Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. htd xs u aentbe ul hrceie Rol n ox 97 ooi ta. 06.The 2016). based of are al., sequence et isolates nucleotide rickettsial Bogovic in novel 1997; differences of Roux, the description and gene, and (Raoult rRNA delineation characterized 16S fully classification, the been the on not for have guidelines comprising but current group exist transitional do the bite, that ticks through humans to transmitted wholly of are are that another. which to species species agent many two Roux, etiologic one of and from consisting Raoult varies of group 2013; severity species pathogenic whose al., recognized some diseases many et by zoonotic are (Parola There caused vector-borne ticks known are sub- these oldest that contacts many to the diseases frequent In of hosts are zoonotic 2013). are there diseases are al., where that Rickettsioses human et communities animals 1997). (Parola rural important domestic in America emerging and rampant South humans are of and between diseases Asia agents these Africa, countries, etiologic in Africa the countries Saharan tropical as many identified in been especially have pathogens known. Tick-borne not are impacts health group human fever the group and INTRODUCTION (spotted fever area spotted SFGR predominant study the the the is being in africae R.tamurae animals R. to domestic that and shows relationship from parkeri three report phylogenetic collected R. This and the have ticks africae, they from Conclusion: in Rhipicephalus rickettsiae that (6.3%) R. ticks. Amblyomma, showed screened 60/953 with of the obtained in rickettsiae in sequences consisting detected detected group DNA rickettsiae) genera was fever the DNA three spotted of Rickettsia into analyses of of Results: delineated Genetic members presence were GenBank. screened. The ticks in study abundance. of sequences the of genera reference in order curated collected decreasing with sequencing in ticks relationships Hyalomma commercial 953 evolutionary analyses a to of phylogenetic for and in (according Version total search ticks sequenced 7 homology A for amplified were MEGA BLASTn selected to amplicons with subjected The ompA chain performed and edited genes. (polymerase three were were ompB PCR forty sequences nucleotide by and and obtained ompA The spp. ompB gltA, facility. Rickettsia positive the to all targeting belonging morphologically delineations), pairs pathogens the primer morphological tick-borne from of specific ticks presence used selecting identified the we randomly were for reaction) by ticks identified assess The To molecularly Africa. were groups. South and delineated Cape, extraction were Ticks Eastern DNA rickettsiae Municipality, globally. to group) distribution, Nkandla diseases fever prior Raymond zoonotic Their (spotted morphologically emerging in SFG for animals potentials. responsible another. domesticated are zoonotic to from ticks have location collected Ixodes ecological different that by one pathogens transmitted from predominantly of differs are transmit which plethora they transmit pathogens to the and propensity diversity the have Ticks Background: Abstract 2020 6, May 3 2 1 Africa. South IWERIEBOR Cape, BENSON Eastern in ticks animals in domestic rickettsiae from group fever collected spotted of evidence Genetic aeu of up made nvriyo otHr aut fSineadAgriculture and Hare Fort Science of of Faculty University Hare Fort of University University Sciences Health Makgatho Sefako R.australis R.bellii , .akari R. n R. and and canadensis 1 ybll Nqoro Ayabulela , R.felis Rickettsia htaeascae ihtcs ie n esadteacsrlgroup ancestral the and fleas and mites ticks, with associated are that eieteegop,teeaeas ayother many also are there groups, these Beside . R.typhi htaedlnae nofu ao rusnml;tetyphus the namely; groups major four into delineated are that and 2 nhn Okoh Anthony , 1 R.prowazekii, glt h pte ee ru hc contains which group fever spotted the A, 3 n ar Obi Larry and , omp Rickettsia A, omp ,adteDgenes D the and B, p.Te r one are They spp. Rickettsia 1 species Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. h omneeto h td.Priso a rne ytefresbfr n ik olcincould collection health animal ticks and animals. any personnel the before veterinary treating of farmers help and the with before handling done by for (REC-270710-02-RA) was granted responsible collection clearance Ticks was technicians ethical Permission animals. the their study. from granted commence the Committee of Ethics commencement Hare the Fort of University The ticks. clearance with infested Ethical be might who study humans This habitations in human diseases Methods and zoonotic treatments. reserves and of game Materials of likelihood natural the commencement to diagnoses assess close in to tick-borne to are priority which order prior for top communities in surveillance diagnosis as in animals them epidemiological laboratory domesticated to consider at of from similar not much aimed might lack very was infections who are to rural these that clinicians therefore, symptoms off due by these with fights misdiagnosed treatments in present ordinarily be infections and HIV/AIDS that thus SFGR system of the could are of immune and prevalence infections most competent flu zoonotic high domesticated zoonotic Besides, the of with these very folks. lack spread down healthy they of the in the coming these as possibilities patients with making probable where great immunocompromised thus Also, very reserves these wild exist equally game of the There many localities. chances from are the these originating wild. communities, there those in the that from in possible is ticks those this pathogens with with with infested contact Couple being animals close the animals homes. where in husbandry to et animal are proximity Bogovic intensive animals with close 2005; rural in al., predominantly is kept et Africa (Parola are South diseases of human Cape thought Eastern of The previously etiology were the that to species such linked 2016). times directly different recent al., been in to and now However, selective confined have unrecognized. highly innocuous were are are humans which diseases approaches in molecular disease these species of and of several development of the ecology the diagnoses, as each the to disease well Prior in as as to overtime sensitive them. tied varying 2018) transmit keep are al., that redistribution diseases ticks and et of distribution tick-borne (Tomassone their of though vectors attributes (Tomassone regions tick another clinical geographical to their and location epidemiological of geographic one The biotopes from zoonotic varies 2018). cases severity of clinical al., some multitudes and et in genus vectors or ticks possible the are its one is indeterminate. of that ticks it transmit diseases be SFG of vectors, to to the tick disease species of ability known particular Members the common a to have of most linked agent genera are the etiologic ticks’ pathogens an Africa, tick-borne these for South most all While of and Cape pathogens. 2019) transovarial Eastern al., or the et transstadial Yawa - In tropical as either genera; the the such be of in 2018). members could species rickettsioses al., rickettsioses tick-borne tick et tick-borne of some (Tomassone transmission of making the Transmission thus in involved world. transmission generally the 2009; are of al., that regions tick et of (Socolovschi species other the the genera to the relative of region like Members their one by conditions tick- from determined environmental of 2018). varies are suitable distribution al., which spread by global et geographical biotopes Tomassone governed The their and generally 2017). as humidity are al., other temperatures, distributions the et Portillo to whose ( region vectors one organisms ticks from the varies in rickettsioses proteins borne essential for encodes that mlom,Haom,Riiehls xds Dermacentor Ixodes, Rhipicephalus, Hyalomma, Amblyomma, mlom,Riiehls Haemaphysalis, Rhipicephalus, Amblyomma, Rickettsia Rickettsia r h tooi gnso ikbrercetissagopof group a rickettsioses tick-borne of agents etiologic the are p.hdbe eetdi ik u hi oe nteetiology the in roles their but ticks in detected been had spp. 2 Amblyomma Rickettsia ob nw eevi of reservoir known a be to and Hyalomma ahgn ntcscollected ticks in pathogens and Ieibre l,2017; al., et (Iweriebor Haemaphysalis .africae R. are Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. iktsaspp. Rickettsia 225R 85F Ref TM bp Amplicon DNA to3’) Tick and (5’ (2010) ticks Sequence al., of Primer et identification Gene Williamson molecular name by the Primer adapted in as used assay sequences PCR Primer a 1. in Table (2001) of Kengluecha. identification and al., gene Kollars species et rDNA and the Williamson 12S (1991) 2016; for of mitochondrial al., used