Presentation by Class I MHC Molecules Requires Cytoplasmic

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Hepatitis C Virus Envelope Glycoprotein E1 Originates in the Endoplasmic Reticulum and Requires Cytoplasmic Processing for Presentation by Class I MHC Molecules This information is current as of September 26, 2021. Mark Selby, Ann Erickson, Christine Dong, Stewart Cooper, Peter Parham, Michael Houghton and Christopher M. Walker J Immunol 1999; 162:669-676; ; http://www.jimmunol.org/content/162/2/669 Downloaded from References This article cites 45 articles, 22 of which you can access for free at: http://www.jimmunol.org/content/162/2/669.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Hepatitis C Virus Envelope Glycoprotein E1 Originates in the Endoplasmic Reticulum and Requires Cytoplasmic Processing for Presentation by Class I MHC Molecules1 Mark Selby,* Ann Erickson,* Christine Dong,* Stewart Cooper,† Peter Parham,† Michael Houghton,* and Christopher M. Walker2* We investigated whether hepatitis C virus envelope glycoprotein E1 is transported from the endoplasmic reticulum (ER) to the cytoplasm of infected cells for class I MHC processing. Target cells expressing E1 were killed by CTL lines from a hepatitis C virus-infected chimpanzee, and synthetic peptides were used to define an epitope (amino acids 233-GNASRCWVA-241) presented by the Patr-B*1601 class I MHC molecule. An unusually high concentration (>100 nM) of this nonameric peptide was required 234 for target cell lysis, but this could be reduced at least 1000-fold by replacing the asparagine at amino acid position 234 (Asn ) Downloaded from with aspartic acid (Asp), the anticipated anchor residue for NH2-terminal peptide binding to Patr-B*1601. Conspicuously, position 234 is part of an N-glycosylation motif (Asn-Xaa-Ser/Thr), suggesting that the Asn234 to Asp substitution might occur naturally within the cell due to deglycosylation/deamidation of this amino acid by the cytosolic enzyme peptide N-glycanase. In support of this model, we demonstrate that presentation of the epitope depended on 1) cotranslational synthesis of E1 in the ER, 2) glyco- sylation of the E1 molecule, and 3) a functional TAP transporter to shuttle peptide from the cytosolic to ER compartment. These results indicate for the first time that during infection of the host, viral envelope glycoproteins originating in the ER are processed http://www.jimmunol.org/ in the cytoplasm for class I MHC presentation. That a posttranslational change in amino acid sequence from Asn to Asp alters the repertoire of peptides presented to CD81 CTL has implications for the design of antiviral vaccines. The Journal of Immu- nology, 1999, 162: 669–676. pitopes presented by class I MHC molecules are gener- Processing pathways for transmembrane glycoproteins that are ated in a multistep process that begins with attachment of not normally present in the cytoplasm remain undefined. Under E ubiquitin (Ub)3 to cytoplasmic or nuclear proteins that are some circumstances processing can occur in the ER rather than the then targeted to the 26S proteasome for degradation into peptides. cytoplasm. For instance, signal peptidase (5–8) or other unidenti- by guest on September 26, 2021 Translocation of peptides from the cytoplasm into the endoplasmic fied proteases (6, 9) can generate peptides that bind directly to reticulum (ER) is mediated by TAP, a heterodimer encoded by class I MHC molecules in the ER, thus bypassing the cytoplasmic TAP-1 and TAP-2 genes located in the MHC (1). Class I MHC Ub/proteasome/TAP pathway. Most epitopes from transmembrane molecules in the ER are closely associated with TAP and various glycoproteins are TAP dependent, however, suggesting that at chaperones that facilitate loading of antigenic peptides (2). A sta- least some processing events occur in the cytoplasm. b ble complex consisting of a class I molecule, 2m, and a peptide At least two different mechanisms could account for cytoplas- of about 8–10 amino acids, is transported to the cell surface via the 1 mic processing of proteins that normally localize to the ER. In the exocytic pathway for surveillance by CD8 CTL (3). This classi- first mechanism, transmembrane glycoproteins may occasionally cal processing pathway might not, however, generate all class I 1 be synthesized on free cytoplasmic rather than membrane-bound MHC-associated peptides displayed by a cell. CD8 CTL also ribosomes, and thus targeted for ubiquitination and destruction by recognize transmembrane glycoproteins, including viral envelope the proteasome. Studies of an HLA-B35-restricted epitope from proteins, tumor Ags, and certain alloantigens, that are