The Role of Chemokines/Chemokine Receptors in Labour

The role of chemokines/chemokine

receptors in labour

Renyi Hua

December 2011

Institute of Reproductive and Developmental Biology Department of Surgery and Cancer Division of Cancer, Faculty of Medicine

Imperial College London

This thesis is submitted for the degree of Doctor of Philosophy at

Imperial College London

Dedicated to my beloved parents and husband

Abstract

Human labour is shown to be an inflammatory process, which involves a marked leukocyte infiltrate into myometrium during labour. My study focused on the role of chemokines, key mediators of leukocyte trafficking, in labour.

Previous gene array data obtained from human labouring myometrium showed that the mRNA expression of the following chemokines was increased in term labouring myometrium, CCL2, CCL20, CXCL1, CXCL5, CXCL8. I decided to focus on myometrial expression of these chemokines and also to include CCL5, another important chemokine. My data confirmed that the expression of human myometrial chemokines was increased in labour and that their expression was up regulated by cytokines and mechanical stretch via NFKB and MAPK, but decreased by prostaglandins and oxytocin via PLC. I also studied the expression of myometrial chemokine receptors, which may mediate some of the effects of chemokines on myometrial function and/or act as decoys, minimising the effects of locally produced chemokines. I found that the expression of the chemokine receptors decreased with the onset of labour, mainly through the action of prostaglandins and oxytocin.

I then used the established model of LPS-induced preterm labour (PTL) in the mouse and found that chemokines and cytokines both increased in the myometrium and placenta. CCL2 is consistently increased with human labour and has been shown to be important in rodent parturition too. I therefore studied the impact of LPS in the CCR2 (the main receptor for CCL2) knockout mouse. There was less inflammation in both the myometrium and placenta and a better pup survival rate in the CCR2-/- mouse. However, the PTL was not delayed, suggesting that CCR2 is not essential for the induction of PTL labour by LPS in the mouse.

I then turned my attention to CCL20, which acts only via CCR6. It is known to drive dendritic cell recruitment and I found that its expression was increased with labour, while that of its receptor was reduced. Functionally, I found that CCL20 up- regulated the myometrial expression of chemokines. Next I used the LPS-induced

preterm labour model in the mouse and found that CCR6 knockout delayed LPS- induced preterm delivery and improved pup survival. These findings were associated with much lower inflammation in myometrium and plasma. These data suggest that CCR6 could be a therapeutic target in the management of PTL.

Chemokines play an important role both in the induction of term labour and in infection induced PTL. Chemokine inhibitors may delay the onset of PTL and improve the fetal outcome.

Statement of originality

All work presented in this thesis was performed by myself unless stated otherwise in the text.

Acknowledgements

First of all, I would like to express my deep and sincere gratitude to my supervisor, Professor Mark Johnson, who provided me the opportunity to peruse my study in the field of ‘Prematurity’. I am heartily thankful to Mark for his inspiration, encouragement, guidance and support from the very preliminary stage to the completion of this project. I have learned a million things from him in the past three years which not only have helped me during my studies but also will accompany me during my journey of life. Secondly, I feel very lucky to have Dr. Sooranna as my second supervisor, who teaches me enormously on what science is and always being my good listener, which I truly appreciate. Furthermore, I would like to thank my third supervisor Professor Philip Bennett who gives me those brilliant ideas on my work and brings so many lovely moments during our lab meetings.

It is very sweet to have my best friend forever, Rosamund Tang, who has always been there for me in every important moment of my life in the past 14 years, cheers me up by offering me lots of KFCs and Curry Laksa, whom I shared most loving and fun time with during my PhD. I also want to say big thanks to my dearest colleagues: Kaiyu, who was my tutor when I first started my lab work; Li, who takes care of me just like a big sister; Ben, who is always helpful and patient, and brought us yummy homemade muffins; Kim, who I share lots of lovely time with in the lab and being a loyal companion on weekends; Leila and Jackson, who brought such enjoyable moments and the funny grandpa stories to the lab; Johann, who is the most lovely person to work with in BSU and offered me lots of help and support in mouse work; Laura, who make us the wonderful team at BSU; Shadi, who is my master SHIFU in the world of animal tissue; Lynne, who consented all the amnion tissue for me; Yooni and David, who gave me good suggestions on mouse work; Kieran, who leads me to the world of FACS; Lynne, who inspired me with hard work and optimism; Vasso, who talked to my GP for me which made my life a lot easier. I wish to thank Dr. Bronwen Herbert. I would not be able to finish my animal work without her dedication.

Besides, it is much appreciated that my aunt Qian Zheng and my uncle Hongtao Ye give me a home in London and send me nice food when I couldn’t bear with my cooking skill. Thank my handsome cousin Shen Ye, who brought me lots of fun by using his X-BOX. Moreover, I owe my sincere gratitude to my parents in law, who take care of me and treat me like their own daughter. I wish to send my most loving thanks to my Mum for her patience and encouragement, to my Dad for his updates and interesting opinions to the national and international news. Last but not least, I would like to thank my beloved husband Jiaqi Chen for constantly being tolerant and loving.

Therefore please allow me to say thank you to all of you again for being there for me. Without your support it would have been next to impossible to accomplish my study and achievements.

Sincerely,

Renyi Hua

List of Publications and Conference Presentations during PhD Study

List of Publications:

1. Renyi Hua, James Pease, Suren Sooranna, Jonathan Viney, Scott M Nelson, Les Myatt, Philip R Bennett, Mark Johnson. Stretch and inflammatory cytokines drive myometrial chemokine expression via NF-κB activation. Endocrinology, 2011 Nov. 1. [Epub ahead of print] Pubmed PMID: 22045664. 2. Lei K, Chen L, Cryar BJ, Hua R, Sooranna SR, Brosens JJ, Bennett, PR, Johnson MR. Uterine stretch and progesterone action. J Clin Endocrinol Metab. 2011 Mar 30. [Epub ahead of print] PubMed PMID: 21450990. 3. Renyi Hua, James E Pease, Weiwei Cheng, Suren R Sooranna, Jonathan M Viney, Scott M Nelson, Les Myatt, Philip R Bennett, Mark R Johnson. Human labour is associated with a decline in myometrial chemokine receptor expression: the role of prostaglandins, oxytocin and cytokines. [Submitted to Biology of Reproduction]

List of Conference presentations:

1. Renyi Hua, Suren R Sooranna, Phillip R Bennett, Scott M Nelson, Mar R Johnson. (Mar 2010). Changes in chemokine and chemokine receptor expression occur prior to labour. REPROD SCI.17:280A. 2. Renyi Hua, Suren R Sooranna, Phillip R Bennett, Scott M Nelson, Mar R Johnson. (Mar 2010). Cytokines increase chemokine expression in myometrium. REPROD SCI.17:280A-281A. 3. Hua RY, Lei KY, Herbert B, Sooranna SR, Bennett PR, Johnson MR. (Mar 2011). Uterine Chemokine Expression in Progesterone Delayed Labour in Mice. REPROD SCI. 18:296A-297A. 4. Hua RY, Viney J, Sooranna SR, Pease J, Bennett PR, Johnson MR. (Mar 2011). Upregulation of Biologically Active Chemokines by Cytokines and Mechanical

Stretch Via MAPK and NF kappa B Pathways in Human Myometrium. REPROD SCI. 18:313A-313A. 5. Malawana J, Howe L, Herbert B, Hua R, Bennett PR, Johnson MR. (Sep. 2011). Immunomodulation in pre term labour: an answer to in utero neurological insult. Animal models and their value in predicting drug efficacy and toxicity. Submitted to The New York Academy of Science Annual Meeting (Sep. 15-16,2011). 6. Suren R Sooranna, Renyi Hua, Hong Xu and Mark R Johnson. The Effect of Pregnancy on Cardiac Chemokine Gene Expression in Mice. [Submitted to Society of Gynecologic Investigation annual meeting (March 2012)]. 7. Laura Howe, Johann Malawana, Renyi Hua, Bronwen Herbert, Simon Waddington and Mark Johnson. PDE Inhibitors: A Treatment for Mothers and Babies At Risk Of Preterm Delivery. [Submitted to Society of Gynecologic Investigation annual meeting (March 2012)]. 8. Bronwen R, Renyi Hua, Simon N Waddington, Suren R Sooranna and Mark R Johnson. Absence of Maternal CCR2 Reduces the Adverse Effects of LPS-induced Inflammation on Neonatal Outcome. [Submitted to Society of Gynecologic Investigation annual meeting (March 2012)]. 9. Johann Malawana, Laura Howe, Renyi Hua, Bronwen Herbert, Suren R Sooranna, Phillip R Bennett and Mark R Johnson. Immunomodulation in Preterm Labour: an Answer to in Utero Neurological Insult. [Submitted to Society of Gynecologic Investigation annual meeting (March 2012)].

Contents

Abstract ...... 1

Statement of originality ...... 3

Acknowledgements ...... 4

List of Publications and Conference Presentations during PhD Study ...... 6

Table of Contents ...... 8

List of Figures ...... 12

List of Tables ...... 14

List of Appendix ...... 15

Abbreviations ...... 16

Chapter 1. Introduction ...... 1

1.1 Preterm delivery ...... 2

1.2 Inflammatory cell infiltration ...... 3

1.2.1 T cells ...... 3

1.2.2 Monocytes/Macrophages ...... 4

1.2.3 Dendritic cells ...... 5

1.2.4 NK cells ...... 6

1.2.5 Mast cells ...... 7

1.2.6 Granulocytes ...... 8

1.2.7 B cells ...... 8

1.3 Cytokines in human parturition ...... 9

1.3.1 Pro-inflammatory cytokines ...... 9

1.3.2 Anti-inflammatory cytokines ...... 12

1.4 Chemokines and chemokine receptors in human labour ...... 13

1.4.1 Chemokine ...... 13

1.4.2 Chemokine receptor ...... 14

1.4.3 Function of chemokine/chemokine receptor ...... 14

1.4.4 Chemokines/chemokine receptors in human reproductive system ...... 16

1.4.5 Regulations of chemokine/chemokine receptor ...... 18

1.5 Signaling pathways involved in human labour ...... 20

1.5.1 Nuclear factor kappa B ...... 20

1.5.2 MAPK pathways ...... 22

1.5.3 Protein kinase ...... 23

1.6 Available human myometrial models ...... 25

1.7 Mouse model ...... 25

1.8 Hypothesis and Objectives ...... 27

1.8.1 Hypothesis ...... 27

1.8.2 Objectives ...... 27

Chapter 2. Materials and Methods ...... 29

2.1 Materials ...... 30

2.2 Methods ...... 39

2.2.1 In vitro studies ...... 39

2.2.2 In vivo studies ...... 45

Chapter 3. Myometrial chemokine expression and regulations ...... 50

3.1 Introduction ...... 51

3.2 Results ...... 52

3.2.1 Myometrial expression of chemokines in pregnancy and labour ...... 52

3.2.2 Cell culture ...... 59

3.2.3 Stretch induced myometrial chemokine expression ...... 59

3.2.4 Cytokines induced myometrial chemokine expression ...... 65

3.2.5 The effects of pro-labour protein on chemokines expression on myometrium ...... 70

3.2.6 The migration of L1.2 cells (B cell line) into IL-1β treated myocytes culture medium ... 75

3.3 Discussion ...... 77

Chapter 4. Myometrial chemokine receptor expressions and regulations ...... 81

4.1 Introduction ...... 82

4.2 Results ...... 84

4.2.1 Myometrial expression of chemokines in pregnancy and labour ...... 84

4.2.2 Mechanical stretch increased myometrial chemokine receptor expression ...... 86

4.2.3 Cytokines reduce the expression of myometrial chemokine receptors ...... 87

4.2.4 Prostaglandins and oxytocin reduce the expression of myometrial chemokine receptors89

4.2.5 PGF2α and oxytocin down-regulate myometrial chemokine receptor mRNA expression via PLC and not PKC ...... 94

4.2.6 Cell culture ...... 98

4.3 Discussion ...... 99

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation...... 102

5.1 Introduction ...... 103

5.2 Results ...... 104

5.2.1 Chemokine expression in the CD1 mouse uterus with gestation ...... 104

5.2.2 Myometrial macrophage and monocyte infiltration...... 107

5.2.3 Intrauterine LPS injection ...... 108

5.2.4 Myometrial chemokine and cytokine mRNA expression in response to LPS ...... 109

5.2.5 The effect of LPS on the phosphorylation of ERK1/2, p65 and c-jun and the levels of COX in myometrium (left horn)...... 112

5.2.6 The maternal IL-6 response to PBS and LPS intra-uterine injection ...... 116

5.2.7 Pup brain chemokine and cytokine mRNA expression in response to LPS ...... 117

5.2.8 Placental chemokine and cytokine mRNA expression in response to LPS ...... 119

5.2.9 The effect of LPS on placental phosphorylation of ERK1/2, p65 and c-jun and the levels of COX-2...... 121

5.3 Discussion ...... 124

Chapter 6. CCR2 knockout improves pup survival in a mouse model of preterm labour. 128

6.1 Introduction ...... 129

6.2 Results ...... 131

6.2.1 Chemokine expression in CCR2-/- mouse uterus with gestation ...... 131

6.2.2 NF-κB p65 and ERK activations on E16, resulting the increase of COX-2 in left horn myometrium. Are the wild type and CCR2-/- the same? ...... 134

6.2.3 Leukocyte infiltrated into myometrium...... 138

6.2.4 Time of labour after LPS treatment and pup survival ...... 141

6.2.5 The effect of LPS on the myometrium of CCR2-/- mice ...... 143

6.2.6 Investigations of the mechanism responsible for improved pup survival in CCR2-/- mice154

6.3 Discussion ...... 174

Chapter 7. CCL20/CCR6 system in human and mouse labour: preliminary findings ...... 180

7.1 Introduction ...... 181

7.2 Results ...... 183

7.2.1 Human myometrial expression of CCR6 in pregnancy and labour ...... 183

7.2.2 The regulations of human myometrial CCR6 expression ...... 184

7.2.3 PGF2α and oxytocin down-regulation of human myometrial CCR6 mRNA expression via PLC ...... 188

7.2.4 The effect of CCL20 on myometrial chemokine expression ...... 189

7.2.5 Time of delivery after LPS treatment and pup outcomes of CCR6-/- mice ...... 193

7.2.6 Myometrial chemokine and cytokine expression of LPS treated CCR6-/- mice ...... 195

7.2.7 Plasma IL-6 level in CD1 and CCR6-/- mice ...... 198

7.3 Discussion ...... 200

Chapter 8. Summary and Discussion ...... 202

8.1 Final summary and discussion ...... 203

8.2 Future work ...... 206

Appendices ...... 207

References ...... 211

List of Figures

Figure 1.1 The potential role of TNFα in PROM and preterm labour. ______11 Figure 1.2 Interactions between cytokines and prostaglandins. ______13 Figure 1.3 Schematic model of the canonical NF-κB signaling pathway. ______21 Figure 1.4 OT signaling pathways in CHO-OTR cells. ______24 Figure 3.1 Gene expression of CCL2, CCL5, CCL20, CXCL1, CXCL3, CXCL5 and CXCL8 in upper and lower PTL, PTNL, TL and TNL myometrium. ______55 Figure 3.2 Correlations between gestational age and myometrial chemokine expressions ______59 Figure 3.3 a-g Stretch induced the expression of myometrial chemokines. ______63 Figure 3.5 a-f Cytokines induced the expression of chemokines. ______68 Figure 3.6 Cytokines induced the expression of chemokines. ______69 Figure 3.7 a-f The effect of pro-labour protein on chemokine expression. ______73 Figure 3.8 The effect of pro-labour gene on chemokine expression. ______74 Figure 3.9 Chemotaxis assay. ______76 Figure 4.1 Gene expression of CCR2, CXCR1 and CXCR2 in upper and lower PTL, PTNL, TL and TNL myometrium. ______85 Figure 4.2 Stretch induced the expression of myometrial chemokine receptors. ______87 Figure 4.3 Cytokines reduced the expression of chemokine receptors. ______89 Figure 4.4 The effect of pro-labour gene on chemokine receptors expression. ______93 Figure 4.5 Pro-labour protein reduced chemokine receptor expressions via PLC. ______97 Figure 5.1 CD1 mouse myometrial chemokine expression. ______106 Figure 5.2 Inflammatory cells in non-pregnant and E18 mice myometrium. ______107 Figure 5.3 Time of labour. ______108 Figure 5.4 Myometrial chemokine and cytokine mRNA expression in response to LPS. ______111 Figure 5.5 a-c The effect of LPS on the phosphorylation of ERK1/2, NF-κB and c-jun and the levels of COX in myometrium (left horn). ______115 Figure 5.6 The maternal IL-6 response to PBS and LPS intrauterine injection. ______116 Figure 5.7 a-c Pup brain chemokine and cytokine mRNA expression in response to LPS. ______118 Figure 5.8 a-c Placental chemokine and cytokine mRNA expression in response to LPS ______120 Figure 5.9 a&b The effect of LPS on the phosphorylation of ERK1/2, NF-κB and c-jun and the levels of COX in the placenta (left horn). ______123 Figure 6.1 CCR2-/- mouse myometrial chemokine expressions. ______133 Figure 6.2 The phosphorylation of myometrial NF-κB (p65), c-jun and ERK1/2 and COX-2 levels in CCR2-/- and CD1 mice. ______137 Figure 6.3 Inflammatory cells in NP and E18 myometrium from CD1 and CCR2-/- mice. ______140 Figure 6.4 Time of labour. ______142 Figure 6.5 The effect of LPS on the myometrium of CCR2-/- mice ______144 Figure 6.6 Comparisons of the effect of LPS/PBS on CD1 and CCR2-/- mice myometrium ______147

Figure 6.7 The investigations of possible pathways involved in the effect of LPS to the myometrium of CCR2-/- mice ______149 Figure 6.8 The effect of LPS/PBS on myometrium of both CD1 and CCR2-/- ______153 Figure 6.9 The effect of LPS on CCR2-/- pup brain ______155 Figure 6.10 The effect of PBS on CD1 and CCR2-/- pup brain ______157 Figure 6.11 The effect of LPS on CD1 and CCR2-/- pup brain ______160 Figure 6.12 The effect of LPS on CCR2-/- placenta ______162 Figure 6.13 Comparisons of chemokine/cytokine expression in placenta between PBS treated CD1 and CCR2-/- mice ______165 Figure 6.14 The effect of LPS on CD1 and CCR2-/- placentae ______167 Figure 6.15 The effect of PBS to CD1 and CCR2-/- placentae ______169 Figure 6.16 The effect of LPS on CD1 and CCR2-/- ______171 Figure 7.1 Expression of human myometrial CCR6 ______183 Figure 7.2 The regulations of human myometrial CCR6 ______187 Figure 7.3 PGF2α and oxytocin down-regulation of human myometrial CCR6 mRNA expression via PLC ______189 Figure 7.4 The effect of CCL20 on other myometrial chemokines ______192 Figure 7.5 Time of delivery and pup outcome of CCR6-/- mice. ______195 Figure 7.6 Myometrial chemokine and cytokine expressions in CCR6-/- mice. ______197 Figure 7.7 Plasma IL-6 in CCR6-/- mice. ______199

