Diabetes Page 2 of 40
High prevalence of a monogenic cause in Han Chinese diagnosed with type 1 diabetes, partly driven by non-syndromic recessive WFS1 mutations.
Running title: Monogenic Diabetes in Chinese diagnosed as T1D
Author:
Meihang Lia, b,d*; Sihua Wangd*; Kuanfeng Xua*; Yang Chena, Qi Fua, Yong Gua, Yun Shia, Mei Zhanga, Min Suna, Heng Chena, Xiuqun Hand, Yangxi Lic.d, Zhoukai Tangd, Lejing Caid, Zhiqiang Lib, Yongyong Shib, Tao Yanga#; Constantin Polychronakosc,d,e#
* Meihang Li, Sihua Wang and Kuanfeng Xu have equal contribution to this paper
# Constantin Polychronakos and Tao Yang will handle correspondence at all stages of refereeing and publication, also post-publication.
a. Department of Endocrinology, the First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou road, Nanjing, Jiangsu province, China. b. The Biomedical Sciences Institute of Qingdao University (Qingdao Branch of SJTU Bio-X Institutes), Qingdao University, 308 Ningxia road, Qingdao, China; c. Research Institute of McGill University Health Centre, 1001 Decarie Boulevard, Montreal, QC, Canada. d. Zhejiang MaiDa Gene Tech Co. Ltd, 68 Xinchi road, Zhoushan, Zhejiang province, China. e. Honorary Professor, Children’s Hospital of Zhejiang University School of Medicine, 3333 Binsheng Road, Hangzhou 310051, China
Meihang Li, Ph.D: [email protected] Tel: +86-15610081675
Sihua Wang, Master: [email protected] Tel: +86-0580-3695111
Kuanfeng Xu, Ph.D: [email protected] Tel: +86-025-68306530
Yang Chen, MD, Ph.D: [email protected] Tel: +86-025-68306530
Qi Fu, Ph.D: [email protected] Tel: +86-025-68306530
Yong Gu, Ph.D: [email protected] Tel: +86-025-68306530
1
Diabetes Publish Ahead of Print, published online November 11, 2019 Page 3 of 40 Diabetes
Yun Shi, Ph.D: [email protected] Tel: +86-025-68306530
Mei Zhang, Ph.D: [email protected] Tel: +86-025-68306530
Min Sun, Ph.D: [email protected] Tel: +86-025-68306530
Heng Chen, Master: [email protected] Tel: +86-025-68306530
Xiuqun Han, Master: [email protected] Tel: +86-0580-3695111
Yangxi Li, Ph.D: [email protected] Tel: +86-0580-3695111
Zhoukai Tang, Master: [email protected] Tel: +86-0580- 3695111
Lejing Cai, Master: [email protected] Tel: +86-0580-3695111
Zhiqiang Li, Ph.D: [email protected] Tel: +86-0532-82991039
Yongyong Shi, Ph.D: [email protected] Tel: +86-0532-82991039
Tao Yang, MD, Ph.D: [email protected] Tel: +86-05803695111
Constantin Polychronakos, MD : [email protected] Tel: +1- 514-4124400 ext:22866
Word count: Total number of words for main manuscript including abstract is 2152. Number of tables is 1. Number of figures is 1.
2 Diabetes Page 4 of 40
Abstract
It is estimated that ~1% of European-ancestry patients clinically diagnosed with type 1
diabetes (T1D) actually have monogenic forms of the disease. Because of the much
lower incidence of true T1D in East Asians, we hypothesised that the percentage would
be much higher.
To test this, we sequenced the exome of 82 Chinese Han patients clinically diagnosed
as T1D but negative for three autoantibodies. Analysis focused on established or
proposed mongenic diabetes genes.
We found credible mutations in 18 of the 82 autoantibody-negative patients (19.5%).
All mutations had consensus pathogenicity support by five algorithms. As in Europeans,
the most common gene was HNF1A (MODY3), in 6/18 cases. Surprisingly, almost as
frequent were diallelic mutations in WFS1, known to cause Wolfram syndrome but also described in non-syndromic cases. Fasting C-peptide varied widely and was not predictive.
Given the 27.4% autoantibody negativity in Chinese and 22% mutation rate, we estimate that around 6% of Chinese with a clinical T1D diagnosis have monogenic diabetes.
Our findings support universal sequencing of autoantibody-negative cases as standard of care in East Asian patients with a clinical T1D diagnosis. Non-syndromic diabetes with WSF1 mutations is not rare in Chinese. Its response to alternative treatments should be investigated.
3 Page 5 of 40 Diabetes
Introduction:
Genetic risk for diabetes is, in most cases, a complex trait. However, monogenic forms
of diabetes do occur(1). These are often misdiagnosed as either type 1 (T1D) or type 2
(T2D) diabetes, an error of therapeutic consequences, as many of these cases can be
treated with sulfonylureas or GLP-1 agonists, obviating insulin injections and
improving metabolic control (2-4). Patients with pathogenic GCK variants can be
treated only with lifestyle advice.
Correct diagnosis in patients clinically diagnosed as T1D (T1Dclin) is challenging.
Because of the extremely high specificity of T1D autoantibodies, screening for
autoantibody negativity is a meaningful first step. This narrows the search to about 20%
of T1Dclin cases who, however, most still probably have autoimmune T1D (5). Family
history is currently the most important clue, based on autosomal dominant inheritance
(1). However, an “agnostic” testing of autoantibody negative cases in the Search for
Diabetes in Youth cohort found that 50% of cases with documented monogenic diabetes
have no family history (6). A similar testing in the Norwegian Childhood Diabetes
Registry shows convincing evidence of monogenic diabetes in about 4% of
autoantibody negative childhood-onset cases (T1Dclin in their vast majority), (7).
Preserved endogenous insulin secretion has been proposed as a screening criterion (8)
but it may not be reliable in T1Dclin cases. Given the substantial benefit to the
individual patient, and with recent methodological advances in molecular diagnostics,
a case can be made for universal testing of all autoantibody negative T1Dclin cases. To
test this, we undertook sequencing in Chinese autoantibody negative T1Dclin cases.
4 Diabetes Page 6 of 40
T1D is much less common in East Asians (EA) (Chinese, Koreans and Japanese) compared to Europeans (9). With a lower denominator, we hypothesised that the positive yield would be higher.
Methods:
Participants
In the process of recruiting cases for the discovery stage of a T1D genome-wide association study (GWAS), the first in EA(10), we tested for autoantibodies in most of the 1,121 subjects (newly diagnosed, with BMI < 24kg/m2, and with at least one episode of ketosis, 586 males and 535 females). Informed consent was obtained from the patients or parents/guardians, in a protocol approved by the Ethics Committee of the
First Affiliated Hospital of Nanjing Medical University, in conformity with the
Declaration of Helsinki.
Selection of genes
We selected a broad list of monogenic diabetes genes from the literature (Ref. 8) , listed in Table S1. To cover possible broad phenotypic heterogeneity, we included genes for neonatal and syndromic diabetes, e.g. WFS1, whose mutations might cause diabetes without other manifestations of Wolfram syndrome (11) and mitochondrial DNA 2967-
3367.