cotransla- the HIV-1 gp120 envelope indicate that this pathway is functional tionally synthesized in the ER on membrane-bound ribosomes (4). in virus-infected cells (9, 10). The gp120 envelope contains a num- ber of signal motifs for Asn-linked glycosylation (Asn-Xaa-Ser/ *Chiron Corp., Emeryville, CA 94608; and †Department of Structural Biology, Stan- Thr, where Xaa is any amino acid except Pro), and all are known ford University, Stanford, CA 94305 to be modified by glycans during synthesis of the polyprotein in Received for publication August 10, 1998. Accepted for publication September the ER (11). One of these Asn residues is contained in the epitope, 24, 1998. but surprisingly was not glycosylated before presentation by the The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance HLA-B35 molecules (10). This result suggests that gp120 polypro- with 18 U.S.C. Section 1734 solely to indicate this fact. tein produced in the cytoplasm because of an error in translation 1 This work was supported by Chiron Corp., National Institutes of Health Grant (12–14) or possibly signal peptide-mediated targeting to the ER (9, AI31168 (to P.P.), and a postdoctoral fellowship from the Arthritis Foundation (to S.C.). 10) was the substrate for class I MHC processing. A second mechanism appears to involve export of defective 2 Address correspondence and reprint requests to Dr. Christopher Walker, Department of Pediatrics, Children’s Hospital, Room W503, 700 Children’s Dr., Columbus, OH transmembrane glycoproteins from the ER to the cytoplasm for 43205. E-mail address: [email protected] proteasome-mediated destruction (15–20). This pathway is sup- 3 Abbreviations used in this paper: Ub, ubiquitin; ER, endoplasmic reticulum; ported by recent studies of class I MHC-restricted epitopes in the PNGase, peptide:N-glycanase; E1, envelope glycoprotein 1 of hepatitis C virus; HCV, hepatitis C virus; NS3, nonstructural 3; moi, multiplicity of infection; LCL, lympho- influenza virus nucleoprotein (21) and the cellular glycoprotein blastoid cell line. tyrosinase that is expressed in melanocytes (22, 23). In the case of Copyright © 1999 by The American Association of Immunologists 0022-1767/99/$02.00 670 AN ER TO CYTOSOL Ag PROCESSING PATHWAY FOR VIRAL GLYCOPROTEINS tyrosinase, it was demonstrated that efficient presentation of one der of E1 to amino acid 383. The internal primers were designated E1-M5 TAP-dependent epitope by HLA-A2 required posttranslational and E1-M3 (CGCGAGGGCGACGCCTCTAGATGTTGG and CGCCAC- conversion of an encoded Asn residue to Asp (22). This required CCAACATCTAGAGGCGTCGCC). The identity of the resulting clones was confirmed by sequencing. Subsequently, the E1-coding sequences cotranslational glycosylation of tyrosinase in the ER and subse- were transferred into pSC11 for generation of recombinant vaccinia vi- quent translocation of the Ag to the cytoplasm where it was deg- ruses. An 80% confluent monolayer of African green monkey BSC-40 cells lycosylated (23), probably by peptide:N-glycanase (PNGase) (24, on a 60-mm dish was infected with 0.05 plaque-forming units of wild-type vaccinia virus (WR strain)/cell. After2hofinfection at 37°C, the cells 25). Removal of glycans by this cytoplasmic enzyme causes a 1 1 were transfected with 12.5 mg of pSC11 E1s1, pSC11 E1s2, and coding change from Asn to Asp by a process of deamidation, and 1 pSC11 E1s2D234 DNA using lipofectin reagent (Life Technologies, it is this modified form of tyrosinase that is processed by the Ub/ Grand Island, NY). Virions were harvested 2 days later, and serial dilutions proteasome/Tap pathway. Whether this processing pathway ap- (from 1021 to 1024) of each were used to infect 80% confluent monolayers plies generally to other glycoproteins is not yet known. of thymidine kinase-deficient human osteosarcoma 143 B cells on 60-mm In this study we demonstrate for the first time that the ER to dishes. After2hat37°C the inoculum was aspirated off the cells. An overlay that included 1% sea plaque agarose and 50 mg/ml 5-bromode- cytosol processing pathway is not restricted to cellular glycopro- oxyuridine was added to infected monolayers, and 3 days later the dishes teins such as tyrosinase, but is also operative for viral glycopro- were overlaid with 1% sea plaque agarose containing 0.03% 5-bromo-4- teins produced in infected cells. Class I MHC-restricted CTL spe- chloro-3-indolyl-b-D-galactoside. Each blue recombinant plaque was cific for envelope glycoproteins E1 and E2 of hepatitis C virus picked from a dish as an agarose plug and transferred into DMEM.
Recommended publications
  • The 3-Dimensional Structure of a Hepatitis C Virus P7 Ion Channel by Electron Microscopy

