Human Immunodeficiency Virus Type 1 VPU Protein Affects Sindbis Virus Glycoprotein Processing and Enhances Membrane Permeabilization

Home , E1 (HCV), Early 35 kDa protein, Vpu protein

Virology 279, 201–209 (2001) doi:10.1006/viro.2000.0708, available online at http://www.idealibrary.com on

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector Human Immunodeficiency Virus Type 1 VPU Protein Affects Sindbis Virus Glycoprotein Processing and Enhances Membrane Permeabilization

Marı´a Eugenia Gonza´lez1 and Luis Carrasco

Centro de Biologı´a Molecular CSIC-UAM, Universidad Auto´noma de Madrid, Cantoblanco, 28049 Madrid, Spain Received July 3, 2000; returned to author for revision August 8, 2000; accepted October 11, 2000

The human immunodeficiency virus type 1 (HIV-1) Vpu is an integral membrane protein that forms oligomeric structures in membranes. Expression of vpu using Sindbis virus (SV) as a vector leads to permeabilization of plasma membrane to hydrophilic molecules and impaired maturation of wild type SV glycoproteins in BHK cells. The 6K protein is a membrane protein encoded in the SV genome that facilitates budding of virus particles and regulates transport of viral glycoproteins through the secretory pathway. Some of these functions were assayed with a SV mutant containing a partially deleted 6K gene. Transfection of BHK cells with pSV⌬6K vector rendered defective SV⌬6K virus, which had lower membrane permeabilization, impaired glycoprotein processing, and deficient virion budding. Replacement of 6K function by HIV-1 Vpu in SV⌬6K was tested by cloning the vpu gene under a duplicated late promoter (pSV⌬6KVpu). The presence of the vpu gene in the 6K-deleted virus enhances membrane permeability, modifies glycoprotein precursor processing, and facilitates infectious virus particle production. Restoration of infectivity of 6K-deleted SV by Vpu was evidenced by increased PFU production and cytopathic effect on infected cells. The modification of SV⌬6K glycoprotein maturation by Vpu was reflected in augmented processing of B precursor and impairment of PE2 cleavage. Taken together, our data support the notion that HIV-1 Vpu and SV 6K proteins share some analogous functions. © 2001 Academic Press Key Words: HIV-1; Vpu; accessory protein; membrane permeability; glycoprotein processing; membrane proteins; viral pathogenesis; Sindbis virus; 6K; alphavirus vector; gene expression.

INTRODUCTION coli and mammalian cells (Gonza´lez and Carrasco, 1998). Replication of Vpu-deficient HIV-1 gives rise to Vpu is a regulatory protein encoded by human immuno- intracytoplasmic particles with aberrant morphology deficiency virus type 1 (HIV-1) (Cohen et al., 1988; Strebel et (Klimkait et al., 1990), associated with the cell surface of al., 1988). Vpu is an integral type I membrane phosphopro- infected cells and connected to each other by short tein that forms homo-oligomers in membranes (Maldarelli stalks (Iwatani et al., 1997). On the other hand, Vpu et al., 1993). Vpu has not been found in virus particles. interacts with the cytoplasmic domain of CD4 within the Immunofluorescence microscopic studies in mammalian cells showed major perinuclear localization of Vpu (Klimkait ER and this specific interaction induces degradation of et al., 1990; Kimura et al., 1994) as well as a minor localiza- CD4 (Chen et al., 1993; Lenburg and Landau, 1993). tion at the cell membrane in a later stage of infection Moreover, the presence of Vpu in the ER–Golgi network (Schubert et al., 1992; Friborg et al., 1995). Vpu synthesized is required for efficient processing of envelope gp160 by E. coli cells appears in a crude membrane fraction, protein (Willey et al., 1992b). In addition, Vpu interferes integrally associated with the outer membrane (Gonza´lez with transport of soluble gp120 and secretion of G pro- and Carrasco, 1998). The dual location of Vpu is intriguing, tein of VSV, and diminishes expression of MHC-I and with many observations pointing to the presence of Vpu in other membrane proteins. Changes mediated by Vpu in the endoplasmic reticulum (ER)–Golgi network and also in the biosynthesis (Coady et al., 1998), trafficking (Vincent plasma membrane. and Jabbar, 1995; Kerkau et al., 1997), or stability of Recent reports implicated Vpu with the modification of proteins (Willey et al., 1992a) were previously proposed membrane functionality. Recombinant Vpu forms cation- to explain inhibition of these membrane proteins. This specific channels when inserted into lipid bilayers and extensive array of inhibitory effects suggests a close also when expressed in E. coli or in Xenopus oocytes interaction between Vpu and the secretory pathway. Ex- (Ewart et al., 1996; Schubert et al., 1996). In addition, Vpu periments using CD4/Vpu hybrids demonstrated that Vpu modifies membrane permeability upon expression in E. in the context of CD4 is capable of reaching the plasma membrane (Raja and Jabbar, 1996). The lack of an extracellular domain and any maturation markers in Vpu 1 To whom correspondence and reprint requests should be ad- makes it technically difficult to follow the progress of the dressed. Fax: 34 91 3974799. E-mail: [email protected]. protein through the secretory pathway.