Pancreatic islet specific autoantibody testing
T1Dclin cases were tested for autoantibodies against GADA, IA-2A, and ZnT8A by 5 Page 7 of 40 Diabetes
radioimmunoassay (12). Cases negative for all three were excluded from the GWAS
and recruited for our project.
Whole-exome sequencing (WES).
Out of the 195 autoantibody negative subjects that available, 82 DNA samples that
passed the quality control of the sequencing company, were sequenced: (no significant
degradation and quantity >500ng). Capture was carried out with the Agilent SureSelect
Human All Exon V6 library followed by sequencing on the Illumina hiSeq at a 100x
depth, by the Shanghai Yuanshen company. Variants in known monogenic diabetes
genes, called by either SAMtools or GATK, were filtered to retain only protein-altering
variants (non-synonymous, frameshift, in-frame insertions/deletions, canonical
splicing), and exclude variants with a minor allele frequency (MAF) >0.0001 for
missense, or >0.001 for truncating, in any population in three public databases (1000
genomes, ExAc and Exome Variant Server). For recessive WFS1, the MAF threshold
was 0.005. All results reported here were confirmed by Sanger sequencing. Variants
were evaluated by five pathogenicity-prediction algorithms (Table 1) and classified by
the revised ACMG/AMP (American College of Medical Genetics and
Genomics/Association for Molecular Pathology) guidelines (13). For comparison,
exome data from 866 unselected Han Chinese subjects, similarly sequenced for reasons
other than diabetes, were also annotated.
To detect copy-number variants (CNV), we searched for extended genomic regions
with loss of heterozygosity (LOH) in exome variants. Coverage (read counts) of exons
6 Diabetes Page 8 of 40
in LOH regions were then compared between the patient with LOH vs. all other subjects.
Identification of mitochondrial mutations
The 113 aAb-neg patients whose DNA sample was unsuitable for WES were checked for mitochondrial polymorphism. Briefly, total DNA was used as template to amplify a target sequence of mitochodridal DNA (m2966-m3346) containing known Chinese mutations. PCR used were: Forward: TCAACAATAGGGTTTACGAC and Reverse:
AGGAATGCCATTGCGATTAG, followed by Sanger sequencing.
Statistical analysis
Given the known limitations of pathogenicity-prediction algorithms, we generated additional support for the variants discovered, and estimates of the false discovery rate, by comparing our findings with 866 non-diabetic Han Chinese.
First, we compared the prevalence of all variants meeting the filtering criteria between our cases and the control exomes by the Fischer exact test for each gene separately.
In addition, we estimated the proportion of our positive findings that might be due to background variant frequency in the population, by applying the expected proportion
(Pexp), of carriers among the 866 controls to our 82 cases and comparing with the observed proportion (Pobs) (Table S2).
Our cases and the control exomes were sequenced by very similar workflows and at the same depth. To confirm similar variant yield per individual, we compared yields for
7 Page 9 of 40 Diabetes
synonymous variants. To also confirm identity of genetic background, we compared
the two groups on the first two components of principal component analysis of
synonymous variants.
Data and Resource Availability
The datasets generated and/or analyzed during the current study are available from the
corresponding author upon request.
Results:
27.4% of Chinese T1Dclin were antibody negative
By radioimmunoassay, 53.7%, 40.7% and 33.8% of the patients were positive,
respectively, for GADA, ZnT8A, and IA-2A. Negativity for all three RIA was 27.4%
(Fig.S1).
Monogenic diabetes in 22% of Chinese autoantibody-negative T1Dclin patients
We had genomic DNA suitable for WES from 82 of these autoantibody negative
patients. Among these 82 exomes, the yield of synonymous variants per patient per
gene was not significantly different from that of the 866 Chinese controls (mean + SEM
was 0.72+0.26 vs. 0.82+0.32, p=0.81). Principal component (PCA) analysis, based on
the exome variants, showed complete overlap of the two population samples (Fig S2).
Of our 82 cases, 18 cases (22.0%, CI95 = 14.6%-32.0%) had variants likely to represent
disease-causing mutations (Table 1), a percentage several-fold higher than that reported
with European ancestry cohorts defined by similar, though not identical criteria (7; 14)).
All were predicted to be pathogenic by three or more of the five algorithms. Variants
8 Diabetes Page 10 of 40
in 6 patients met ACMG-AMP (13) criteria for very strong (PVS1) and another four for
strong (PS3 or PS4) evidence of pathogenicity. All 18 had, at the very least, moderate
pathogenicity evidence (PM2). It is important to note that these ratings rely on features
other than computational prediction of pathogenicity and, therefore, they constitute
completely independent evidence. Three additional patients, not counted here, narrowly
missed our pre-determined MAF cut-off (Table S3) but also likely have monogenic
diabetes.
The most common gene mutated was HNF1A (MODY3) with 6/18 patients. Two
mutations were null and one was absent from all databases. All were either truncating
or rated deleterious/disease causing by four or all five of the five algorithms (Table 1).
Some were previously reported with MODY3 (Table S4). Among the 866 controls,
there were only two patients with HNF1A variants meeting the same predetermined
criteria. Thus, Pobs, = 7.3% (CI95 3.9 – 14.4%) of autoantibody negative T1Dclin
Chinese patients have HNF1A mutations. Pexp, derived from the controls, was 0.2%
-6 (CI95 0.08 - 0.4%) with p=6.5x10 , false discovery q= 0.03.
Somewhat surprisingly, almost as common as MODY3 were diallelic variants of WFS1,
recessively mutated in Wolfram syndrome (WS), in 4 cases not reported to have any
other syndromic features and initially recruited for the T1D GWAS. One was
homozygous and, in another two cases, the two variants were close enough to be
confirmed in trans, by alignment inspection (Fig.S3). All of these variants were rated
deleterious by at least 4 of the 5 algorithms and two have been previously reported in
cases of fully expressed WS (Table S4). Only one of the 866 controls had two missense
mutations, both predicted benign by all 5 algorithms. For 4/82 vs. 0/866, Pobs = 4.9%
-6 (CI95 2.4% - 11.1%) vs. Pexp= 0% (CI95 0 – 0.6%) p = 6.5x10 , false discovery q=0.
Thus, by our best estimate, 5% of autoantibody negative Chinese T1Dclin cases have
9 Page 11 of 40 Diabetes
non-syndromic diabetes due to WFS1 mutations.
One patient was thoroughly examined and found to be normal by fundoscopic eye exam,
audiogram and urine density (Fig.S4), confirming the reported absence of other WS
manifestations (optic nerve atrophy, hearing loss and diabetes insipidus) in that case.
The remaining six patients were mutated in other MODY genes (Table 1) but the
numbers were too small for statistics (Table S2). Two patients had mutations in KLF11
(MODY7) and PAX4 (MODY9), OMIM genes whose role in monogenic diabetes
remains unconfirmed. Only one KLF11 mutation met pathogenicity prediction criteria,
vs. two controls (p=0.25), not providing support for this gene. NEUROD1 is better
established as the cause of MODY6(15) and supported by our finding of a mutation in
one patient (deleterious by all 5 algorithms) vs. 0/866 in the controls. Other well-
established genes found mutated were HNF1B, ABCC8, GCK (each in two patients )
and INS (one patient).