List of Tables

Table 2.1 Primers for human chemokine/chemokine receptors used in real-time PCR ...... 35 Table 2.2 Primers for mouse chemokine/chemokine receptors used in real-time PCR ...... 36 Table 2.3 The demographic data of paired upper and lower segment myometrial samples ...... 40 Table 2.4 Primers for genotyping PCR ...... 48 Table 3.1 Correlations between human chemokines expressions and gestational age ...... 59 Table 3.2 The effects of MAPK and NF-κB P65 inhibitors on cytokines induced chemokine expression (percentage changes compared to IL-1β or TNFα treatment alone in 1, 6 and 24 hours, respectively) ... 71

List of Appendix

Appendix 1 Chemokine expression in prolonged cell culture at 6,24 and 54 hours ...... 207 Appendix 2 Pro-labour proteins down regulated chemokine receptor expressions was not via PKC ..... 208 Appendix 3 Chemokine receptor expression in prolonged cell culture ...... 210

Abbreviations

ANOVA: analysis of variance cAMP: cyclic adenosine monophosphate cDNA: complementary DNA

C/EBP: CAAT/enhancer binding protein

COX: cyclo-oxygenase

CCL2 / MCP-1: Chemokine (C-C motif) ligand 2/ monocyte chemotactic protein-1

CCL5/ RANTES: Chemokine (C-C motif) ligand 5/ Regulated upon Activation, Normal T-cell Expressed, and Secreted

CCL20/LARC/MIP3a: Chemokine (C-C motif) ligand 20/ liver activation regulated chemokine/ Macrophage Inflammatory Protein-3

CXCL1: Chemokine (C-X-C motif) ligand 1

CXCL5/ENA-78: Chemokine (C-X-C motif) ligand 5/ epithelial-derived neutrophil-activating peptide 78

CXCL8/IL-8: Chemokine (C-X-C motif) ligand 8/ Interleukin 8

CCR2: Chemokine (C-C motif) receptor 2

CCR6: Chemokine (C-C motif) receptor 6

CXCR1: Chemokine (C-X-C motif) receptor1

CXCR2: Chemokine (C-X-C motif) receptor2

DMEM: dulbecco’s modified eagles’ medium

DMSO: dimethyl sulfoxide

DNA: deoxyribonucleic acid dNTP: deoxyribonucleoside triphosphates

E. coli: Escherichia coli

EDTA: ethylenediaminetetraacetic acid

ERK: extracellular-signal-regulated kinases

FBS: fetal bovine serum

GAPDH: glyceraldehyde 3-phosphate dehydrogenase

IκBα: nuclear factor-kappa B inhibitor α

IκK: inhibitory κB kinase

IL-1β: interleukin-1 beta

JNK: C-Jun N terminal Kinase

LPS: lipopolysaccharide

MAPK: mitogen-activated protein kinase

NF-κB: nuclear factor-kappa B

PBS: phosphate buffered saline

PGE2: Prostaglandin E2

PGF2α: Prostaglandin F2-alpha

PKC: protein kinase C

PLC: phospholipase C

PI3K: Phosphatidylinositol 3-kinases qPCR: quantitative PCR

RNA: ribonucleic acid rpm: revolution per minute

RT-PCR: reverse transcription polymerase chain reaction

TBE: tris-borate buffer

TNFα tumour necrosis factor-α

Chapter 1. Introduction

1.1 Preterm delivery

For much of the 20th century, preterm birth, defined as birth at less than 37 completed weeks of gestation, was viewed as an unpredictable and unpreventable fact of life. Preterm delivery accounts for up to 70% of neonatal deaths and 75% of neonatal morbidity and complicates between 5 and 11% of pregnancies 1. The neonatal morbidity associated with preterm delivery includes cerebral palsy, blindness, deafness, respiratory illness and other complications of neonatal intensive care 2,3. Medical efforts have focused on ameliorating the consequences of prematurity rather than preventing its occurrence. This approach has resulted in improved neonatal outcomes, but rates of preterm delivery have remained unchanged or even increased while the costs of preterm delivery, both in terms of the suffering of infants and their families and of the economic burden to society, persist 4. According to estimates by the World Health Organization, among the 130 million infants born each year worldwide, 8 million die before reaching their first birthday predominantly due to preterm birth 5. Prevention (of preterm delivery), in this instance, is by far better than our current “cures” of the consequences.

Preterm labour (PTL) is the most important cause of preterm delivery. Its management is still suboptimal, with prophylactic progesterone reducing the risk of PTL by 40% and acute interventions usually giving sufficient time for steroid administration, but neither intervention has yet been proven to improve neonatal outcome 6. This lack of success in the management of PTL reflects our limited understanding of the mechanisms involved and until these are elucidated it is unlikely that we will be able to significantly reduce the burden of premature birth.

Three types of factors may contribute to spontaneous preterm birth: social stress and race, infection and inflammation, and genetics 7. Current concepts of PTL implicate infection and inflammation as the main causative factors.

Reduction of interval between uterine contractions was considered as one of the most useful criteria to establish the onset of labour8. The question of what triggers the change in state of the myometrium from quiescence to contractile is key to the

Chapter 1. Introduction

understanding of the onset of preterm and term labour. Thus, I focussed on myometrium in this thesis.

1.2 Inflammatory cell infiltration

Labour is characterized by an influx of inflammatory cells into the myometrium and cervix 9-13. Cervical ripening, which usually precedes the onset of labour, has been compared to an inflammatory reaction and is characterized by an accumulation of leukocytes in the cervical stroma 14; unlike myometrium, this effect only occurs prior to the onset of labour at term and no more of infiltrated cells were found during labour. The inflammatory infiltration of the cervix consists predominantly of neutrophils and macrophages 9. Similar inflammatory cells infiltrate the placenta, maternal decidua and the fetal membranes during parturition, and may play a role in spontaneous rupture of the membranes either during or prior to the onset of labour 15,16. In myometrium, inflammatory leukocytes selectively invade by following homing (chemokines) signals and then release cytokines, which stimulate the expression of myometrial PGs, more chemokines and other labour related factors. The inflammatory infiltration is more intense in lower segment myometrium 17. However, the function of these leukocytes remains unclear. It is known that they were from the local circulation and were recruited by chemotactic process during labour and induced the rupture of fetal membranes 11,18,19. Interestingly, circulating leukocyte concentrations have been suggested to predict pregnancy outcome in the first trimester and to be a marker of cervical dilation in later pregnancy 20,21.

1.2.1 T cells

The human T cell is one of the most important subpopulations of leukocytes in pregnant uterus 22-24. There are only 6-30% of the decidual T cells that will eventually take up residence presenting during the transformation of the endometrium in the first trimester of human pregnancy25-27. This low number of T cells in early pregnancy suggests that T cells may not be critical in the early events of human pregnancy 28. However, T cells are reported to be increased in the uterus at term 17, 45-50% of them were CD3+ cells and express cell markers such as CD25, CD69 and HLA-DR that

Chapter 1. Introduction

indicated activation and suggests they may play a role of maintenance of pregnancy 27,29. Other studies showed that there is an increase in regulatory uterine T cells (Treg) induced by pregnancy and the cell surface markers indicate that they are activated. These cells were suggested to be involved in the protection of fetus from the maternal immune attack in the maternal-fetal interface 30-32. T cells in the choriodecidua are γδ T cells, a subtype of T cells that act as a professional antigen－presenting cells (APC) by processing antigens and presenting such antigens to αβ T cells. These cells were presented at term and significantly increased during labour 33,34. Furthermore, γδ T cells could also act as αβ T cells and secret cytokines and lyse target cells. These features indicate that γδ T cells may play important role in the initiation of adaptive immune responses and uterine remodelling 35,36.

Chemokines CCL5, CXCL9, CXCL10 and CXCL11 are responsible for the recruitment of T cells 37-39. Recently, I have shown that myometrial CCL5 is up-regulated in human term labour 40.

1.2.2 Monocytes/Macrophages

Monocytes have multiple functions in immune system, such as replenishing residential macrophages and dendritic cells. In respond to inflammatory signals, monocytes migrate to sites of inflammation and divide/differentiate into macrophages and dendritic cells 41. They stimulate the activation and differentiation of other leukocytes subpopulations 42.

In human parturition, macrophages and other leukocytes appear in the early phase of pregnancy and increase at the onset of labour 17. Macrophages are found in the endometrial stroma as well. Since they produced a variety of factors, including prostaglandins and cytokines, macrophages were suggested to contribute to contractile activity 43,44. These cells may be the source of MMP-9, an enzyme that plays an important role in the rupture of fetal membrane 45-47. Decidual macrophages are the give rise to the CD45+ cells and 10% of the decidual leukocytes 48-50. Their

Chapter 1. Introduction

secretory products such as IL-6, IL-1 and CXCL8 regulate the development and activation of human monocytes/macrophages 51,52.

The recruitment of monocytes/macrophages depend on the concentration of local chemokines, such as CCL2, which have been shown to up-regulated during labour 40. Monocytes in fetal membrane were shown to respond to chemokines such as CCL2 and CCL3 and their activity increased during labour 18. Fetus-derived trophoblasts attract monocytes by expressing CXCL16, which interacts with CXCR6 on decidual cells, which leads to the fetal-maternal immune activity 53.

Macrophages were found to be the major cell type of leukocytes in mouse uterus 54. In mouse parturition, macrophage numbers in the uterus were inversely related to those in the cervix. In myometrium, total macrophage numbers were increased on Day 15 of mouse pregnancy when compare to those in non-pregnant controls, then declined before birth, and increased postpartum. Uterine macrophages were clustered in stromal connective tissue and, they appeared to surround the muscle bundles near term and postpartum. Cervical macrophage numbers are reported to peak on Day 18, then to decline to non-pregnant levels by the day after birth; they are localized to the subepithelium, often perivascular or near ganglia 43.

These findings suggest that macrophages and their products may be more important in the process of cervical remodeling than in uterine contractility during mouse pregnancy and parturition.

1.2.3 Dendritic cells

During pregnancy, several mechanisms are involved in the maintenance of maternal tolerance of the fetus. Medawar considered three mechanisms, 1) anatomic separation of fetus and mother, 2) antigenic immaturity of the fetus, and 3) immunologic tolerance of the mother. The maternal balance between active immunity and tolerance at the fetomaternal interface is of crucial importance.

Chapter 1. Introduction

Natural killer (NK) cells and antigen-presenting cells (APCs) are the predominant populations of immune cells that gain access to the maternal-fetal interface in both mice and humans 55. APCs are specifically equipped to initiate and maintain immune responses. Special attention has been paid to dendritic cells (DCs) due to their immunological importance and their migratory properties. DCs are found in almost all peripheral tissues, including the pregnant uterus of mice and humans, as well as in primary and secondary lymphoid organs. DCs are not only essential for the induction of primary immune responses but may also be important for the induction of immunological tolerance as well as for the regulation of some type of T-cell-mediated immune responses 56. The maturity of DCs seems to influence their immunological function, so that immature DCs contribute to the induction of tolerance, whereas mature DCs influence the generation of pro-inflammatory responses 57. Immunostimulatory mature DCs have been found in decidual tissue early in human pregnancy, where they may contribute to the development of tolerance to the conceptus 58 and they are suggested to play a similar role in mouse pregnancy. However, uterine DCs may also promote immune tolerance of the pregnancy by producing IL-10, an inhibitor of the immune response 59.

1.2.4 NK cells

NK cells are an important cell population, which may determine early placental growth and development. They make up 70% of decidual leukocytes (70%) during first trimester, but decrease to 3% at term 25,60,61. The possible roles of these NK cells include control of uterine vascular remodelling and extravillous trophoblast invasion while providing local antiviral activity 62. It is suggested that there are two potential origins of decidual NK cells, either developing locally in the decidua from a hematopoietic precursor or from mature peripheral blood NK cells 63. Decidual NK cells express TGF-β and IL-10 in normal pregnancy suggesting a role in immune tolerance. They also express IFN-γ and kill extravillous trophoblasts in miscarriage tissue 64.

Chapter 1. Introduction

1.2.5 Mast cells

In human reproductive system, mast cells are found in high density in myometrium, endometrium and cervix, especially near the blood and lymph vessels and nerves 65-67. However, there was no change of myometrial mast cell density before and after the onset of labour at term 17. In mouse pregnant uterus, on the contrary, the density of mast cells were shown to constantly increase with the gestational age starting from the second half of pregnancy and peaked at term 68. It is suggested that the presence of mast cells in the uterus is to maintain the quiescence of the myometrium during pregnancy 69.

Some of the mast cells have cell-bound IgE and membrane-bound electron granules, which contain histamine 68,70. In the bovine, the degranulation of mast cells produce tryptase and other protease 71. In general, mast cells express three types of mediators including 5-HT, which has been shown to be involved in cervical ripening 72; prostaglandins and COX-1, 2, which may induce uterine contractions; and cytokines such as TNFα and chemokines which attract other leukocytes into myometrium 73,74. The activation of mast cells is regulated by endocrine system. For example, estrogens potentiate mast cells degranulation and histamine release 75. The density of mast cells also changes in pathological conditions of human parturition. In pre-eclampsia, mast cells are increased, whereas in intrauterine growth retardation, the mast cell density is lower 76,77.

Nine chemokine receptors are found to present on the surface of mast cells, including CXCR1, CXCR2, CCR1, CCR3 and CCR4. Chemokines, which interact with these receptors, are responsible for the recruitment of mast cell 78.

Although there is a lack of change in mast cell numbers in human labour, these data suggest that the mediators produced by mast cells can influence labour promoting uterine contractility and increasing the inflammatory infiltration 68,79,80.

Chapter 1. Introduction

1.2.6 Granulocytes

Granulocytes are a type of white blood cells that present granules in their cytoplasm. There are three types of them, neutrophils, eosinophils and basophils. They are a major source of inflammatory mediators including plasminogen activators, collagenase, elastase, and pro-inflammatory cytokines such as IL-1β and TNFα in human labour 81,82. Granulocytes are present in the uterus throughout pregnancy and their density, especially neutrophils, increase at term 17,83. Granulocytes were suggested to be involved in different events of parturition, and being the major subpopulation of leukocytes that infiltrated into choriodecidua during labour at term 84. In human, collagenase-containing neutrophils infiltrated into cervix before the onset of labour, which might be associated with the increase of collagenolytic activity, that induces cervical ripening. Furthermore, the density of neutrophils was parallel with the process of cervical dilation 14,82,85. Uterine neutrophils also can produce MMP-9, which may contribute to the placental abruption and premature membrane rupture 86,87. Neutrophils and basophils were found to be increased in myometrium at term and during labour in both upper and lower segment of myometrium, which suggest they have important roles in human parturition 17. In mice, neutrophils and macrophages infiltrate into cervix before the onset of labour and are probably involved in the process of cervical remodelling 88.

CXCL2, CXCL3 and CXCL8 are the three chemokines that regulate the density of granulocytes in human reproductive tissues 89,90. CXCL8, which is associated with the influx of neutrophils, is up regulated during labour in human myometrium 40, while in the fetal membranes, the expression of the CXCL8 receptors, CXCR1 and CXCR2, is increased during labour 84.

1.2.7 B cells

The density of B cells only change during antigenic challenges such as intrauterine infection, when germinal centers form 91. Unlike other leukocyte subtypes, there is no change of B cell numbers in the myometrium with the onset of labour 17. However, an increase of B cells could be found in human peripheral blood in preterm labour 92.

Chapter 1. Introduction

The recruitment of B cells depends on the level of CXCL13, a chemokine that attracts both T cell and B cells. There is no change of CXCL13 during labour. But the level of CXCL13 increased dramatically in amniotic fluid during intra-amniotic infection 93. In that clinical scenario, B cells were suggested to “cooperated” with other leukocytes to promote the onset of labour 42.

1.3 Cytokines in human parturition

Activated inflammatory cells, such as neutrophils and macrophages are a rich source of inflammatory mediators, which include inflammatory cytokines and chemokines. Cytokines are secreted proteins with growth, differentiation and activation functions that regulate and determine the nature of immune responses and control immune cell trafficking and the cellular arrangement of immune organs. Cytokines are known to play a pivotal role in human reproduction, being involved in ovulation, implantation, placentation and parturition 94. Several studies have highlighted the association between elevated cytokine expression and preterm delivery, with increased levels in maternal serum, amniotic fluid and placenta 95-98.

1.3.1 Pro-inflammatory cytokines

Pro-inflammatory cytokines IL-1β, IL-6 and TNFα are considered to be biomarkers of preterm delivery 99. IL-1β is a cytokine produced by activated macrophages, it plays an important role in inflammatory process 100, stimulating T cell and macrophages to secrete IL-6. Interestingly, IL-6 promotes smooth muscle contractility directly 101,102. Comparing term labour with preterm labour, IL-1β and IL-6 mRNA expression was greater in term myometrium. There was no difference in TNFα mRNA expression 103. The expression of myometrial IL-1β and IL-6 mRNA is increased in labouring women as compared to non-labour controls 103. IL-1β, IL-6 and TNFα staining is weakly localized to myometrial cells and is much greater in leukocytes. The density is greatest in samples obtained during term labour 104.

The fetal membrane production of IL-1β and IL-6 is greater in preterm labour and the expression of all three cytokines is up-regulated with chorioamnionitis 90. In women

Chapter 1. Introduction

with premature rupture of the membranes (PROM) or intraamniotic infection (IAI), the amniotic fluid and fetal membrane levels of IL-1, IL-1β, IL-6 and TNFα are elevated 105,106. In a mouse model of preterm labour, LPS increased the fetal membrane expression of IL-1β, IL-6 and TNFα 107. Inflammatory cytokines increase the production of prostaglandins and other factors that lead to cervical ripening and uterine contraction. In addition, fetal membrane cytokines play an important role in the pathway of cells apoptosis, which leads to PROM.