Alphavirus vectors are convenient tools to study the toradiography of the SDS–PAGE of radioactive-labeled functioning of cellular compartments involved in the se- cells (Fig. 1C). This was confirmed by Western blot anal- cretory pathway. There is evidence that Semliki Forest ysis (Fig. 1D). Levels of Vpu were comparable to those virus vector produces high levels of HIV-1 envelope gly- obtained for other recombinant genes using this expres- coproteins, which are proteolytically processed, folded, sion system (Hahn et al., 1992). and transported to the cell membrane (Paul et al., 1993). Indeed, glycoproteins of HIV-1 and alphavirus envelopes Enhancement of membrane permeability by share the secretory pathway for transport from the ER to recombinant SVVpu: effects on glycoprotein the cell surface (reviewed in Einfeld, 1996; Strauss and maturation Strauss, 1994). Both viruses synthesize a precursor of the envelope protein in the endoplasmic reticulum, and The modification of membrane permeability by Vpu these proteins are glycosylated, modified by chaperone, was analyzed by using the SV expression vector in BHK and oligomerized before reaching the Golgi compart- cells. The plasma cell membrane is nonpermeable to ment. Both envelope precursors acquired Endo-H resis- hydrophilic molecules like hygromycin B (HB), a potent tance in the Golgi and proteolytic cleavage by furin yields inhibitor of translation (Carrasco, 1995). Membrane bar- mature glycoproteins. Moreover, as previously noted, rier integrity of cells transfected with SVWT and SVVpu Vpu and alphavirus 6K proteins share structural and RNAs was tested by analyzing protein synthesis of cells functional similarities (Carrasco, 1995) and also cause treated with different concentrations of HB (Fig. 2). SDS– plasma membrane alterations (Sanz et al., 1994; Gonza´- PAGE analysis of cell lysates demonstrated that treat- lez and Carrasco, 1998). ment with 0.5 mM HB blocks protein synthesis in SV- To explore potential modification of normal protein transfected cells, consistent with previous data using processing through the secretory pathway, Vpu was ex- alphavirus-infected cells (Mun˜oz et al., 1985). Notably, pressed using Sindbis virus (SV) vector. Interestingly, we SVVpu-transfected cells were more sensitive to the inhi- find that proteolytic processing of SV 6K-truncated bition of translation by HB. Enhancement of membrane polyprotein can be complemented in trans by HIV-1 Vpu permeability was not found, however, when other heter- protein. We also find that Vpu complements membrane ologous proteins, such as HIV-1 Vif protein, were synthe- permeabilization capacity of 6K-defective Sindbis virus. sized (Fig. 2). These results are consistent with the idea that the dis- Interference of Vpu protein with maturation of SV gly- ruption of membrane integrity and the modification of coproteins was studied by pulse-chase experiments (Fig. protein-processing compartments by Vpu are connected. 3A). Cells transfected with RNA transcripts that expressed wild type SV genes showed that proteolytic RESULTS processing of PE2 started before 90 min of chase and Expression of vpu by recombinant Sindbis virus was completed 1 h later, yielding mature E2 glycoprotein. By contrast, SV glycoprotein processing was hampered To analyze the functionality of a recombinant viral in SVVpu-transfected cells. Thus, the B precursor of protein, it is desirable that the levels of its expression be about 98 kDa containing all glycoproteins was observed comparable to a genuine viral infection. Some prokary- after the pulse and was processed soon after. In addi- otic and eukaryotic transient expression systems that produce a high level of a single protein are available tion, the PE2 precursor remained uncleaved, even after (Sanz et al., 1994; Gonza´lez and Carrasco, 1998). For that 150 min of chase, such that mature E2 was not detected. purpose, we used a Sindbis virus vector that expressed To further analyze PE2 processing, cells were labeled the vpu gene under the control of an additional SV sub- with radioactive mannose (Fig. 3B). Mannose-labeled genomic promoter rendering pSVVpu plasmid (Fig. 1A). PE2 precursor and E1 glycoproteins were found whether This construct allowed the possibility of introducing into or not Vpu was present in transfected cells. Notably, cells the in vitro RNA transcripts from pSVWT and mature E2 was not detected in SVVpu-transfected cells. pSVVpu. Both pSVWT and pSVVpu plasmids were lin- To test whether the defects of glycoprotein processing earized, in vitro-transcribed using T7 RNA polymerase, affected virus production, virus plaque analysis was car- and capped. BHK-21 cells were transfected with in vitro- ried out (Fig. 3C). The amount of virus produced by either made RNA transcripts. Cells electroporated with RNA SVWT- or SVVpu-transfected cells was similar (see be- from pSVVpu will produce two separate late mRNAs low). The plaque size was also equivalent in both in- encoding SV glycoprotein precursor and Vpu protein. stances, although the presence of Vpu rendered a more Thus, synthesis of SV structural proteins is not stoichio- defined contour of plaques. In addition, we observed that metric with synthesis of Vpu protein. Immunofluores- a more pronounced cytopathic effect was induced upon cence analysis of transfected cells showed that over 90% SVVpu infection of BHK cells. Our conclusion from these of cells were positive for Vpu protein (Fig. 1B). Levels of experiments is that HIV-1 Vpu enhances membrane per- Vpu synthesis were high enough to be detected by au- meability over that observed by SVWT infection and Vpu Vpu MODIFIES GLYCOPROTEIN TRANSPORT 203