Both HNF1B mutations were complete gene deletions within the known recurrent
microdeletion at 17q22, reported to account for as many as 50% of MODY5 cases (16).
The two patients had LOH over at least 1.4 Mb that encompassed HNF1B among 28
genes (Fig. 1, top). Over the LOH region in each patient, each of 178 exons had
approximately half the read counts of the average of all other patients (Fig.1 bottom),
p=7.5x10-15 and 1x10-16 for patient 17 and 18 respectively. Adjacent to the deletion,
there were no shared haplotypes, indicating independent occurrence in two different
ancestral chromosomes.
Fasting C-peptide, available in 56/82 patients, varied widely and was no different
between patients with or without a mutation (mean 249.5 vs. 280.5, p=0.6699). (Fig.
S5A).
10 Diabetes Page 12 of 40
For the 82 patients (37 females), the median age at diagnosis was 20, (range 1 to 61 years). Patients with mutations were younger, with median age at diagnosis 13.5 vs.
23.2 (p=0.0297) (Fig. S5B).
In a parallel study, 126 T1Dclin, autoantibody negative patients, including 44 whose
DNA sample was unsuitable for WES, were tested for mitochondrial DNA mutations by Sanger sequencing. Four had the m.3243A>G mutation and two the m.3316A>G, both previously reported in Chinese diabetes patients (17; 18). Heteroplasmy, estimated from the sequencing peaks, ranged from 6.2% to 50.4% (Table S5), well within the described range (19).
The distribution of genetic causes of 18 confirmed cases of monogenic diabetes and 6 cases of mitochondrial diabetes are shown in Supplementary Figure 6.
Discussion
With 27.4% of Chinese T1Dclin being autoantibody negative, and 22.0% of them having monogenic diabetes, our best estimate for the overall prevalence of monogenic diabetes in patients diagnosed as T1D is 6%, considerably higher than the approximately 1% reported in comparable childhood cohorts of European decent (6; 7).
In the UK, 3.6% was reported among patients chosen for preserved C-peptide (8), a very different population from our T1Dclin cases. Our results show that C-peptide cannot distinguish monogenic cases presenting with a clinical picture leading to the diagnosis of T1D.
This percentage is even higher if we add the mitochondrial cases. Such high incidence is not surprising, given that the denominator (autoimmune T1D) is much less common
11 Page 13 of 40 Diabetes
in EA. These findings make a strong argument for universal autoantibody testing of all
Chinese (and, arguably, Korean and Japanese) T1Dclin patients with sequencing of the
autoantibody negative cases. Studies similar to ours in European-ancestry patients may
also reveal monogenic diabetes rates substantially higher than currently reported, if
diallelic WFS1 mutants are included. Despite the low yield and high cost, the benefit
to individual patients may well justify the expense, as most of these monogenic diabetes
cases are amenable to alternative treatments.
Our other important finding is the high prevalence of non-syndromic WFS1 cases,
much more common than Wolfram syndrome and comparable to that reported in
consanguineous families in Lebanon (11), in a non-consangineous population. Non-
syndromic diabetes has also been reported with homozygosity for a non-synonymous
variant frequently found in Ashkenazi Jews (20) but it is clearly not confined to that
variant. The therapeutic implications of this diagnostic reassignment remain to be
seen, but successful use of incretin interventions has been reported (21; 22). It should
definitely be included in all monogenic diabetes panels.
We expect that these preliminary findings will stimulate much larger studies in various
populations, to better define the prevalence of monogenic diabetes in agnostic searches.
Despite the limitations of our study, including small sample size (counterbalanced by
the large effect size and highly significant results) and lack of detailed phenotype data
(a convenience sample collected for a different purpose), we propose that our findings
will apply to the vast majority of T1Dclin cases and justify serious consideration of
agnostic screening of all cases diagnosed as T1D in East Asians.
12 Diabetes Page 14 of 40
Acknowledgements:
Author contributions: Constantin Polychronakos and Tao Yang developed the study concept and supervised the study. Meihang Li helped with the study design and interpretation of results and wrote the manuscript. Sihua Wang performed the bioinformatic analysis of the exome sequencing data. Yangxi Li participated in the writing and corrections of the manuscript. Kuanfeng Xu summarized clinical information of T1Dclin patients from 11 hospitals and helped correcting the manuscript. Yang Chen, Qi Fu, Mei Zhang, Min Sun, Yong Gu and Yun Shi are clinicians that collected the T1Dclin patients. Heng Chen tested the pancreatic auto- antibodies. Xiuqun Han, Zhoukai Tang and Lejing Cai carried out the Sanger of all
WES variants. Xiuqun Han also designed the PCR primers for each variant. Zhiqiang
Li and Yongyong Shi collected the control sequencing data from 866 WES for the selected genes.
The authors wish to thank all patients who consented to participate in the study. For valuable technical assistance, we thank Min Shen, Yingjie Feng from First Affiliated
Hospital of Nanjing Medical University. The study was supported by Grants from the
National Natural Science Foundation of China (81830023, 81270897 and 81670715) and the Key Research and Development Program of Science and Technology
Commission Foundation of Jiangsu Province (SBE2017750381); MaiDa Gene
Technology is indebted to the 5313 Leading Talents Project of Zhoushan city, Zhejiang province for generous funding of this project.
13 Page 15 of 40 Diabetes
Conflict of Interest Statement: The authors declared that they have no conflicts of
interest to this work.
Statement of guarantor: Constantin Polychronakos and Tao Yang assume responsibility
for the accuracy of all statements made in this paper and for the integrity of the raw
data and their processing.
Statement: The VCF files generated during analyzed the current study is not publicly
available due to Chinese policy that public sharing of genomic data is not allowed.
Disclosure: Zhejiang MaiDa Gene Tech Co. Ltd. is a publicly funded for-profit
corporation that will be offering genetic testing services.
References
1. Nakhla M, Polychronakos C: Monogenic and other unusual causes of diabetes mellitus. Pediatric clinics of North America 2005;52:1637-1650 2. Bacon S, Kyithar MP, Rizvi SR, Donnelly E, McCarthy A, Burke M, Colclough K, Ellard S, Byrne MM: Successful maintenance on sulphonylurea therapy and low diabetes complication rates in a HNF1A-MODY cohort. Diabetic medicine : a journal of the British Diabetic Association 2016;33:976- 984 3. Urakami T, Habu M, Okuno M, Suzuki J, Takahashi S, Yorifuji T: Three years of liraglutide treatment offers continuously optimal glycemic control in a pediatric patient with maturity-onset diabetes of the young type 3. Journal of pediatric endocrinology & metabolism : JPEM 2015;28:327-331 4. Ostoft SH, Bagger JI, Hansen T, Pedersen O, Faber J, Holst JJ, Knop FK, Vilsboll T: Glucose-lowering effects and low risk of hypoglycemia in patients with maturity-onset diabetes of the young when treated with a GLP-1 receptor agonist: a double-blind, randomized, crossover trial. Diabetes care 2014;37:1797- 1805 5. Bouyonnec CPAC-l: Non-autoimmune, young-onset, insulin-deficient diabetes; does it exist? . 3rd Global Congress for Consensus in Pediatrics & Child Health, Bangkok Thailand 2014; 6. Pihoker C, Gilliam LK, Ellard S, Dabelea D, Davis C, Dolan LM, Greenbaum CJ, Imperatore G, Lawrence JM, Marcovina SM, Mayer-Davis E, Rodriguez BL, Steck AK, Williams DE, Hattersley AT, Group SfDiYS: Prevalence, characteristics and clinical diagnosis of maturity onset diabetes of the young due to mutations in HNF1A, HNF4A, and glucokinase: results from the SEARCH for Diabetes in Youth.