et detection the are (Yawa that targeting and morphologically for PCR identified identification hitherto by Screening tick genera 2010). done both the was for of identification representatives PCR from species using tick assessed of ticks was in Confirmation specimen bacteria of tick detection Each and tick and of materials, tips templates. identification isolation from barrier Molecular the template temporally filter from dispensing, and far free physically reagent performed both DNA/RNase i.e., was separated setup functions, certified was PCR specific Commercially handling contamination. reagent to aerosol handling. prevent throughout dedicated template to used were used and instruments sets were and setup, pipettor blades PCR as reagents, well isolation, of contaminations as were precautionary cross Absolute process reactions light. avoid PCR the same UV and to using the overnight processing adopted sterile from ticks were left collected All always measures were extraction. species which DNA same cabinet for biosafety the in processed of and performed and engorged nymphs together adult to the The pooled while according (2017). were extraction separately al. animal Kit DNA et processed Universal Iweriebor for which were by DNA separately samples ticks described Quick tick previously non-engorged processed blades ZYMORESEARCH as the and sterile and system from delineations instruction with miniprep manufacturer’s residues morphological bits the Tissue ethanol into their DNA chopped the on were ReliaPrep in all based ticks dry using remove dishes The to to Petri reactions. left order the and PCR in water downstream in distilled done the sterile affect was with negatively This washed might dish. were Petri specimens sterile preserved the a extraction, not DNA does to it ticksPrior as from consideration into extraction taken DNA not genomic were 2019; Total pathogens genders al., Ticks transmit et Yawa 2010). to 2017; ability al., al., morphological its et et using affect Williamson 4 (Iweriebor identified 2003; at accordingly were htt- stored al., processed collected were and et species and Walker keys tick - accordingly taxonomic All labelled samples appropriate 2017). properly of through: and al., were mix-up criteria into et tubes avoid as (Iweriebor forceps to accessed sites animals processing measures using collection further precautionary by and until be taking horses) animals wild ethanol of and 70% basis cattle can some contained the sheep, on that (goats, tubes map of animals Nalgene domestic mL site boast from 50 manually coordi- collected which Study were geographical Ticks reserve others. 32.836 Mu- their natural 32 and local collection and coordinates: fish at deer, Ticks Mhlaba following sites Great located giraffe, Raymond the with Beaufort collection boars, in ps://tse2.mm.bing.net/th?id=OIP.GvQ4IE1x4Slo9oTuUb9EBgHaEk&pid=Api&P=0&w=284&h=176 Fort with boundary Ticks antelope, 2018 and shares Debe, like September Municipality Location from Province. to local be follow; 2017 Cape Mhlaba as March mond Eastern are from the nates conducted in was nicipality study identifications. The and collection tick area, Study 12S 12S TACTTAAGATGT 1 40Wle ta. 2003 al., et Walker 54.0 110 TTAAGCTTTTCAGAGGAATTTGCTC TWGTCCTGCTA52.7 TTTWWGCTGCACCTTGACTTAA Rickettsia p.wspromduigtreo h rmrpisa niae nTbe1 Table in indicated as pairs primer the of three using performed was spp. Rickettsia 3 ahgn speiul eotdb enr tal. et Regnery by reported previously as pathogens ° Rickettsia 7 ”S 26 S, 0” 47’ ° 27.154 S spp ° ° ,udrRay- under E, 8 ”E De- E. 0” 38’ Rickettsia spp. ° C Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. opooi lsicto ssoni iue1 h rprin ftedffrn ik olce ntetwo the in collected ticks different the the of of proportions accuracy The the 1. confirmed identification Figure all methods Molecular in morphological they GenBank. by shown that in delineated as showed sequences ticks classification ticks’ sequences different curated morphologic rDNA of with representatives mitochondrial homology the 12S sequence of tick 97% host. edited than common more the the had of as analysis serving BLAST cattle Furthermore, with sites study both in species truncatum three adult), to (n=133 belonged they that showed were ticks collected were the which delineate genera, to Raymond used in method rickettsial identification tick-borne localities Morphological of designated prevalence the sites. the for sampling from analyzed the collected and Province in were Cape pathogens samples Eastern ticks’ of Municipality (953) Local three Mhlaba fifty and hundred sites Nine study two the within prevalence Tick RESULTS for numbers. sets accession data for 1000 Sequence with GenBank search software Builder. NCBI version Tree BLAST to 7 BioEdit submitted the Mega using were using after constructed samples tree were GenBank positive phylogenetic trees from possible Phylogenetic maximum obtained replicate. a sequences bootstrap construct to reference used with was aligned which were sequences Edited curated other ho- with 97% analysis along Phylogenetic above analyses 3.1.7 had phylogenetic that GenBank. for sequences the strains in Rickettsial reference sequences as NCBI. SFGR used GenBank of were the representatives characterized samples previously in test of the curated with sequences using mology genetic species representative search the tick with www.ncbi.nlm.nih.gov) homology of and compared Information, delineation to were rickettsial Biotechnology for sequences for subjected edited suffice Center were the could (National where sequences Tool genes Search nucleotide the Alignment of generated Local any Basic The such version. as 2019.0.3 and genus Prime equal delineate the are to power among genes discriminatory also amplified the species that were three fact amplicons the the with rDNA by coupled 12S spp. constraint of tick’s financial out to of due samples representatives the was for cons amplified 43 sequenced the was Only none all facility. and while sequencing sequenced sequenced commercial were a amplicons in B sequenced positive were 60 products the PCR search amplified BLASTn The and editing sequence sequencing, DNA RrCS989 RrCS372 BG2-20 BG1-21 602N Rr.190 70P Rr.190 .hebraeum A. rompB rompB lACCAAGTTCCTTTAATACTTCTTTGC gltA TTTGTAGCTCTTCTCATCCTATGGC gltA .6 n=3aut ndcesn re fterprevalence. their of order decreasing in adult) =93 (n 9.76% rompA rompA omp .simus. R. CTTCCACCTC55.2 GCATCTGCACTAGCACTTTC 1994 &Raoult, Eremeeva 55.6 GGCAATTAATATCGCTGACGG 511 91%(=33adult), 373 (n= 39.14% Rhipicephalus TGGAATCCAA 1 25Rgeye l,1991 al., et Regnery 52.5 610 ATGGCGAATATTTCTCCAAAA mlcn eesqecddet oetcnclcntansadaltepositive the all and constraints technical some to due sequenced were amplicons A GGACTCCCCC 64.9 AGTGCAGCATTCGCTCCCCCT 17%(=1 adult), (n=112 11.75% Rickettsia , Amblyomma h lgmn n euneeiigwsahee sn Geneious using achieved was editing sequence and alignment The . glt .appendiculatus R. oiieapios h nblt osqec the sequence to inability The amplicons. positive A and hpcpau vrt eversti eversti Rhipicephalus 4 Hyalomma 57.4 1 90KlasadKengluecha,2001 and Kollars 59.0 410 64 n163)adult), (n=156(34) 16.4% ihsxdffrn species different six with .hebraeum A. .2 n=6aut,and adult), =86 (n 9.02% a h otprevalent most the was .microplus R. . mns them Amongst glt Rickettsia ampli- A 13.96% omp H. Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. oa f6 63)pstv ape o h he ee mlfidwr eetdfor detected of were identification amplified the genes for three used assays the PCR for samples analyzed. ticks positive 953 (6.3%) the 60 of total A of prevalence and identification Detection, analysis phylogenetic in used strains tick Reference 3: Table Horse stage Developmental Sheep species Tick Goat Cattle geogra- Beaufort, Animal Fort and Location Debe in species study. tick GenBank this from collected in 32.836 obtained of generated sequences coordinates: sequences distribution reference phical ticks’ and of the Proportion list of 2: the analysis Table is phylogenetic 3 the Table in while used 2 Tables were in that presented are sites study tanAcsinNme pce egahcloii References origin Geographical Species Number Accession Strain AF031865 AF150049 KX377407 MG076938 MK332391 KU568502 EU921766 AF150043 MF479198 KY676839 KY676832 KU284864 KU284920 KU284929 ° 27.154 S .hebraeum A. truncatum H. simus R. microplus R. hebraeum A. eversti eversti R. appendiculatus R. truncatum H. simus R. microplus R. hebraeum A. eversti eversti R. truncatum H. simus R. appendiculatus R. microplus R. hebraeum A. eversti eversti R. ° ,codnts32 coordinates E, .punctatus R. hebraeum A. gemma A. maculatum A. microplus R. geigyi R. microplus R. Boophilus evertsi R. australis R. annulatus R. parvitarsum A. triste A. trigrinum A. 5 ° 7 ”S 26 S, 0” 47’ utai Murrell 1999 Beati, 2016 Kumsa, Lado Ndekezi Australia 1999 Beati, Amzati Zuquete Zimbabwe Labruna Ethiopia 2017 Duron, Mexico 2017 Uganda Duron, Guinea-Bissau Lado Lado Lado Mozambique Jordan DRC Africa South Israel Argentina Uruguay Brazil dl 25 18 21 27 4 65 9 9 2 62 20 24 Adult Adult 79 12 113 Adult 0 Adult 55 Adult 67 Adult 3 94 Adult 27 Adult 25 170 Adult 5 77 Nymph Adult Adult Adult Adult Adult Adult Adult Adult Rickettsia Rickettsia ° 8 ”E. 0” 38’ spp . p.wr oiiefralgenes all for positive were spp. ntesuysites study the in iktsapositive Rickettsia ticks of Number Rickettsia tal et al et al et al et tal et tal et tal et tal et tal et ,2017 ., 2015 ., 2015 ., 2015 ., ,2017 ., ,1999 ., ,2018 ., ,2016 ., ,2008 ., p.from spp. Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. n rvl hthv aiiae h itiuino ikvcosadtersial nmlhssi short exotic introduce a to in capacity hosts the have animal which of suitable materials birds territories. Genetic including their new trade animals into and of global pathogens vectors migration and improved their tick as reservoirs iii) and well of are ticks as activities, distribution which iv) outdoor ticks the time, increased of with facilitated space contact to have human for due that increased reserves travels responsible pathogens ticks ii) turn and SFGR be are population, in could tick-borne that human that territories that of increased ecological processes factors transmitters into of physiological Other humans result times of increased a infringement reproduction. recent stimulates as are;-i) accelerated in cycles could changes ultimately occurred notable These these observed and have and the growth rains. that globally rapid and humidity fever to drought relative spotted lead rickettsial of increased of cycles and epidemiology to temperatures the warmer due in to following change attributed notable the be a under been have database There GenBank the in (rickettsia DISCUSSION deposited MK405447-MK405477 identification), been (rickettsia (tick have MK405386-MK405446 MK347206-MK347212 gene), study this numbers: accession in obtained Sequences numbers accession GenBank Uncultured with homology close respectively. having 76% as it showed search between clustered B150 the of analyses with constructed tree between equidistance clustered A198 with and illustrated A196 as sequences while database the 81% R.tamurae nucleotides above of values GenBank generated bootstrap Majority NCBI with with MG515014) from analyzed 4. sequences and Figure reference in selected with clustered randomly sequences were test analysis of phylogenetic sequences respectively. for study D used to 3A sequences and Reference D to of sequences 2A sequences acids amino homologous Figures and corresponding in Nucleotides the shown alignments. with with sequences homologous performed nucleotide were 100% and alignments was acid amino 209 both sample in of respectively A209 Similarly, alignments. africae sequences R. nucleotide and acid amino the The while respectively. (EU272186) 3a-d and 2a-d between homology in with mologous africae of sequences homologous 22%. omp was with sheep 97% generated of above for that while search goats homology from more A ticks with sites in study prevalence the 23% in cattle, collected ticks from of genera three in the detected from of obtained all were and fragments (43) DNA the Rickettsial ompA delineate some to only analyzed which and of sequenced sample were positive every per profiled fragments addtsRickettsia Candidatus eune yBATaayi hwdta aoiyo h eune ae[]8 oooywith homology [?]98% have sequences the of majority that showed analysis BLAST by sequences B hl nytosmls(18 n 29hd9%smlrt with similarity 99% had B209 and (B188) samples two only while (LC388791) E628)wieB0 ftesm apews10 ooooswith homologous 100% was sample same the of B209 while (EU622980) .hebreaum. A. .tamurae R. omp omp .africae R. and A omp omp omp R.africae R.rhipicephali and A lo ihrpooto fteptoes(5)wr bandi ik collected ticks in obtained were (55%) pathogens the of proportion higher a Also, D131)rsetvl ae on based respectively (DQ113910) eune ssoni iue5wt otta ausaoe7% Phylogenetic 70%. above values bootstrap with 5 Figure in shown is sequences B and A U716wt 7 otta au ssoni iue4wietephylogenetic the while 4 Figure in shown as value bootstrap 77% with EU272186 ftesm apews10 oooosto homologous 100% was sample same the of B omp omp , omp .parkeri R. C011)wt 2 otta eiblt n 18adA0 clustered A208 and A188 and reliability bootstrap 92% with (CP001612) omp eune upr h bevddsrpnisi oooy Sequence homology. in discrepancies observed the support sequences B Rickettsia omp eune lsee with clustered sequences A ee.Tepyoeei reotie for obtained tree phylogenetic The genes. B A131)and (AF123719) fsml 8 hwd9%smlrt with similarity 99% showed 188 sample of A eune ftetosmlswr bevda hw nFigures in shown as observed were samples two the of sequences B omp and Rickettsia eune hwdta hyhdahg eunesmlrt of similarity sequence high a had they that showed sequences gene). B Rickettsia .tamurae R. 6 R.parkeri nGnak oprsno h 43 the of Comparison GenBank. in p.dw oteseislevel. species the to down spp. eetetreSG htwr eetdamongst detected were that SFGR three the were omp Rickettsia .africae R. K131)pyoeeial u BLAST a but phylogenetically (KY113111) LSnanalysis BLASTn B .parkeri R. ln and clone U39;K653,GU247115, KJ645933, (U43790; omp R.parkeri K131)ad10 ho- 100% and (KY113111) and A .conorii R. ompA . R.tamurae oee,discordances However, omp addtsRickettsia Candidatus K131)i both in (KY113111) omp eesoe that showed gene 6)amplicons (60) B omp eune as sequences B F059)by (FJ015092) (DQ113910) n 60 and A omp R. A Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. idatce yAiaMori-Kajihara Akina by articles Find Japan 001-0020 Sapporo, Kita-ku, 6 Mori-Kajihara Akina Kajihara Masahiro by articles Find Japan 001-0020 Sapporo, Kita-ku, 6 Kajihara Masahiro Japan Matsuno 060-0818 Keita Sapporo, by Kita-ku, articles 9, Find W 18 N University, Hokkaido CoRE), Japan 060-0818 Sapporo, Kita-ku, 9, 5 W 18 N University, Hokkaido 4 Matsuno Keita Qiu Yongjin by articles Find Zambia Lusaka, 32379, Box O. 3 Qiu Yongjin Thu June Japan May 060-0818 by Sapporo, articles Kita-ku, Find 9, W 18 N Thu University, June Hokkaido Kita-ku, May 10, W Tanzania. of 20 Moshi, N result 2 in Control, a with Zoonosis TGR identified for Japan as and inpatients Center 001-0020 SFGR symptoms among Research Sapporo, 51.7% University acute flulike Hokkaido of for had seroprevalence Management, a and tested them reported Analysis 2005). were of (2011), al., who al., (27%) et fever et Consigny majority Prabhu febrile Also 2010; Africa, al., 2011). South al., et to et Mediannikov travelers 2004; be 940 al., might et of contacting Africa (Ndip group transmitted sub-Saharan -51% a are the 21.4% In and between in of regions ranges Sero-prevalence living it geographical populace Africa. Senegal given the of a of regions to Majority endemic restricted that are region. diseases rickettsial given they to tick-borne seropositive the rather single world inhabiting one ticks the 2016). no al., is over by there et all globally, (Bogovic found found bite are is ticks bite diseases through tick rickettsial humans etiologic African United though it Even the African, 2016). to are al., sub-Saharan transmitted et the they is (Bogovic it in and respectively prevalent which related Japan byfrom very in closely transmitted are rickettsiosis generally are that and is species fever Brazil fever and bite three America tick These of American States study. and this African in of agents collected genera ticks the iiino lblEieilg,Hkad nvriyRsac etrfrZooi oto,N2 10, W 20 N Control, Zoonosis for Center Research University Hokkaido Epidemiology, Global of Division 10, W 20 N Control, Zoonosis for Center Research University Hokkaido Epidemiology, Global of Division (GI- Education and Research Collaborative for Diseases, Institution Infectious Global of Control, Zoonosis School for Graduate Station Medicine, Global Veterinary of Faculty Microbiology, of Laboratory P. Zambia, of University Medicine, Veterinary of School Zambia, in Control Zoonosis for Center Hokudai Diseases, Infectious of School Graduate Medicine, Veterinary of Faculty Parasitology, of Laboratory .africae R. .africae R. h tooi gn fArcntc-iefvruo eunn rmtertae (Prabhu travel their from returning upon fever tick-bite African of agent etiologic the u adyd hyscubt fia ikbt ee si swt rvlr othe to travelers with is it as fever bite tick African to succumb they do hardly but Amblyomma ik hc evr sishs n idrdnsaei reservoir it are rodents wild and host its as servers which ticks .africae R. 7 nCmro sbten1.%-5.