TNFα is secreted by macrophages, as well as other leukocytes. The main role of TNFα is to regulate immune cell function and to promote inflammation acting through its two receptors, TNF-R1 and 2 108,109. These two receptors may activate different pathways, which cause different actions when engaged with TNFα110. When binding to TNFR1, TNFα activates caspase by activating the two death domaines. On the other hand, TNFα activates TRAF2 via TNFR2, which is an anti-apoptotic, but pro- inflammatory factor. TRAF2 activates NF-κB, which increases local inflammation and prostaglandins concentrations leading to preterm labour 111 (Figure 1.1). Other studies suggested that NF-κB activation induces MMP expression and promotes apoptosis 112.

396 Menon & Fortunato, Fetal membrane inflammatory cytokines

Table 4 Expression of Fas-FasL mediated apoptotic pathway conditions. As discussed earlier in this review, all of these genes during PROM and PTL. cytokines induce prostaglandin production from the placental tissues, resulting in contractions. This leads us to FAS Fas L Caspase 8 FADD TRADD GAPDH theorize that one or more of these cytokines may act as PROM HIH HH H a switch between the pathways that lead to PTL vs. PTL " II H" H PROM. Cytokines may increase MMP activity or accel- " – Expression seen in at least 50% of the tissues. erate apoptosis, each of which is associated with PROM GAPDH – House keeping gene. (Table 4). In an attempt to identify the factors that determine Table 5a Cytokine induction of MMP activity. which pathway is followed (i.e. PTL vs. PROM) we exam- ined the ability of inflammatory cytokines to induce MMP Gene Expression IL-1 IL-6 TNF Control activation, induction of mRNA for pro-apoptotic factors MMP2 HHHH and the presence of apoptosis after cytokine stimulation. MMP9 HHHy The studies were conducted in vitro using amniochorion *MMP2 Specific activity HHHH collected from women undergoing elective repeat c-sec- *MMP9 Specific activity yyH y tion at term with no documented pregnancy related Documented by zymogram analysis using gelatin substrate. complications. These membranes were exposed to concentrations of IL-1, IL-6 and TNF-a seen in the amniotic Table 5b MMP and Caspase activity in cytokine-stimulated amniochorion compared to unstimulated controls. fluid of women with intraamniotic infection and the tissue MMP and apoptotic response was evaluated w54, 55x. Activity Assay IL-1 IL-6 TNF The results are summarized in Table 5a and 5b. IL-1b and TNF may direct the events that promote PROM over PTL. MMP2 lllTNF can activate MMPs, while both IL-1b and TNF can MMP9 ll≠ activate apoptosis, both of which are commonly asso- Caspase 2 ≠ l ≠ ciated with PROM. Conversely, IL-6 is neither an acti- Caspase 3 ≠ l ≠ Caspase 8 ≠ l ≠ vator of MMPs nor an inducer of apoptosis. We propose Caspase 9 ≠ l ≠ that during intraamniotic infection, the outcome will be TUNEL positive cells* 55% 25% 80% determined based on the concentration of the individual *Unstimulated control membranes showed ;15% TUNEL pos- cytokines in the amniotic fluid. IL-6 seems to have a

itive cells. Chapter 1. Introduction higher concentration (in the microgram range) compared l No change. to the other two (picogram range). Additionally, as a prostaglandin stimulant IL-6 may lead to preterm labor and not directly promote PROM w11x.

TNF as a switching mechanism in PTL, PROM pathways

Multiple factors may be involved in TNF mediated MMP and apoptosis activation as opposed to TNF mediated prostaglandin production. The concentration of bioactive TNF, the availability of TNF receptors (namely TNFR1 and TNFR2) and TNF’s affinity for binding to these receptors all may play a role. The different TNFR signaling pathways engender different actions by TNF-a. TNFR1 is mainly involved in MMP9 activation w42x. Signaling of FigureFigure 1.1 The potential 3 The role potential of TNFα in PROM role and of preterm TNF receptorslabour. (TNFRI and TNFRII) in fetal membrane apoptosis and inflammation. See text TNF through TNFR1 and TNF receptor associated death Adapted from Ramkumar Menon and Stephen J. Fortunato. Fetal membrane inflammatory cytokines: a for details w3, 6, 19, 42x. domain (TRADD) activates transactivator nuclear factor switching mechanism between the preterm premature rupture of the membranes and preterm labor pathways.kappa-B (Nf-kB) (see Figure 1). This activation promotes J. Perinat.pathways Med. 32 (2004) that 391 lead–399 to PTL and PROM, we have identified apoptosis, induces MMP expression and increase inflam- three major elements that should be considered as fac- mation leading to PROM. TNF binding to TNFR2 can also Pro-torsinflammatory cytokines are present in the placenta throughout normal gestation in determining the outcome and they are: inflam- activate Nf-kB, however, it does not interact with TRADD, matory cytokines, increased matrix metalloproteinase instead the TNF-TNFR2 complex directly recruits TNF and their levels increases in the presence of infection and inflammation. Besides their (MMP) activity and apoptosis. MMP activity and apop- receptor associated factor-2 (TRAF2) which is anti-apop- ability to induce apoptosis, which occurs in both early and late gestation, the tosis are most strongly associated with PROM, whereas totic but pro-inflammatory w3, 6, 42x. If TNF binds to cytokines inflammatory keep the balance cytokines between are placental increased growth in and both apoptosis of these and are also TNFR2, this can lead to increased prostaglandin produc- involved in the regulation of hormone secretion 113,114. The secretion of hCG, one of the major polypeptides produced by placenta, is stimulated by both IL-1β and TNFα indirectly 115,116, via an increase in IL-6 and the activation of IL-6 receptor system 117. IL-1β also increases the placental production of CRH and ATCH 118. In this case, the effect of IL-1β is mediated via an increase in prostaglandin synthesis 119.

Several cytokines, including IL-1β, IL-6 and TNFα are present in the amniotic fluid during the third trimester and increase with the onset of labour. The concentrations correlate with the number of granulocytes present in the placenta 15,120,121.

Chapter 1. Introduction

Cytokines also contribute to cervical ripening and the concentrations of cytokines in cervicovaginal secretion are elevated during spontaneous labour at term and, peak at the time of full cervical dilation 122.

1.3.2 Anti-inflammatory cytokines

In addition to pro-inflammatory cytokines, gestational tissues also produce some of the anti-inflammatory cytokines, such as IL-10 and IL-4 123,124. Choriodecidua IL-10 levels are increased in response to LPS, IL-1β or TNFα treatment 125,126. As an anti- inflammatory cytokine, the administration of IL-10 delayed the LPS induced preterm labour in rats 127. A fall in the expression of anti-inflammatory cytokines may facilitate the inflammatory process that is suggested to lead to preterm labour and it is reported that placental IL-10 levels are decreased prior to the onset of labour and remain low throughout labour 128,129. In some in vitro studies, IL-10 inhibited the production of pro-inflammatory cytokines and prostaglandins by the amnion and choriodecidua 130. Another anti-inflammatory cytokine, IL-4, reduced the production of prostaglandins in decidual cells and increased the level of IL-1RA 131. Both IL-10 and IL-4 showed no change in amniotic fluid before or after labour 126. However, these two cytokines were reported to exert inflammatory effects in gestational tissues

132,133 . For example, IL-10 up-regulated PGE2 and IL-6 expression in amnion explants. This led to the hypothesis that the withdrawal or reversal of anti-inflammatory cytokines might be required for the onset of labour 129.

In general, labour is associated with an increase of pro-inflammatory cytokines, which stimulate the secretion of PGs, which in turn induces a series of changes such as cervical ripening or membrane rupture leading to the onset of labour. However, this effect can be inhibited by anti-inflammatory cytokines, such as IL-10 and IL-4 (Figure 1.2) 134.

Chapter 1. Introduction

Keelan et al.: Cytokines, Prostaglandins and Parturition S39

Figure 3. Cytokine-prostaglandin interactions. Proinflammatory cytokines such as TNF-! act in a coordinated fashion to up-regulate prostanoid biosynthesis and down-regulate metabolism. Effects on expression and activity of isomerases and PG receptors in gestational tissues are, as yet, unknown. Figure modified and redrawn from Hansen et al. (Key enzymes of prostaglandin biosynthesis and metabolism. Coordinate regulation of expression by cytokines in gestational tissues: a review.Figure Prostaglandins 1.2 Interactions Other Lipid Mediators, between 57, 243–57,cytokines 1999, withand permission prostaglandins. from Elsevier Science).

Adopted from Hansen WR, Keelan JA, Skinner SJ, Mitchell MD. Key enzymes of prostaglandin biosynthesis part in cytokine signalling in the process of labour than is tissues has been the subject of intensive investigation (Kniss, currentlyand metabolism. thought and this Coordinate process may regul well beation controlled of expression by 1999 ). by It has cytokines become dogma in gestational that cytokines tissues: regulate a prosta- review. SOCSProstaglandins proteins. Other Lipid Mediat. 1999 Jun;57(4):243glandin-57. production and that this is an important aspect of parturition (Hansen et al., 1999); cytokines such as TNF-! and IL-1" have been shown by numerous studies to act in a CYTOKINE1.4 Chemokines and chemokine receptors in human labour REGULATION OF INTRAUTERINE coordinated fashion at multiple points of the prostanoid PROSTAGLANDIN PRODUCTION biosynthetic pathway (Figure 3). Production of prostaglandins by cells from the amnion (Romero et al., 1989; Bry and Regulation1.4.1 Chemokine of arachidonic acid metabolism in the gestational Hallman, 1992), chorion (Lundin-Schiller and Mitchell, 1991), membranes is believed to be key to the maintenance of decidua (Mitchell, Edwin and Romero, 1990), and myo- pregnancy and the initiation and progression of labour in metrium (Hertelendy et al., 1993; Pollard and Mitchell,135 1996) women.Chemokines play an important role in leukocyt Extensive studies over many decades have charted is enhancede recruitment and activation by IL-1" and TNF-!, at least in part through. They changes in prostanoid levels and prostanoid production rates in increased expression of prostaglandin H synthase (PGHS)-2 intrauterineare a large family of small chemotacti tissues prior to and during labour (Mitchell et al.,c cytokines (8(Hansen et al., 1999-10 KD). Chemokines have rapid ; Kniss, 1999; Rauk and Chiao, 2000). The 1995; Olson, Mijovic and Sadowsky, 1995). Biosynthetic stimulatory eﬀects of LPS on choriodecidual PG production is capacitylocal for biological prostaglandins, actions especially and of act amnion-derived through specific predominantly G protein dependent-coupled upon local receptors. TNF-! release More and PGEthan 2, increases 50 in chemokines women with term have or preterm been labour identified; (Gibb, action they (Sato, Keelan are divided and Mitchell, into 2003). four IL-6 (albeit structural at high 1998). More recent focus has been on the changes in expres- doses) has also been shown to stimulate prostaglandin produc- sionsubclasses based on their amino of the two isoforms of PGHS and their respective-terminal cystein roles in tion by thee motif, designated CC, C, CXC and amnion and decidua (Mitchell et al., 1991), while the biosynthesis of prostanoids in parturition (Teixeira et al., the chemokine macrophage inhibitory protein (MIP)-1! 1994CX3C chemokines. ; Slater et al., 1995; MijovicThe chemokines are known as CC or β et al., 1998). Similarly, the stimulates amnion and- chorionchemokines if the first two cell prostaglandin production upregulation of PGHS-2 expression by cytokines in gestational (Dudley, Edwin and Mitchell, 1996). The important cysteines are adjacent to each other. Chemokine agonists that have an intervening amino acid between the first two cysteines are sub classified as CXC or α-chemokines.

Chapter 1. Introduction

Another subfamily, the CX3C or the γ -chemokine, possesses only one protein in its category and is defined by three intervening residues between the first two cysteines. In C or δ-chemokine, the polypeptide has only two of the four cysteines 136.

There is a considerable redundancy between the chemokines, largely because of the limited number of chemokine receptors as compared with chemokine ligands, leading to promiscuous ligand–receptor binding. A simple nomenclature system was recently devised for chemokines and their receptors, which had previously been named based on their first identified functions137. Chemokines can be divided into two types, inflammatory and homeostatic chemokines. Inflammatory chemokines are expressed in inflamed tissues and are critical for attracting leukocytes, whereas homeostatic chemokines maintain physiological traffic and immune surveillance by leukocytes 138.

1.4.2 Chemokine receptor

Leukocytes migrate to sites of inflammation in response to chemokines 139, which act through seven-transmembrane domain G protein-coupled receptors termed chemokine receptors. Seven CXC (CXCR1–7), 10 CCR (CCR1–10), 1 CX3CR (CX3CR1), and 1 CR (XCR1) chemokine receptor have been identified 140. CC chemokines mainly interact with lymphocytes, macrophages, and monocytes 141. Neutrophils express only a very limited number of chemokine receptors 142-144, predominantly receptors

145 of the CXC or CX3C family, in particular CXCR1 and CXCR2 and consequently, with the exception of CXCR1/CXCR2 ligands, the majority of chemokines have no functional effect on human neutrophils 146. It is not yet known which chemokine receptor interactions trigger which corresponding intracellular pathway. It is suggested that when bound by the same chemokine different receptors may elicit distinct functional responses. For example, CXCR1 and CXCR2 mediate changes in Ca+2, release of granule enzymes and chemotaxis when bound by CXCL-8. However, CXCR1 also specifically activates phospholipase D 147,148.

1.4.3 Function of chemokine/chemokine receptor

The major function of chemokines is to act as chemoattractants to guide the migration of cells. Cells that are attracted by chemokines follow a signal of increasing

Chapter 1. Introduction

chemokine concentration towards the source of the chemokine. Recent experimental evidence suggests that the process of chemotaxis is dependent not only on a chemokine concentration gradient but also on the presence and activity of multiple proteolytic enzymes. MMPs were shown to affect chemotaxis of inflammatory cells through multiple mechanisms. In an asthma mouse model, S100A8, which is a homologous myeloid-related protein that induced the chemotaxis and adhesion of neutrophils, was found to be cleaved by MMP2 and to lose some of its chemotactic activity 149. The activity of chemokines is initiated when binding to a specific G- protein receptor. The well-known function of chemokines and their receptors is to develop and respond to the immune system. However, they are found to have broader roles. In animal models, the fetus of mothers deficient in CXCL12 or its receptor CXCR4, developed cerebellar, cardiac septum and B cell lymphopoesis abnormalities and died in utero or at birth 150,151.

In general, chemokine/chemokine receptors regulate inflammatory cell infiltration. They act as messengers of adaptive immunity 152. For example, mice lacking CCR7 or its ligand CCL21 and mice lacking CXCR5 have defects in the entry and positioning of T-lymphocytes and B-lymphocytes in secondary lymphoid organs 153,154. Several chemokines are involved in both B and T cell maturation at different stages of development 155-157. The chemokine systems involved in B cell maturation include CXCL12/CXCR4, CXCL13, and CCL20 151,158. CCL2, CCL3 and the receptors CCR2 and CCR5 have been observed to regulate T-cell maturation 155. CCL5 activates monocytes, T lymphocytes, basophils, and eosinophils. It participates in the adhesion and transmigration of T cells to the endothelium and is produced by T cells, macrophages, endothelial cells, and gestational tissues 159.

The migration of dendritic cells (DCs) to tissues and lymph nodes is central to immunity and surveillance by the immune system. There are several receptors on the dendritic cell surface including CCR1, CCR2, CCR5, CCR6, CCR7, and CXCR2. The chemokines that bind these receptors regulate the migration of monocytes and immature dendritic cells 160-162. Chemokine receptor expression is regulated on these DCs. Inflammatory chemokines promote recruitment and localization of DCs to sites

Chapter 1. Introduction

of inflammation and infection. When expose to maturation signals, DCs undergo a chemokine receptor switch, with down regulation of inflammatory chemokine receptors followed by the induction of CCR7, which drives immature DCs to leave tissues and to localize in lymphoid organs where antigen presentation takes place 162,163.

Chemokine biology is intrinsically linked to the activities of other cytokines. An example of how chemokines modulate the immune response is evident from the function of CCL2 on T helper cell polarization 164. In response to challenges to the host, type 1 and type 2 T helper (TH1 and TH2) cells secrete cytokines that enhance cell-mediated and humoral immunity, respectively. However, CCL2 deficient mice are unable to mount TH2 responses and thus synthesize extremely low levels of IL-4, IL- 5, and IL-10. Since wild type mice are normally susceptible to Leishmania major owing to the TH2 response, CCL2 deficient mice, which can only mount a TH1 response, are far more resistant to Leishmania major infection.

1.4.4 Chemokines/chemokine receptors in human reproductive system

Prior to and during labour it is likely that specific subsets of pro-inflammatory chemokines direct uterine and cervical leukocyte homing and control their behaviour on arrival. In the mouse, the expression of CCL2 is significantly increased by IL-1β. It also markedly increased after intrauterine LPS while TLR4 expression did not significantly change, which indicates that CCL2 potentially plays an important role during the pro-inflammatory immune response, leading to preterm labour 165. In rats, level of CCL2 increased with advancing gestational age. Furthermore, administration of P4 receptor antagonist RU486 induced an increase in CCL2 mRNA, whereas maintenance of elevated P4 levels as late gestation cause a significant decrease in gene expression 166. The Nelson group recent found in a gene array on labouring human myometrium samples that CXC chemokines CXCL1, CXCL2, CXCL3, CXCL5 and CXCL8; CC chemokines CCL2 and CCL20 are up regulated in term labouring myometrium 167. In addition, I included CCL5 in this study since other studies showed that the concentration of CCL5, and also CXCL8, were increased in amniotic fluid with the gestational age and further with the spontaneous onset of labour 170,171. I chose to

Chapter 1. Introduction

study the receptors of these chemokines, CXCR1 and CXCR2 for CXCL5 and CXCL8, CCR2 for CCL2 and CCR6 for CCL20.

There is evidence that fetal membrane chemokine levels, including CCL13, CCL19, CCL21, are increased at the end of pregnancy, while others, CXCL10, CCL2, CCL8, CCL3 and CCL13, increase with the onset of labour. Fetal membranes obtained from women undergoing spontaneous labour induced a stronger chemotaxis to leukocytes than none labour samples. Furthermore, chemotaxis from labouring samples was selective to monocytes and T lymphocytes 18. CCL2 levels are also increased in amniotic fluid of women experiencing term and preterm delivery 168,169. Similarly, choriodecidual CXCL8 levels are increased in term labour 172. CXCL8 is also thought to have a role in PPROM as women who present with PPROM have higher levels of CXCL8 173. Interestingly, women destined to undergo PPROM have higher levels of CXCL8 in early pregnancy than in late pregnancy, which suggests that different mechanisms are responsible for PROM at different gestations 174.