14 Diabetes Page 16 of 40
The Journal of clinical endocrinology and metabolism 2013;98:4055-4062 7. Johansson BB, Irgens HU, Molnes J, Sztromwasser P, Aukrust I, Juliusson PB, Sovik O, Levy S, Skrivarhaug T, Joner G, Molven A, Johansson S, Njolstad PR: Targeted next-generation sequencing reveals MODY in up to 6.5% of antibody-negative diabetes cases listed in the Norwegian Childhood Diabetes Registry. Diabetologia 2017;60:625-635 8. Shields BM, Shepherd M, Hudson M, McDonald TJ, Colclough K, Peters J, Knight B, Hyde C, Ellard S, Pearson ER, Hattersley AT, team Us: Population-Based Assessment of a Biomarker-Based Screening Pathway to Aid Diagnosis of Monogenic Diabetes in Young-Onset Patients. Diabetes care 2017;40:1017- 1025 9. Diaz-Valencia PA, Bougneres P, Valleron AJ: Global epidemiology of type 1 diabetes in young adults and adults: a systematic review. BMC public health 2015;15:255 10. Zhu M, Xu K, Chen Y, Gu Y, Zhang M, Luo F, Liu Y, Gu W, Hu J, Xu H, Xie Z, Sun C, Li Y, Sun M, Xu X, Hsu HT, Chen H, Fu Q, Shi Y, Xu J, Ji L, Liu J, Bian L, Zhu J, Chen S, Xiao L, Li X, Jiang H, Shen M, Huang Q, Fang C, Li X, Huang G, Fan J, Jiang Z, Jiang Y, Dai J, Ma H, Zheng S, Cai Y, Dai H, Zheng X, Zhou H, Ni S, Jin G, She JX, Yu L, Polychronakos C, Hu Z, Zhou Z, Weng J, Shen H, Yang T: Identification of Novel T1D Risk Loci and Their Association With Age and Islet Function at Diagnosis in Autoantibody-Positive T1D Individuals: Based on a Two-Stage Genome-Wide Association Study. Diabetes care 2019; 11. Zalloua PA, Azar ST, Delepine M, Makhoul NJ, Blanc H, Sanyoura M, Lavergne A, Stankov K, Lemainque A, Baz P, Julier C: WFS1 mutations are frequent monogenic causes of juvenile-onset diabetes mellitus in Lebanon. Human molecular genetics 2008;17:4012-4021 12. Liu J, Bian L, Ji L, Chen Y, Chen H, Gu Y, Ma B, Gu W, Xu X, Shi Y, Wang J, Zhu D, Sun Z, Ma J, Jin H, Shi X, Miao H, Xin B, Zhu Y, Zhang Z, Bu R, Xu L, Shi G, Tang W, Li W, Zhou D, Liang J, Cheng X, Shi B, Dong J, Hu J, Fang C, Zhong S, Yu W, Lu W, Wu C, Qian L, Yu J, Gao J, Fei X, Zhang Q, Wang X, Cui S, Cheng J, Xu N, Wang G, Han G, Xu C, Xie Y, An M, Zhang W, Wang Z, Cai Y, Fu Q, Fu Y, Zheng S, Yang F, Hu Q, Dai H, Jin Y, Zhang Z, Xu K, Li Y, Shen J, Zhou H, He W, Zheng X, Han X, Yu L, She J, Zhang M, Yang T: The heterogeneity of islet autoantibodies and the progression of islet failure in type 1 diabetic patients. Science China Life sciences 2016;59:930-939 13. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL, Committee ALQA: Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genetics in medicine : official journal of the American College of Medical Genetics 2015;17:405-424 14. Irgens HU, Molnes J, Johansson BB, Ringdal M, Skrivarhaug T, Undlien DE, Sovik O, Joner G, Molven A, Njolstad PR: Prevalence of monogenic diabetes in the population-based Norwegian Childhood Diabetes Registry. Diabetologia 2013;56:1512-1519 15. Malecki MT, Jhala US, Antonellis A, Fields L, Doria A, Orban T, Saad M, Warram JH, Montminy M, Krolewski AS: Mutations in NEUROD1 are associated with the development of type 2 diabetes mellitus. Nature genetics 1999;23:323-328 16. Edghill EL, Stals K, Oram RA, Shepherd MH, Hattersley AT, Ellard S: HNF1B deletions in patients with young-onset diabetes but no known renal disease. Diabetic medicine : a journal of the British Diabetic Association 2013;30:114-117 17. Ji L, Hou X, Han X: Prevalence and clinical characteristics of mitochondrial tRNAleu(UUR) nt 3243 A-->G and nt 3316 G-->A mutations in Chinese patients with type 2 diabetes. Diabetes research and
15 Page 17 of 40 Diabetes
clinical practice 2001;54 Suppl 2:S35-38 18. Wang S, Wu S, Zheng T, Yang Z, Ma X, Jia W, Xiang K: Mitochondrial DNA mutations in diabetes mellitus patients in Chinese Han population. Gene 2013;531:472-475 19. Murphy R, Turnbull DM, Walker M, Hattersley AT: Clinical features, diagnosis and management of maternally inherited diabetes and deafness (MIDD) associated with the 3243A>G mitochondrial point mutation. Diabetic medicine : a journal of the British Diabetic Association 2008;25:383-399 20. Bansal V, Boehm BO, Darvasi A: Identification of a missense variant in the WFS1 gene that causes a mild form of Wolfram syndrome and is associated with risk for type 2 diabetes in Ashkenazi Jewish individuals. Diabetologia 2018;61:2180-2188 21. Toppings NB, McMillan JM, Au PYB, Suchowersky O, Donovan LE: Wolfram Syndrome: A Case Report and Review of Clinical Manifestations, Genetics Pathophysiology, and Potential Therapies. Case reports in endocrinology 2018;2018:9412676 22. Lu S, Kanekura K, Hara T, Mahadevan J, Spears LD, Oslowski CM, Martinez R, Yamazaki-Inoue M, Toyoda M, Neilson A, Blanner P, Brown CM, Semenkovich CF, Marshall BA, Hershey T, Umezawa A, Greer PA, Urano F: A calcium-dependent protease as a potential therapeutic target for Wolfram syndrome. Proceedings of the National Academy of Sciences of the United States of America 2014;111:E5292-5301
16 Diabetes Page 18 of 40
Table 1. Genetic variants found in Monogenic Diabetes genes Age of Patient AA Hom diagnosis Family HbA1c % FCP (pmo Pathogenicity ID Gene Transcript ID CDS change Change /Het (years) history (mmol/mol) l/L) snp138 maxMAF ExAC GnomAD