FIG. 1. Expression of HIV-1 vpu using SV vector. (A) Schematic representation of vpu expression under control of duplicated SV promoter. (B) Immunofluorescence detection of Vpu protein expressed in transfected cells. BHK cells were electroporated with mRNA synthesized from pSVWT or pSVVpu. At 18 h posttransfection cells were fixed, labeled with anti-Vpu rabbit polyclonal serum, and immunostained. (C) Radioactive detection of HIV-1 Vpu and SV proteins. BHK cells were transfected with mRNA of SVWT or SVVpu, or were mock-transfected. After 24 h they were metabolically labeled with [35S]methionine for 1 h. Cell lysates were subjected to SDS–15% PAGE and autoradiography. (D) Immunoblot detection of Vpu protein. Duplicated polyacrylamide gel of (C) was transferred to nitrocellulose filter and incubated with Vpu polyclonal antiserum. alters the posttranslational modifications of SV glycopro- agreement with experiments from other laboratories, the teins. titer of secreted virus dropped over 2 logs with virus encoding a truncated 6K protein (SV⌬6K) (Liljestro¨m et al., Vpu complements 6K-deletion mutant of Sindbis virus 1991). Notably, the presence of Vpu led to a partial comple- It has been hypothesized that HIV-1 Vpu and alphavi- mentation of the 6K defect, such that a 10-fold increase of rus 6K proteins share structural and functional charac- virus production (SV⌬6KVpu) was found. Vpu trans-comple- teristics. To test this possibility we constructed recombi- mentation of 6K truncation was more pronounced when the nant pSV⌬6K by deleting 22 amino acids of the 6K se- virus yields for SVVpu and SV⌬6KVpu were compared (10- quence. This internal deletion in the 6K gene left the fold decrease). Further evidence that Vpu complemented protease recognition sites intact. Thereafter, pSV⌬6KVpu the SV⌬6K defect was obtained by examining the develop- was constructed by cloning the vpu sequence in trans of ment of a cytopathic effect in BHK cells infected by the four 6K-truncated SV genome. Virus collected after transfec- different viruses (Fig. 4B). The 6K-defective virus was de- tion with the four different RNA preparations, SVWT, void of cytopathogenic capacity, whereas Vpu encoding SVVpu, SV⌬6K, and SV⌬6KVpu, were titrated (Fig. 4A). truncated virus was as cytopathogenic as wild type virus. In Virus production was decreased slightly by the presence conclusion, Vpu partially restores virus production of 6K- of Vpu (SVVpu) as compared to that of SVWT. In good defective virus as well as its cytopathogenicity. 204 GONZA´ LEZ AND CARRASCO

FIG. 2. Vpu enhances the SV-mediated hygromycin B entry into BHK cells. Cells were transfected with mRNA synthesized from pSVWT, pSVVpu, and pSVVif. At 20 h posttransfection, hygromycin B was added to cell cultures. After 20 min cells were metabolically labeled with [35S]methionine for 45 min. Cell lysates were subjected to SDS–15% PAGE and autoradiography. FIG. 4. Vpu protein trans-complements 6K-defective Sindbis virus. (A) Effect of Vpu protein on SV infectivity. BHK cells were electroporated with mRNA synthesized from pSVWT, pSVVpu, pSV⌬6K, or pSV⌬6KVpu. Both 6K and Vpu enhance membrane permeability in Extracellular virus was harvested 24 h posttransfection (SVWT and bacteria and in mammalian cells (Sanz et al., 1994; SVVpu) or 48 h posttransfection (SV⌬6K and SV⌬6KVpu). Virus suspen- Gonza´lez and Carrasco, 1998; Sanz, 1998). To examine sions were titrated by plaque assay. (B) Effect of Vpu protein on whether Vpu complements the 6K defect in this respect, cytopathic effect produced by 6K-truncated SV. Monolayers of BHK ⌬ cells were infected at 1 PFU/cell with recombinant virus collected from BHK cells were infected with viruses SV 6K and transfected cells. At 18 h postinfection, phase-contrast micrographs of SV⌬6KVpu. The presence of 0.5 mM HB in the culture infected cell monolayers were taken.

FIG. 3. Vpu protein interferes with SV growth. (A) Processing of the SV polyprotein in the presence of Vpu. BHK cells were electroporated with mRNA of SVWT or SVVpu. At 24 h after transfection, cells were pulsed with [35S]methionine for 20 min, after which they were chased at the times indicated. Cell lysates were analyzed in SDS–10% PAGE. (B) Glycosylation of SV proteins in Vpu-expressing cells. At 21 h posttransfection with mRNA, BHK cells were labeled with 5 ␮Ci of [3H]mannose for 1 h. Cell lysates were analyzed by SDS–10% PAGE and autoradiography. (C) Morphology of plaques formed by SVVpu virus. Recombinant virus were harvested from mRNA-transfected cells, diluted, and plated on BHK cells. After 3 days of incubation with agar-overlay medium, plaques were stained and photographed. Vpu MODIFIES GLYCOPROTEIN TRANSPORT 205