The human cervix produces large amounts of CXCL8 and this is regulated by steroid hormones 52. CXCL8 was first described as a potent chemotactic and neutrophil- activating factor in 1980s 175. Cervical CXCL8 increases progressively during labour without infection as the cervix dilates 176. It is believed that neutrophils which infiltrate into the cervical stroma and the lower segment myometrium contribute to in the production of MMPs that play a central role in cervical dilation 177.

Chemokine receptors are expressed in uterus 178, where they play an important role in the physiology and pathology of the human reproductive system. CCR5 is present in human endometrium throughout the menstrual cycle and the expression of CXCR1 was found to reach a peak at the midsecretory phase 179. In leiomyoma, the chemokine receptor CCR3 was increased in the myometrium of patients with submucosal fibroids 178 and CXCR2, CXCR3 and CXCR4 were increased in human endometriosis samples 180 which may indicate a role in this condition.

Chapter 1. Introduction

Among all the chemokine/chemokine receptors, CCL20/CCR6 plays a major role in inducing migration of DCs, T and B cells181. In human parturition, CCL20 is found in amniotic fluid and its concentration increases as term approaches. Spontaneous labour (term and preterm) is associated with increased bioavailability of amniotic fluid CCL20 suggesting that an increase in CCL20 may be part of the common pathway of human parturition182. Patients who had intra-amniotic infection also had a dramatically elevated level of CCL20182. However, research on the role of DCs in human myometrium is limited.

Despite their role in the induction of inflammation, chemokine receptors have been shown to act as decoys, so regulating the activity of their ligands. Some specific non- signalling decoy receptors have been shown to be expressed in fetal-maternal interface and their dysregulation was suggested to result in fetal loss183,184. In addition, signalling receptors such as CCR1, CCR2 and CCR5 can act as decoys under specific circumstances185. However, currently it is not known how myometrial chemokine receptor expression changes through pregnancy and with the onset of labour.

1.4.5 Regulations of chemokine/chemokine receptor

It is well known that cytokines can induce the expression of chemokines. In rat myocardial cells, treatment with TNFα induced CXCL5 expression, which suggested that the increase of chemokines being a down-stream effect of inflammatory cytokines. This effect was via activated NF-κB 186,187. In human astrocytes, cytokines IL-1β and TNFα increase the expression of chemokines CXCL8, CXCL10, CXCL9, CCL2 and CCL5. However, IFN-γ only increased CXCL9 and CXCL10 188. IL-6 had very little effect on these cells 189. In myometrium, the expression of chemokines is up regulated by IL-1β and TNFα at both the mRNA and protein level. IL-1β also enhanced the chemotactic effect of these chemokines 40.

Progesterone is a steroid hormone and plays essential roles in normal human physiology. It is one of the most important hormones in the development and maintenance of human pregnancy. In rodent models of pregnancy, labour is

Chapter 1. Introduction

associated with progesterone withdraw 190. As in the human, circulating progesterone levels do not decrease, the hypothesis that there is either a decline in local levels or a functional withdrawal of progesterone action in labour was proposed. There are several potential mechanisms which may be involved: changes in the number, affinity or distribution of progesterone receptors; production of an antiprogestin, which prevent the physiological action of progesterone; inactivation of progesterone in the target tissue before receptor interaction either by a change in local synthesis, metabolism or sequestration by a binding protein 191. Progesterone is known to have anti-inflammatory functions; it suppresses the expression of chemokines, such as CXCL8 192. Progesterone also decreased the level of CCL5 and CXCL12 and, reduced the densities of CCR5 and CXCR4 193-195. Further, progesterone reduced the migration of mast cells toward the chemokine CXCL12 by decreasing its receptor CXCR4 expression and reduces the calcium response to chemokines and Akt phosphorylation 196.

The activation of the myometrium, the switch from a state of relative quiescence during pregnancy to one of increased contractility associated with labour, involves increased sensitivity to endogenous uterotonins and results from the coordinated expression of ‘contraction-associated proteins’ (CAPs), including actin, myosin, connexin-43, and the receptors for oxytocin and prostaglandins. In both the human and rat, a significant increase in myometrial prostaglandin F2α receptor mRNA expression is associated with labour at term and myometrial oxytocin receptor density increases markedly before parturition. PGF2a values were increased only at the time of term birth, but PGE2 was elevated during both preterm and term labour 197.

During pregnancy, the uterus is under constant stretch through the growth of the pregnancy (fetus, placenta and amniotic fluid). Other conditions, such as multiple pregnancy, polyhydramnios, or uterine abnormalities result in relative or absolute uterine overdistension 198. Studies suggest that uterine distension is a major drive to uterine contractility 199. The numbers of multiple gestations, arising from the use of assisted reproductive technologies or simply because the average maternal age is

Chapter 1. Introduction

increasing, are associated with a 56% risk of delivery before 37 weeks and a 10-15% risk of delivery before 32 weeks of gestation 200. The uterus begins to contract when the ability of the uterus to accommodate the change in volume, through hyperplasia and hypotrophy, is exceeded and uterine wall tension begins to rise. The level of CXCL8 and the activity of collagenase in fetal membrane is elevated when the membranes are stretched 198. Similarly, when amnion and myometrial cells are stretched in vitro, the synthesis of prostaglandins is increased, which down regulate the expression of chemokines 201,202. Mechanical stretch on rat myometrium smooth muscle cells induced a release of CCL2 protein and enhanced the monocyte chemoattractant activity of CCL2 166.

1.5 Signaling pathways involved in human labour

1.5.1 Nuclear factor kappa B

NF-κB is a protein complex that controls the transcription of DNA. NF-κB family comprise five members, including NF-κB1 (P105/p50), NF-κB2 (P100/p52), p65 (Rel A), c-Rel and Rel B 203. One of the NF-κB pathways is called canonical pathway, which is triggered, by LPS and pro-inflammatory cytokines, such as TNFα and IL-1β. This effect involves IκB kinase (IKK)-mediated phosphorylation IκBα 204. IκK-dependent phosphorylation targets IκBα for degradation by the proteasome. Once IκBα is degraded, p65 is phosphorylated and the NF-κB nuclear localization signals are unmasked, allowing the p50/p65 dimer to translocate to the nucleus where it binds to NF-κB response factors in the promoter of target genes. Degradation of p105 may simultaneously occur, which releases more NF-κB dimers, including p50/p65. The p105 precursor may also be processed in response to cytokines to generate additional p50 homodimers, which may take part in NF-κB DNA binding or be displaced from DNA by transactivating dimers. In the nucleus, further phosphorylation and acetylation modifications of NF-κB occur, promoting the recruitment of co-activators, such as CREB-binding protein to drive transcription. Termination of signaling occurs when newly synthesized IκBa displaces DNA-bound NF-κB and exports it back to the cytoplasm (Figure 1.3) 205-207.

Chapter 1. Introduction

572 T M Lindstro¨m and P R Bennett

Figure 3 Schematic model of the canonical NF-kB signalling pathway. Stimulation of the cell by tumour necrosis factor-a (TNFa), interleukin-1b (IL-1b) or lipopolysaccharide (LPS) leads to the degradation of the small IkB proteins (classically IkBa), by the IKK complex. IKK-dependent phosphorylationFigure targets 1.3 Schematic IkBa for ubiquitination model of (Ub) the and canonical degradation NF by- theκB proteasome. signaling Oncepathway. IkBa is degraded, p65 is phosphorylated (P) and the NF-kB nuclear localization signals are unmasked, allowing the p50/p65 dimer to translocate to the nucleus where it binds to NF-kB response elementsAdopted (kB) in the promoterfrom Tamsin of target M genes. Lindstrom Induction andof p105 Phillip degradation R Bennett, may simultaneously The role occur,of nuclear thereby factor releasing kappa further B NF- inkB human dimers, including p50/p65. The p105 precursor may also be processed in response to cytokines to generate additional p50 homodimers, which may take part in NF-labour.kB DNA Reproduc binding ortion be displaced (2005) from130 DNA569– by581 transactivating dimers. In the nucleus, further phosphorylation and acetylation (A) modiﬁcations of NF-kB occur, promoting the recruitment of co-activators, e.g. CREB-binding protein (CBP) to drive transcription. Termination of signalling occurs when newly synthesized IkBa displaces DNA-bound NF-kB and exports it back to the cytoplasm.

complexNF (Tanaka-κB plays et al. 1999, a key Rudolph role in et al.regulating 2000) and the degradation immune or response limited processing to infection of the protein 208. NF (Cohen-κB can involve the degradation of IkBa,IkBb and IkB1. The et al. 2004). Presumably processing of p105 will provide 209 p105 proteinpathways are important for the cytokine stimulated CCL2 may also play a role in the canonical path- solely p50 subunits whereas and CCL7 production degradation may release . It a k way. In addition to the constitutive, cotranslational proces- variety of NF- B subunits bound210 to the p105 ankyrin sing ofalso regulates the chemoattractants such as CCL2 and p105 (Lin et al. 1998), which provides the resting repeats. CXCL-8 . The production of cell withseveral pro the small amount-inflammatory cytokines, such as TNFα, IL of p50 required for its basal The non-canonical-1β, IL pathway-6, IL is-17 and IL activated in- response23, which to a needs (e.g. low-level transcription or repression of tran- subset of NF-kB inducers, such as lymphotoxin b, B-cell scription),are IKK-dependent all increased phosphorylation during and labour, ubiquitina- are NFactivating-κB-dependent factor, or the211 CD40-213. Promoters ligand, although of these these can tion of p105 may occur in response to pro-inﬂammatory also trigger the canonical pathway. In the non-canonical cytokinescytokines contain and LPS (HeissmeyerNFet- al.κB 1999,response elements, which are essential for transcription of Heissmeyer pathway, which is NEMO- and IKKb-independent (Clau- et al. 2001). Such inducible targeting of the p105 precur- dio et al. 2002, Dejardin et al. 2002), IKKa homodimers sor can result in two distinct processes, which employ dis- phosphorylate p100 associated with RelB. This elicits the tinct ubiquitin ligases: there may be either complete 21processing of p100 to p52 and releases transcriptionally

Reproduction (2005) 130 569–581 www.reproduction-online.org

Chapter 1. Introduction

CXCL8 gene in amnion and cervical cells 214. On the other hand, NF-κB is a highly inducible by pro-inflammatory stimuli. LPS, TNFα and IL-1β were shown to activate NF-κB in uterus 215-217. In IL-1β deficient mice, NF-κB activity decreased due to the decline of cytokine production when treated with LPS 218. Stretch also induces activation of NF-κB in amnion cells, but not myometrial cells 219.

Prostaglandins are involved in the process of labour, including cervical ripening, dilation and stimulating uterine contraction 220. The promoter of COX-2 contains two NF-κB binding sites. Blocking the nuclear translocation of NF-κB inhibits TNFα and IL-1β induced COX-2 expression in amnion and trophoblast cells 217,221.

In early pregnancy, the suppression of NF-κB activation by progesterone is important in maintaining the quiescence of the uterus 222. During labour, NF-κB activation is reported to occur in myometrium, cervix and amnion 223-225,226. Suggesting that NF-κB activation is a key part of the onset and progression of labour.

1.5.2 MAPK pathways

Mitogen-activated protein (MAP) kinases respond to extracellular stimuli (mitogens, heat shock and pro-inflammatory cytokines) and regulate cellular activations, which involve differentiation, gene expression, proliferation and apoptosis 227. Six groups of MAPKs have been defined in mammalian cells: extracellular signal-regulated kinases (ERK1 and ERK2), Jun N-terminal kinases (JNK), which are crucial in regulating responses to various stresses and apoptosis and p38 kinase isoforms, ERK5, ERK3/4 and ERK7/8. Among the targets of MAPKs are several transcription factors, including NF-κB, p53 and activating transcription factor 2 (ATF2) that modulate the expression of genes encoding pro-inflammatory cytokines 228. Hypertrophy induced by mechanical stretch of the rat uterus stimulates myometrial cell activate MAPK cascades 229,230. In rat myometrium, MAPKs are involved in inhibiting gap junction- mediated cellular communication and stretch-induced c-fos expression 231,232. In addition, the expression of MAPK p38 and ERK-1/2 in conjunction with ATF2 isoforms within the human uterine corpus during pregnancy and labor is likely to play a key role in preparation of the uterus for delivery 233.

Chapter 1. Introduction

In human myometrial cells, the MAPK pathways are also implicated in the induction of COX-2 expression and in mediating the effects of OT and corticotropin-releasing hormone (CRH) 202,234. CRH is a stress hormone, which has been suggested to play an important role in human parturition. The level of CRH increases in maternal plasma during the last weeks of pregnancy. Its receptors are highly expressed in choriodecidua, placenta and myometrium 235. Moreover, the MAPK cascade is reported to be involved in PGF2α and endothelin-1 induced rat puerperal contraction 236,237. MAPK activity increases in the rat myometrium from day 15 to day 20 of gestation and but intriguingly declines sharply just before parturition 238. During the same interval, a shift in intracellular distribution of the Ras protein precedes the down-regulation of membrane-dependent mitogenic signaling and uterine hypertrophy as gestation approaches parturition 239. ERK phosphorylation levels increase in a rat model of preterm delivery. After chronically being treated with an agent that prevents ERK activation, the onset of preterm labour of the rat is delayed 240,241. The effect of oxytocin on human myometrium, which is mediated via a G- protein linked receptor, activates MAPK pathways, and stimulates the expression of prostaglandins 242.

1.5.3 Protein kinase

PKC constitute a family of enzymes, which may determine two essential uterine processes, contractility and proliferation. There are 3 subfamilies of PKC, the

2+ conventional PKC isoforms (α, βI, βII, and γ), the activation of which requires Ca , diacylglycerol, and a phospholipid for activation; the novel PKC isoforms (δ, ε, η, θ) that require DAG, but do not require Ca2+ for activation and the atypical PKC isoform (protein kinase Mζ and ι / λ isoforms) require neither Ca2+ nor diacylglycerol for activation. PKC is present in human myometrium and is required for proliferation of human myometrial cells 243. Further, PKCs are thought to be involved in determining the balance between T helper (Th1) (pro-inflammatory) and Th2 (anti-inflammatory) cytokine production that has been described at the time of parturition 244 and are important components of the TNFα/IL-1β signaling pathway that controls NF-κB activation. Such roles suggest that PKC may be critically important in the control of

Chapter 1. Introduction

human labour. Further, the levels of PKC mRNA isoforms in pregnant human myometrium were greater than those in non-pregnant myometrium 244,245. In CHO cells that being transfected with rat OTR, PKC activation through G proteins and ERK2 phosphorylation were shown to be vital steps in the process of OT stimulation of

246 PGE2 and c-fos synthesis (Fig 1.6) .

Another important kinase involved in human parturition is phospholipase C (PLC). PLC consists of a group of enzymes that cleaves the phospholipids just before the

phosphate group and is involved in particular cell signal pathways. PLCβ1-4 is the well-known mammalian phosphatidylinositide-specific PLCβ subfamily. A pregnant human myometrial cell line expressed only PLCβ1 and PLCβ3. PLCβ1, PLCβ2, and PLCβ3 are presented in human myometrium 247,248. Oxytocin-mediated ERK1/2 activation in human myometrial cells involves a PLC-independent pathway 234. In rat myometrium, PLC coupling, which involves in cAMP-dependent phosphorylation, can exert a negative effect on the stimulation of IP3 formation by oxytocin and thereby affect contraction/relaxation in the myometrium 249. PLC is also involved in the prostaglandin-induced increase in intracellular calcium levels in myometrial cells 250.

E640 OXYTOCIN, ERK2, AND PGE2

Fig. 9. OT signaling pathways in CHO- OTR cells. Major route, indicated by heavy arrows, involves Gi and Gq activation of PLC and subsequently PKC. Effects of OT on PGE2 synthesis and c-fos expression are totally (or almost totally, repectively) blocked by inhibition of ERK2 phosphorylation with PD- 98059. Potential pathways involving activation of p21ras either by Ca2⇧ or by Shc-Grb2-Sos formation, via tyrosine kinase phosphorylation, appear to be less important in this system (broken arrows). Sites of action of PTX, U-73122, BAPTA and TMB, GF-109203X and PD- 98059 are also shown. Downloaded from

ajpendo.physiology.org cific for the ⌅, ⌃, and ⇥ isoforms of PKC, but it has effects of OT on PGE2 were completely blocked by recently been showFiguren that i1t.4a lOTso i nsignalinghibits MA pathwaysPKAP PD in-98 CHO059. In-OTRhibitio ncells.of E R K2 phosphorylation by PTX kinase-1⌃ (Rsk-2) and p70 S6 kinase, both members of and GF-109203X gave proportional effects on OT- the MAPK cascade (2). Because both these activities stimulated PGE2 release, indicating a clear causal are downstream froAdaptedm ERK2, ifromt is m Zuzanaore likel yStrakova,that the Johnrelat ioA.ns hCopland,ip betwee nStephenERK2 ac tJ.iv aLolait,tion an dandPG EMelvyn2 synthe -s. Soloff, ERK2 mediates inhibition of OT-stimulated ERK2 phosphorylation by sis. Although it has been demonstrated that MAPK is GF-109203X was due to the inhibition of PKC activity. on December 8, 2009 oxytocin-stimulated PGE synthesis.inv oAmlve dJ iPhysioln cPLA2 Endocrinolphosphoryla Metabtion (23 274:634), there i-s641,evi- 1998. 2⇧ 2⇧ 2 Inhibition of increases in [Ca ]i with the Ca sponges dence to suggest that the rise in intracellular Ca2⇧, and partially blocked OT-stimulated ERK2 phosphoryla- not phosphorylation of c PLA , is essential for activation 2⇧ 24 2 tion. Conversely, elevation of [Ca ]i with Calcimycin of the arachidonic acid cascade in rat liver macro- caused ERK2 phosphorylation, indicating that intracel- phages (5). In other studies, PD-98059 inhibited p42/ 2⇧ lular Ca is important in activating ERK2 in CHO- p44MAPK activation in thrombin-, collagen- and phorbol OTR cells. The effects of Calcimycin on ERK2 were ester-stimulated platelets, but did not interfere with blocked by PKC inhibition, suggesting that rather than the release of arachidonic acid or with cPLA phosphor- [Ca2⇧] causing ERK2 phosphorylation via a PKC- 2 i ylation (7). Our findings, which indicate a causal rela- independent, p21ras-mediated process (14, 15), Ca2⇧ tionship between inhibition of ERK2 phosphorylation activates PKC. The transcription factor Elk-1 (ternary complex factor- and inhibition of PGE2 production, are more consistent 1), which participates in formation of a ternary complex with the conclusions of other studies (34). In summary, with the serum response element allowing transcrip- we have shown that PKC activation through G proteins tion of c-fos, is phosphorylated by ERKs (19). Because and ERK2 phosphorylation are vital steps in the pro- OT activated ERK2, it was not surprising that OT also cess of OT stimulation of PGE2 and c-fos synthesis (Fig. induced increases in c-fos mRNA levels. Indeed, OT 9). PKC-independent steps involving p21ras appear to induction of c-fos mRNA was virtually eliminated by be less important in OT signaling in CHO-OTR cells pretreating CHO-OTR cells with the MEK1/2 inhibitor (Fig. 9). Our studies also establish these cells as a valid PD-98059. AP1 activity often is induced by mitogens, model to study additional signaling pathways involved and the ERK pathway is generally considered to be in OT action. involved in cell proliferation or differentiation, depending on cellular context (12). However, OT had no effect We thank Solweig Soloff for expert technical assistance. 3 This research was supported in part by National Institute of Child on [ H]thymidine incorporation by CHO-OTR cells, Health and Human Development Grant HD-26168 (M. S. Soloff). unlike FBS or bFGF. Thus the role of OT-induced Address for reprint requests: M. Soloff, Dept. of Obstetrics and synthesis of c-fos mRNA in CHO-OTR cells remains to Gynecology, Univ. of Texas Medical Branch, 301 University Blvd., be determined. The phosphorylation of ERK2 is critical Galveston, TX 77555–1062. for OT-induced PGE2 synthesis, as the Received 1 October 1997; accepted in final form 12 December 1997.