%wiein while 51.8% - 11.9% between is Cameroon in 1 nto Risk of Unit Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. idatce yKnKatakura Japan Ken 060-0818 by Sapporo, articles Kita-ku, Find 9, W 18 N University, Hokkaido 2 Katakura Ken Oosako Hideo by articles Find Japan 0425 14 Oosako Hideo Andoh Masako by articles Find Japan 890-0065 Kagoshima, Korimoto, 1-21-24 13 Andoh Masako Gokuden Mutsuyo by articles Find Japan 892-0835 Kagoshima, 12 Gokuden Mutsuyo Seto Junji by articles Find 11 Seto Junji Chiba Kazuki by articles Find 10 Chiba Kazuki Monma Naota by articles Find 9 Monma Naota Omori Ryosuke by articles Find Japan 332-0012 Saitama, Agency, 8 Japan 001-0020 Sapporo, 7 Omori Ryosuke aoaoyo aaiooy aut fVtrnr eiie rdaeSho fIfciu Diseases, Infectious of School Graduate Medicine, Veterinary of Faculty Parasitology, of Laboratory Japan 960-1295 Fukushima, Hikarigaoka, 1 University, Medical Fukushima Control, Infection of Department Technology and Science Japan (PRESTO), Technology and Science Embryonic for Kita-ku, 10, Research W Precursory 20 N Control, Zoonosis for Center Research University Hokkaido Bioinformatics, of Division uaooPeetrlIsiueo ulcHat n niomna cec,Uosi uaoo 869- Kumamoto, Uto-shi, Science, Environmental and Public-Health of Institute Prefectural Kumamoto University, Kagoshima Medicine, Veterinary of Faculty Joint Health, Public Veterinary of Laboratory cho, Kinko 11-40 Health, Public and Research Environmental for Institute Prefectural Kagoshima Japan 990-0031 Yamagata, Toka-machi, 1-6-6 Health, Public of Institute Prefectural Yamagata Japan 960-8560 Fukushima, Houkida, Mitouchi 16-6 Health, Public for Institute Fukushima 8 Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. nUad Nkoe l,21) oee,Wnre l 21) eotdfidn h N of DNA the finding reported (2014), al. et Waner However, 2013). al., et (Nakao about Uganda in in and rash eschar generalized variegatum the and of lymphadenopathy Amblyomma development regional myalgia, the cases. headache, after the reported fever, days of any of many 50% bite been that appear not tick usually normally has are through ATBF there they with disease date, associated the to symptoms acquired and the who disease mild Africa a africae East of generally R. to infection is traveler to ATBF attributed Austrian Tanzania. deaths an to diagnostic visit on al. molecular and a (2016) eschar and et during had immunological Angerami He al. Similarly, both by Brazil. et by to infected prevalent. Harrison country. return confirmed be being the his was upon to departing as which Africa to methods ATBF (2007) South prior visited of about who al. day characteristics Brazilian report a et symptoms a to bite Socolovschi on Uganda. weeks ATBF tick people by reported two from a first reported (2018) returning a of the been traveler from complained were Slovenian previously returning and (2013) a had after pains in al. et chills, care ATBF Socolovschi et fever, sought of Botswana, 2016; Lorusso for illnesses case like al., Uganda underlying a et countries to Bogovic without reported Africa visit 2011; man (2016) Southern tourists al., Slovenian the from et al. 29-year-old Prebhu obtained from et The 2017; been Bogovic most have al., endemic, date et 2007). to (Nilssona is al., Zimbabwe documented it and been which Africa, have to South that countries cases ATBF from on returning data of majority The Nakao Japan Ryo 060-0818 by Sapporo, articles Kita-ku, Find 9, W 18 N University, Hokkaido 2 Nakao Ryo Japan Isoda 060-0818 Norikazu Sapporo, by Kita-ku, articles 9, Find W 18 N University, Hokkaido CoRE), Japan 5 001-0020 Sapporo, Kita-ku, 10, W 1 Isoda Norikazu Sugimoto Chihiro by articles Japan Find 001-0020 Sapporo, Kita-ku, 10, W Japan 20 060-0818 Sapporo, Kita-ku, 9, W 15 18 N University, Hokkaido CoRE), 5 Sugimoto Chihiro Takada Ayato by articles Find Japan 001-0020 Sapporo, Japan Kita-ku, 060-0818 Sapporo, Kita-ku, 9, W 6 18 N University, Hokkaido CoRE), 5 Takada Ayato aoaoyo aaiooy aut fVtrnr eiie rdaeSho fIfciu Diseases, Infectious of School Graduate Medicine, Veterinary of Faculty Parasitology, of Laboratory (GI- Education and Research Collaborative for Institution Global Control, 20 N Zoonosis Control, for Zoonosis Station for Center Global Research University Hokkaido Management, and Analysis Risk of Unit (GI- Education and Research Collaborative for Institution Global Control, Zoonosis for Station Global 10, W 20 N Control, Zoonosis for (GI- Center Education Research University and Hokkaido Research Epidemiology, Global Collaborative of for Division Institution Global Control, Zoonosis for Station Global iiino olbrto n dcto,Hkad nvriyRsac etrfrZooi oto,N Control, Zoonosis for Center Research University Hokkaido Education, and Collaboration of Division sotnascae iha nclto shra h pto taheto h ikvco.Usually, vector. tick the of attachment of spot the at eschar inoculation an with associated often is ikhsbe eotdt etevco of vector the be to reported been has tick .africae. R. .africae. R. fia ikbt ee a lobe eotdfrtefis ieby time first the for reported been also had fever bite tick African oee,js like just However, 9 .africae R. .parkeri R. .africae R. ntcsi gnawhere Uganda in ticks in iktsoi,tedsaecue by caused disease the rickettsiosis, ihapeaec f97.1% of prevalence a with .conorii R. .africae R. Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. ot fiab aaine l 21)wihhsntbe eotdpeiul n t ahgncpotential pathogenic its and previously reported been tamurae not R. has which (2018) unknown. al. currently et is Halajian by Africa South male adult D. to 2A Figures Rickettsia in shown as be the alignments not of acid may assignments amino sites phylogenetic study discordant the observed We in and cases undetected. human gone in have involvement probably its omp may pathogen, in human it detected a as as unlikely been documented has been organism has the it and Uruguay, and parkeri Brazil, Argentina, triste as with A. such illness countries associated American eschar and Latin case Infections disease USA. human first the the in Since 2008). al., to parkeri et akin (Paddock very Honduras from is by returned that caused who rickettsiosis traveler of eschar-related a case in mild No reported a though throat, though though America 2008). sore even myalgias, RMSF Central al., headache, in region to et soles, reported similar (Paddock or very been palms vomiting however is on have or that petechiae fever nausea pustules, moderate or diarrhea, with to vesicles lymphadenopathy, associated grade rashes, by symptoms low papules humans the or a of of macules with Some Infection usually severity. is States. in it less United and southeastern bite in tick described infected Texas been have eastern cows South parkeri and in in dogs DNA collected in its were of infections of that eggs detection ticks and the tissues Coast reported the Gulf in from parkeri organism time R. the then, first et of since Paddock the ever finding 2016; for and the al., organism et describe the (Kimita to USA isolated first the the of was case states (1993), female fever southeastern humans Cowdry, spotted many in rickettsiosis in 2008). index ailments reported al., The The related and identified fever. eschar species. been spotted by Amblyomma have Mountain characterized by Rocky is transmitted of by organism is symptoms caused continents to the similar America with are North associated which and disease South fever the spotted in prevalent is reports that these and parkeri 2016) R. al., of et Congo, DNA Bogovic of the 2013; Republic as al., assessed. finding Democratic et we our Sudan, (Parola with Liberia, consonant Burundi Guinea, in and are Senegal, Kenya Mali, Niger, as Nigeria, to such belonging Cameroon, countries ticks sampled. African of animals several species domestic different in the of from in PCR detection specimens by the blood detected reported in pathogen (2014) the in of al. 77.14% et in Yssouf Maina as adult Similarly, well Also, tick. as country. host Comoros, the given the a of to Union of nor the detection continent the African of the reported 2.7% to (2014) distribution al. in et limited not is rickettsia in ylmadetritum Hyalomma .parkeri R. and A .variegatum A. .maculatum A. nteArcncnietadteeieilgclipiain r o elkon oee,because However, known. well not are implications epidemiological the and continent African the in nms ae sascae ihancoi shra h on fiouainatrsvrldy fan of days several after inoculation of point the at eschar necrotic a with associated is cases most in aebe eotdaogprosrsdn nteeooia ag ftevco tick vector the of range ecological the in residing persons among reported been have ik Rmre l,21) o h rttm,hr erpr h eeto fgntcmtra of material genetic of detection the report we here time, first the For 2011). al., et (Romer ticks hpcpau Bohls microplus (Boophilus) Rhipicephalus a endtce nohrtc pce te than other species tick other in detected been has hpcpau simus Rhipicephalus .parkeri R. .parkeri R. p tanG-em sa nopeeydsrbdrcetilta a eetdfo he fed three from detected was that rickettsial described incompletely an is Ga-Seema strain sp. ebro h pte ee ru iktsai h tooi gn fAeia ikbt fever bite tick American of agent etiologic the is rickettsia group fever spotted the of member a omp neto codn oIakae l 21)i soitdwt ypossc sml local mild as such symptoms with associated is (2013) al. et Imaokaa to according infection Y110rsetvl nFg n n hswssont es ihncetd and nucleotide with so be to shown was this and 5 and 4 Figs in respectively KY113110 ee fsml 8 ste eefudt lse with cluster to found were they as 188 sample of genes B .parkeri R. ik olce rmdmsi uiat nKnaee huhte on oevidence no found they though even Kenya in ruminants domestic from collected ticks a eotdb adc ta.