addition of 1 mM HB was not sufficient to block SV translation. In contrast, protein synthesis of cells infected with SV⌬6KVpu was completely blocked by the addition of 0.5 mM HB. This result reveals that Vpu restores membrane permeabilization by 6K-defective SV. Previous studies implicated the 6K protein in the regulation of SV polyprotein processing (Schlesinger et al., 1993). In good agreement, we found that the absence of an intact 6K protein led to an accumulation of the B immature precursor, as revealed by pulse-chase experiments (Fig. 6A). The PE2 precursor also gave rise to mature E2 in BHK cells infected with SV⌬6K. Since the presence of Vpu induced modifications in SV glycoprotein processing (see above), we carried out this study with recombinant SV⌬6KVpu. Curiously, Vpu facilitated B precursor processing, while still interfering with PE2 maturation. After a prolonged chase (15 h), intact B was still detected in SV⌬6K-infected cells and mature E2 could not be detected in SV⌬6KVpu-infected FIG. 5. Vpu protein trans-complements 6K-mediated permeabiliza- cells. Since Vpu partially complemented growth of 6K-de- tion of cells to hygromycin B. BHK cells were infected with 1 PFU/cell fective virus, it was of interest to determine the glycoprotein ⌬ ⌬ of SVWT, SVVpu, SV 6K, or SV 6KVpu. At 21 h postinfection, hygro- composition of SV⌬6K particles. To this end, methionine- mycin B was added and 10 min later cells were metabolically labeled with [35S]methionine for 1 h. Cell extracts were subjected to SDS–15% labeled virus particles were obtained and the protein com- PAGE and autoradiography. position was analyzed by SDS–PAGE (Fig. 6B). Both SV⌬6K and SV⌬6KVpu particles contained mature E1 and E2 in a proportion similar to that of SVWT. This result indicates that, medium completely blocked protein synthesis of cells by despite the defects observed in glycoprotein processing, a infected wild type virus (Fig. 5). The permeabilization small proportion of glycoproteins were correctly processed capacity of SV⌬6K was clearly diminished, i.e., even and assembled in cells with SV⌬6KVpu.

FIG. 6. The trans-complementary effect of Vpu on proteolytic processing of SV polyprotein. (A) Maturation of SV 6K-truncated polyprotein in the presence of Vpu protein. BHK cells were infected with 1 PFU/cell of SV⌬6K and SV⌬6KVpu. At 20 h postinfection, cell were pulsed for 15 min with [35S]methionine and chased at the times indicated. Cell lysates were analyzed in SDS–10% PAGE and autoradiography. (B) Glycoprotein assembly in SV particles. Cells (5 ϫ 10 5) were infected with a suspension of viral particles of SVWT (lane 1), SV⌬6K (lane 2), or SV⌬6KVpu (lane 3) at a multiplicity of infection of 1 PFU/cell. At 24 h postinfection, cells were methionine starved for 1 h; cells were then pulse-labeled with 100 ␮Ci of [35S]methionine for 6 h and chased for 17 h. Extracellular virions (extra) were separated from cell debris (intra) and proteins were analyzed as referred to in the text. The exposure time for autoradiography was adjusted in each lane to obtain enough signal for each protein band. Only qualitative, not quantitative, comparison of the different samples can be made. 206 GONZA´ LEZ AND CARRASCO