    The 3-Dimensional Structure of a Hepatitis C Virus P7 Ion Channel by Electron Microscopy

    The 3-dimensional structure of a hepatitis C virus p7 ion channel by electron microscopy Philipp Luika, Chee Chewb, Jussi Aittoniemib, Jason Changc, Paul Wentworth, Jrc, Raymond A. Dweka, Philip C. Bigginb, Catherine Ve´ nien-Bryand, and Nicole Zitzmanna,1 Department of Biochemistry and aOxford Glycobiology Institute, bStructural Bioinformatics and Computational Biochemistry, cThe Scripps/Oxford Laboratory, and dLaboratory of Molecular Biophysics, University of Oxford, South Parks Road, Oxford OX1 3QU, United Kingdom Communicated by Charles M. Rice, The Rockefeller University, New York, NY, May 29, 2009 (received for review December 23, 2008) Infection with the hepatitis C virus (HCV) has a huge impact on have suggested that monomers assemble into either hexamers global health putting more than 170 million people at risk of (10) or heptamers (9) in lipid bilayers. developing severe liver disease. The HCV encoded p7 ion channel We report here the 3-dimensional (3D) structure of an HCV is essential for the production of infectious viruses. Despite a p7 ion channel. Chemically synthesized p7 monomers of native growing body of functional data, little is known about the 3-di- length and charge were solubilized in detergent. The resulting mensional (3D) structure of the channel. Here, we present the 3D oligomeric channels were negatively stained, imaged, and ana- structure of a full-length viroporin, the detergent-solubilized hex- lyzed using single particle reconstruction. The 3D structure was americ 42 kDa form of the HCV p7 ion channel, as determined by determined by the random conical tilt approach at a resolution single-particle electron microscopy using the random conical tilting of Ϸ16 Å.
  • Viewed in Mclaughlin-Drubin and Munger, 2008)

    Viewed in Mclaughlin-Drubin and Munger, 2008)