(04,nmru ae frcetisscue by caused rickettsioses of cases numerous (2004), al. et Paddock by reported was ik htwr olce nJcsnCut,Msor.Hwvr akre l (1963), al. et Parker However, Missouri. County, Jackson in collected were that ticks a rtrcgie yPdoke l,(04 n vrsnete;nmru cases numerous then; since ever and (2004) al., et Paddock by recognized first was ikcletdfo idba nIre niaigta h pte ee group fever spotted the that indicating Israel in boar wild a from collected tick F iktsa aebe rqetydtce in detected frequently been have rickettsiae SFG a ik olce rmtodnesi 04i lhaae ipp Province, Limpopo Hlahlagane, in 2014 in donkeys two from collected ticks .variabilis D. .africae R. nsuytcscletdfo oal oetctdaiasin animals domesticated locally from collected ticks study in .africae R. ntcsrmvdfo esn nTxs USA. Texas, in persons from removed ticks in n9%of 90% in .variegatum A. 10 .parkeri R. .maculatum A. .parkeri R. a eetdi h ieetgnr ftcsthat ticks of genera different the in detected was mlom,Riiehls Hyalomma Rhipicephalus, Amblyomma, .variegatum A. .maculatum A. iktsoe r ee,iouaineschar, inoculation fever, are rickettsioses ik bandfo ateipre into imported cattle from obtained ticks .africae R. aebe rqetyrpre nseveral in reported frequently been have .africae R. swdl itiue hogotthe throughout distributed widely is Candidatus_Rickettsia .parkeri R. %of 1% , sWlimo ta. (2010), al., et Williamson as gntp N n9.%of 92.6% in DNA –genotype eei aeil aebeen have materials genetic .maculatum. A. .appendiculatus R. iktsoi aebeen have rickettsiosis R.parkeri .maculatum A. rickettsiosis EU27216.1 .parkeri R. However, genera and R. R. R. Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. ihtetosqecsa hw nFgrs3-,the highly 3A-D, most Figures is B209 in sample shown that fever as indicating spotted sequences two in the involvement with with its Phylogenetic similarity that where 2013). 100% confirmed Laos al., had search et in (Gaowa homology as organism and well the reported respectively as for was the seropositive 2018) it tested until of al., patient humans analyses et a to deer, non-pathogenic after (Halajian infest documented be Japan also was to 2011; thought case can in al., previously it et cases was Imaokaa although It human 2018; host in 2018). al., primary al., et it et (Halajian as (Halajian humans ticks as pigs 2013). well domestic al., as and et livestock boar Motoi domestic rickettsioses. and wild fever ungulates the other spotted has cattle, other Unlike and in Japan 2018). seen in al., of et ticks often Symptoms (Halajian is organism it the pain. as against with antibody and infection of heat SFGR, titers most serum redness increased erythema, with cellulitis swellings, mimics like signs inflammatory ehv eotdo h eeto ftc-on iktsaptoeswihaeteeilgcaet of DNA agents the etiologic found and the animals are domestic of which from materials pathogens collected genetic rickettsia ticks of assessed tick-borne We of rickettsioses. of detection group the fever on spotted diseases. reported tick-borne have of could 1995; spread We pathogens al., ticks-borne global et that the Berglund unlikely fueling 2006; expansive not thus al., is and niches et it Conclusion: vectored ecological ticks (Heile 2015), their new with animals al., into and et current of humans introduced ticks Sparagano nature The of easily 2012; of migratory interaction be al., the 1995). spread et increased as observable al., Palomar well climate, these 2019; et as CDC, for global (Berglund animals reason in America in the change trade of global be the States to United With Similarly, reported of al., 2013). pathogens. North-East been et al., the has (Phongmany et change to transmit (Gaowa climate spread they recent that has of babesiosis RMSF Sweden with of in along greatly country an extended of the is range has there of ecological why part the factors Germany, as large possible in just a be 2006) example, rapid over might For very These to globally. ticks distances. diseases of spread 2018). long tick-borne spread al., has over and the et ticks making migration (Nooroong of thus animal zones spread created diversity, ecological and increasing being host of are pets new range animal niches into wide of favorable by transmit a and mobility over they new constrained increased diseases change, range the to climate and to ecological attributed ticks Due an be of expansion have can rapid niches transmit current ecological The they factors. diseases climatic the and movement as well as Ticks in countries of Asian a report East Far in first some detection the its is stated this report However, recent a observation. while this Brazil elucidate of to nymphs needed screened is sequencing different genome with full like study with related elhipiain ftcs ie n h edt eotsc ie sqikya osbe grsieticks Aggressive the possible. on as quickly member as community bites study the such the report educate the in to also for personal need responsible should health the be They and on probably bites call may ticks’ patients. wakeup they of symptoms a their as implications and therefore by pathogens health signs is these presented with data by patients symptoms caused This of flulike infections treatment communities. consider and rural to diagnosis complete communities these the a in in or considered fever sequencing not of genome are Full SFGR detail. the Usually, in further studied be and should the that of observation discordance another The result. this elucidate .arce .parkeri R. africae, R. omp ol aehle ofrhrrsleteecnrvrisbtisffiin eore osrie us. constrained resources insufficient but controversies these resolve further to helped have would B .africae R. Amblyomma omp .tamurae R. and A .ovale A. .parkeri R. eaentsr frcmiainddocri h w ee nqeto.Further question. in genes two the in occur did recombination if sure not are We . and p.a eotdb lno(lnoe l,07 h eetdteptoe in pathogen the detected who al.,2017) et (Blanco Blanco by reported as spp. .tamurae R. R.tamurae omp .tamurae R. ikcletdfo ml aml uha idrdnsadmruil in marsupials and rodents wild as such mammals small from collected tick a enioae rmtesi ipyseie rmwl or n loin also and boars wild from specimen biopsy skin the from isolated been has eune fsml 0 sindte as them assigned 209 sample of sequences B .variegatum A. and xdsricinus Ixodes .tamurae- R. sntascae ihhg ee,gnrlzdrs,lymphadenopathy rash, generalized fever, high with associated not is .tamurae R. epromdncetd n mn cdsqecsalignments sequences acid amino and nucleotide performed We . ntetregnr ftcscletdi hssuy h detection The study. this in collected ticks of genera three the in .tamurae R. omp ieptoe,teaeto F iktsoi nJpnand Japan in rickettsiosis SFG of agent the pathogen, like ikcletdfo atei h fia continent. African the in cattle from collected tick h gn httasi npamssadLm borreliosis Lyme and anaplasmosis transmit that agent the and A omp ntcscletdi fiaclsfrfrhrsuisto studies further for calls Africa in collected ticks in 11 ampyai megaspinosa Haemaphysalis nthe in omp R.tamurae euneis sequence A omp hwdcmlt oooywith homology complete showed B omp ee rget ftesm ape salso is samples same the of fragments genes B eergo hl the while region gene B a rtioae from isolated first was .africae R. .tamurae R. .veriabilis D. .africae R. hl the while ik(lnoe l,2017). al., et (Blanco tick emcno reticulatus Dermacentor .tamurae R. a enassociated been has h otadvector and host the omp .testudinarium A. omp and a closely was A .tamurae R. .tamurae R. sequence B infection omp A Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. References https://orcid.Org/0000-0002-5269-1849 Iweriebor identifica- Chuks (tick Benson MK347206-MK347212 //www.ncbi.nlm.nih.gov/nuccore, the ORCID to https: contributed (rickettsia at MK405447-MK405477 and study [GenBank] tion), the write- in supervised manuscript. and final AIO able analyses Statement: the and of bioinformatics Availability LCO approval and BCI, and Data editing work while manuscript AN, laboratory data, BCI, sampling, the by of The interpretation out BCI. S carried by N were designed O up was UTI B study NTRI The CO S R O T interest. AUTH of S conflict NTERE no I declare F authors O All T and C research FLI Hare N Fort of CO University from obtained was (UREC). OBI013) committee number; ethics L in (cert PPROVA assistance certificate A their clearance L for Ethical A and collection C sample I for TH farms E the into access us allowed collection. who sample study. farmers however, the the considered of thank not We findings were the states of feeding relevance and the genders diminish Acknowledgments tick way that any are health in study not the the do mitigate of these to of limitations competence as of The the so transmission demonstrate species. and to agencies needed acquisition government are relevant regarding studies Further as the by infestations. ticks’ commenced of implications be should strategies control Rol,D,Ru,V 19) iktsoe sprdgso e reegn netosdiseases. infectious emerging or new of paradigms as Rickettsioses (1997). (2013). V. al. Roux, D., et Raoult, T. Kernif, 2. O., Mediannikov, M.B., Labruna, C., Socolovschi, C.D., Paddock, P., Parola, 1. Tmsoe . otlo . o´kva . os,R,Oe,JA 21) elce set ftick-borne of aspects Neglected (2018). J.A. fever Nov´akov´a, Oteo, A., spotted R., Portillo, between Sousa, L., relationship M., Tomassone, The (2009). 