DISCUSSION motes fusion and release of virions. Accordingly, Vpu channels can be involved in the enhancement of 6K- The analogies of 6K and Vpu were previously noticed deleted particle release. The complementation of 6K with (Carrasco, 1995). Both proteins are small and hydropho- Vpu suggests that Vpu induces a modification on mem- bic, and both interact with membranes. The functioning branes similar to 6K that may influence budding of virus of Vpu and 6K was related with virion production, mem- particles from the cell membrane. brane permeabilization, and glycoprotein processing. Ev- idence of the extent of these similarities between Vpu and 6K is further provided by our present results, show- Glycoprotein processing ing that replacement of 6K by Vpu in the SV⌬6K en- Vpu can affect the sorting of proteins from the secre- hances virion production, membrane permeability, and tory pathway by direct protein–protein interactions the cytopathic effect. In addition, Vpu restores proteolytic through specific Vpu-responding-elements or by modifi- processing of B, the glycoprotein precursor that was cation of secretory compartments by means of the ion accumulated by cells infected with 6K-deleted virus, channel activity. In accord with defects in the secretion of while it inhibits the furin-mediated cleavage of PE2. membrane proteins (Kerkau et al., 1997; Willey et al., 1992b; Vincent and Jabbar, 1995), we found that Vpu Virus production impaired the processing of PE2 glycoprotein. These observations suggest that Vpu modifies the functioning of The mechanism by which Vpu enhances the release of cellular compartments involved in the secretory pathway. virus particles is intriguing. Vpu increases the pinching- A previous report showed that the expression of a viral off from the plasma membrane of infectious particles and protein endowed with ion channel activity, such as influ- virus-like particles of HIV. Moreover, Vpu augments virus enza M2, also results in the modification of viral glyco- particle production from other retroviruses as divergent protein transport (Sakaguchi et al., 1996). Self-assembly as Visna virus and Mo-MLV (Klimkait et al., 1990; Paul et of Vpu monomers into noncovalent oligomers, resem- al., 1998; Go¨ttlinger et al., 1993). The 6K protein affects bling potassium channels, can alternate during vesicular two different steps during the SV replication cycle: (i) transport with monomeric structures (Willbold et al., virion release from the plasma membrane (Gaedigk- 1997; Moore et al., 1998; Marassi et al., 1999). Thus, the Nitschko et al., 1990) and (ii) the transport of vesicles proportion of oligomeric forms of Vpu during its transport containing SV glycoproteins (Schlesinger et al., 1993). to the plasma membrane can determine the availability Transport of 6K protein through secretory cellular com- of ion channels that modify each cellular compartment. partments is well characterized (reviewed in Strauss and This then helps to explain why Vpu affects the process- Strauss, 1994), whereas the precise mechanism by ing of SV glycoproteins at multiple sites. which 6K contributes to virus assembly and infectivity of It is noteworthy that Vpu trans-complements a 6K- virions is obscure. The number of infectious virus parti- deficient SV because, in the wild type virus, the 6K gene cles (6K-deleted SV) was 10-fold higher in the presence is translated as part of a precursor that gives rise to the of Vpu. This finding adds further evidence to the potential structural glycoproteins. As soon as 6K is covalently analogy of Vpu and 6K proteins. separated from E1 and PE2, it becomes associated with the PE2/E1 complex. The sequence-specific interactions Membrane permeabilization between 6K and the PE2/E1 complex allows the trans- Vpu disrupts membrane integrity in prokaryotic and port of 6K protein to the cell membrane, where it be- eukaryotic cells (Gonza´lez and Carrasco, 1998). Ion comes assembled into virions, although with a lower channel activity of Vpu on model membranes was previ- stoichiometric proportion than that of mature glycopro- ously documented (Ewart et al., 1996; Marassi et al., teins (Gaedigk-Nitschko and Schlesinger, 1990). Thus, 1999). Besides, 6K is also a membrane-active protein the sequence divergence between 6K and Vpu should able to enhance membrane permeability (Sanz et al., prevent the specific interaction of Vpu with PE2/E1 com- 1994). SV⌬6K mutants show defects in promoting mem- plexes during assembly of 6K-deleted virus. The stability brane permeability (Sanz and Carrasco, unpublished re- of PE2/E1 complex is critical for furin-mediated cleavage sults). The capacity to permeabilize the plasma mem- (Strauss and Strauss, 1994). Conceivably, the absence of brane and to induce the cytopathic effect were recovered 6K/heterodimer-specific interactions may cause the re- by 6K-deleted virus carrying the vpu gene. This repre- duction of virus production that we observed with sents a good model system to test other viral proteins SV⌬6KVpu, as compared to that of SVWT. In SV⌬6K, Vpu endowed with the capacity to enhance membrane per- complemented some 6K functions but not sequence- meability. specific interactions. Actually, a SV chimeric virus in A model explaining the role of Vpu channels in the which the 6K gene had been replaced with that from budding process suggests that insertion