1 HNF1A NM_000545.5 c.1192C>G p.Q398E Het 20 N NA NA 0 . . D, D, N, D, D
NA, NA, NA, NA, 2 HNF1A NM_000545.5 c.865delC p.P289fs Het 12 Y 9.1 (76) NA 0.0007 0.0002 0.00006272 NA
3 HNF1A NM_000545.5 c.686G>A p.R229Q Het 16 N 9.8 (84) 734.8 0 . . D, D, D, D, D
4 HNF1A NM_000545.5 c.1512C>A p.S504R Het 4 N 12.3 (111) 49.56 0.0001 . 0.000008134 D, P, D, D, D
NA, NA, NA, D, 5 HNF1A NM_000545.5 c.956-1G>C .(splicing) Het 12 N 7.4 (57) 6.8 0 . . NA
6 HNF1A NM_000545.5 c. 347C>T p.A116V Het N NA 426.24 D, D, D, D, D 18 c.1096_1097 insAGGACA NA, NA, NA, NA, GCAAG p.Q366fs 0 . . NA NM_006005.3 170.16
7 WFS1 c.1376T>G p.L459R Het 9 N 15.6 (147) 0 . . D, D, D, D, D
c.472G>A p.E158K 0.0002 0.00001659 0.0000204 T, D, D, D, D
8 WFS1 NM_006005.3 Het 18 N 111.7 rs188848 c.985T>A p.F329I NA 517 0.002 0.0001 0.0002 D, D, D, D, D
9 WFS1 NM_006005.3 c.1892C>T p.S631F Hom 5 N NA 69.93 0 . . D, P, D, D, D
17 Page 19 of 40 Diabetes
c.472G>A p.E158K 0.0002 0.00001659 0.0000204 T, D, D, D, D
10 WFS1 NM_006005.3 Het 22 N rs188848 c.985T>A p.F329I NA NA 517 0.002 0.0001 0.0002 D, D, D, D, D
11 ABCC8 NM_000352.3 c.1834G>A p.E612K Het 29 Y NA 170.9 0.00003006 0.00001652 0.000008143 T, B, D, D, D
c.1811T>C p.L604P 0 . . T, D, D, D, D 12 ABCC8 NM_000352.3 Het 14 N NA c.793C>T p.R265W 14.2 (132) 0 . . D, D, N, D, D
rs803566 13 INS NM_000207.2 c.94G>A p.G32S Het 7 Y 16 (151) 166.5 0 . . D, D, D, D, D 64
14 GCK NM_000162.3 c.665T>A p.V222D Het 3 Y 6.1 (43) 314 0 . . D, D, D, D, D
rs193922 15 GCK NM_000162.3 c.661G>A p.E221K Het 36 N NA NA 317 0 . . T, D, D, D, D
NEUR 16 OD1 NM_002500.4 c.316G>A p.A106T Het 13 Y NA 399.6 0 . . D, D, D, D, D
17 NA, NA, NA, NA, HNF1B NM_000458.2 WGD WGD Het 25 Y 8.4 (68) NA NA
NA, NA, NA, NA, 18 HNF1B NM_000458.2 WGD WGD Het 14 N 13.7 (126) 480 NA
FCP: Fasting C-peptide, pmol/L. In the Pathogenicity column, the results of evaluation algorithms are indicated in single-letter codes in this order: for SIFT (D: deleterious, T:tolerated); for Polyphen2 (D:Probably damaging, P:Possibly damaging, B:benign); for LRT ( D:Deleterious,N:Neutral); for MutationTaster (D:Disease causing, N:Polymorphism); for LR (D:Deleterious, T:Tolerated). NA: Not available. WGD: whole gene deletion Reference list for previous reports of some mutations is provided in the supplementary Table S4.
18 Diabetes Page 20 of 40
Figure Legend Figure 1. Demonstration of the 17q22 microdeletion that encompasses HNF1B in patient 18. Top: LOH. A plot of the proportion of reads for one of the two alleles calculated as B/(A+B), where A and B are the read counts for each allele (by the Illumina convention, the non-Reference nucleotide is called A if it is A or T, otherwise B). Homozygotes cluster around 0 or 1, heterozygotes around 0.5. Complete LOH can be seen over 1.4 Mb. Only positions with at least one non-Reference allele are shown (all others are homozygous Reference). Bottom: Copy number over the LOH region in each patient was estimated by comparing read counts at each exon (normalized as counts per million) to the average of all other patients. Divided by that average, intact DNA clusters around 1, heterozygous deletion around 0.5. To harmonize with the conventional display from microarray data, the ratio is plotted as base 2 log (intact DNA is 0, heterozygous deletion is -1). Only exons with 50 or more mapped reads are included. A heterozygous deletion is clearly demonstrated over the LOH, p= 10-16 by paired t-test comparing each exon to the average of all other patients.
19 Page 21 of 40 Diabetes
Figure 1. Demonstration of the 17q22 microdeletion that encompasses HNF1B in patient 18. Top: LOH. A plot of the proportion of reads for one of the two alleles calculated as B/(A+B), where A and B are the read counts for each allele (by the Illumina convention, the non-Reference nucleotide is called A if it is A or T, otherwise B). Homozygotes cluster around 0 or 1, heterozygotes around 0.5. Complete LOH can be seen over 1.4 Mb. Only positions with at least one non-Reference allele are shown (all others are homozygous Reference). Bottom: Copy number over the LOH region in each patient was estimated by comparing read counts at each exon (normalized as counts per million) to the average of all other patients. Divided by that average, intact DNA clusters around 1, heterozygous deletion around 0.5. To harmonize with the conventional display from microarray data, the ratio is plotted as base 2 log (intact DNA is 0, heterozygous deletion is -1). Only exons with 50 or more mapped reads are included. A heterozygous deletion is clearly demonstrated over the LOH,.p= 10-16 by paired t-test comparing each exon to the average of all other patients.
119x91mm (240 x 240 DPI) Diabetes Page 22 of 40
High prevalence of a monogenic cause in Han Chinese diagnosed with type 1 diabetes, partly driven by non-syndromic recessive WFS1 mutations.
ON-LINE SUPPLEMENTARY MATERIAL.
Supplementary table: p. 2-9
Supplementary figure: p. 10-15
Supplementary reference: p. 16-20
1 Page 23 of 40 Diabetes
Table S1. Genes analyzed after WES.