6. P. Parola, No- D., C., Raoult, O., Marques, Fever Mediannikov, C., I.P„ Socolovschi, Tick-Bite IFonseca, 5. S., African Edouard, Santib´a˜nez, A., Duarte, (2016). R., S., Sousa, T. de Avsic-Zupanc, A., Portillo, M., 4. Korva, S., Lotric-Furlan, P., Bogovic, 3. Ieibr .. maa .. dgoiy,A,Iwrn . b,LC,Oo,AI 21) Genetic (2017). A.I. Okoh, L.C., Obi, emerging A., world: Igwaran, the A., around Adegborioye, rickettsioses E.J., Mmbaga, Tick-borne B.C., (2005). Iweriebor, D. 8. Raoult, C.D., Paddock, P., Parola, 7. Yw,M,Nagw,N,Kdee .. uhne . pnuo .. auu ..(2019). M.C. Marufu, T.C., Mpendulo, V., Muchenje, C.T., Kadzere, N., Nyangiwe, M., Yawa, 9. irbooyReview, Microbiology Approach. Geographic a World: the Review, around Rickettsioses Tick-Borne on Update rickettsioses. ticks. spp. ixodid Rickettsia and of Rickettsiae detection group the for Guidelines (2017). Diseases, M. Zoonotic Santos, Borne A.M., Palomar, M., vakova, Uganda. from Slovenia to http://dx.doi.org/10.3201/eid2210.160650 Returning Traveler in rfiigfrAalsaadErihaseisi ik olce nteEsenCp rvneo South of Province Cape Eastern the in collected ticks in species Ehrlichia Africa. and Anaplasma for profiling 18:719–756. Review Microbiology Clinical concepts. old challenging diseases nsac fteRiiehls(opiu)mcolsi h etr-eta ein fthe of regions western-central the in microplus (Boophilus) Rhipicephalus the of search In M microbiology, BMC .5–0.di1.18CR0021 MI:PMC3811236. PMCID: doi:10.1128/CMR.00032-13 p.657–702. aaie Vectors & Parasites 10:694–719. 17:23–32. 71,p.45. 17(1), h aata upr h nig fti td r pnyavail- openly are study this of findings the support that data The 123https://doi.org/10.1186/s13071-018-2856-y 11:263 , eeiayResearch Veterinary omp .parkeri R. ee,adM458-K046(rickettsia MK405386-MK405446 and gene), A 12 swl scagsi h noybot ntetick the in endosymbionts the in changes as well as mrigIfciu Diseases Infectious Emerging 40:34 , lnclMicrobiology Clinical 2(0.DOI: (10). 22 , omp .hebraeum A. gene). B Clinical Vector Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. Lrso . rsk,KA,Mjkdni . ge,A,Wlun .. ioz,K (2013). K. Picozzi, S.C., Welburn, A., Igweh, tick A., African Majekodunmi, K.A., Gruszka, (2017). V., C. Lorusso, Pahlso, 26. S., Stromdah, P., Rundlof-Nygrenb, Norwegian K., Wallmeniusa, (2003). K., al. et Nilssona, A.Z., 25. Henriksen, G., Hasle, T., Hoel, S., Vene, P.E., Massung, Fournier, L.D., M., Jensenius, Oliver, 24. K.A., Fitzpatrick, G.J., Kersh, A.J., Roche, W.L., Nicholson, M., Prabhu, 23. Sclvci . asmt,K,Mre .. aos,B,Rol,D,Prl,P 20) Identifica- (2007). P. Parola, D., Raoult, B., Davoust, J.L., Marie, K., Matsumoto, C., Socolovschi, 27. Tick- Travelers. French (2010). in Fever D. Tick-bite African Raoult, (2005). D. J.F., Raoult. D., Trape, Mizzi, C., J., Rolain. Sokhna, P.H., Consigny, F., 22. Fenollar, G., Diatta, O., Mediannikov, 21. Ni,LM,Fkm .. oyr .. dp .. iaj,VP,Wle,DH 20) Detection (2004). D.H. Walker, V.P., Titanji, R.N., Ndip, D.H., Bouyer, E.B., Fokam, L.M., Ndip, 20. bootstrap. the using approach An phylogenies: on limits Confidence phylogenetic (1985). reconstructing for J. search Felsenstein, method new alignment A 17. local method: neighbor-joining Basic The (1990). (1987). M. D.J. Nei, Lipman, N., Saitou, E.W., Myers, 16. W., Miller, W., Gish. S.F., Altschul, 15. group fever Spotted (2001). A. Kengluecha Jr, T.M species Kollars, rickettsiae group 14. fever spotted among Differentiation (1994). D. Raoult, X., Yu, M., Eremeeva, esti- and 13. rickettsiae of identification Genotypic (1991). B.D. Plikaytis, and C.L. Spruill, R.L., Regnery, 12. Kmr . tce,G,adTmr,K 21) EA:MlclrEouinr eeisAnalysis Genetics Evolutionary Molecular MEGA7: (2016). K. Tamura, and New Press, G., University Stecher, Oxford S., Phylogenetics. and Kumar, Evolution 19. Molecular (2000). S. Kumar, and M., Nei, 18. (2010). S.F. Atkinson, M.A., Turnbough, J.P., Seals, G.J., Teltow, Ticks P.M., Billingsley, (2003). P.C., A.A. Williamson, Latif, 11. I.G., Horak, A., Estrada-Pana, J.L., Camicas, A., Bouattour, A.R., Walker, 10. iefvri eunn wds rvlr.Rpr ftocssadapcso igotc NETECO INFECT diagnostics of aspects and cases two doi.org/10.1080/20008686.2017.1343081 of 1343081 Report 7, travelers. EPIDEM Swedish returning in fever Africa. Among bite sub-Equatorial rural Rickettsioses to travelers Group in fever bite Typhus Diseases, tick African Infectious and Clinical Group. Study Group, Fever Bite Fever Tick African Spotted Fever, Tanzania. Q PMC3148261 PMCID: Northern 10.1093/cid/cir411 in doi: (2011). Patients Febrile Hospitalized al. et R.F., ino iktsa,Uad n Djibouti. and eid1310.070078 Uganda rickettsiae, of tion 7.10.3201/eid1910.130389 africae Diseases, Infectious Senegal. Emerging rural in diseases emerging ses, neglected rickettsioses, borne fRceti fia nainsadtcsaogtecatlrgo fCameroon. of region coastal the along Hygiene ticks and and Medicine Tropical inpatients africae Rickettsia of trees. tool. DNA. PCR-amplified of polymorphism length fragment Microbiology restriction of analysis by genes. rickettsial two pp.1576-1589. of 173(5), portions 1991; for , divergence sequence intraspecies of mation eso . o igrdatasets. bigger for 7.0 version York. 39:783-791. Didelphimorphidae) (Marsupialia: Tennessee. opossums in and (Carnivora:Procyonidae) raccoons infesting Ixodidae) USA. Texas, Persons, from Removed Ticks in Diseases, spp. tious Rickettsia and Ehrlichia, Species. Borrelia, of Identification to Guide 0-9545173-0-X A ISBN Edinburgh Africa; of in Animals Domestic of Africa. South Province, ps://doi.org/10.1016/j.ttbdis.2019.01.009 Cape Eastern 449.i:81di1.1371/journal.pntd.0000821PMID:20856858 14;4(9).pii:e821.doi:10. ora fMlclrBiology, Molecular of Journal oeua ilg n Evolution, and Biology Molecular in mlom variegatum Amblyomma 32:803–10 , ora fMdclEntomology, Medical of Journal 6 ,DI 10.3201/eid1603.091333 DOI: 3, 16, 611–.http://dx.doi.org/10.1086/375083 36:1411–7. w.d.o/i o.1,N.11, No. 11, Vol. * www.cdc.gov/eid * oeua ilg n Evolution, and Biology Molecular 71:363–6. , ik,Uad n Nigeria. and Uganda ticks, 1() pp.403-410. 215(3), 4:406-425. mrigIfciu Diseases, Infectious Emerging ik n ikbreDiseases Tick-borne and Ticks 8612 O:10.1603/0022-2585-38.4.601 DOI: 38:601–2. 13 lnclIfciu Diseases Infectious Clinical Rickettsia mrigIfciu Diseases Infectious Emerging 33:1870-1874 in LSNgetdToia Disea- Tropical Neglected PLoS isineReports Bioscience emcno variabilis Dermacentor 310–0 doi.org/10.3201/ 13:1508–10. 03 564-567 10(3) , ora fbacteriology of Journal mrcnJunlof Journal American ora fClinical of Journal 34:e8–e15. 53(4): , mrigInfec- Emerging University , Evolution 19:1705– , Rickettsia (Acari: . htt- , Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. Mti . sn,M,Ioua . no . aaaa . aao . uui .(03.Detection (2013). M. Suzuki, A., of Takano, Case H., Kawabata, Human S., First Ando, The H., Inokuma, (2011). M., E. Asano, Y., Morita, Motoi, K., Kusatakea, 45. K., Tabarab, S., Kanekoa, al. K., Imaokaa, et 44. R.R., Lash, A., Varela-Stokes, W.L., Nicholson, F., Crudo, from agent A.C., infectious an Seijo, on Observations Y., (1939). Romer, G.E. Davis, arachnids.41. G.W., and Cox, insects G.M., of Kohls, tissues R.R., the Parker, in rickettsia 40. of distribution The (1993). E.V. Cowdry, 39. Hlja,A,Plmr .. otlo . en,H,Rmr,L,Oe,JA 21) eeto of Detection Hon- (2018). J.A. from Oteo, Returning L., Traveler Romero, H., in Heyne, Rickettsiosis A., Portillo, Tick-Borne A.M., Palomar, A., (2009). Halajian, M.E. 43. Wilson, L.H., Chen, 42. Byers, J., Jiang, P.J., Sniezek, C.L., Tamminga, C.D., Paddock, A.L., Richards, T.J., Whitman, 38. Pdok .. ily .. rgt .. oisn .. crd,BJ,Ln,CC,Ekenna, C.C., Lane, B.J., Schrodt, H.N., Robinson, C.S., McLellan, Wright, J., R.W., Goddard, Finley, C.S., C.D., Goldsmith, Paddock, S.R., 37. Zaki, J.A., Comer, J.W., Sumner, C.D., Paddock, 36. Kmt,G,Mti . yno,SG,Wmnooi . atmi .