of Vpu at the Ross River virus gave rise to a 10-fold reduction of as- plasma membrane alters the resting potential and pro- sembled virus (Yao et al., 1996). The approximately two- Vpu MODIFIES GLYCOPROTEIN TRANSPORT 207 fold decrease in the yield of SVWT titer by Vpu could be GTP; 10 U of RNAsin; and 0.5 ␮l of T7 RNA polymerase. the arithmetical result of the increase of virus production In addition, 1 mM of 7mG(5Ј)ppp(5Ј)G (New England by the enhancement of membrane permeabilization and BioLabs, Beverly, MA) was added to the reaction mixture the decrease of virus assembly resulting from the ab- to obtain capped RNAs. BHK-21 cells were transfected sence of specific interactions of Vpu with glycoprotein with capped RNAs by electroporation, following a previ- complexes. Therefore, the partial complementation of ously reported protocol (Liljestro¨m et al., 1991). Briefly, 6K-deleted mutant by Vpu provides a model to study the 2 ϫ 10 6 cells were resuspended in 0.4 ml of phosphate- functionality of other viral proteins related to 6K. buffered saline (PBS) and mixed with 25 ␮l of transcription product at room temperature. The mixture was elec- MATERIALS AND METHODS troporated in a 0.2-cm cuvette by two consecutive pulses at 1500 V and 25 ␮F with a Gene Pulser (Bio-Rad, Her- Plasmids cules, CA). The transfected cells were diluted 1:20 with DMEM with 5% FCS and plated. pSVWT, a plasmid containing a full-length copy of the Sindbis virus genome downstream from the T7 promoter, Cell culture and viruses was constructed from pTE3Ј2J (Hahn et al., 1992) by replacing the SacI–SpeI fragment containing the SP6 Baby hamster kidney (BHK-21) cells were cultured in promoter with the corresponding region from pT7TOTO Dulbecco’s modified Eagle’s medium (DMEM) with 5% plasmid (generously provided by Dr. C. M. Rice, St. Louis, heat-inactivated fetal calf serum (FCS). Sindbis virus was MO). pSV⌬6K, containing Sindbis virus genome with a propagated in BHK cells. Plaque assay was performed truncated 6K protein, was obtained by an intermediate on BHK cells; confluent monolayers were infected with subcloning of an NdeI–BamHI fragment. This fragment serial virus dilutions, covered with 0.7% agar-overlaid was obtained in two pieces by PCR amplification from the medium, and incubated for 3 days. Following standard pSVWT template. Oligonucleotides used for the 5Ј fragment procedures, cell monolayers were fixed with 10% form- were: 5ЈSub6K (CCCGGGCATATGGGATGGCCACACGAAA- aldehyde and plaques stained with 2% crystal violet in ATAGTACAG) and 3ЈDel6K (GGCGCGCATGCCTGGACCCA- 10% formaldehyde. GAAGAACGGCTGACT). Oligonucleotides used for the 3Ј fragment were: 5ЈDel6K (CCCGGGGCATGCGCCGGCGC- Immunoblot analysis Ј CTACCTGGCGAAGGTA) and 3 Sub6K (GGCGCCGGATC- Proteins were separated by SDS–PAGE (10% poly- CTTATTAGACGTACGCCTCACTCATCTGGCT). Each ampli- acrylamide) and transferred onto a nitrocellulose filter. fied fragment was doubled digested with NdeI and SphIor The filter was blocked by incubation in 3% nonfat dry milk SphI and BamHI, respectively (restriction sites of oligonu- in washing solution (0.05% Tween in PBS), at room tem- cleotides are underlined) and then ligated. The fragment perature for 1 h. Blocked membrane was washed three containing a new internal SphI site and compatible cohe- times with washing solution and then incubated with the sive ends was subcloned into pET11 using NdeI and primary antibody at room temperature for 2 h. After re- BamHI restriction sites. Digestion of the pET11 construct moving antibody, the filter was washed three times with with BssHII and SplI rendered a fragment containing a washing solution and incubated with biotin-conjugated mutated 6K (deletion of 24–45 amino acids and conversion secondary antibody at room temperature for 1 h. After of Leu22 to Ala) that was used to replace the wild type 6K washing three times, streptavidin-conjugated peroxidase ⌬ sequence in pSVWT. pSVVpu and pSV 6Vpu were ob- was coupled to biotin-labeled immune complex. The tained by subcloning the NcoI–BamHI fragment containing filter was then incubated with luminol-luciferin solution vpu sequence from pTM1vpu (Gonza´lez and Carrasco, and the light emission from the chemiluminescence re- ⌬ 1998) into pSVWT or pSV 6K, using the shuttle phagemid action was captured on an Agfa X-ray film. vector pH3Ј2J1 (Hahn et al., 1992). A procedure similar to that used for pSVVpu construction was followed for pSVVif Metabolic labeling of proteins construction; the vif gene was PCR-amplified from the BH10 35 Cell monolayers were labeled with L-[ S]methionine clone of HIV-1 (Hahn et al., 1984) using oligonucleotides 3 (1000 Ci/mmol) or D-[2,6- H]mannose (38 Ci/mmol) (Am- containing 5ЈNcoI and 3ЈBamHI restriction sites. ersham, Arlington Heights, IL) in methionine-free DMEM and glucose-free DMEM, respectively. In pulse/chase In vitro transcription and transfections experiments, cells were methionine starved for 30 min Plasmid containing T7 promoter was linearized with before radioactive labeling, the metabolic labeling was XhoI before use as a template for in vitro transcription, terminated by washing cell monolayers with fresh me- which was performed in 25 ␮l at 37°C for 2 h. Reaction dium, and cells were maintained in DMEM containing mixtures contained: 2.5 ␮l DNA template; 40 mM Tris– unlabeled methionine for the appropriate chase period.