Gene Genbank Reference Phenotype OMIM Inheritance Sequence ABCC8 NM_000352.3 Permanent neonatal diabetes 606176 Dominant (often de novo) or recessive Transient neonatal diabetes 610374 Dominant (often de novo) or recessive MODY 610374 Dominant BSCL2 NM_001122955.3 Congenital generalised lipodystrophy, severe insulin 269700 Recessive resistance and diabetes CEL NM_001807.4 MODY 609812 Dominant CISD2 NM_001008388.4 Wolfram Syndrome 2 (diabetes mellitus, hearing loss, 604928 Recessive optic atrophy and defective platelet aggregation). EIF2AK3 NM_004836.6 Wolcott-Rallison syndrome 226980 Recessive FOXP3 NM_014009.3 Immunodysregulation, polyendocrinopathy, and 304790 X-Linked Recessive enteropathy, X-linked syndrome (IPEX) GATA4 NM_002052.4 Permanent neonatal diabetes with pancreatic agenesis Not assigned Dominant (often de novo) and congenital heart defects GATA6 NM_005257.4 Permanent neonatal diabetes with pancreatic agenesis 600001 Dominant (often de novo) and congenital heart defects GCK NM_000162.3 Permanent neonatal diabetes 606176 Recessive MODY 125851 Dominant GLIS3 NM_001042413.1 Permanent neonatal diabetes with congenital 610199 Recessive hypothyroidism HNF1A NM_000545.5 MODY 600496 Dominant
2 Diabetes Page 24 of 40
HNF1B NM_000458.2 Renal Cysts and Diabetes syndrome (RCAD) 137920 Dominant (often de novo) HNF4A NM_001287182 MODY 125850 Dominant IER3IP1 NM_016097.4 microcephaly, epilepsy, and diabetes syndrome (MEDS) 614231 Recessive IL2RA NM_000417.2 Immunodysregulation, polyendocrinopathy, and 606367 Recessive enteropathy, X-linked syndrome (IPEX) INS NM_000207.2 Permanent neonatal diabetes 606176 Dominant (often de novo) or recessive Transient neonatal diabetes Not assigned Dominant (often de novo) or recessive
MODY 613370 Dominant INSR NM_000208.3 Severe insulin resistance 610549 Dominant KCNJ11 NM_000525.3 Permanent neonatal diabetes 606176 Dominant (often de novo) Transient neonatal diabetes 610582 Dominant (often de novo) MODY Not assigned Dominant LMNA NM_170707.3 Familial Partial Lipodystropy (FPLD2) 151660 Dominant MNX1 NM_005515.3 Neonatal diabetes & IUGR Not assigned Recessive NEUROD1 NM_002500.4 Permanent neonatal diabetes and neurological Not assigned Recessive abnormalities MODY 606394 Dominant NEUROG3 NM_020999.3 Permanent neonatal diabetes with congenital 610370 Recessive malabsorptive diarrhoea NKX2-2 NM_002509.3 Neonatal diabetes and developmental delay Not assigned Recessive PAX6 NM_001258462.1 Aniridia and impaired glucose tolerance 106210 Dominant PDX1 NM_000209.3 Permanent neonatal diabetes +/- pancreatic agenesis 260370 Recessive MODY 606392 Dominant
3 Page 25 of 40 Diabetes
PPARG NM_015869.4 Familial Partial Lipodystropy (FPLD3) 604367 Dominant PTF1A NM_178161.2 Permanent neonatal diabetes with cerebellar and 609069 Recessive pancreatic agenesis RFX6 NM_173560.3 Permanent neonatal diabetes with pancreatic hypoplasia, 601346 Recessive intestinal atresia, and gallbladder aplasia or hypoplasia
SLC2A2 NM_000340.1 Fanconi-Bickel syndrome 227810 Recessive SLC19A2 NM_006996.2 Thiamine responsive megaloblastic anaemia, diabetes 249270 Recessive and deafness (TRMA) syndrome TRMT10A NM_152292.4 Diabetes, microcephaly and short stature 616033 Recessive WFS1 NM_006005.3 Wolfram syndrome (Diabetes insipidus, diabetes 222300 Recessive mellitus, optic atrophy and deafness, DIDMOAD) ZFP57 NM_001109809.2 Transient neonatal diabetes 601410 Recessive KLF11 NM_003597.4 Maturity-onset diabetes of the young, type VII 603301 Dominant Diabetes mellitus, type 2 125853 Dominant PAX4 NM_006193.2 MODY 612225 Not assigned Diabetes mellitus, ketosis-prone 612227 Dominant, Recessive BLK NM_001715.2 MODY 613375 Dominant APPL1 NM_012096.2 MODY 616511 Dominant Autoimmune disease, multisystem, infantile-onset 615952 Dominant STAT3 NM_139276.2 Hyper-IgE recurrent infection syndrome 147060 Dominant Mandibular hypoplasia, deafness, progeroid features, and 615381 Dominant POLD1 NM_001256849.1 lipodystrophy syndrome Colorectal cancer 612591 Dominant
4 Diabetes Page 26 of 40
Table S2. Comparison of the frequencies of pathogenic variants (deleterious by at least 3 of the 5 algorithms) between the 82 cases (observed fraction) and the 866 controls (expected fraction).
# pathogenic variants
Gene Cases N=82 Controls N=866 p Pobs (CI95) Pexp (CI95) WFS1 4 0 4.38E-05 0.049 (0.024 - 0.111) 0.00 (0-0.006) HNF1A 6 2 6.49E-06 0.073 (0.039-0.144) 0.002 (0.0008-0.004) KLF11 1 2 0.255 ABCC8 3 2 0.006 GCK 2 0 0.007 INS 1 0 0.085 NEUROD1 1 0 0.085
5 Page 27 of 40 Diabetes
Table S3. Missense mutations with MAF<0.0005 likely also pathogenic.
Patient Age of Family Gene Transcript ID CDS change AA Change Hom/Het HbA1c snp138 maxMAF ExAC GnomAD Pathogenicity Ref ID onset history
14 HNF4A NM_001287182 c.5C>T p.S2L Het 7 Y NA NA 0.0005 0.0004 0.00005677 NA, NA, NA, NA, NA NA
8 HNF1A NM_000545.5 c.1854C>G p.I618M Het 5 N NA rs193922591 0.0002 . 0.00001626 T, P, N, D, D NA
19 ABCC8 NM_000352.3 c.4135C>T p.R1379C Het 18 N NA rs137852673 0.0004 0.00002663 0.000005143 D, D, D, A, D (1)
In the Pathogenicity column, the results of evaluation algorithms are indicated in single-letter codes in this order: for SIFT (D: deleterious, T:tolerated); for Polyphen2 (D:Probably damaging, P:Possibly damaging, B:benign); for LRT ( D:Deleterious,N:Neutral); for MutationTaster (D:Disease causing, N:Polymorphism, A: disease_causing_automatic); for LR (D:Deleterious, T:Tolerated). NA: Not available.