Chapter 1. Introduction

1.6 Available human myometrial models

A number of studies have been performed on primary myometrial cells and myometrial cell lines, a viral-based transformation of myometrial cells has been used by several laboratories251,252. Some have suggested that the phenotype of these cells might not reflect normal myometrial cell characteristics, however, after being transfected with an expression vector for the catalytic subunit of human telomerase, primary cells have been shown to maintain a normal karyotype and phenotype253,254. Anderson’s group recently developed three telomerase-immortalized cell line from term-pregnant human myometrium. These cells were shown to have a normal karyotype and were proved to be smooth muscle by a α-actin staining255. Over the 20 years, most of the studies on myometrium were done on primary cultured cells, when used at low passage number these cells retain most of the characteristics of normal cells. Therefore, I used primary cultured cells in my studies. Human primary cultures cells can easily be treated to mimic physiological and pathological processes, however, these studies are limited by the absence of other cell types, the loss of the normal intracellular relationships and the homeostatic mechanisms present in the body. Consequently, although hypotheses can be generated in vitro, they need to be tested in vivo by using appropriate animal models both to elucidate the mechanisms of labour and to investigate possible interventions to prove the outcomes.

1.7 Mouse model

Despite some biological differences, mouse models are very important and frequently used in the study of human labour, since they can be used in large numbers and tolerate to surgery very well. They can be genetically altered to help define the pathways involved in parturition. Equally, there are differences between rodent and human pregnancy, for example progesterone withdrawal, which occurs before labour in rodent, does not happen in human. On the other hand, recent studies have shown that progesterone withdrawal might not be necessary for mouse preterm labour256,257. Inflammation represents a common biochemical pathway, in which the different causes of both preterm and term labour converge 12. Intrauterine infection is thought

Chapter 1. Introduction

to induce preterm labour through the interaction of bacterial products with the toll- like receptors 258,259. To mimic this process, inflammatory or infectious agents were introduced. The use of live bacteria may mimic such cases as human preterm labour in which culture of amniotic fluid test positive for bacteria. Killed bacteria, LPS or lipotechoic acid induced an inflammatory state without an overt infection. Studies have shown that a very low dose of LPS (1–10 ng) injected in mice can specifically activate TLR-4 signaling, leading to dramatic increases in proinflammatory cytokine production 260,261. Intrauterine injection of 10 μg LPS induced preterm delivery in all mice within 16.8 hours (54.7hours for saline injected mouse) 262 An intrauterine injection of TLR-4-grade LPS at doses between 0.25 and 5μg on d17 of pregnancy led to rapid preterm delivery within 18 hours and high pup mortality, whereas the induced preterm delivery of LPS injection at a dose of 0.1 μg on d 16 occurred within 24 hour which associated with a wider potential window for therapeutic intervention and with reduced mortality 263. The level of TNFα, CCL2 and IL-6 increased in the amniotic fluid 3-6 hours after the i.p. injection of LPS, and the increase was greater in d17 animals than in the d16. There was a robust response in the myometrium with up-regulation of IL-1β, MIP-2, IL-4, TNFα, IL-6, and IL-10 mRNA 264. However, pharmacological agents against IL-1β or TNFα did not prevent inflammatory-induced preterm delivery in mouse 265.

CCL2 and its receptor CCR2 are essential for monocytes trafficking. In the rat, the expression of CCL2 increases with advancing gestational age has and only decreases after labour 166. However, whether there are differences of the expression of chemokine/chemokine receptors during pregnancy and labour between rat and mice remains unknown. CCR2 knockout (CCR2KO) mouse has been used in parturition related studies, but it has been used in other models. In LPS induced lung infection, compare to wild type mice, CCR2KO mice showed lower macrophages accumulations in alveolar, which was accompanied by high level of CCL2 in bronchoalveolar lavage fluid 266. Similar results occurred in peritoneal macrophage numbers after thioglycollate injection 267.

Chapter 1. Introduction

CCR6 is expressed on immature dendritic cells 268-270, memory T cells 271, and B cells 272, suggesting that CCR6 plays an important role in adaptive immunity. CCR6 has only one chemokine ligand, CCL20, although β-defensin has been reported to bind CCR6 with a lower affinity 273. These characteristics of CCR6 make CCR6 knock out mouse a very good model in the study of chemokine/chemokine receptor in human. In a peritoneal cavity inflammation model, a CCR6-/- C57B/6 mouse model had significantly lower numbers of macrophages and dendritic cells, but a higher number of B cells in the peritoneal cavity, as compared to wild type controls. After the injection of LPS, the level of chemokines and cytokines in peritoneal cavity in CCR6-/- mouse were significantly lower than the wild type ones, suggesting that the CCR6-/- mouse may be interesting to study in inflammation-induced preterm labour 274.

1.8 Hypothesis and Objectives

1.8.1 Hypotheses

The expression of chemokines increases with the onset of labour.

Myometrial chemokine expression is regulated by cytokines, chemokines, stretch and pro-labour factors.

CCL2/CCR2 and CCL20/CCR6 are essential for normal and LPS-induced labour in the mouse.

1.8.2 Objectives

1) To define human myometrial expression of chemokines and their receptors with advancing pregnancy and labour.

2) To elucidate the role of inflammatory cytokines, labour-associated factors (OT, PGs) and stretch in the regulation of the expression of myometrial chemokines and their receptors.

Chapter 1. Introduction

3) To investigate which pathways (PLC, PKC and/or PI3K) are involved in the PG and OT induced down-regulation of myometrial chemokine expression.

4) To use chemotaxis assays to identify whether the supernatants of myometrial and amnion cell cultures exposed to mechanical stretch and inflammatory cytokines stimulate chemotaxis and neutrophil activation.

5) To investigate the effects of CCL20 on pro-labour gene expression in primary cultures of human myometrial cells.

6) To define the patterns of expression of chemokines and their receptors in mouse myometrium during the oestrous cycle, pregnancy and parturition term and inflammation-induced PTL.

7) To investigate whether chemokine receptor deletion (CCR6 and CCR2) alter the response to inflammation and delay normal LPS induced preterm labour in the mouse.

Chapter 2. Materials and Methods

2.1 Materials

Chemicals, reagents and solvents

Absolute Ethanol: Fisher Scientific

Acrylamide: Roche

Agarose: Invitrogen

β-Mercaptoethanol: Sigma-Aldrich

Bench top protein marker: Promega

Bovine Serum Albumin: Sigma-Aldrich

Bromophenol Blue: Bio-Rad

Deoxynucleotide triphosphate (dNTP): Bio-Rad

DNA Ladders: Invitrogen

Ethylenediaminetetraacetic Acid (EDTA): Sigma-Aldrich

Fixation Buffer: eBiosciences

Isopropanol: Fisher Scientific

Methonal: Fisher Scientific

MgCl2: Sigma-Aldrich

NaCl: Sigma-Aldrich 30

Chapter 2. Materials and Methods

NaOH: Sigma-Aldrich

Oligo-dT random primers: Applied Biosysterems

Oligonucleotides and primers: Invitrogen

RNaseZap: Ambion

RIPA Buffer: Sigma-Aldrich

Skimmed Milk Power: Marvel

SYNR Green Reagents: Applied Biosystems

SYBR Safe: Invitrogen

Tris Base: Sigma-Aldrich

Tween 20: Sigma-Aldrich

Buffer, Solutions and Gels

TE buffer

100mM Tris-Hcl, pH8.0

1mM EDTA, pH8.0

Complete protease inhibitor tablets (Roche)

FACS Wash Buffer

0.5% FCS in PBS

Chapter 2. Materials and Methods

Polyacrylamide stacking gels

125mM Tris-HCl, pH6.8

5% Acrylaimide/Bis

1% SDS

1%Ammonium persulfate

0.1% TEMED

Phosphate Buffered Saline (PBS)

140nM NaCl

2.5nM KCl

1.5mM KH2PO4, pH7.2

10mM Na2HPO4, pH7.2

Tris Buffered Saline (TBS)

130mM NaCl

20mM Tris-HCl, pH 7.6

Adjusted to pH7.4 with HCl

TBS-Tween 20 (TBS-T)

0.1% Tween 20 in TBS

Chapter 2. Materials and Methods

Western Blocking Buffer

5% (w/v) non-fat milk in TBS-T

Solutions for genotyping

Solution 1 (pH 12):

25mM NaOH

0.2mM EDTA Na2

47.48ml dH2O

Solution 2 (pH 5.0):

40mM Tis-HCL, pH8.0

48ml dH2O

Antibodies

Anti-goat IgG: Daco

Anti-mouse IgG, HRP-linked Antibody: Cell Signaling, 7076

Anti-rabbit IgG, HRP-likned Antibody: Cell Signaling, 7074

Alexa Fluor 647 anti-CD192: eBiosciences

Alexa Fluor 647 anti-CD196: eBiosciences

APC anti-CD181: eBiosciences

Chapter 2. Materials and Methods

APC anti-CD182: eBiosciences

β-actin : Abcam, Ab6276

COX-2: Santa Cruz Biochemicals, SC-1745

NF-κB p65: Santa Cruz Biochemicals, SC-8008

Phospho-C/EBPβ: Cell Signaling

Phospho-c-Jun: Santa Cruz Biochemicals,

Phospho-NF-κB p65 (Ser536): Cell Signaling3031

CD45 eBiosciences

F4/80 eBiosciences

CD11b eBiosciences

CD11c eBiosciences

Gr1 eBiosciences

CCR2 antibody: Abcam

CCR6 antibody: Abcam

CXCR1 antibody: Abcam

CXCR2 antibody: Abcam

Chapter 2. Materials and Methods

Primers

Table 2.1 Primers for human chemokine/chemokine receptors used in real-time PCR

Name Genebank/EMBL Forward (F) and Reverse (R) primer Nucleotide no. Ct value Accession no.

F: 5’-TGATGACATCAAGAAGGTGGTGAAG- BC014085 1644-1883 GAPDH 3’ 15.56±1.12 R: 5’-TCCTTGGAGGCCATGTAGGCCAT-3’ F: 5’-GCCTTCCTGATTTCTGCAGC -3’ NM000584 136-285 CXCL8 R: 5’- CGCAGTGTGGTCCACTCTCA -3’ 14.98±1.63

F: 5’-GAAAGCTTGCCTCAATCCTG-3’ NM001511 325-498 CXCL1 R: 5’-GCCTCTGCAGCTGTGTCTCT-3’ 18.03±2.98

F: 5’-CCATATTCCTCGGACACCAC-3’ NM002985 141-321 CCL5 R: 5’- TGTACTCCCGAACCCATTTC-3’ 19.65±3.40

F: 5’-TCTGTGCCTGCTGCTCATAG X14768 74-276 CCL2 R: 5’-AGATCTCCTTGGCCACAATG-3’ 17.84±2.38

F: 5’-TTTATTGTGGGCTTCACACG NM004591 91-228 CCL20 R: 5’-TGGGCTATGTCCAATTCCAT-3’ 20.56±3.86

F: 5’- GTGTTGAGAGAGCTGCGTTG-3’ NM_002994 201-480 CXCL5 R: 5’- GGCTTCTGGATCAAGACAAA-3’ 16.82±2.47

F: 5’- TTTGTTTGTCTTGGCTGCTG-3’ NM_000634 463-686 CXCR1 R: 5’- AGTGTACGCAGGGTGAATCC-3’ 23.80±3.38

F: 5’- ACATGGGCAACAATACAGCA-3’ NM_001557 605-783 CXCR2 R: 5’-TGAGGACGACAGCAAAGATG-3’ 20.10±2.54

F: 5’- TGGCTGTGTTTGCTTCTGTC-3’ NM_000647 501-729 CCR2 R: 5’- TCTCACTGCCCTATGCCTCT-3’ 15.84±4.04

F: 5’- GAGGTCAGGCAGTTCTCCAG-3’ NM_004367 311-581 CCR6 R: 5’- CTGCCCAGAATGGGAGAGTA-3’ 17.84±2.38

F: 5’- CAAGCTTAGGCTGCTCCATC-3’ NM_002989 81-481 CCL20 R: 5’- TCAGTCCTCTTGCAGCCTTT-3’ 18.53±2.20

Chapter 2. Materials and Methods

Table 2.2 Primers for mouse chemokine/chemokine receptors used in real-time PCR Name Forward (F) and Reverse (R) Genebank/EMBL Nucleotide Ct value primer sequence (5’-3’) Accession no. no. F:5’-ACTCCACTCACGGCAAATTC-3’ GAPDH R:5’-TCTCCATGGTGGTGAAGACA-3’ NM001001303 201-371 17.52±2.89

CCL2 F: 5’-CCCACTCACCTGCTGCTACT-3’ NM_011333 81-481 18.20±1.69 R: 5’-TCTGGACCCATTCCTTCTTG-3’ CCL5 F: 5’- CCCTCACCATCATCCTCACT-3’ NM_013653 51-321 R: 5’- CCTTCGAGTGACAAACACGA- 17.84±2.38 3’ CXCL1 F: 5’- GCCTATCGCCAATGAGCTG-3’ NM_008176 71-321 R: 5’- AAGGGAGCTTCAGGGTCAAG- 18.10±1.26 3’ CCL20 F: 5’- CGACTGTTGCCTCTCGTACA- NM_016960 59-320 3’ 19.84±2.45 R: 5’- CACCCAGTTCTGCTTTGGAT- 3’ CXCL5 F: 5’- CGCTAATTTGGAGGTGATCC- NM_009141 161-490 3’ 20.56±1.09 R: 5’- GTGCATTCCGCTTAGCTTTC- 3’

Cell Culture materials and medium

Cell strainer (2 mm): Falcon

Collagenase XI or 1A: Sigma-Aldrich

Dulbecco’s Modified Eagles’ Medium: Sigma-Aldrich

Fetal Bovine Serum: Sigma-Aldrich

Filter Unit (0.20 μM): Sartorius

L-glutamine: Sigma-Aldrich

Nutrient Mixture F-12 Ham: Sigma-Aldrich

Chapter 2. Materials and Methods

Penicillin/Streptomycin: Sigma-Aldrich

Tissue Culture Plastic-ware: Corning, Falcon, Orange

Trypsin/EDTA: Sigma-Aldrich

6-well Flexible-bottom plates: Flexcell International Corp.

Enzymes

Ampli-Tag Gold DNA Polymerase: Applied Biosystems

DNase I (RNase-free): Qiagen

MuL V reverse transcriptase: Applied Biosystems

Inhibitors and Treatments

Complete Protease Inhibitors: Roche

ERK Inhibitor U0126: Sigma-Aldrich

Halt Phosphatase Inhibitor Single-Use Cocktail: Thermo

IKK-2 Inhibitor TPCA-1: Sigma-Aldrich

Interleukin 1β: Sigma-Aldrich

JNK Inhibitor SP600125: Sigma-Aldrich p38 Inhibitor SB203580: Sigma-Aldrich

PGE2: Sigma-Aldrich 37

Chapter 2. Materials and Methods

PGF2α: Sigma-Aldrich

TNFα: Sigma-Aldrich

Kits cDNA synthesis and SYBR Green for qPCR: Applied Biosystems

GenElut Gel Extration Kit: Qiagen

QIA quick PCR perification Kit: Qiagen

RNeasy mini Kit: Qiagen

SDS-PAGE electrophoresis and Westerm Blotting materials

Cell Lysis buffer: Cell Signaling

ECL Plus Western Blotting Detection System: GE Healthcare

ECL hperfilm: Amersham Biosciences

Hybond ECL Nitrocellulose membrane: Amersham Biosciences

Novex Sharp Pre-stained Protein Standard: Invitrogen

NuPAGE LDS Samples buffer: Invitrogen

NuPAGE MOPS SDS running buffer: Invitrogen

SDS PAGE pre-cast gels: Invitrogen

Supersignal West Pico Chemiluminescent Substrate: Pierce 38

Chapter 2. Materials and Methods

Transfer buffer: Bio-Rad

2.2 Methods

2.2.1 In vitro studies

Tissue specimens

All procedures involving paired upper and lower segment human myometrial tissues were conducted in compliance with the Institution Review Board of the University of Cincinnati (Cincinnati, OH, USA). Informed consent was obtained from all women before any tissue collection. Human myometrial samples were taken from four groups of women (mean gestational age ± SD in each case), at preterm no labour (PTNL: 31.5 ± 3.5 wks; mean ± SD; n=8), preterm labour (PTL: 32.3 ± 4.1 wks; n=8), term no labour (TNL: 38.0 ± 1.2 wks; n=8) or term labour (TL: 39.4 ± 0.5 wks; n=8)(Table 2.3). Labour was defined as the presence of regular uterine contractions (every 3-4 minutes) resulting in cervical effacement and dilation. Myometrial samples were removed from the upper margin of the incision made in the lower uterine segment, and for the upper segment, an Allis clamp was used to group a small segment (1.0x0.5 cm) of myometrium below the fundus and tissue excised using Mayo scissors (this included the serosal surface but not the endometrium). Haemostasis was obtained using a single figure of size 8 sutures. Tissues were flash frozen in liquid nitrogen prior to storage at - 70°C. The indications for caesarean section included: failure to progress (n=4), fetal distress (n=8), previous uterine surgery (n=12), malpresentation (n=5), severe pre-eclampsia (n=5), placenta praevia (n=1) and gestational diabetes (n=1).