HCl (pH 7.9); 6 mM MgCl2; 2 mM spermidine–HCl; 5 mM When noted, proteins incorporated in mature viral parti- dithiothreitol; 1 mM each ATP, CTP, and UTP; 500 ␮M cles were separated from total viral proteins by sequen- 208 GONZA´ LEZ AND CARRASCO tial low- and high-speed centrifugations. Briefly, cell Friborg, J., Ladha, A., Gottlinger, H., Haseltine, W. A., and Cohen, E. A. monolayers together with culture medium were centri- (1995). Functional analysis of the phosphorylation sites on the hu- fuged at 2000 g for 10 min. Pelleted cells were sus- man immunodeficiency virus type 1 Vpu protein. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 8, 10–22. pended in sample buffer (160 mM Tris–HCl, pH 6.8, 100 Gaedigk-Nitschko, K., Ding, M., Aachlevy, M., and Schlesinger, M. J. mM dithiothreitol, 2% SDS, 0.03% bromphenol blue, and (1990). Site-directed mutations in the Sindbis virus 6K protein reveal 11.6% glycerol), heated to 100°C for 4 min, and analyzed sites for fatty acylation and the underacylated protein affects virus by SDS–10% PAGE and autoradiography. The superna- release and virion structure. Virology 175, 282–291. tant was clarified by centrifugation at 10,000 g for 10 min. Gaedigk-Nitschko, K., and Schlesinger, M. J. (1990). The Sindbis virus 6K protein can be detected in virions and is acylated with fatty acids. Precipitated debris was removed and the supernatant Virology 175, 274–281. containing viral particles was layered on top of 1/10 Gonza´lez, M. E., and Carrasco, L. (1998). The human immunodeficiency volume of PBS with 20% sucrose (w/v), and centrifuged at virus type 1 Vpu protein enhances membrane permeability. Biochem- 100,000 g for2hat4°C, in a Beckman TL100 ultracen- istry 37, 13710–13719. trifuge (Beckman Coulter, Fullerton, CA). Pellets contain- Go¨ttlinger, H. G., Dorfman, T., Cohen, E. A., and Haseltine, W. A. (1993). Vpu protein of human immunodeficiency virus type 1 enhances the ing partially purified virus were suspended in sample release of capsids produced by gag gene constructs of widely buffer and viral proteins were resolved by SDS–10% divergent retroviruses. Proc. Natl. Acad. Sci. USA 90, 7381–7385. PAGE and visualized by autoradiography on Agfa X-ray Hahn, B. H., Shaw, G. M., Arya, S. K., Popovic, M., Gallo, R. C., and film. Wong-Staal, F. (1984). Molecular cloning and characterization of the HTLV-III virus associated with AIDS. Nature 312, 166–169. Hahn, C. S., Hahn, Y. S., Braciale, T. J., and Rice, C. M. (1992). Infectious Immunofluorescence assay Sindbis virus transient expression vectors for studying antigen pro- Very dilute cell monolayers were grown on glass cov- cessing and presentation. Proc. Natl. Acad. Sci. USA 89, 2679–2683. Iwatani, Y., Song, S. K., Wang, L. Q., Planas, J., Sakai, H., Ishimoto, A., erslips. Prior to immunostaining, cell monolayers were and Cloyd, M. W. (1997). Human immunodeficiency virus type 1 Vpu washed with PBS and fixed with 4% paraformaldehyde modifies viral cytopathic effect through augmented virus release. for 10 min at room temperature. Cells were washed twice J. Gen. Virol. 78, 841–846. with PBS and permeabilized with 0.2% Triton X-100 in Kerkau, T., Bacik, I., Bennink, J. R., Yewdell, J. W., Hu¨nig, T., Schimpl, A., PBS for 2 min at room temperature. After washing with and Schubert, U. (1997). The human immunodeficiency virus type 1 (HIV-1) vpu protein interferes with an early step in the biosynthesis of PBS, cells were incubated in PBS with primary polyclonal major histocompatibility complex (MHC) class I molecules. J. Exp. antiserum for1hat37°C. Cells were then washed with Med. 185, 1295–1305. PBS three times and incubated in PBS with rhodamine- Kimura, T., Nishikawa, M., and Ohyama, A. (1994). Intracellular mem- conjugated goat anti-rabbit IgG (Pierce, Rockford, IL) for brane traffic of human immunodeficiency virus type 1 envelope 1 h at 37°C. The coverslips were placed on glass slides, glycoproteins: Vpu liberates Golgi-targeted gp160 from CD4-depen- mounted with Mowiol solution, and viewed with a Zeiss dent retention in the endoplasmic reticulum. J. Biochem. 115, 1010– 1020. Axiovert 35 microscope (Zeiss, Thornwood, NY). Klimkait, T., Strebel, K., Hoggan, M. D., Martin, M. A., and Orenstein, J. M. (1990). The human immunodeficiency virus type 1-specific ACKNOWLEDGMENTS protein vpu is required for efficient virus maturation and release. J. Virol. 64, 621–629. We thank Dr. Miguel Angel Sanz for construction of pSVWT plasmid Lenburg, M. E., and Landau, N. R. (1993). Vpu-induced degradation of and mutant form pSV⌬6K. This work was supported by Fondo de CD4: Requirement for specific amino acid residues in the cytoplas- Investigacioń Sanitaria (Grant 98/0644) and Comunidad de Madrid mic domain of CD4. J. Virol. 67, 7238–7245. (Grant 07B/0002/1997). We also acknowledge the institutional grant to Liljestro¨m, P., Lusa, S., Huylebroeck, D., and Garoff, H. (1991). In vitro the CBM of Fundacioń Areces. mutagenesis of a full-length cDNA clone of Semliki Forest virus: The small 6.000-molecular-weight membrane protein modulates virus REFERENCES release. J. Virol. 65, 4107–4113. Maldarelli, F., Chen, M.-Y., Willey, R. L., and Strebel, K. (1993). Human Carrasco, L. (1995). Modification of membrane permeability by animal immunodeficiency virus type 1 Vpu protein is an oligomeric type I viruses. Adv. Virus Res. 45, 61–112. integral membrane protein. J. Virol. 67, 5056–5061. Chen, M.-Y., Maldarelli, F., Karczewski, M. K., Willey, R. L., and Strebel, Marassi, F. M., Ma, C., Gratkowski, H., Straus, S. K., Strebel, K., Oblatt- K. (1993). Human immunodeficiency virus type 1 Vpu protein induces Montal, M., Montal, M., and Opella, S. J. (1999). Correlation of the degradation of CD4 in vitro: The cytoplasmic domain of CD4 contrib- structural and functional domains in the membrane protein Vpu from utes to Vpu sensitivity. J. Virol. 67, 3877–3884. HIV-1. Proc. Natl. Acad. Sci. USA 96, 14336–14341. Coady, M. J., Daniel, N. G., Tiganos, E., Allain, B., Friborg, J., Lapointe, Moore, P. B., Zhong, Q. F., Husslein, T., and Klein, M. L. (1998). Simu- J. Y., and Cohen, E. A. (1998). Effects of Vpu expression on Xenopus lation of the HIV-1 Vpu transmembrane domain as a pentameric oocyte membrane conductance. Virology 244, 39–49. bundle. FEBS Lett. 431, 143–148. Cohen, E. A., Terwilliger, E. F., Sodroski, J. G., and Haseltine, W. A. Munõz, A., Castrillo, J. L., and Carrasco, L. (1985). Modification of (1988). Identification of a protein encoded by the vpu gene of HIV-1. membrane permeability during Semliki Forest virus infection. Virol- Nature 334, 532–534. ogy 146, 203–212. Einfeld, D. (1996). Maturation and assembly of retroviral glycoproteins. Paul, M., Mazumder, S., Raja, N., and Jabbar, M. A. (1998). Mutational Curr. Top. Microbiol. Immunol. 214, 133–176. analysis of the human immunodeficiency virus type 1 Vpu transmem- Ewart, G. D., Sutherland, T., Gage, P. W., and Cox, G. B. (1996). The Vpu brane domain that promotes the enhanced release of virus-like protein of human immunodeficiency virus type 1 forms cation-selec- particles from the plasma membrane of mammalian cells. J. Virol. 72, tive ion channels. J. Virol. 70, 7108–7115. 1270–1279. Vpu MODIFIES GLYCOPROTEIN TRANSPORT 209