    MIAMI UNIVERSITY The Graduate School Certificate for Approving the Dissertation We hereby approve the Dissertation of Anand Prakash Candidate for the Degree: Doctor of Philosophy Dr. Eileen Bridge, Mentor Dr. Gary R. Janssen, Reader Dr. Joseph M. Carlin, Reader Dr. Xiao-Wen Cheng Dr. David G. Pennock Graduate School Representative ABSTRACT INVESTIGATING THE TRIGGERS FOR ACTIVATING THE CELLULAR DNA DAMAGE RESPONSE DURING ADENOVIRUS INFECTION by Anand Prakash Cellular genomic integrity is constantly attacked by a variety of exogenous and endogenous agents. In response to damaged DNA, the cell activates a DNA damage response (DDR) pathway to maintain genomic integrity. Cells can also activate DDRs in response to infection with several types of viruses. The cellular DDR pathway involves sensing DNA damage by the Mre11, Rad50, Nbs1 (MRN) sensor complex, which activates downstream ataxia-telangiectasia mutated (ATM) and ATM-Rad3-related (ATR) kinases. These kinases phosphorylate downstream effector proteins implicated in cell cycle arrest, DNA repair, and, if the damage is irreparable, apoptosis. The induction of DDRs includes focal accumulation and phosphorylation of several DDR proteins. Adenovirus (Ad) mutants that lack early region 4 (E4) activate a cellular DDR. E4 proteins normally inactivate the MRN sensor complex and prevent downstream DDR signaling involved in DNA repair and cell cycle checkpoint arrest in wild- type Ad5 infections. The characteristics of Ad infection that activate the cellular DDR are not well understood. We have investigated the ability of replication defective and replication competent Ad mutants to activate cellular DDRs and G2/M cell cycle arrest. Ad infection induced early focal accumulation of DDR proteins such as Mre11, Mdc1, phosphorylated ATM (pATM), phosphorylated Chk2 (pChk2), and 53BPI, independent of the replication status of the mutants studied.
  • Entry of Hepatitis B and C Viruses

    Entry of Hepatitis B and C Viruses

    VIRAL HEPATITIS FORUM Getting Close Viralto Eradication Hepatitis Forum I. Basic Getting Research Close to Eradication I. Basic Research Entry of Hepatitis B and C Viruses Seungtaek Kim Severance Biomedical Science Institute, Institute of Gastroenterology, Department of Internal Medicine, Yonsei University Col- lege of Medicine, Seoul, Korea B형과 C형 간염 바이러스에 대한 최근의 분자, 세포생물학적인 발전은 간세포를 특이적으로 감염시키는 이들 바이러스에 대한 세포 수용체의 발굴과 더불어 그들의 작용 기전에 대해 더 자세한 정보들을 제공해주고 있다. 특히 C형 간염 바이러스의 경우, 간세포의 서로 다른 곳에 위치한 세포 수용체들이 바이러스의 세포 진입시에 바이러스 표면의 당단백질과 어떤 방식으로 서로 상호 작용하며 세포 내 신호 전달 과정을 거쳐 세포 안으로 들어오게 되는지 그 기전들이 서서히 드러나고 있다. 한편, B형 간염 바이러스의 경우, 오랫동안 밝혀내지 못했던 이 바이러스의 세포 수용체인 NTCP를 최근 발굴하게 됨으로써 세포 진입에 관한 연구에 획기적인 계기를 마련하게 되었으며 동시에 이를 저해할 수 있는 새로운 항바이러스제의 개발도 활기를 띠게 되었다. 임상적으로 매우 중요한 이 두 바이러스의 세포 진입에 관한 연구는 앞으로도 매우 활발하게 이루어질 것으로 기대된다. Keywords: B형 간염 바이러스, C형 간염 바이러스, 세포 진입, 신호 전달, NTCP There are five hepatitis viruses although their classes, genomes, and modes of transmission are different from each other. Of these, hepatitis B virus (HBV) and hepatitis C virus (HCV) are the most dangerous, life-threatening pathogens, which are also responsible for 80-90% of hepatocellular carcinoma. HBV belongs to hepadnaviridae (family) and it has double-strand DNA as its genome, however, its replication occurs via reverse transcription like retrovirus replication. In contrast, HCV belongs to flaviviridae (family) and has positive-sense, single-strand RNA as its genome.
  • Topological Analysis of the Gp41 MPER on Lipid Bilayers Relevant to the Metastable HIV-1 Envelope Prefusion State

    Topological Analysis of the Gp41 MPER on Lipid Bilayers Relevant to the Metastable HIV-1 Envelope Prefusion State