Chapter 2. Materials and Methods

Table 2.3 The demographic data of paired upper and lower segment myometrial samples

PTNL (n=8) PTL (n=8) TNL (n=8) NL (n=8)

Gestational age 32.3 (26-35.3) 33.3 (26.2-36.3) 38.4 (37-39.5) 39.3 (37.3-40.6)

Reason for LSCS

FTP - - - 3

NRFHT 2 2 - 2

PUS - 3 5 3

Malpresentation - 3 1 -

PET 4 - 1 -

Placenta praevia 1 - - -

GDM 1 - - -

FTP, failure to progress; NRFHT, non-assuring fetal heart trace; PET, pre-eclampsia; GDM, gestational diabetes.

The myometrial samples for cell culture were collected in Chelsea and Westminster Hospital (London, United Kingdom). Tissue samples were taken from the upper margin of lower uterine segment incision at the time of TNL caesarean sections. The samples were placed in Dulbecco’s modified Eagle’s Medium (DMEM, Invitrogen) medium, which contains 100mU/ml penicillin and 100 μg/ml streptomycin. Samples were stored at 40C for no more than 3h before the cell preparation for culture. The study was approved by the local Ethics Committee (RREC3663) and all specimens were obtained after written patient consent.

Primary cell culture

Myometrial tissue was washed in phosphate-buffered saline (PBS) after obtained and finely dissected. Cut tissue was then digested for 45minutes at 370C in a mixture of collagenase solution containing 1 mg/ml collagenase 1A (Sigma) and 1 mg/ml collagenase XI in a mixed medium (50% DMEM and 50%

Chapter 2. Materials and Methods

Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham). Tissue pieces were filtered through a cell strainer (70 mm mesh) using a Pasteur pipette. Cells were then centrifuged at 179g for 5 min and re-suspended with DMEM medium containing 10% fetal calf serum, L-glutamine and 100mU/ml penicillin and 100mg/ml streptomycin. Cells then were cultured in T25 in an atmosphere of 5% CO2: 95% air at 370C. Myometrial cells from passage 1-4 were washed using PBS and trypsinised in 0.25% trypsin and cultured in 6-well plates with stripped medium (5% Charcoal and Dextran-stripped fetal calf serum, L-glutamine and 100 mU/ml penicillin and 100 mg/ml streptomycin).

For mechanical stretch, cells were subjected to a static stretch of 16% for different period of time using 6-well flexible-bottom plates, which pre-coated with collagen type I (Flexcell International Corp., McKeesport, PA). Unstretched cells grown in the same stretch plates were used as controls. To determine the expression of chemokine/chemokine receptors with cytokines and pro-labour genes, cells were incubated with IL-1β, TNFα, IL-6, IL-8, PGE2, PGF2α and oxytocin respectively for 1, 6 and 24 hours. A lower serum medium containing 1% fetal calf serum was used to serum starve the cells 12 hours prior to each treatments.

Protein extraction from cultured cells

Cell Lysis Buffer (Cell Signaling) containing protease inhibitor and phosphatase inhibitor was used to prepare protein samples from cultured cells. Cell lysate was obtained by using a cell scraper and, supernatant was taken from a centrifugation at 13,000 ×g for 30 min at 40C. The concentration of protein was determined by Protein assay (Bio-Rad Laboratories, USA). Bovine serum was used as standards. Samples were then aliquot and stored at -70oC. Before western blotting, protein samples were denatured in heater at 70oC for 10 min.

Chapter 2. Materials and Methods

Quantitative RT-PCR

Total RNA was extracted and purified from cell or tissue samples using RNeasy mini kit (Qiagen Ltd, UK) according to manufacturer’s protocol. After quantification, 1.0 µg was reverse transcribed with oligo dT random primers using MuLV reverse transcriptase (Applied Biosystems Ltd, UK). Primer sets for chemokine/chemokine receptors were designed and obtained from Invitrogen. These primer sets produced amplicons of the expected size (Table 1). Assays were validated for all primer sets by confirming that single amplicons of appropriate size and sequence were generated according to predictions. Quantitative PCR was performed in the presence of SYBR Green (Roche Diagnostics Ltd, UK), and amplicon yield was monitored by Rotor Gene R-G 3000 (Corbett Research, Australia) that continually measures fluorescence caused by the binding of the dye to double-stranded DNA. Pre-PCR cycle was 7 min at 95℃ followed by 35 cycles of 95℃ for 10 s and 72℃ for 10 s followed by final extension at 72℃ for 1 min. The cycle in which fluorescence reached a preset threshold (cycle threshold) was used or quantitative analyses. The cycle threshold in each assay was set at a level where the exponential increase in amplicon abundance was approximately parallel between all samples. The melt curve, which is a post PCR analysis used to test the integrity of the cDNA and the purity of the amplified samples and thus ensure that one is analysing the correct product. In order to correct the variations, data were expressed relative to the amount of constitutively expressed housekeeping gene. Our group tested the use of several commonly used housekeeping genes, including GAPDH, β-actin, 18sRNA, Calponin, HGRP and L19. It was found GAPDH was the best one to use to study myometrial cells. Conventional PCR was performed using Ampli-Taq Gold DNA polymerase (Applied Biosystems Ltd). Pre-PCR cycle was 10 min at 95℃ followed by 35 cycles of 95℃ for 1 min, 56-60℃ for 1 min and 72℃ for 1 min followed by final extension 72℃ for 10 min.

Chapter 2. Materials and Methods

DNA electrophoresis and purification

1.5% agarose gels were prepared by dissolving agarose in 1×tris-borate-EDTA (TBE) buffer and was heated until boiling. After cooling down, SYBR safe DNA gel stain (Invitrogen) was added to the solution, which was then poured into an appropriate mould. PRC products and restriction fragments were electrophoresed in 1×TBE at 100- 120V. The size of DNA fragments was estimated by comparing with the markers (Invitrogen). Target DNA fragments were cut and purified from agarose gel by Wizard SV Gel and PCR Clean-Up System (Promega) according to manufacturer’s protocol.

Western blot analysis

Denatured protein samples (40-60ug) were loaded in 10-15 well gels (Invitrogen) and run on 80-130 volts. After that, an electrophoretic transfer onto a Hybond ECL nitrocellulose membrane (Amersham Pharmacia Biotech) was performed. Membranes were blocked in washing buffer (5M NaCL, Tris-HCL and Tween) containing 5% milk for 1 h at room temperature, washed in washing buffer and hybridized with the primary antibody over night at 4℃. Membranes were washed again and then incubated with secondary antibody at a dilution of 1:2000 for 2 h at room temperature. SuperSignal West Pico Chemiluminescent Substrate (Pierce, USA) was used for detection. Protein band size was determined using Novex Sharp Pre-stained Protein Standard (Invitrogen).

ELISA

Cell culture medium was collected 24 hours after cells were stretch by 16%, or treated with IL-1β and oxytocin. Before the supernatant was collected, cell culture medium was spun at 13.3RPM for 20 minutes. All supernatant was diluted 5-100 fold before use. IL-8 ELISA kit was used (R&D Systems). The assay was performed following the manufacturer’s protocol. 50ml of standards and samples were used in this assay. A

Chapter 2. Materials and Methods

miroplate reader was used to determine the density. Reading was performed at both 450nm and 540nm to correct for optical imperfections in the plate.

Transfection

All steps were performed in a tissue culture cabinet, with the exception of the electroporation step. L1.2 cells (a murine B cell line) were counted using a haemocytometer. 1.5x107 cells were transferred to a sterile 50 ml tube, and centrifuged at 1200 RPM, 21°C, for 5 minutes. The vector pCDNA3 containing CCR2 or CXCR2 constructs were used. 50μg (10.5mg/ml) tRNA and 1 μg DNA per 1x106 cells were added to the bottom of a sterile cuvette (BTX Harvard Apparatus, USA). The supernatant of the centrifuged cells was decanted, and the pelleted cells resuspended in 800μl simple Roswell Park Memorial Institute medium (RPMI), transferred to cuvette, and incubated at room temperature for 20 minutes. The cuvette was placed in a BioRad Gene-pulser (BioRad, USA), electroporated at 330 volts, 975 μF, and incubated at room temperature for 20 minutes. The contents of the cuvette were transferred to a T-75 tissue culture flask containing 15 ml complete RPMI, and incubated for 5 hours at 37°C. 150 μl 1M sodium butyrate was added to the flask to give a final concentration of 10 mM, and the cells incubated overnight at 37°C. The expressions of CCR2 and CXCR2 on transfected L 1.2 cells were detected by FACS before the chemotaxis assay be performed.

Chemotaxis Assay

The chemotaxis assay was performed on transfected L1.2 cells. Once expression had been confirmed by staining and flow cytometry, a 96 well chemotaxis plate (Neuroprobe, USA) was blocked by adding 30 μl 1% BSA (0.1 g in 10 ml simple RPMI) to each well, and incubating at room temperature for 30 minutes, which prevented the chemokines from sticking to the plastic of the wells. Supernatant from myometrium cell culture was used, and was diluted to 1:2, 1:4 and 1:8. The 1% BSA was removed from the plate and the chemokine stocks added. 31 μl 0.1% BSA was added to the first well as a buffer control, then 31 μl of different dilution of supernatant to the next well, and so on. The wells were filled in duplicate. The membrane of the chemotaxis plate was carefully attached to the

Chapter 2. Materials and Methods

fluid in each well. 20 μl of cells (at 10x106/ml) were pipetted onto the contact point on the membrane. The lid of the plate was closed, and the plate was placed in a humidified box and incubated for 5 hours at 37°C. After incubation, the lid and membrane were removed, and the cells scraped off the membrane. Cells, which migrated through the membranes into the supernatant in each well, were counted by using a microscope.

Flow cytometry

Primary cultured myometrial cells were pre-treated with oxytocin (10nM/ml) for 24 hours. Cells were lifted by cell dissociation solution (Sigma-Aldrich) and washed by FACS wash buffer (PBS containing 0.5% bovine serum albumin). None treated cells were harvested as controls. Cells were suspended in wash buffer and mixed with different antibodies for 60 minutes. Cells were incubated with the following antibodies: Alexa Fluor 647 anti-CD192 (CCR2), Alexa Fluor 647 anti-CD196 (CCR6), APC anti-CD181 (CXCR1) and APC anti-CD182 (CXCR2), respectively. Mouse IgG2b and IgG1 antibodies (R&D systems) were used as isotype control. After incubated on ice for 45 minutes, cells were washed and re-suspended FACS wash buffer. Flow cytometry was performed on a BD FACSCalibur flow cytometry system. A minimum of 10,000 events were counted. Data were analysed using FACSCalibur software.

2.2.2 In vivo studies

Animals

Animal studies were performed under UK Home Office License 70/6906 and in accordance with the UK Animals (Scientific Procedures) Act of 1986. Virgin female and stud male CD1 outbred mice were purchased from Charles River (Margate, UK) at 6-8 weeks of age. Female CCR2 knockout (KO) and CCR6 KO mice on a C57BL/6 background were purchased from the Jackson Laboratory (Bar Harbor Maine, USA). All mice were maintained in open cages at 21 ± 1°C, with ad libitum access to food (RM1 diet, Lillico Biotechnology, UK) and water, and a 12:12 light/dark cycle regimen. All mice were

Chapter 2. Materials and Methods

acclimatised for a minimum of 72 hours before undergoing any regulated procedure or mating.

Outbreeding of transgenic strains

To add genetic variation to these strains and allow comparison with our inflammation- induced preterm labour model in CD1 mice (see section 1.2), KO female mice (classed as the F0 generation) were mated with CD1 outbred males. Heterozygous pups (F1 generation) from different litters were mated together, producing a heterogeneous F2 generation (25% KO, 50% heterozygous and 25% wild type litters). Genotyping was performed to determine between KO, heterozygous and wild type animals. The resulting KO F2 generation (males and females) were interbred to expand the colony for experimentation.

Timed-mating

Timed mating was employed to enable accurate timing of intrauterine injections. Female mice (CD1; CCR2-/- or CCR6-/-) were mated with a stud CD1 male overnight. The presence of a copulatory plug in the vagina of the female indicated successful mating and was classed as E0 (day 0) of gestation.

Mouse model of localized intrauterine inflammation and preterm delivery

Intrauterine administration of LPS to rodents has been described by Elovitz275. An adapted version of this model has subsequently been established in our group263 and further optimized for this study.

A laparotomy was performed on day 16 (E16) of gestation with anaesthesia induced and maintained using isoflurane (need to look up supplier). Morphine analgesia (2.5mg/kg) was administered subcutaneously 30 minutes prior to surgery. Pregnant mice were swabbed with povidone iodine (Ecolab, UK) before a 1.5cm incision was made in the lower abdomen between the last two sets of nipples. Both uterine horns were exteriorised and wrapped in PBS saturated surgical swabs (MidMed) whilst the number

Chapter 2. Materials and Methods

of live fetuses per horn was determined. 10μg/dam (in a total volume of 25μl) of Escherichia coli LPS serotype 0111:B4 (Sigma) or sterile PBS was then infused into the upper right uterine horn between the first and second sacs with care not to enter the amniotic cavity. If this was not possible because there were less than two fetuses in the right uterine horn, then the left horn was injected. The wound was closed in two layers (the muscle layer by continuous suture and the skin by simple interrupted sutures (MidMed, UK). Mice were allowed to recover in a heating chamber at 30ºC for 30 minutes before returning to their home cage.

Tissue Collection

Tissue collections were performed at 3h, 7h and the onset of labour after intrauterine injection of PBS or LPS. Delivery of the first pup was considered as the onset of labour. Maternal serum, plasma, myometrium, cervix, placentas and fetal brains were collected. Tissue was snap frozen on dry ice for molecular studies. Maternal myometrium and fetal brains were also fixed overnight in 10% neutral-buffered formalin (Sigma) at room temperature and then transferred into 70% ethanol the next day.

RNA extraction

Mouse tissues were snap frozen on dry ice after collection. 30mg tissue from each sample was used. RNA extraction was performed using RNAesy Kit and Qiashredder (Qiagen). The concentration of RNA in each sample was measured by NanoDrop. 2ug RNA was used in cDNA synthesis.

Protein extraction

Mouse tissues were snap frozen on dry ice after collection. Samples were weighed before extraction. 2ml of RIPA Buffer (Sigma) containing protease inhibitor and phosphatase inhibitor was added into per 100mg frozen tissue and homogenized for 30 seconds. Lysate was sonicated and, supernatant was taken from a centrifugation at 13,000 ×g for 30 min at 40C. The concentration of protein was determined by Protein

Chapter 2. Materials and Methods

assay (Bio-Rad Laboratories, USA) and bovine serum was used as standards. Samples were then aliquot and stored at -80oC. Protein samples were denatured in heater at 70oC for 10 min before western blotting.

Genomic DNA extraction and genotyping PCR

The ear clips from tested mice were taken and put in 75µl of solution 1, then vortex. The solution containing ear clips were heated afterwards to 95 oC for 10min and cooled down to 4 oC. Solution 2 was added and, the whole solution was vortexed and spun down. 4µl of final solution was used and mixed with PCR reaction mix which containing 2 µl PCR Buffer(×10), 2 µl dNTP’s (2mM), 0.6 µl Mgcl2 (50mM), 1 µl of primer F (10µM), 1 µl of primer R (10µM), 4 µl of DNA, 9.3 µl dH2O and 0.1 µl Taq (5U/ µl). Genotyping PCR thermocycler condition for CCR2 KO was 95 oC for 5min, 95 oC for 30sec, 65 oC for 1min, 72 oC for 2min and, after 35 cycles heated 75 oC for 10min and 4 oC for 10min. Genotyping PCR thermocycler condition for CCR6 KO was 95 oC for 5min, 95 oC for 30sec, 69 oC for 1min, 72 oC for 1min and, after 35 cycles heated 72 oC for 10min and 4 oC for 10min.

Table 2.4 Primers for genotyping PCR Name Forward (F) and Reverse (R) primer sequence (5’-3’) Size CCR2 WT F: 5’-CCACAGAATCAAAGGAAATGG-3’ 424bp R: 5’-CCAATGTGATAGAGCCCTGTG-3’ CCR2 KO F: 5’- CTTGGGTGGAGAGGCTATTC-3’ 280bp R: 5’- AGGTGAGATGACAGGAGATC-3’ CCR6 WT F: 5’- GGGTGGGATTAGATAAATGCCTGCTCT-3’ 228 R: 5’- CCCTAGAAGAGGTCAGAAACTTCAC-3’ CCR6 KO F: 5’- AAAACCCAAGTGTTGGTGGCATGAG-3’ 442 R: 5’- CCCTAGAAGAGGTCAGAAACTTCAC-3’ Cell preparation

Uteri were dissected free of decidua in ice-cold PBS. Minced and weighed tissue was enzymatically dissociated in PBS containing collagenase X (Sigma, UK) and 30 μg/ml DNase I (Roche) for 30 minutes at 37°C with intermittent trituration and, filtered through a 70-μm cell strainer. Cells were washed twice in FACS wash buffer containing 5 mM EDTA. Live pup brains were harvested 3h post operation, and gently homogenized

Chapter 2. Materials and Methods

in 1ml fixation buffer for 10 seconds. After 1 min incubation in room temperature, 15ml FACS wash buffer was added to stop fixation. Fixed cells were then washed twice in FACS wash buffer.

Flow cytometry

Inflammatory cell suspensions were prepared for flow cytometry analysis. Samples were stained with fluorophoreconjugated anti-mouse antibodies for CD45, CD11c, CD11b, Gr-1, F4/80 (eBiosciences, UK) and then analyzed using a FACSCalibur cytometer with CellQuest (Becton Dickinson, Oxford, UK) and FlowJo (Tree Star, Ashland, OR) software. Cells were quantified-using microsphere counting beads (Caltag Medsystems, Buckingham, UK).

Statistical analysis

All data were initially tested for normality using a Kolmogorov-Smirnoff test. Normally distributed data were analyzed using a Student t test for 2 groups and an analysis of variance (ANOVA) followed by a Dunnett or Bonferroni post hoc test for 3 groups or more. Data that were not normally distributed were analyzed using a Wilcoxon matched pairs test for paired data, Mann Whitney test for unpaired data and when comparing 3 groups or more a Friedman’s Test, with a Dunn's Multiple Comparisons post hoc test. p<0.05 was considered statistically significant.