Paul, N. L., Marsh, M., McKeating, J. A., Schulz, T. F., Liljestro¨m, P., regulation of virus release from HIV-1-infected cells. FEBS Lett. 398, Garoff, H., and Weiss, R. A. (1993). Expression of HIV-1 envelope 12–18. glycoproteins by Semliki Forest virus vectors. AIDS Res. Hum. Ret- Schubert, U., Schneider, T., Henklein, P., Hoffmann, K., Berthold, E., roviruses 9, 963–970. Hauser, H., Pauli, G., and Porstmann, T. (1992). Human-immunodefi- Raja, N. U., and Jabbar, M. A. (1996). The human immunodeficiency ciency-virus-type-1-encoded Vpu protein is phosphorylated by ca- virus type 1 Vpu protein tethered to the CD4 extracellular domain is sein kinase II. Eur. J. Biochem. 204, 875–883. localized to the plasma membrane and is biologically active in the Strauss, J. H., and Strauss, E. G. (1994). The alphaviruses: Gene ex- secretory pathway of mammalian cells: Implications for the mecha- pression, replication, and evolution. Microbiol. Rev. 58, 491–562. nisms of Vpu function. Virology 220, 141–151. Strebel, K., Klimkait, T., and Martin, M. A. (1988). A novel gene of HIV-1, Sakaguchi, T., Leser, G. P., and Lamb, R. A. (1996). The ion channel vpu, and its 16-kilodalton product. Science 241, 1221–1223. activity of the influenza virus M2 protein affects transport though the Vincent, M. J., and Jabbar, M. A. (1995). The human immunodeficiency Golgi apparatus. J. Cell Biol. 133, 733–747. virus type 1 Vpu protein: A potential regulator of proteolysis and Sanz, M. A. (1998). Caracterizacioń funcional de la proteıńa6Kde protein transport in the mammalian secretory pathway. Virology 213, Alfavirus. El virus Sindbis como vector de expresioń. Ph.D. Thesis, 639–649. Universidad Autonoma de Madrid. Willbold, D., Hoffmann, S., and Ro¨sch, P. (1997). Secondary structure Sanz, M. A., Pe´rez, L., and Carrasco, L. (1994). Semliki Forest virus 6K and tertiary fold of the human immunodeficiency virus protein U (Vpu) protein modifies membrane permeability after inducible expression cytoplasmic domain in solution. Eur. J. Biochem. 245, 581–588. in Escherichia coli cells. J. Biol. Chem. 269, 12106–12110. Willey, R. L., Maldarelli, F., Martin, M. A., and Strebel, K. (1992a). Human Schlesinger, M. J., London, S. D., and Ryan, C. (1993). An in-frame immunodeficiency virus type 1 Vpu protein regulates the formation of insertion into the Sindbis virus 6K gene leads to defective proteolytic intracellular gp160-CD4 complexes. J. Virol. 66, 226–234. processing of the virus glycoproteins, a trans-dominant negative Willey, R. L., Maldarelli, F., Martin, M. A., and Strebel, K. (1992b). Human inhibition of normal virus formation, and interference in virus shut off immunodeficiency virus type 1 Vpu protein induces rapid degrada- of host-cell protein synthesis. Virology 193, 424–432. tion of CD4. J. Virol. 66, 7193–7200. Schubert, U., Ferrer-Montiel, A. V., Oblatt-Montal, M., Henklein, P., Yao, J. S., Strauss, E. G., and Strauss, J. H. (1996). Interactions between Strebel, K., and Montal, M. (1996). Identification of an ion channel PE2, E1, and 6K required for assembly of alphaviruses studied with activity of the Vpu transmembrane domain and its involvement in the chimeric viruses. J. Virol. 70, 7910–7920.