    Topological analysis of the gp41 MPER on lipid bilayers relevant to the metastable HIV-1 envelope prefusion state Yi Wanga,b, Pavanjeet Kaurc,d, Zhen-Yu J. Sune,1, Mostafa A. Elbahnasawya,b,2, Zahra Hayatic,d, Zhi-Song Qiaoa,b,3, Nhat N. Buic, Camila Chilea,b,4, Mahmoud L. Nasre,5, Gerhard Wagnere, Jia-Huai Wanga,f, Likai Songc, Ellis L. Reinherza,b,6, and Mikyung Kima,g,6 aLaboratory of Immunobiology, Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02115; bDepartment of Medicine, Harvard Medical School, Boston, MA 02115; cNational High Magnetic Field Laboratory, Florida State University, Tallahassee, FL 32306; dDepartment of Physics, Florida State University, Tallahassee, FL 32306; eDepartment of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115; fDepartment of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02215; and gDepartment of Dermatology, Harvard Medical School, Boston, MA 02215 Edited by Peter Palese, Icahn School of Medicine at Mount Sinai, New York, NY, and approved September 23, 2019 (received for review July 18, 2019) The membrane proximal external region (MPER) of HIV-1 envelope immunologically vulnerable epitopes targeted by several of the most glycoprotein (gp) 41 is an attractive vaccine target for elicitation of broadly neutralizing antibodies (bNAbs) developed during the broadly neutralizing antibodies (bNAbs) by vaccination. However, course of natural HIV-1 infection (10–13). Insertion, deletion, current details regarding the quaternary structural organization of and mutations of residues in the MPER defined the functional the MPER within the native prefusion trimer [(gp120/41)3] are elu- importance of the MPER in Env incorporation, viral fusion, and sive and even contradictory, hindering rational MPER immunogen infectivity (14–16).
  • How Influenza Virus Uses Host Cell Pathways During Uncoating

    How Influenza Virus Uses Host Cell Pathways During Uncoating

    cells Review How Influenza Virus Uses Host Cell Pathways during Uncoating Etori Aguiar Moreira 1 , Yohei Yamauchi 2 and Patrick Matthias 1,3,* 1 Friedrich Miescher Institute for Biomedical Research, 4058 Basel, Switzerland; [email protected] 2 Faculty of Life Sciences, School of Cellular and Molecular Medicine, University of Bristol, Bristol BS8 1TD, UK; [email protected] 3 Faculty of Sciences, University of Basel, 4031 Basel, Switzerland * Correspondence: [email protected] Abstract: Influenza is a zoonotic respiratory disease of major public health interest due to its pan- demic potential, and a threat to animals and the human population. The influenza A virus genome consists of eight single-stranded RNA segments sequestered within a protein capsid and a lipid bilayer envelope. During host cell entry, cellular cues contribute to viral conformational changes that promote critical events such as fusion with late endosomes, capsid uncoating and viral genome release into the cytosol. In this focused review, we concisely describe the virus infection cycle and highlight the recent findings of host cell pathways and cytosolic proteins that assist influenza uncoating during host cell entry. Keywords: influenza; capsid uncoating; HDAC6; ubiquitin; EPS8; TNPO1; pandemic; M1; virus– host interaction Citation: Moreira, E.A.; Yamauchi, Y.; Matthias, P. How Influenza Virus Uses Host Cell Pathways during 1. Introduction Uncoating. Cells 2021, 10, 1722. Viruses are microscopic parasites that, unable to self-replicate, subvert a host cell https://doi.org/10.3390/ for their replication and propagation. Despite their apparent simplicity, they can cause cells10071722 severe diseases and even pose pandemic threats [1–3].
  • Opportunistic Intruders: How Viruses Orchestrate ER Functions to Infect Cells

