frequently associated with lower expression levels and anism recently described for another ionotropic gluta- the G allele was expressed at higher rates. They con- mate receptor, where a single amino acid substitution cluded that to date this is the first example of a genetic acts as dominant by completely blocking the desensit- polymorphism that affects the primary structure of a ization of the entire receptor.13–15 However further human ionotropic glutamate receptor subunit.8 expression studies in vivo are required to clarify the We have assayed for functional differences in the function of these GRIK3 polymorphic variants. amino acidic sequence of the two GRIK3 isoforms by In conclusion, these findings confirm the involve- using the proteomics tools ProtParam, Prosite, ment of the ionotropic glutamate receptors in schizo- PREDATOR available on ExPASy web site phrenia and suggest a specific role of the GRIK3 gene (http://www.expasy.ch/) and the analysis showed no in the susceptibility to the disease. significant differences for almost all the biochemical- biophysical parameters. Only the analysis of the insta- Methods bility index (II) showed a difference, and we found that ala310 had an II value of 39.08, suggesting that the pro- Patients recruitment and clinical assessment tein is stable, and instead ser310 had a value of 40.26, Ninety-nine schizophrenic patients, recruited from the suggesting protein instability.12 Psychiatric Rehabilitation Centre IRCCS S Giovanni di To investigate the role of this polymorphism in Dio, Fatebenefratelli (Brescia, Italy), and 116 unrelated schizophrenia we have analysed in a case-control healthy controls gave written informed consent to par- association study the allele frequencies and the geno- ticipate in this study, as recommended by the Ethics type distributions in a population of 99 schizophrenic Committee of the Centre. All the individuals were Cau- patients and 116 unaffected controls. Allele fre- casoid living in Northern Italy. quencies, genotype distributions and the statistical All the patients met the diagnostic criteria of DSM- analysis are shown in Table 1. Both the populations IV for schizophrenia as diagnosed by two psychiatrists were in Hardy–Weinberg equilibrium (P = 0.3556) and using the Structured Clinical Interview for DSM-IV the allelic frequencies in our controls did not differ Patient Edition (SCID-P). The Brief Psychiatric Rating from data previously reported (P = 0.7761).8 The allele Scale (BPRS) was used to evaluate symptoms. frequency came close to statistical significance (P = 0.0694) with an excess of ala allele in schizophrenic Sample collection patients. This excess was evidenced by the genotype A7–10 ml peripheral blood sample was collected from distribution that was significantly different (␹2 = 7.98, each individual and stored at −20°C before use. P = 0.019). Furthermore considering ala allele as domi- nant the difference in the distribution was even more Nucleic acid purification and PCR significant (P = 0.0105) with an OR = 2.031, 95% CI Genomic DNA was extracted from leukocytes accord- 1.177–3.504. This suggests that ser310ala dimorphism ing to a standard method (salting out). The GRIK3 in the GRIK3 gene is associated with schizophrenia (GenBank accession number U16127) single nucleotide with a potential role of ala310 allele. polymorphism T/G in position 928 was screened by a PCR amplification followed by digestion with a restric- tion endonuclease. The primers used for the PCR were Table 1 Allele and genotype frequencies of the GRIK3 GRIK3-F (forward) 5Ј ATTCCGGATTCTCAATGTGG 3Ј ser310ala polymorphism and GRIK3-R (reverse) 5Ј GGGAGTTCACGG TCATCTGT 3Ј. PCR conditions were denaturation at Patients Controls 94°C for 5 min followed by 35 cycles at 94°C for 30 s, = = (n 99) (n 116) 58°C for 30 s, 72°C for 30 s with a final elongation step at 72°C for 5 min. The PCR products were digested Allele frequency overnight at 25°C with 5 units of the restriction endo- ser allele 130 (0.65) 171 (0.737) nuclease SmaI (Promega, Madison, WI, USA) and elec- ala allele 68 (0.35) 61 (0.263) trophoresed on a 2% agarose gel (Gibco BRL, Life Tech- ␹2 = 3.297 (df = 1); P = 0.0694 nologies, Paisley, UK).