Chapter 3. Myometrial chemokine expression and regulations

3.1 Introduction

Preterm delivery accounts for up to 70% of neonatal deaths and 75% of neonatal morbidity and complicates between 5 and 11% of pregnancies 1. Preterm labour (PTL) is the most important cause of preterm delivery. Current concepts of PTL implicate infection and inflammation as the main causative factors. The inflammatory process in human parturition is associated with a marked neutrophil and macrophage infiltration of the cervix and myometrium 17, resulting in an increase in myometrial cytokines. The primary role of leukocytes is in host defence against pathogenic microorganisms, however, within tissues, leukocytes acquire other critical functions, regulating cell growth, development and function 276. Human labour is critical as the activated leucocytes release potent inflammatory cytokines that drive prostaglandins synthesis and the increase in the contractility of myometrial.

Chemokines must be involved in the process of human labour, since they are the main regulator of leukocyte migration, tissue infiltration and activation. A recent study reported that human myometrial expression of the chemokines CCL2, CCL20, CXCL1, CXCL5 and CXCL8 was greater in samples obtained after the onset of term labour than before 167. Further, levels of various chemokines, including CCL5 in amniotic fluid are increased with both preterm and term labour and these increases are greater in the presence of infection 169,171,182,277. The greater increase in the presence of infection is probably explained by the activation of the toll-like receptors (TLR), key players in the innate response to infections, linked to NF-κB, the archetypal inflammatory transcription factor that known to drive chemokine expression in human myometrium 278. However, which factor (s) are responsible for the increase in myometrial chemokine expression with spontaneous labour is not certain and whether, as suggested above, the inflammatory infiltration is important in the onset and progression of labour or is simply a consequence of labour is also debated. However, in a rat model of human pregnancy and labour, CCL2, a

Chapter 3. Myometrial chemokine expression and regulations

chemokine that involved in the recruitment and activation of macrophages, increases both before and with the onset of parturition 279. Interestingly, the pre- parturition increase is driven by mechanical stretch 279 although other studies have shown that CCL2 is also increased by both IL-1β and the TLR-4 agonist LPS 165. These data suggest that in the rat at least the inflammatory infiltration precedes the on set of labour and may be involved in its onset.

In this study, in order to understand whether the increases in myometrial chemokines are important in the onset and progression of preterm and term labour, or, as others suggest, only increased in response to the process of labour I have investigated (1) the pattern of myometrial chemokine expression during pregnancy and with the onset of labour both before and at term; (2) the factors that regulate myometrial chemokine expression; and (3) the potential intracellular signalling pathways involved.

3.2 Results

3.2.1 Myometrial expression of chemokines in pregnancy and labour

In TL samples, CCL2 and CXCL8 mRNA levels were increased significantly in both upper and lower uterine segments and CXCL1 mRNA significantly increased in the upper segment only (Fig.3.1a-c). In PTL samples, CCL5, CXCL5 and CCL20 mRNA expression was only significantly increased in the lower segment (Fig.3.1d-g). I find a consistent relationship between chemokine mRNA and advancing gestation only when I included all of the samples (upper and lower segments, labouring and non- labour) (Fig. 3.2a-f).

Chapter 3. Myometrial chemokine expression and regulations

Figure 3.1 Gene expression of CCL2, CCL5, CCL20, CXCL1, CXCL3, CXCL5 and CXCL8 in upper and lower PTL, PTNL, TL and TNL myometrium.

Chapter 3. Myometrial chemokine expression and regulations

a 10

0.1 r =0.4223***

0.01

0.001 CCL2:GAPDH

0.0001

0.00001 22.5 25.0 27.5 30.0 32.5 35.0 37.5 40.0 42.5 45.0 Wks

b 1.0×10-02

1.0×10-03

* 1.0×10-04 r =0.2897

1.0×10-05 CXCL8:GAPDH

1.0×10-06

1.0×10-07 22.5 25.0 27.5 30.0 32.5 35.0 37.5 40.0 42.5 45.0 Wks

Chapter 3. Myometrial chemokine expression and regulations

c 1.0×10-04

1.0×10-05

1.0×10-06

-07 1.0×10 r =0.4131*** 1.0×10-08

1.0×10-09

1.0×10-10

CXCL1:GAPDH 1.0×10-11

1.0×10-12

1.0×10-13

1.0×10-14 22.5 25.0 27.5 30.0 32.5 35.0 37.5 40.0 42.5 45.0 Wks

d 1.0×10-05

r =0.0367 1.0×10-06

1.0×10-07 CCL5:GAPDH

1.0×10-08 22.5 25.0 27.5 30.0 32.5 35.0 37.5 40.0 42.5 45.0 Wks

Chapter 3. Myometrial chemokine expression and regulations

e 1.0×10-05

1.0×10-06

1.0×10-07

*** 1.0×10-08 r =0.4649

1.0×10 -09

1.0×10-10 CXCL5:GAPDH 1.0×10-11

1.0×10-12

1.0×10-13 22.5 25.0 27.5 30.0 32.5 35.0 37.5 40.0 42.5 45.0 Wks

f 1.0×10-04 1.0×10-05 1.0×10-06 1.0×10-07 r =0.3476** 1.0×10-08 1.0×10-09 1.0×10-10 1.0×10-11 1.0×10-12 1.0×10-13 -14 CCL20:GAPDH 1.0×10 1.0×10-15 1.0×10-16 1.0×10-17 1.0×10-18 22.5 25.0 27.5 30.0 32.5 35.0 37.5 40.0 42.5 45.0 Wks

Figure 3.2 Correlations between gestational age and myometrial chemokine expressions

Paired upper and lower segment human myometrial samples were obtained from four groups of women

(mean gestational age ± SD in each case), at preterm no labour (PTNL; 31.5 ± 3.5 wks; mean ± SD; n=8), PTL (32.3 ± 4.1 wks; n=8), term no labour (TNL; 38.0 ± 1.2 wks; n=8) or TL (39.4 ± 0.5 wks; n=8). The gene expressions were measured by quantitative rtPCR. n=8 for this experiment. Non- parametric correlation test was performed between gestational age and myometrial chemokine expression, spearman r was shown. a semilog line was drawn base on the nonlinear regression. NL, stands for non-labour, TNL stands for term non-labour, PTNL stands for preterm non-labour. * indicates p<0.05. ** indicates p<0.01, *** indicates p<0.001

Chapter 3. Myometrial chemokine expression and regulations

3.2.2 Cell culture

I found that myometrial chemokine mRNA expression did not change in prolonged culture at 6, 24 and 54 hours (Appendix 1).

3.2.3 Stretch induced myometrial chemokine expression

Chemokine mRNA expression in cultured myometrial cells in response to stretch was assessed after the application of 16% stretch for 1, 3, 6 hours. CCL2, CXCL8 and CXCL1 mRNA levels were significantly increased at the 6 hours, CCL5 mRNA was significantly increased at 3 and 6 hours and CCL20 mRNA at 3 hours only (Fig.3.3a- f). The increase in CXCL5 mRNA did not quite reach significance in this series of experiments, but did in later studies. The levels of all of the chemokines above, including CXCL5, were significantly increased in the culture supernatant after 6 hours stretch (Fig.3.3g).

It is reported that chemokine expressions were primarily regulated by NF-κB 278, but previously using EMSA our group had failed to find any evidence of a stretch- induced activation of NF-κB activity 219. Since stretch enhanced chemokine expression, I re-assessed the impact of stretch on NF-κB activation, using p65 phosphorylation and found that stretch increased phospho-p65. The increase was detectable by 5 minutes, persisted until 30 minutes and could be blocked by an IκK inhibitor (TPCA-1, Fig.3.4).

Since previously our group found that stretch drove both CXCL8 and COX-2 mRNA expression via MAPK 280, I pre-incubated myometrial cells with both MAPK and IκK inhibitors and found that the 6 hour stretch-induced increase in CCL2, CXCL8, CXCL1 and CCL20 mRNA expression was inhibited by pre-incubation of myometrial cells with the ERK-inhibitor U0126, and the IKK-2 inhibitor TPCA-1. In the case of CCL5, pre-incubation with the JNK inhibitor SP600125 and TPCA-1 and for CXCL5 pre-incubation with TPCA-1 only blocked the stretch–induced increase in mRNA 59

Chapter 3. Myometrial chemokine expression and regulations

expression (Table 3.1). The effect of the IκK inhibitor was most marked and most consistent.

400 *

300

200

100

CCL2:GAPDH(%CONTROL) 0 CONTROL STRETCH 1h STRETCH 3h STRETCH 6h

400 ** 300

200

100

CXCL8:GAPDH(%CONTROL) 0 CONTROL STRETCH 1h STRETCH 3h STRETCH 6h

Chapter 3. Myometrial chemokine expression and regulations

1000 *

100

CXCL1:GAPDH(%CONTROL) 10 CONTROL STRETCH 1h STRETCH 3h STRETCH 6h

1000

100

CXCL5:GAPDH(%CONTROL) 10 CONTROL STRETCH 1h STRETCH 3h STRETCH 6h

Chapter 3. Myometrial chemokine expression and regulations

1000 **

100

CCL20:GAPDH(%CONTROL) 10 CONTROL STRETCH 1h STRETCH 3h STRETCH 6h

Chapter 3. Myometrial chemokine expression and regulations

Figure 3.3 a-g Stretch induced the expression of myometrial chemokines. a-f: Human myometrial cells were exposed to 16% stretch for 0, 1, 3 and 6 hours. mRNA was extracted and measured using quantitative rtPCR, n=6. Data were analysed using an ANOVA followed by a Dunnett’s post test or with a Friedman’s Test followed by a Dunn’s post test depending on the data distribution. CCL2, ANOVA=0.0257, Dunnett’s p<0.05 at 6 hours, Fig.2a; CXCL8, ANOVA=0.0027， Dunnett’s p<0.01 at 6 hours, Fig.2b; CXCL1, ANOVA=0.0325，Dunnett’s p<0.05 at 6 hours, Fig2c; CCL5 , ANOVA p=0.0027，Dunnett’s p<0.01 at 3 and 6 hour, Fig. 2d; CCL20, ANOVA=0.0325, Dunnett’s p<0.05 at 3 hours, Fig. 2F. Data are shown as the median, the 25th and 75th percentiles and the range. * indicates p<0.05. ** indicates p<0.01. g: Human uterine smooth muscle cells were exposed to 16% stretch for 0 and 6 hours. The supernatant collected and chemokine levels measured by ELISA. Data are expressed as median and range, n=8 and analysed using a paired t test or Wilcoxon matched pairs test depending on data distribution. CCL2, Wilcoxon=0.0078, Dunnett’s p<0.01; CXCL8, Paired t test=0.0017, Dunnett’s p<0.01; CXCL1, Paired t test=0.0029, Dunnett’s p<0.01, Fig.2i; CCL5 and CXCL5, Wilcoxon=0.0313, Dunnett’s p<0.05; CCL20, Paired t test=0.0143, Dunnett’s p<0.05, Fig. 2l, and * indicates p<0.05. ** indicates p<0.01.

Chapter 3. Myometrial chemokine expression and regulations

Phospho&p65)

p65)

β&ac-n)

6000 *** -actin

β *** 4000 ***

### 2000 ### ## phospho-p65: 0 TPCA-1 CONTROL Stretch 5min Stretch 15min Stretch 30min Stretch+TPCA-1 5min Stretch+TPCA-1 15min Stretch+TPCA-1 30min n=4

Figure 3.4 Stretch induced the expression of myometrial chemokines.

Myometrial cells were treated with or without TPCA-1, after stretch, whole cell protein was extracted. Total and phosphor-NF-κB P65 were detected by western blot and, densitometry was expressed as Mean with SEM.

Chapter 3. Myometrial chemokine expression and regulations

Table 3.1 The effects of MAPK and NF-κB P65 inhibitors on stretch induced chemokine expression (percentage changes compared to stretch alone)

Stretch increased chemokines expressions (data not shown). Data were shown as percentage of stretch treatment alone, ANOVA Test was used if data were parametric, and Friedman’s Test if data were non- parametric, with a Dunn's Multiple Comparisons post hoc test. N=6 for each experiment. * indicates p<0.05. ** indicates p<0.01, *** indicates p<0.001.

3.2.4 Cytokines induced myometrial chemokine expression

IL-1β (10ng/ml) and TNFα (10ng/ml) induced marked increases in the expression of CCL2, CXCL1 and CXCL8 mRNA (Fig.3.5a-c) and a less pronounced response in CCL5, CXCL5 and CCL20 mRNA expression (Fig.3.5d-f). IL-1β also induced similar increases in culture supernatant chemokine levels (Fig.3.6). TPCA-1 blocked the cytokine-induced increases chemokine mRNA expression and this effect was most

Chapter 3. Myometrial chemokine expression and regulations

consistent in CCL2, CXCL8 and CXCL1 mRNAs (Table3.2), The MAPK inhibitors blocked the effect of cytokines on chemokine mRNA expression, but this effect for the most part was minor when compared to that of the IκK-2 inhibitor (Table 3.2).

100000 *** *** *** 10000 *

1000

100

CCL2:GAPDH(%CONTROL) 10 1h 6h 1h 6h 24h 24h α α β β β α IL1- IL1- TNF TNF IL1- TNF CONTROL

1.0×1007 *** *** * 1.0×1006 **

1.0×1005

1.0×1004

1.0×1003

1.0×1002

01 CXCL8:GAPDH (%CONTROL) 1.0×10 1h 6h 1h 6h 24h 24h α α β β β α IL1- IL1- TNF TNF IL1- TNF CONTROL

Chapter 3. Myometrial chemokine expression and regulations

1000000

100000 ** ***

10000

1000

100

CXCL1:GAPDH(%CONTROL) 10 1h 6h 1h 6h 24h 24h α α β β β α IL1- IL1- TNF TNF IL1- TNF CONTROL

1.0×1008 *

1.0×1006

1.0×1004 * *

1.0×1002 CCL5:GAPDH(%CONTROL) 1.0×1000 1h 6h 1h 6h 24h 24h α α β β β α IL1- IL1- TNF TNF IL1- TNF CONTROL

Chapter 3. Myometrial chemokine expression and regulations

100000 *** 10000 * *

1000

100 CXCL5:GAPDH (%CONTROL) 10 1h 6h 1h 6h 24h 24h α α β β β α IL1- IL1- TNF TNF IL1- TNF CONTROL

1000000 *

10000 *** *

100

CCL20:GAPDH(%CONTROL) 1 1h 6h 1h 6h 24h 24h α α β β β α IL1- IL1- TNF TNF IL1- TNF CONTROL

Figure 3.5 a-f Cytokines induced the expression of chemokines. a-f: Human myometrial cells were incubated with or without 10ng/mL IL-1β or TNFα for 1, 6 and 24 hours. At the end of incubation RNA was extracted and converted to cDNA. The expressions of chemokine, including CCL2, CCL5, CCL20, CXCL1, CXCL5, CXCL8 were measured by quantitative RTPCR. n=6 for this experiment, data analyzed using ANOVA Test if data were parametric, and

Chapter 3. Myometrial chemokine expression and regulations

Friedman’s Test if data were non-parametric, with a Dunn's Multiple Comparisons post hoc test. For IL-1β treatment, CCL2, Friedman<0.0001, Dunnett’s p<0.001 at 6 hours, p<0.05 at 24 hours, Fig.3a; CXCL8, ANOVA<0.0001, Dunnett’s p<0.001 at 6 hours, p<0.01 at 24 hours, Fig.3b; CXCL1, Friedman=0.0007, Dunnett’s p<0.01 at 6 hours, Fig3c; CCL5 , Friedman=0.0015, Dunnett’s p<0.05 at both 6 and 24 hours, Fig. 3d; CXCL5, Friedman=0.0015, p<0.05 at 24 hours Fig. 3e; CCL20, ANOVA=0.0019, Dunnett’s p<0.05 at 1 hour, Fig. 3f. For TNFα treatment, CCL2, ANOVA<0.0001, Dunnett’s p<0.001 at 6 and 24 hours, Fig.3a; CXCL8, Friedman=0.0006, Dunnett’s p<0.01 for 6 hours, p<0.05 for 24 hours, Fig.2b; CXCL1, ANOVA<0.0001, Dunnett’s p<0.001 at 1 hours, Fig2c; CCL5 , Friedman=0.0007, Dunnett’s p<0.05 at 1 hour, Fig. 2d; CXCL5, Friedman<0.0001, Dunnett’s p<0.05 at 6 hours, p<0.001 at 24 hours, Fig. 3e; CCL20, ANOVA=0.0004, Dunnett’s p<0.001 at 1 hour, p<0.05 at 6 hour, Fig. 2f. Data are shown as the median, the 25th and 75th percentiles and the range, and * indicates p<0.05. ** indicates p<0.01, *** indicates p<0.001.

Figure 3.6 Cytokines induced the expression of chemokines.

Human myometrial cells were pre-incubated with IL-1β for 0 and 24 hours. The supernatant was collected, and the protein levels of chemokines in stretched cell culture medium were measured by ELISA. Data are expressed as median and range, n=8 for this experiment. Wilcoxon matched pairs test was performed. CCL2, Wilcoxon=0.0313, Dunnett’s p<0.05; CXCL8, Paired t test<0.0001, Dunnett’s p<0.001; CXCL1, Paired t test<0.0001, Dunnett’s p<0.001; CCL5, Paired t test=0.0125, Dunnett’s p<0.05; CXCL5, Paired t test=0.0435, Dunnett’s p<0.05, CCL20, Wilcoxon=0.0156, Dunnett’s p<0.05and * indicates p<0.05. ** indicates p<0.01, *** indicates p<0.001

Chapter 3. Myometrial chemokine expression and regulations

Table 3.1 The effects of MAPK and NF-κB P65 inhibitors on cytokines induced chemokine expression (percentage changes compared to IL-1β or TNFα treatment alone in 1, 6 and 24 hours, respectively)

Cytokines increased chemokine expression at various time points (data not shown). Data were shown as percentage of IL-1β/TNFα treatment alone, ANOVA Test was used if data were parametric, and Friedman’s Test if data were non-parametric, with a Dunn's Multiple Comparisons post hoc test. Data are shown as the median, the 25th and 75th percentiles and the range. * indicates p<0.05. ** indicates p<0.01, *** indicates p<0.001.

3.2.5 The effects of pro-labour protein on chemokines expression on myometrium

Treatment of myometrial cells with PGE2, PGF2α and oxytocin (100nM/ml) had an inhibitory effect on chemokine mRNA expressions, being most marked for oxytocin treatment and least for PGE2 (Fig. 3.7a-f). Incubation with oxytocin (100nM/ml) also reduced the levels of chemokines in the culture supernatant (Fig.3.8).