    Opportunistic Intruders: How Viruses Orchestrate ER Functions to Infect Cells

    REVIEWS Opportunistic intruders: how viruses orchestrate ER functions to infect cells Madhu Sudhan Ravindran*, Parikshit Bagchi*, Corey Nathaniel Cunningham and Billy Tsai Abstract | Viruses subvert the functions of their host cells to replicate and form new viral progeny. The endoplasmic reticulum (ER) has been identified as a central organelle that governs the intracellular interplay between viruses and hosts. In this Review, we analyse how viruses from vastly different families converge on this unique intracellular organelle during infection, co‑opting some of the endogenous functions of the ER to promote distinct steps of the viral life cycle from entry and replication to assembly and egress. The ER can act as the common denominator during infection for diverse virus families, thereby providing a shared principle that underlies the apparent complexity of relationships between viruses and host cells. As a plethora of information illuminating the molecular and cellular basis of virus–ER interactions has become available, these insights may lead to the development of crucial therapeutic agents. Morphogenesis Viruses have evolved sophisticated strategies to establish The ER is a membranous system consisting of the The process by which a virus infection. Some viruses bind to cellular receptors and outer nuclear envelope that is contiguous with an intri‑ particle changes its shape and initiate entry, whereas others hijack cellular factors that cate network of tubules and sheets1, which are shaped by structure. disassemble the virus particle to facilitate entry. After resident factors in the ER2–4. The morphology of the ER SEC61 translocation delivering the viral genetic material into the host cell and is highly dynamic and experiences constant structural channel the translation of the viral genes, the resulting proteins rearrangements, enabling the ER to carry out a myriad An endoplasmic reticulum either become part of a new virus particle (or particles) of functions5.
  • The Origins of G12P[6] Rotavirus Strains Detected in Lebanon

    The Origins of G12P[6] Rotavirus Strains Detected in Lebanon

    RESEARCH ARTICLE Reslan et al., Journal of General Virology DOI 10.1099/jgv.0.001535 The origins of G12P[6] rotavirus strains detected in Lebanon Lina Reslan1,2†, Nischay Mishra3†, Marc Finianos1, Kimberley Zakka1, Amanda Azakir1,4, Cheng Guo3, Riddhi Thakka3, Ghassan Dbaibo1,2, W. Ian Lipkin3,* and Hassan Zaraket1,4,* Abstract The G12 rotaviruses are an increasingly important cause of severe diarrhoea in infants and young children worldwide. Seven human G12P[6] rotavirus strains were detected in stool samples from children hospitalized with gastroenteritis in Lebanon during a 2011–2013 surveillance study. Complete genomes of these strains were sequenced using VirCapSeq- VERT, a capture- based high- throughput viral- sequencing method, and further characterized based on phylogenetic analyses with global RVA and vaccine strains. Based on the complete genomic analysis, all Lebanese G12 strains were found to have Wa- like genetic backbone G12- P[6]-I1- R1- C1- M1- A1- N1- T1- E1- H1. Phylogenetically, these strains fell into two clusters where one of them might have emerged from Southeast Asian strains and the second one seems to have a mixed backbone between North Ameri- can and Southeast Asian strains. Further analysis of these strains revealed high antigenic variability compared to available vaccine strains. To our knowledge, this is the first report on the complete genome- based characterization of G12P[6] emerging in Lebanon. Additional studies will provide important insights into the evolutionary dynamics of G12 rotaviruses spreading in Asia. INTRODUCTION (glycoprotein), are found on the double-shelled capsid Group A rotavirus (RVA) infection is the global leading structure, and are used as determinants of serotype specificity cause of severe, dehydrating diarrhoea in children younger [3].
  • Hepatitis C Virus P7—A Viroporin Crucial for Virus Assembly and an Emerging Target for Antiviral Therapy

    Hepatitis C Virus P7—A Viroporin Crucial for Virus Assembly and an Emerging Target for Antiviral Therapy