(06.Pyoeei ainsof Variants Phylogenetic A.K., (2016). J. Waitumbi, N’Douba, F., Wamunyokoli, S.G., Nyanjom, N., B., Mutai, Amanzougaghene, G., Kimita, Y.L., 35. Achi, M., Dahmani, K.P., Yao, C.B., Ehounoud, 34. Mia .. in,J,Ouo .. ulr .. d,F,Ooa . ekn .. jna M.K., Njenga, D.R., Feikin, E., Ogola, F., Ade, S.J., Cutler, S.A., Omulo, J., Jiang, A.N., Maina, 33. Ysu,A,Sclvci . enf . emm . Lgdc . ots,P,Prl,P ta.(2014). al. et P. Parola, P., Tortosa, E., ELagadec, S., Temmam, T., Kernif, C., Socolovschi, A., Yssouf, 32. Nko . i,Y,Iaah,M,Mgn,JW,Zo,L,Io . uioo .(2013). Y. C. Atiya-Nasagi, R., Sugimoto, King, K.Y., K., Mumcuoglu, Ito, A.B., Din, L., M.E., Eremeeva, Zhou, A., Keysary, J.W., T., Waner, Magona, 31. M., Igarashi, Y., Qiu, R., Nakao, 30. Hrio,N,Brmn,H,Frte,C,Rmatr . zl,M,Shta .(06.Molecular (2016). A. Schotta, M., Szell, M., Ramharter, C., Forstner, H., Burgmann, N., (2018). M.R. Harrison, Resende, 29. C., Medorima, F., Santos, F.A, Nieri-Bastos, F.S., Krawczak, R.N., Angerami, 28. iktsatmreIfcini Japan. in Infection tamurae Rickettsia (2011). maculatum. Amblyomma ontcaet n e iktsasri ntcsfo oky rmSuhArc:Ipiain for Implications Africa: South from donkeys from ticks in strain Rickettsia medicine. new travel a and agents zoonotic duras. 10.3201/eid1707.101857 doi: Virginia. Medicine Experimental bite, tick after infection parkeri Rickettsia Diseases, (2007). J.W. Sanders, D.K., . ls,MA,Tmig,CL,Ol ..e l 20) iktsapreircetissadits and rickettsiosis parkeri Rickettsia (2008). al. fever. et spotted C.A. Mountain Ohl, Rocky from C.L., distinction Tamminga, clinical fever M.A., spotted Blass, of O., cause recognized newly a States. parkeri: United Rickettsia the (2004). in rickettsiosis C.A. Ohl, C.L., Tamminga, S.L., iktsaarce n nietlIetfiaino Cniau iktsaMylni”i Kenya. in Moyalensis” Rickettsia ”Candidatus Includ- Diseases of Tropical Neglected Identification Pathogens d’Ivoire. Incidental Multiple and Cote africae, in Rickettsia (2016). Vectors O. Tick Mediannikov, in F., Species |DOI:10.1371/journal.pntd.0004367 Fenollar, New Potential D., ing Raoult, J.D., N’Guessan, aigtmTcsfo oetcMmasi ua etr ey:Ipiain o ua Health. Human for Implications Amblyomma in Kenya: Variants Western africae Rural Rickettsia Diseases, in of Zoonotic Prevalence Mammals Vector-Borne High Domestic from (2014). Ticks al, variegatum et S., Mpoke, S., Cleaveland, is oeua eeto fRceti fia ntcsfo h no fteComoros. the of Union the from ticks in africae Rickettsia of Vectors detection molecular First 21) iktsaarceadCniau iktsabraiei ik nIsrael. Hygiene, in and Ticks in Medicine Tropical barbariae and Rickettsia of Candidatus Uganda and africae from Rickettsia (2014). variegatum spacers. Amblyomma intergenic in of rickettsiae sizes group http://dx.doi.org/10.1016/j.ttbdis.2013.07.001 using fever identification spotted their of prevalence High igoi fArcntc iefvruigeca wb nataee eunn rmTanzania. from returning traveler a in swabs eschar using fever bite Wochenschr, tick Klin African of diagnosis traveler. American South a 10.1177/2050313X18775301 in DOI: fever –3) tick-bite 6(1 African of report First mrigIfciu Diseases, Infectious Emerging iktsaparkeri Rickettsia :4 http://www.parasitesandvectors.com/content/7/1/444 7:444 , 33436 58. 13:334–336. rvlMdcn n netosDiseases Infectious and Medicine Travel 2:0–0 O 10.1007/s00508-016-1047-0 DOI 128:602–605 37:431–459 , ulcHat Report, Health Public iktsoi,Argentina. Rickettsiosis, O:017/0004788 DOI:10.1371/ , lnclIfciu Diseases, Infectious Clinical 4(0,DI 10.1089/vbz.2014.1578 DOI: (10), 14 05,p.9092doi:10.4269/ajtmh.13-0697. 920–922 pp. 90(5), 58:1321–1323.doi: 15(8): aeRpr nDermatology, in Report Case 14 3;54:1482–1484. 139; mrigIfciu Diseases Infectious Emerging lnclIfciu Diseases, Infectious Clinical ik n ikBreDiseases Tick-Borne and Ticks 64-0 o:10.1016/j.tmaid.2018.10.007 doi: 26:43-50. , 10.3201/eid1508.090172 15;38(6):805-11. LSNgetdToia Diseases, Tropical Neglected PLOS :87 O:10.1159/000326941 DOI: 3:68–73 AEOe e aeReports Case Med Open SAGE h mrcnSociety American The mrigInfectious Emerging 77:1169–1173. 17(7): , 7 1188–1196. 47: aaie & Parasites 4:506–12. , ora of Journal PLOS Wien , Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. .roli,M508 R ogltmne H325Rsoaa KY113110_R.parkeri, MF511254_- MH532255_R.slovaca, Rickettsia, mongolotimonae, Candidatus _R. EU272186_ MH500082 KF702333_Candi- raoultii, sibirica, rickettsia, R. AY319290_R. KY780025_R. Rickettsia, raoultii, datus AH015610_R. africae, CP001612_R. OmpA africae, AF123706_R. sibir- , parkeri parkeri HM050273_R. R. KY113111_R_ AF123717_ R.africae, rhipicephali, KT633262.1 africae, AF123719_R. mongolotimonae, KX227791_R. KT633262_R.africae,DQ097083_R. massiliae, Rickettsia, KU645284_Candidatus AF123714_R. ica, KY233245_Candida- Rickettsia, U83436_R.africae, tus JQ792105_R.raoultii, monacen- CP001227_R.peacockii, LN794217_R. KX227791_R.africae, sis, KY113111_R.parkeri, KX227788_R.africae, AF123706_R.africae, AF149110_R.conorii, CP003341_R.parkeri, DQ113910_R.tamurae, OMPB Saaao . ere . inapr,A., Giangaspero, J.A. D., Oteo, George, A., Portillo, O., S., Sparagano, Santibanez, L., 56. Roncero, D., Mazuelas, P., Santibanez, A.M., Palomar, and Control 55. Disease for Centers source: Content (RMSF). fever spotted Mountain Rocky (2019). Runehagen, CDC. M., Carlsson, 54. H., Elmrud, A., Ringer, A., Lindberg, George, K., Ornstein, R., A., Eitrem, Distribution, J., Berglund, - Estrada-Pena, 1794) 53. (Fabricius, reticulatus M., Dermacentor (2006). Derdakova, E. Schein, A.O., A., Heydorn, C., Heile, Bormane, 52. K.M., Hansford, J.M., Medlock, Phi- B., 51. Rasachack, V., Soukkhaseum, S.D., Blacksell, R., Phetsouvanh, J.M., Rolain, S., Phongmany, bacteria of 50. studies Phylogenetic (2018). A. Ahantarig, V., Baimai, W., Trinachartvanit, P., Nooroong, 49. Lemos, de M., Ogrzewalska, L., Strecht, Chiba, R.C., Oliveira, N., de Monma, A.G., Silva, R., da B.R., Omori, Teixeira, A., C.M., Blanco, Mori-Kajihara, 48. M., Kajihara, K., Matsuno, Y., Qiu, M.J., Thu, Takada, H., 47. Fujita, T., Honda, F., Kawamori, Y., Yoshikawa, D., Wu. Wuritu, M., Aochi, N.O., Gaowa, 46. 21) oeo id ndseslo tooi gnso ikbrezooe,San 2009. Spain, zoonoses, tick-borne of agents etiologic of dispersal in Diseases birds Infectious of Role (2012). Sweden. Southern Diseases Vector-Borne in disease Lyme , Prevention of Study Epidemiologic Medicine An of Journal (1995). England R. New Norrby, C., for Svanborg, A., forces Driving Germany. (2013). in al. canis 119(7-8):330-4 , Babesia et for vector Europe. P.M,. and in biology ticks Jensen, ricinus J.K., Ixodes of and Jensen, distribution infections T.G., geographical Rickettsial in Jaenson, changes (2006). I., Golovljova, al. J.C., et V., Chu, K., Laos. Frichithavong, Vientiane, .S, fever, their Soukkhaseum, and K., Thailand asakha, in ticks Dermacentor and Amblyomma in co-infection. Anaplasma) and from their Coxiella, rodents (Rickettsia, and and rickettsiae Brazil. marsupials states, group on Sul collected fever do Ixodidae) Grosso spotted Mato pp.90-98. (Acari: of and ticks Parana Diversity in Catarina, Santa Microorganisms (2019). (2017). E.R.S. al. et Japan. in ticks M. host with Gokuden, association J., 2007–2011. Seto, Japan, Ticks, K., in 23460996 Rickettsiae PMID: 10.3201/eid1902.120856 (2013). doi: 338–340. al. 19(2): et Y. Oikawa, N., eune sdi hlgntcaaye fteop n mBgenes patho- ompB and tick-borne ompA and the ticks of of analyses phylogenetic case in The used birds. sequences migrating by gens. transmitted diseases arthropod-borne Prefecture, Shimane in skins leucomystax) scrofa (Sus boar wild and Japan. ticks in DNA tamurae Rickettsia of eeiayParasitology, Veterinary ora fVtrnr eia Science, Medical Veterinary of Journal ik n ikbreDiseases, tick-borne and Ticks ainlCne o mrigadZooi netosDsae NEI),Dvso of Division , (NCEZID) Diseases Infectious Zoonotic and Emerging for Center National 818–1 80. 18:1188–91. , mrigIfciu Diseases, Infectious Emerging (DVBD). , 213:61–6. 333:1319-24 , cec Report, Science eBn ceso ubr fRceti reference Rickettsia of numbers Accession GenBank :4,pp.963-971. 9:(4), 75:263–267. 15 elnrudMnhnrteazlceWochenschrift tierarztliche Munchener und Berliner ptlka .(05.Atrpd n associated and Arthropods (2015). E. Spitalsk´a, ˇ :10.PI:30728409 PMID: 1500. 