6 Diabetes Page 28 of 40
Table S4. Genetic variants found in Monogenic Diabetes genes (with reference)
Patient AA Hom Patient Hom Gene Transcript ID CDS change Ref Gene Transcript ID CDS change AA Change Ref ID Change /Het ID /Het
1 HNF1A NM_000545.5 c.1192C>G p.Q398E Het NA c.472G>A p.E158K (21; 22) 10 WFS1 NM_006005.3 Het 2 HNF1A NM_000545.5 c.865delC p.P289fs Het (1-6) 3 HNF1A NM_000545.5 c.686G>A p.R229Q Het (7-14) c.985T>A p.F329I NA 4 HNF1A NM_000545.5 c.1512C>A p.S504R Het NA 11 ABCC8 NM_000352.3 c.1834G>A p.E612K Het NA 5 HNF1A NM_000545.5 c.956-1G>C splicing Het NA c.1811T>C p.L604P NA 12 ABCC8 NM_000352.3 Het 6 HNF1A NM_000545.5 c. 347C>T p.A116V Het NA c.793C>T p.R265W NA c.1096_1097 insAGGAC p.Q366fs NA 13 INS NM_000207.2 c.94G>A p.G32S Het (1; 15-20) 7 WFS1 NM_006005.3 Het AGCAAG c.1376T>G p.L459R NA 14 GCK NM_000162.3 c.665T>A p.V222D Het (23; 24) c.472G>A p.E158K (21; 22) 15 GCK NM_000162.3 c.661G>A p.E221K Het (25-29) 8 WFS1 NM_006005.3 Het NEURO c.985T>A p.F329I NA 16 NM_002500.4 c.316G>A p.A106T Het NA D1
17 HNF1B NM_000458.2 WGD WGD Het (30) 9 WFS1 NM_006005.3 c.1892C>T p.S631F Hom NA 18 HNF1B NM_000458.2 WGD WGD Het (30)
NA: Not available. WGD: whole gene deletion
7 Page 29 of 40 Diabetes
Table S5. Genetic variants found in Mitochondrial DNA
Patient Mutation Sanger Sequencing Gender Age of onset BMI HbA1c (%) FCS (pmol/L) ID 20 m. A3243G
Female 41 19.56 NA NA
21 m. G3316A
Male 46 NA NA 283.20
22 m. A3243G
Female 31 17.48 NA NA
8 Diabetes Page 30 of 40
23 m. A3243G
Female 39 22.06 NA NA
24 m. G3316A
Male 61 16.94 11.4 411.20
25 m. A3243G
Female 24 NA 6.5 795.00
9 Page 31 of 40 Diabetes
Figure S1. Positive rate of auto-antibodies from Total T1Dclin been tested.
10 Diabetes Page 32 of 40
Figure S2. PCA analysis:In order to show that our 82 cases and 866 Chinese controls are from the same genetic background, we use the synonymous SNPs of the two exomes to do principal component analysis.As expected,the two population samples show practically complete overlap.
11 Page 33 of 40 Diabetes
Figure S3. Read alignment showing that the two WFS1 mutations (p.Q366fs-p.L459R) are on different read pairs, and therefore in trans.
12 Diabetes Page 34 of 40
Figure S4. The audiogram (A) and eye fundus photography (B) of one of the patients with diallelic WFS1 mutations.
13 Page 35 of 40 Diabetes
Figure S5. Fasting C-peptide(p=0.6699) (A) and age of diagnosis(p=0.0297) (B) in monogenic forms of diabetes (MFD) vs. the mutation-netative group (non-MFD).
14 Diabetes Page 36 of 40
Figure S6. Distribution of genetic causes of 18 confirmed cases of monogenic diabetes and 6 cases of mitochondrial diabetes. Data presented as number of cases caused by mutations in each gene.
15 Page 37 of 40 Diabetes
References
S1. Alkorta-Aranburu G, Carmody D, Cheng YW, Nelakuditi V, Ma L, Dickens JT, Das S, Greeley SAW, Del
Gaudio D: Phenotypic heterogeneity in monogenic diabetes: the clinical and diagnostic utility of a gene panel-based
next-generation sequencing approach. Molecular genetics and metabolism 2014;113:315-320
S2. Kristinsson SY, Thorolfsdottir ET, Talseth B, Steingrimsson E, Thorsson AV, Helgason T, Hreidarsson AB,
Arngrimsson R: MODY in Iceland is associated with mutations in HNF-1alpha and a novel mutation in NeuroD1.
Diabetologia 2001;44:2098-2103
S3. Klupa T, Warram JH, Antonellis A, Pezzolesi M, Nam M, Malecki MT, Doria A, Rich SS, Krolewski AS:
Determinants of the development of diabetes (maturity-onset diabetes of the young-3) in carriers of HNF-1alpha
mutations: evidence for parent-of-origin effect. Diabetes care 2002;25:2292-2301
S4. Thanabalasingham G, Pal A, Selwood MP, Dudley C, Fisher K, Bingley PJ, Ellard S, Farmer AJ, McCarthy MI,
Owen KR: Systematic assessment of etiology in adults with a clinical diagnosis of young-onset type 2 diabetes is a
successful strategy for identifying maturity-onset diabetes of the young. Diabetes care 2012;35:1206-1212
S5. Ludovico O, Carella M, Bisceglia L, Basile G, Mastroianno S, Palena A, De Cosmo S, Copetti M, Prudente S,
Trischitta V: Identification and Clinical Characterization of Adult Patients with Multigenerational Diabetes Mellitus.
PloS one 2015;10:e0135855
S6. Tung JY, Boodhansingh K, Stanley CA, De Leon DD: Clinical heterogeneity of hyperinsulinism due to HNF1A
and HNF4A mutations. Pediatric diabetes 2018;19:910-916
S7. Kaisaki PJ, Menzel S, Lindner T, Oda N, Rjasanowski I, Sahm J, Meincke G, Schulze J, Schmechel H, Petzold
C, Ledermann HM, Sachse G, Boriraj VV, Menzel R, Kerner W, Turner RC, Yamagata K, Bell GI: Mutations in the
hepatocyte nuclear factor-1alpha gene in MODY and early-onset NIDDM: evidence for a mutational hotspot in exon
4. Diabetes 1997;46:528-535
S8. Vesterhus M, Raeder H, Johansson S, Molven A, Njolstad PR: Pancreatic exocrine dysfunction in maturity-onset
diabetes of the young type 3. Diabetes care 2008;31:306-310
16 Diabetes Page 38 of 40
S9. Eide SA, Raeder H, Johansson S, Midthjell K, Sovik O, Njolstad PR, Molven A: Prevalence of HNF1A
(MODY3) mutations in a Norwegian population (the HUNT2 Study). Diabetic medicine : a journal of the British
Diabetic Association 2008;25:775-781
S10. Irgens HU, Molnes J, Johansson BB, Ringdal M, Skrivarhaug T, Undlien DE, Sovik O, Joner G, Molven A,
Njolstad PR: Prevalence of monogenic diabetes in the population-based Norwegian Childhood Diabetes Registry.