    Viruses 2010, 2, 2078-2095; doi:10.3390/v2092078 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Review Hepatitis C Virus P7—A Viroporin Crucial for Virus Assembly and an Emerging Target for Antiviral Therapy Eike Steinmann and Thomas Pietschmann * TWINCORE †, Division of Experimental Virology, Centre for Experimental and Clinical Infection Research, Feodor-Lynen-Str. 7, 30625 Hannover, Germany; E-Mail: [email protected] † TWINCORE is a joint venture between the Medical School Hannover (MHH) and the Helmholtz Centre for Infection Research (HZI). * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +49-511-220027-130; Fax: +49-511-220027-139. Received: 22 July 2010; in revised form: 2 September 2010 / Accepted: 6 September 2010 / Published: 27 September 2010 Abstract: The hepatitis C virus (HCV), a hepatotropic plus-strand RNA virus of the family Flaviviridae, encodes a set of 10 viral proteins. These viral factors act in concert with host proteins to mediate virus entry, and to coordinate RNA replication and virus production. Recent evidence has highlighted the complexity of HCV assembly, which not only involves viral structural proteins but also relies on host factors important for lipoprotein synthesis, and a number of viral assembly co-factors. The latter include the integral membrane protein p7, which oligomerizes and forms cation-selective pores. Based on these properties, p7 was included into the family of viroporins comprising viral proteins from multiple virus families which share the ability to manipulate membrane permeability for ions and to facilitate virus production. Although the precise mechanism as to how p7 and its ion channel function contributes to virus production is still elusive, recent structural and functional studies have revealed a number of intriguing new facets that should guide future efforts to dissect the role and function of p7 in the viral replication cycle.
  • Emergence of Human G2P[4] Rotaviruses in the Post-Vaccination Era in South Korea: Footprints of Multiple Interspecies Re-Assortm

    Emergence of Human G2P[4] Rotaviruses in the Post-Vaccination Era in South Korea: Footprints of Multiple Interspecies Re-Assortm

    www.nature.com/scientificreports OPEN Emergence of Human G2P[4] Rotaviruses in the Post-vaccination Era in South Korea: Footprints Received: 6 November 2017 Accepted: 5 April 2018 of Multiple Interspecies Re- Published: xx xx xxxx assortment Events Hien Dang Thanh1, Van Trung Tran1, Inseok Lim2 & Wonyong Kim1 After the introduction of two global rotavirus vaccines, RotaTeq in 2007 and Rotarix in 2008 in South Korea, G1[P8] rotavirus was the major rotavirus genotype in the country until 2012. However, in this study, an emergence of G2P[4] as the dominant genotype during the 2013 to 2015 season has been reported. Genetic analysis revealed that these viruses had typical DS-1-like genotype constellation and showed evidence of re-assortment in one or more genome segments, including the incorporation of NSP4 genes from strains B-47/2008 from a cow and R4/Haryana/2007 from a bufalo in India, and the VP1 and VP3 genes from strain GO34/1999 from a goat in Bangladesh. Compared to the G2 RotaTeq vaccine strain, 17–24 amino acid changes, specifcally A87T, D96N, S213D, and S242N substitutions in G2 epitopes, were observed. These results suggest that multiple interspecies re-assortment events might have contributed to the emergence of G2P[4] rotaviruses in the post-vaccination era in South Korea. Group A rotavirus (RVA) is the etiological agent primarily responsible for gastroenteritis in young humans and many other animal species. RVA, a member of the Reoviridae family, is an infectious virion that consists of a triple-layered icosahedral capsid containing a genome of 11 segments of double-stranded RNA in it.
  • Ubiquitin in Retrovirus Assembly: Actor Or Bystander?

    Ubiquitin in Retrovirus Assembly: Actor Or Bystander?

    Commentary Ubiquitin in retrovirus assembly: Actor or bystander? Volker M. Vogt* Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY 14853 he assembly of retroviruses is decep- and this signals internalization by endocy- that has a functional relationship with Ttively simple. Only the product of the tosis. The enzymology of ubiquitin conju- ubiquitin. gag gene is required for the formation of gation is complex. The first step is activa- The core element of the late domains of a virus-like particle (1). After its synthesis tion of ubiquitin by an ATP-requiring RSV (16) (Fig. 1), murine leukemia virus in the cytoplasm Gag is targeted to the enzyme called E1, leading to conjugation (17), and Mason Pfizer monkey virus (18) plasma membrane, where Gag-Gag inter- of ubiquitin to E1 via a high-energy thio- is the sequence PPPY, which is found actions, Gag-RNA interactions, Gag- ester bond. The ubiquitin is transferred by about 150–200 amino acid residues from membrane interactions, and perhaps Gag- E1 to a second enzyme, E2. A third en- the Gag N terminus in these and other host protein interactions lead to a bulging zyme, E3, which may form a complex with retroviruses. The core element of the out of the nascent virus particle, first as a E2, then transfers the ubiquitin to amino HIV-1 late domain, PTAP (15), is located horseshoe-shaped and then as a lollipop- groups of the target protein. Although in a different part of the protein, the shaped structure that can be visualized by cells have only one E1, they may have C-terminal portion called p6 (Fig.
  • Functional Control of HIV-1 Post-Transcriptional Gene Expression by Host Cell Factors