9: 12:256–262. ik n ikbreDiseases, tick-borne and Ticks aaiooyadVectors, and Parasitology mrigIfciu Diseases, Infectious Emerging Emerging :(1), 8: 6:1 Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. he uloie netta differentiate that insert nucleotides three with has sequence the against B209 sample of gene ompB the of alignment sequence of acid with sequence reference Amino has homologous strain. sequence 3b: reference test the Figure the with sequence that ho- query homology the the against percentage of similarity B209 highest sample on of based rae gene obtained ompB was the sequence of of strain. sequence with alignment reference reference the sequence has mologous with Nucleotide sequence sequence test query 3a: the the Figure of that similarity homologous homology acid the amino percentage represent against highest dots A188 on sample based of obtained Rickettsia gene was ompA sequence the Reference of strain. of alignment reference sequence the acid reference with Amino the sequence query 2d: against the Figure A188 of similarity sample nucleotide represent of dots The gene acid ompA with amino the has represent of dots alignment homology. The of sequence sequence reference GenBank. Nucleotide homologous with the the strain. has 2c: reference in against sequence the Figure tool test B188 with sequence the BLAST sample query that Nucleotide the of homology of through gene percentage similarity obtained highest ompB was on the based which of obtained alignment was sequence sequence of with sequence acid reference has Amino homologous sequence strain. 2b: reference test the Figure the with that sequence ho- query homology the the percentage against of similarity B188 highest sample on of based eri gene obtained ompB was the of sequence of sequence alignment reference sequence mologous sequences Nucleotide reference the 2a: while arrowed Figure and of number. bracket using accession in reference sequences are GenBank by Ripicephalus with sequences in and constructed Test Hyalomma are intermingled Amblyomma, GenBank. was genera; sequences from identified cladogram obtained Test three sequences The the with generated clustered program. samples GenBank. species 2.1 ticks from tick ClustalX of sequences Hyalomma, in rDNA reference Amblyomma, method mitochondrial the neighbour-joining 12S with the of study cladogram the rectangular LC388791_R. from Neighbour-joining tamurae, 1: DQ103259_R. Figure africae, U43790_R. parkeri KY513920_R. GU247115_R. parkeri,KU744412_R. africae, tamurae,KC003476_R. africae sibirica, KJ645933_R. MG515014_R. MF379309_R. africae, MH532254_R.slovaca, EU622980_R.africae, barbariae, sibirica, Rickettsia KY233245_CANDIDATUS hc a bandtruhNcetd LS oli h eBn.Tedt ersn mn acid amino with represent with dots identity of 100% The sequences the reference of GenBank. alignment ogous sequence the with strain. Nucleotide reference has in 3c: the sequence Figure tool with test sequence BLAST the query Nucleotide that the homology of through similarity percentage obtained highest was on which based obtained was sequence hc a bandtruhNcetd LS oli h eBn.Tedt ersn nucleotide represent dots The GenBank. the in tool BLAST Nucleotide through obtained was which hc a bandtruhNcetd LS oli h eBn.Tedt ersn nucleotide represent dots The GenBank. the in tool BLAST Nucleotide through obtained was which .tamurae R. Rickettsia p tanG-em hc a bandtruhNcetd LS oli h eBn.The GenBank. the in tool BLAST Nucleotide through obtained was which Ga-Seema strain sp. eeec eunewsotie ae nhgetpretg oooyta h etsequence test the that homology percentage highest on based obtained was sequence Reference p tanG-em hc a bandtruhNcetd LS oli h GenBank. the in tool BLAST Nucleotide through obtained was which Ga-Seema strain sp. . .africae R. eeec eunewsotie ae nhgetpretg oooyta h test the that homology percentage highest on based obtained was sequence Reference .africae R. Rickettsia and Rhipicephalus hc a bandtruhNcetd LS oli h eBn.The GenBank. the in tool BLAST Nucleotide through obtained was which .tamurae R. hra the whereas .tamurae R. .parkeri R. p tanG-em M938)idctn 5 homology. 95% indicating (MG953288) Ga-Seema strain sp. .tamurae R. Rickettsia .parkeri R. .africae R. pce eeec tan bandfo eBn.Alsequenced All GenBank. from obtained strains reference species D135)and (DQ103259) omp K131)idctn 0%homology. 100% indicating (KY113111) p tanG-em M938)idctn 95% indicating (MG953288) Ga-Seema strain sp. D131)idctn 0%homology. 100% indicating (DQ113910) and K131)idctn 0%homology. 100% indicating (KY113111) D131)idctn 0%homology. 100% indicating (DQ113910) 16 eeo h aesml a 0%identity 100% has sample same the of gene B omp .tamurae R. eeo apeA0 gis h homol- the against A209 sample of gene A r nelnda oiin9 o9.The 99. to 97 position at underlined are .africae R. E628)indicating (EU622980) .timurae R. .parkeri R. Reference Reference Reference Reference .timu- R. .park- R. Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. ihhg otta ausaoe9% etsqecsaei odi re dot. green in bold in are sequences Test 99%. the above in values positions bootstrap sequences high 236 study with of All with total 2000). clustered a Kumar, B188 and were B209; (Nei There MEGA7 1st+2nd+3rd+Noncoding. in with eliminated. were conducted phylogenetically were were clustered included data analyses Evolutionary positions missing dataset. and Codon final gaps containing sequences. positions nucleotide All distances 86 the evolutionary in involved The together analysis 1985). clustered method (Felsenstein, The taxa p-distance branches associated the the = to the using length next which computed branch shown in were of is trees sum replicates) the replicate (1000 with of test tree percentage bootstrap optimal The The shown. 1987). is Nei, and 2.89828155 GenBank. (Saitou et NCBI method Neighbor-Joining (Kumar from the MEGA7 using obtained in sequences conducted other reference were of with related tree analyses clustered Phylogenetic Evolutionary red diamond 5: dataset. the Figure denoted final sequences of were test the units There The in the included eliminated. 2016). positions in positions were al., data 166 Codon are missing of sequences. and and evolutionary nucleotide total gaps 2000) The 67 together containing a involved Kumar, positions clustered analysis 1985). and All The (Felsenstein, taxa (Nei branches 1st+2nd+3rd+Noncoding. site. associated were the method per the differences to p-distance which base next the of length in shown number using branch trees is of computed replicates) replicate sum were (1000 the of distances test with percentage tree bootstrap The optimal the The in shown. 1987). is Nei, 1.67432413 and (Saitou = GenBank. method NCBI Neighbor-Joining from the strain. using obtained reference sequences the reference with of related sequence tree query Phylogenetic the 4: of Figure similarity acid amino represent dots differentiate The that insert nucleotides three with The has sequence test the with the with identity of identity 100% alignment cating of sequence sequences acid strain. reference reference Amino homologous the with 3d: sequence query Figure the of similarity nucleotide represent dots .tamurae R. .parkeri R. .africae R. . eeec eunewsotie ae nhgetpretg oooythat homology percentage highest on based obtained was sequence Reference .africae R. .africae R. omp omp A131)wiesml 29cutrdwith clustered B209 sample while (AF123717) hc a bandtruhNcetd LS oli h GenBank. the in tool BLAST Nucleotide through obtained was which eesqecsi odgnrtdfo h td ihthe with study the from generated bold in sequences gene A eesqecsi odgnrtdfo h td ihthe with study the from generated bold in sequences gene B .tamurae R. eune rmGnakwt h xeto fsqecsB8 and B188 sequences of exception the with GenBank from sequences 18 hra the whereas .africae R. n r nteuiso h ubro aedffrne e site. per differences base of number the of units the in are and 17 D135)and (DQ103259) and omp .tamurae R. omp eeo h aesml a 100% has sample same the of gene B eeo apeA0 gis the against A209 sample of gene A h vltoayhsoywsinferred was history evolutionary The inferred was history evolutionary The r nelnda oiin9 o99. to 97 position at underlined are Rickettsia .africae R. .tamurae R. references. E628)indi- (EU622980) (DQ113910) Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. I a -B0 n E R.tamurae.docx REF and B209 from-domestic-animals-in-eastern-cape-south-africa d- c articles/448809-genetic-evidence-of-spotted-fever-group-rickettsiae-in-ticks-collected- b 3a, FIG ALIGNMENTS.docx ACID AMINO file Hosted AND NUCLEOTIDE AI88 of ticks-collected-from-domestic-animals-in-eastern-cape-south-africa D com/users/319008/articles/448809-genetic-evidence-of-spotted-fever-group-rickettsiae-in- - 2A FIG file Hosted vial at available 18 https://authorea.com/users/319008/ vial at available https://authorea. Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. 19 Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. 20 Posted on Authorea 6 May 2020 | CC BY 4.0 | https://doi.org/10.22541/au.158879218.82923756 | This a preprint and has not been peer reviewed. Data may be preliminary. 21