Diabetologia 2013;56:1512-1519
S11. Consortium STD, Estrada K, Aukrust I, Bjorkhaug L, Burtt NP, Mercader JM, Garcia-Ortiz H, Huerta-Chagoya
A, Moreno-Macias H, Walford G, Flannick J, Williams AL, Gomez-Vazquez MJ, Fernandez-Lopez JC, Martinez-
Hernandez A, Jimenez-Morales S, Centeno-Cruz F, Mendoza-Caamal E, Revilla-Monsalve C, Islas-Andrade S,
Cordova EJ, Soberon X, Gonzalez-Villalpando ME, Henderson E, Wilkens LR, Le Marchand L, Arellano-Campos
O, Ordonez-Sanchez ML, Rodriguez-Torres M, Rodriguez-Guillen R, Riba L, Najmi LA, Jacobs SB, Fennell T,
Gabriel S, Fontanillas P, Hanis CL, Lehman DM, Jenkinson CP, Abboud HE, Bell GI, Cortes ML, Boehnke M,
Gonzalez-Villalpando C, Orozco L, Haiman CA, Tusie-Luna T, Aguilar-Salinas CA, Altshuler D, Njolstad PR,
Florez JC, MacArthur DG: Association of a low-frequency variant in HNF1A with type 2 diabetes in a Latino population. Jama 2014;311:2305-2314
S12. Johansson BB, Irgens HU, Molnes J, Sztromwasser P, Aukrust I, Juliusson PB, Sovik O, Levy S, Skrivarhaug
T, Joner G, Molven A, Johansson S, Njolstad PR: Targeted next-generation sequencing reveals MODY in up to 6.5% of antibody-negative diabetes cases listed in the Norwegian Childhood Diabetes Registry. Diabetologia 2017;60:625-
635
S13. Karaca E, Onay H, Cetinkalp S, Aykut A, Goksen D, Ozen S, Atik T, Darcan S, Tekin IM, Ozkinay F: The spectrum of HNF1A gene mutations in patients with MODY 3 phenotype and identification of three novel germline mutations in Turkish Population. Diabetes & metabolic syndrome 2017;11 Suppl 1:S491-S496
S14. Yorifuji T, Higuchi S, Kawakita R, Hosokawa Y, Aoyama T, Murakami A, Kawae Y, Hatake K, Nagasaka H,
Tamagawa N: Genetic basis of early-onset, maturity-onset diabetes of the young-like diabetes in Japan and features
17 Page 39 of 40 Diabetes
of patients without mutations in the major MODY genes: Dominance of maternal inheritance. Pediatric diabetes
2018;19:1164-1172
S15. Stoy J, Edghill EL, Flanagan SE, Ye H, Paz VP, Pluzhnikov A, Below JE, Hayes MG, Cox NJ, Lipkind GM,
Lipton RB, Greeley SA, Patch AM, Ellard S, Steiner DF, Hattersley AT, Philipson LH, Bell GI, Neonatal Diabetes
International Collaborative G: Insulin gene mutations as a cause of permanent neonatal diabetes. Proceedings of the
National Academy of Sciences of the United States of America 2007;104:15040-15044
S16. Rubio-Cabezas O, Edghill EL, Argente J, Hattersley AT: Testing for monogenic diabetes among children and
adolescents with antibody-negative clinically defined Type 1 diabetes. Diabetic medicine : a journal of the British
Diabetic Association 2009;26:1070-1074
S17. Bonfanti R, Colombo C, Nocerino V, Massa O, Lampasona V, Iafusco D, Viscardi M, Chiumello G, Meschi F,
Barbetti F: Insulin gene mutations as cause of diabetes in children negative for five type 1 diabetes autoantibodies.
Diabetes care 2009;32:123-125
S18. Wasserman H, Hufnagel RB, Miraldi Utz V, Zhang K, Valencia CA, Leslie ND, Crimmins NA: Bilateral
cataracts in a 6-yr-old with new onset diabetes: a novel presentation of a known INS gene mutation. Pediatric
diabetes 2016;17:535-539
S19. Brahm AJ, Wang G, Wang J, McIntyre AD, Cao H, Ban MR, Hegele RA: Genetic Confirmation Rate in
Clinically Suspected Maturity-Onset Diabetes of the Young. Canadian journal of diabetes 2016;40:555-560
S20. Ortolani F, Piccinno E, Grasso V, Papadia F, Panzeca R, Cortese C, Felappi B, Tummolo A, Vendemiale M,
Barbetti F: Diabetes associated with dominant insulin gene mutations: outcome of 24-month, sensor-augmented
insulin pump treatment. Acta diabetologica 2016;53:499-501
S21. Gasparin MR, Crispim F, Paula SL, Freire MB, Dalbosco IS, Manna TD, Salles JE, Gasparin F, Guedes A,
Marcantonio JM, Gambini M, Salim CP, Moises RS: Identification of novel mutations of the WFS1 gene in Brazilian
patients with Wolfram syndrome. European journal of endocrinology 2009;160:309-316
S22. Pedroso JL, Lucato LT, Kok F, Sallum J, Barsottini OG, Oliveira AS: Association of optic atrophy and type 1
diabetes: clinical hallmarks for the diagnosis of Wolfram syndrome. Arquivos de neuro-psiquiatria 2015;73:466-468
18 Diabetes Page 40 of 40
S23. Incani M, Cambuli VM, Cavalot F, Congiu T, Paderi M, Sentinelli F, Romeo S, Poy P, Soro M, Pilia S, Loche
S, Cossu E, Trovati M, Mariotti S, Baroni MG: Clinical application of best practice guidelines for the genetic diagnosis of MODY2 and MODY3. Diabetic medicine : a journal of the British Diabetic Association 2010;27:1331-
1333
S24. Yu X, Chen M, Zhang S, Yu ZH, Sun JP, Wang L, Liu S, Imasaki T, Takagi Y, Zhang ZY: Substrate specificity of lymphoid-specific tyrosine phosphatase (Lyp) and identification of Src kinase-associated protein of 55 kDa homolog (SKAP-HOM) as a Lyp substrate. The Journal of biological chemistry 2011;286:30526-30534
S25. Guazzini B, Gaffi D, Mainieri D, Multari G, Cordera R, Bertolini S, Pozza G, Meschi F, Barbetti F: Three novel missense mutations in the glucokinase gene (G80S; E221K; G227C) in Italian subjects with maturity-onset diabetes of the young (MODY). Mutations in brief no. 162. Online. Human mutation 1998;12:136
S26. Mantovani V, Salardi S, Cerreta V, Bastia D, Cenci M, Ragni L, Zucchini S, Parente R, Cicognani A:
Identification of eight novel glucokinase mutations in Italian children with maturity-onset diabetes of the young.
Human mutation 2003;22:338
S27. Caetano LA, Jorge AA, Malaquias AC, Trarbach EB, Queiroz MS, Nery M, Teles MG: Incidental mild hyperglycemia in children: two MODY 2 families identified in Brazilian subjects. Arquivos brasileiros de endocrinologia e metabologia 2012;56:519-524
S28. Santana LS, Caetano LA, Costa-Riquetto AD, Quedas EPS, Nery M, Collett-Solberg P, Boguszewski MCS,
Vendramini MF, Crisostomo LG, Floh FO, Zarabia ZI, Kohara SK, Guastapaglia L, Passone CGB, Sewaybricker LE,
Jorge AAL, Teles MG: Clinical application of ACMG-AMP guidelines in HNF1A and GCK variants in a cohort of
MODY families. Clinical genetics 2017;92:388-396
S29. Giuffrida FMA, Moises RS, Weinert LS, Calliari LE, Manna TD, Dotto RP, Franco LF, Caetano LA, Teles MG,
Lima RA, Alves C, Dib SA, Silveiro SP, Dias-da-Silva MR, Reis AF, Brazilian Monogenic Diabetes Study G:
Maturity-onset diabetes of the young (MODY) in Brazil: Establishment of a national registry and appraisal of available genetic and clinical data. Diabetes research and clinical practice 2017;123:134-142
19 Page 41 of 40 Diabetes
S30. Dotto RP, Giuffrida FM, Franco L, Mathez AL, Weinert LS, Silveiro SP, Sa JR, Reis AF, Dias-da-Silva
MR:Unexpected finding of a whole HNF1B gene deletion during the screening of rare MODY types in a series of
Brazilian patients negative for GCK and HNF1A mutations.Diabetes research and clinical practice. 2016;116:100-4
20