    Functional Control of HIV-1 Post-Transcriptional Gene Expression by Host Cell Factors

    Functional control of HIV-1 post-transcriptional gene expression by host cell factors DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Amit Sharma, B.Tech. Graduate Program in Molecular Genetics The Ohio State University 2012 Dissertation Committee Dr. Kathleen Boris-Lawrie, Advisor Dr. Anita Hopper Dr. Karin Musier-Forsyth Dr. Stephen Osmani Copyright by Amit Sharma 2012 Abstract Retroviruses are etiological agents of several human and animal immunosuppressive disorders. They are associated with certain types of cancer and are useful tools for gene transfer applications. All retroviruses encode a single primary transcript that encodes a complex proteome. The RNA genome is reverse transcribed into DNA, integrated into the host genome, and uses host cell factors to transcribe, process and traffic transcripts that encode viral proteins and act as virion precursor RNA, which is packaged into the progeny virions. The functionality of retroviral RNA is governed by ribonucleoprotein (RNP) complexes formed by host RNA helicases and other RNA- binding proteins. The 5’ leader of retroviral RNA undergoes alternative inter- and intra- molecular RNA-RNA and RNA-protein interactions to complete multiple steps of the viral life cycle. Retroviruses do not encode any RNA helicases and are dependent on host enzymes and RNA chaperones. Several members of the host RNA helicase superfamily are necessary for progressive steps during the retroviral replication. RNA helicase A (RHA) interacts with the redundant structural elements in the 5’ untranslated region (UTR) of retroviral and selected cellular mRNAs and this interaction is necessary to facilitate polyribosome formation and productive protein synthesis.
  • Clinical and Virological Characteristics of Rotavirus Gastroenteritis and Prevalence of Strains in Tochigi, Japan

    Clinical and Virological Characteristics of Rotavirus Gastroenteritis and Prevalence of Strains in Tochigi, Japan

    in vivo 28: 1141-1148 (2014) Clinical and Virological Characteristics of Rotavirus Gastroenteritis and Prevalence of Strains in Tochigi, Japan KEI NUMAZAKI and MAHO ICHIKAWA Division of International Infectious Diseases, Graduate School of Health and Welfare, International University of Health and Welfare, Nasu-shiobara, Tochigi, Japan Abstract. Aim: Rotavirus infection is a serious countries (1). Each year, the vaccine prevents an estimated gastrointestinal infection that is usually prevalent during 40,000 to 50,000 hospitalizations among U.S. infants and winter months and often seen in infants and young children. young children. Rotavirus illness has also decreased among Studies on genotypes of prevalent rotavirus strains are older children and adults that are not vaccinated; they are important for preventing infection, developing vaccines, and likely gaining indirect protection from rotavirus disease as its evaluation. The purpose of this study was to make an vaccinated children are less likely to get the disease and investigation of a rotavirus infection in the Nasu Region of spread it to others. Focusing on deaths of under 5 years in Tochigi, Japan and to compare findings to those of other developing countries infectious gastroenteritis has critical regions. Materials and Methods: We examined the clinical roles. Nature of rotavirus in spans of many mammals and findings in 147 patients who attended the Department of birds, infection of rotavirus infection in humans is virtually Pediatrics at International University of Health and Welfare limited to humans. Hospital in the Nasu-shiobara City, Tochigi Prefecture, Rotavirus, a member of the family Reoviridae, has 11 Japan during April 1, 2008 to March 31, 2010.