Chapter 3. Myometrial chemokine expression and regulations

1000

100 * * * *

CCL2:GAPDH(%CONTROL) 1 1h 6h 1h 6h 24h 2 2 24h 2 2a 2a 2a PGE PGE PGE PGF PGF PGF CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

10000

1000

100 ** * ** * ** 10

CXCL8:GAPDH (%CONTROL) 0.1 1h 1h 6h 6h 2 2 24h 24h 2a 2a 2 2a PGE PGE PGF PGF PGE PGF CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

Chapter 3. Myometrial chemokine expression and regulations

10000 *

1000

100 * *

CXCL1:GAPDH(%CONTROL) 0.1 1h 6h 1h 6h 2 2 24h 24h 2a 2a 2 2a PGE PGE PGF PGF PGE PGF CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

10000

100 * *

0.01 CCL5:GAPDH(%control) 0.0001 1h 6h 1h 6h 2 2 24h 24h 2a 2a 2 2a PGE PGE PGF PGF PGE PGF CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

Chapter 3. Myometrial chemokine expression and regulations

10000

1000

100 *** *** *** *** *** *** 10

1 CXCL5:GAPDH (%CONTROL) 0.1 1h 6h 1h 6h 2 2 24h 24h 2a 2a 2 2a PGE PGE PGF PGF PGE PGF CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

10000

1000 100 *** ** 10

0.1

0.01

0.001

0.0001

CCL20:GAPDH(%CONTROL) 0.00001 1h 6h 1h 6h 2 2 24h 24h 2a 2a 2 2a PGE PGE PGF PGF PGE PGF CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

Figure 3.7 a-f The effect of pro-labour protein on chemokine expression. a-f: Human myometrial cells were incubated with or without 10nM PGE2, PGF2a and 100nM oxytocin for 1, 6 and 24 hours. At the end of incubation RNA was extracted and converted to cDNA. Copy numbers of chemokine, including CCL-2, CCL5, CCL20, CXCL1, CXCL5, CXCL8 were measured by quantitative rtPCR. n=6 for this experiment, data analysed using ANOVA Test if data were parametric, and Friedman’s

Chapter 3. Myometrial chemokine expression and regulations

Test if data were non-parametric, with a Dunn's Multiple Comparisons post hoc test. CCL2,

ANOVA<0.0001, Dunnett’s p<0.001 at PGE2 6 hours, p<0.05 at PGF2α 1 hour, oxytocin 1, 6 and 24 hours,

Fig. 4a; CXCL8, Friedman=0.0007, Dunnett’s p<0.01 at PGE2 24 hours, oxytocin 24 hours and PGF2α 24 hours, p<0.05 for both PGF2α at 6 hour and oxytocin at 24 hours Fig.4b; CXCL1, Friedman=0.0003,

Dunnett’s p<0.05 for both PGE2 1 hour and oxytocin 24 hours, p<0.001 for PGF2α at 1,6 and 24 hours,

Fig.4c; CCL5, Friedman=0.002, Dunnett’s p<0.05 for both PGE2 and oxytocin at 1 hour, Fig.4d; CXCL5,

ANOVA<0.0001, Dunnett’s p<0.001 for all time points of PGF2α and oxytocin treatments, Fig.4e; CCL20,

ANOVA<0.0001, Dunnett’s p<0.001 for PGF2α 24 hours, p<0.01 for oxytocin 1 hour, Fig.4f. Data are shown as the median, the 25th and 75th percentiles and the range, and * indicates p<0.05. ** indicates p<0.01, *** indicates p<0.001.

Figure 3.8 The effect of pro-labour gene on chemokine expression.

Human myometrial cells were pre-incubated with IL-1β for 0 and 24 hours. The supernatant was collected, and the protein levels of chemokines in cell culture medium were measured by ELISA. Data are expressed as median and range, n=8 for this experiment. Wilcoxon matched pairs test was performed. CCL2, Paired t test=0.0005, Dunnett’s p<0.001, Fig.4g; CXCL8, Wilcoxon=0.0078, Dunnett’s p<0.01; CXCL1, Paired t test=0.0003, Dunnett’s p<0.001; CCL5, Paired t test=0.0498, Dunnett’s p<0.05; CXCL5, Paired t test=0.0229, Dunnett’s p<0.05; CCL20, Wilcoxon=0.0156, Dunnett’s p<0.05, and * indicates p<0.05. ** indicates p<0.01, *** indicates p<0.001. 74

Chapter 3. Myometrial chemokine expression and regulations

3.2.6 The migration of L1.2 cells (B cell line) into IL-1β treated myocytes culture medium

To determine whether the chemokines released by myometrial cells were bioactive, chemotaxis assays was performed using CCR2 and CXCR1 transfectants and a series of dilutions of IL-1β treated myometrial cells culture medium. Both sets of transfectants migrated to the diluted supernatants with the typical bell-shaped dose response curves, while naive cells which were not transfected were unresponsive (Fig.9a&b) suggesting that the CCR2 and CXCR2-specific chemokines detected in the supernatant by ELISA (CCL2, CXCL1, CXCL5 and CXCL8) were biologically active and able to recruit leukocytes.

Chapter 3. Myometrial chemokine expression and regulations

Figure 3.9 Chemotaxis assay.

Primary cultured myometrial cells were incubated with 1ng/mL IL-1β, supernatant was harvested after 24 hours. The ability of L1.2 transfectants expressing CCR2 (a) or CXCR2 (b) and negative controls to migrate in response to a series of dilutions of the supernatant was subsequently assessed by chemotaxis. Data are mean±SEM for n = 4.

Chapter 3. Myometrial chemokine expression and regulations

3.3 Discussion

This study shows that human myometrial chemokine expression generally increases with the advancing gestation and again at the onset of labour, CCL2 and CXCL8 increasing with term labour in both upper and lower uterine segments and CCL5, CXCL5 and CCL20 in preterm labour in the lower uterine segment only. These changes might be driven by inflammation and mechanical stretch since in myometrial cultures, stretch, IL-1β and TNFα all increased chemokine expression

via both NF-κB and MAPK pathways. In contrast, the pro-labour proteins, PGF2α and oxytocin, decreased the expression of myometrial chemokines. These data suggest that myometrial chemokine expression increases before the onset of human labour, potentially in response to stretch and/or inflammatory cytokines and may therefore play an important role in its onset and progression.

Both PTL and TL in the human is characterised by a marked increased myometrial inflammatory infiltration composed of macrophages, neutrophils and T- lymphocytes 17. The primary role of the infiltration is still not clear, but may contribute to the onset of labour or to uterine remodelling after delivery. I focussed on the chemokines previously found to be increased in a study of term labouring myometrium167, and found two distinct patterns. CCL2 and CXCL8 mRNAs were elevated in the upper and lower segments of TL only (the expression of CXCL1 mRNA followed a similar pattern, but did not reach significance in the lower segment samples because of one outlying sample), while CCL5, CCL20 and CXCL5 mRNA were increased in PTL lower segment myometrium only. It is clear that different subsets of chemokines may attract specific inflammatory cells, determined by their chemokine receptor expression. For example, Th2 cells mainly express CCR4, while Th1 cells express high level of CCR5, which will be attracted by CCL5, CCL3 and CCL4281, which bind to CCL2, CCL5 and CCL17. Consequently, I might expect to see different subtypes of inflammatory cells in TL and PTL, but this has yet to be studied. The distinct patterns of chemokine expression in TL and PTL may

Chapter 3. Myometrial chemokine expression and regulations

reflect differences in aetiology and/or role, for example, in PTL the inflammatory infiltration may contribute to the onset of labour, while in TL, its role might be to remodel the uterus after labour. I then investigate which factors regulate myometrial chemokine expression and then to define which intracellular pathways were involved to see if either approach could explain the differential expression of the chemokines in term and preterm labour.

Pathway analysis of a human labour gene array data suggested that the onset of human labour was initiated by inflammatory stimulation, rather than either of the other two alternatives that were considered, functional progesterone withdrawal or oxytocin receptor activation 282. Consistent with this idea, our group found previously that IL-1β and IL-6 mRNA expression was increased with the onset of labour in lower segment myometrium, interestingly, although CXCL8 increased with advancing gestation in this study, the expression of IL-1β and IL-6 did not 103. These data suggest that chemokine expressions increase first followed by an influx of inflammatory cells, which then increase local cytokine levels. These Inflammatory cytokines may then act to increase myometrial contractility directly and/or through increased PG synthesis.

In this study, I found that incubating myometrial cells with IL-1β and TNFα markedly increased CXCL1, CCL2 and CXCL8 mRNA expression, but had a lesser effect on CXCL5, CCL5 and CCL20 mRNA expression. This is similar to the pattern I observed in labouring myometrium, where CCL2, CXCL8 and CXCL1 mRNAs were increased in the upper and lower myometrial segments with TL and CXCL5, CCL5 and CCL20 mRNAs were only elevated in the lower uterine segment in PTL. Further, I found that the IκK-2 inhibitor, TPCA-1, which reduces NF-κB activation, markedly blocked cytokine-driven CCL2, CXCL8 and CXCL1 mRNA expression. These data suggest that the chemokine expression of TL is driven by inflammation in general and the activation of NF-κB specifically. These data are consistent with previous reports of increased NF-κB activity with human labour 226,283 and previous data from group, which showed that p65 over-expression, drove chemokine expression

Chapter 3. Myometrial chemokine expression and regulations

278. Although these data show clearly that chemokine expression can be driven by inflammatory cytokines, it is clear that the inflammatory cytokines only increase with the onset of labour and not with advancing gestation 103. Therefore, which process initiates the increase in myometrial chemokine expression, is unclear. The withdrawal of progesterone suppression is one possible explanation, however some studies analysis suggests that progesterone withdrawal is secondary to inflammation and not vice versa 282. During pregnancy, the growing conceptus distends the uterus, subjecting the myometrium to progressively greater degrees of stretch, which our group have previously found to up-regulate the expression and synthesis of various labour associated genes including COX-2 and CXCL8 284,285 in a MAPK-dependent manner 280. Uterine stretch has also been shown to be responsible for the pre-parturition increase in CCL2 in myometrium in rats279. In this study, I found that stretch of myometrial cells increased the mRNA expression and synthesis of several chemokines. It is possible that increased uterine stretch caused by the growing conceptus would drive the increase in myometrial chemokine expressions and induce an inflammatory infiltration 279 so reversing the pro-gestational dominance and ultimately bringing about the onset of labour.

Finally, I investigated whether pro-labour proteins could drive chemokine expression, since I reasoned that if the inflammatory infiltration promoted uterine remodelling in the post partum, then the process of labour could be expected to drive chemokine expression. However, I found that oxytocin and PGF2α in virtually all cases decreased the mRNA expression of chemokines, suggesting that the labour associated increase in chemokine expression is not induced by oxytocin, PGE2 or

PGF2α. Interestingly, oxytocin has been reported to have an anti-inflammatory effect in humans, reducing the endotoxin-induced increase in plasma cytokines and chemokines 286.

This study highlights an intriguing differential expression of chemokines in term labour and preterm labour. This study suggests that uterine stretch may initiate the elevation in chemokine expression leading to the infiltration of the myometrium by 79

Chapter 3. Myometrial chemokine expression and regulations

activated inflammatory cells. These in turn release cytokines, which drive further chemokine expressions creating a positive feedback loop which culminates in the onset of labour. Given the key role played by NF-κB p65 in both stretch and inflammatory cytokine-induced chemokine expression agents that modulate its activity might be of potential therapeutic benefit in the management of preterm delivery. Indeed, inhibition of NF-κB p65 activity through various means has been shown to successfully prevent preterm delivery in some animal models 263,287,288. It remains to be seen whether inhibition of NF-κB activity is of therapeutic benefit in human preterm delivery.

Chapter 4. Myometrial chemokine receptor expression and regulations

Chapter 4. Myometrial chemokine receptor expressions and regulations

Chapter 4. Myometrial chemokine receptor expression and regulations

4.1 Introduction

Labour is characterized by an marked inflammatory cells into the myometrium and cervix 9-13. Leukocytes migrate to sites of inflammation in response to chemokines139, which act through seven-transmembrane domain G protein-coupled receptors termed chemokine receptors. Seven CXC (CXCR1–7), ten CCR (CCR1–10), one CX3CR (CX3CR1), and one CR (XCR1) chemokine receptor has been identified 140. The CC chemokines mainly interact with lymphocytes, macrophages, and monocytes 141. Neutrophils express a very limited number of chemokine receptors

142-144 , predominantly receptors of the CXC or CX3C family, in particular CXCR1 and CXCR2 145 and consequently, with the exception of CXCR1/CXCR2 ligands, the majority of chemokines have no functional effect on human neutrophils 146. It is not yet known which chemokine receptor interactions trigger which corresponding intracellular pathway. It is suggested that when bound by the same chemokine different receptors may elicit distinct functional responses. For example, CXCR1 and CXCR2 mediate changes in Ca+2, release of granule enzymes and chemotaxis when bound by CXCL8. However, CXCR1 also specifically activates phospholipase D 147,148. Prior to and during labour it is likely that specific subsets of pro-inflammatory chemokines direct uterine and cervical leukocyte homing and control their behaviour on arrival. CXC chemokines CXCL1, CXCL2, CXCL3, CXCL5 and CXCL8, CC chemokines CCL2, CCL5 and CCL20 are up regulated in myometrium in term labour (Chapter 3). It is suggested that the CXC chemokines exert their effect via CXCR1 and CXCR2 on neutrophils expressed and that, CC chemokines act via CCR1, CCR2 and CCR6 to recruit monocytes as observed in the myometrium of spontaneous labour and LPS-induced preterm labour 165,167.

Chemokine receptors are expressed in the uterus, where they are held to play an important role in the physiology and pathology of the human reproductive system 178. CCR5 was found in human endometrium throughout the menstrual cycle while the expression of CXCR1 was reported to reach a peak in the mid-secretory phase

Chapter 4. Myometrial chemokine receptor expression and regulations

179. In leiomyoma, CCR3 is increased in the myometrium of patients with submucosal fibroids 178. CXCR2, CXCR3 and CXCR4 expression was increased in human endometriosis samples 180 perhaps suggesting a role in its pathogenesis. Myometrial cells express chemokine receptors 192, in the case of CXCL8, our group have previously shown that it alters prolabour gene expression and others have shown that it drives fibroid proliferation 289. The receptor for CXCL8 was reported to decline with pregnancy and further with the onset of labour previously 290, but the behaviour of other chemokine receptors and their functional significance is unknown. In this study, I have investigated the expression of the chemokine receptors, CCR2, CXCR1 and CXCR2, in human myometrium throughout pregnancy and after the onset of preterm and term labour. The factors that may regulate their expression and the intracellular pathways involved have also been assessed.

Chapter 4. Myometrial chemokine receptor expression and regulations

4.2 Results

4.2.1 Myometrial expression of chemokines in pregnancy and labour

During pregnancy, only CXCR1 declined with advancing gestation (-0.4683, p=0.0337). in the non-labouring lower segment myometrial samples only (Fig4.1e). There were no changes in either upper or lower segments with the onset of PTL, but with term labour, all 3 receptors declined in upper segment samples (p<0.05-0.01, Fig4.1a-c) and showed a trend to decline in lower segment myometrial samples as well.

Chapter 4. Myometrial chemokine receptor expression and regulations

d 100

10 r = -0.4683

CXCR1:GAPDH 0.1

0.01 20 25 30 35 40 45 Wks

Figure 4.1 Gene expression of CCR2, CXCR1 and CXCR2 in upper and lower PTL, PTNL, TL and TNL myometrium. a-c:Paired upper and lower segment human myometrial samples were obtained from four groups of women (mean gestational age ± SD in each case), at preterm no labour (PTNL; 31.5 ± 3.5 wks; mean ± SD; n=8), PTL (32.3 ± 4.1 wks; n=8), term no labour (TNL; 38.0 ± 1.2 wks; n=8) or TL (39.4 ± 0.5 wks; n=8). See Table 2.3 for details regarding the phenotype of the samples. Messenger RNA expression was measured by quantitative rtPCR. n=8 for this experiment. Comparisons were made between groups using a Wilcoxon

Chapter 4. Myometrial chemokine receptor expression and regulations

test. * indicates p<0.05. ** indicates p<0.01. d: Non-parametric correlation test was performed between gestational age and myometrial chemokine expression, spearman r was shown. a semilog line was drawn base on the nonlinear regression.

4.2.2 Mechanical stretch increased myometrial chemokine receptor expression

Chemokine receptor mRNA expression was assessed after myometrial cells were subjected to 16% of stretch for 0, 1, 3 and 6 hours. CCR2 mRNA expression was increased at 1 and 6 hours (both p<0.05, Fig4.2a) and CXCR1 was increased at 6 hours only (p<0.01, Fig4.2b).

a 300 * * 200

100 (100%control) CCR2:GAPDH

0 CONTROL

STRETCH1h STRETCH3h STRETCH6h

b 400

300 **

200

100 (100%control) CXCR1:GAPDH

0 CONTROL STRETCH 1h STRETCH 3h STRETCH 6h 86

Chapter 4. Myometrial chemokine receptor expression and regulations

c 250

200

150

100 (%CONTROL)

CXCR2:GAPDH 50

0 CONTROL

STRETCH 1h STRETCH 3h STRETCH 6h STRETCH

Figure 4.2 Stretch induced the expression of myometrial chemokine receptors.

Human uterine smooth muscle cells were exposed to 16% stretch for 0, 1, 3 and 6 hours. mRNA was extracted and measured using quantitative rtPCR, n=6. Data were analysed using a Paired T-test or with a Wilcoxon Test depending on the data distribution. CCR2, p=0.0313 at 1 and 6 hours, Fig.2a; CXCR1, p=0.0046 at 6 hours, Fig.2b. Data are shown as the median, the 25th and 75th percentiles and the range. * indicates p<0.05. ** indicates p<0.01.

4.2.3 Cytokines reduce the expression of myometrial chemokine receptors

Chemokine receptor mRNA expression was assessed after myometrial cells were exposed to TNFα (10ng/ml), IL-1β (10ng/ml) and CXCL8 (10ng/ml) for 1, 6 and 24 hours. CCR2 mRNA expression was reduced by CXCL8 (10ng/ml) at 24 hours (p<0.05, Fig.3a) and CXCR2 reduced by IL-1β at 24 hours (p<0.01, Fig.3c), by TNFa at 1 and 24 hours (both p<0.05, Fig4.3c) and CXCL8 at 1 and 6 hours (p<0.01 and 0.05 respectively, Fig4.3c).

There was a relationship between the myometrial mRNA expression of CXCL8 and both CXCR1 (r=-31, p=0.04) and CXCR2 (r=-0.33, p=0.03), but not between CCL2 and CCR2 (r=-0.19, p=0.15) in labouring upper and lower segment samples.

Chapter 4. Myometrial chemokine receptor expression and regulations

a 10000

1000

100 *

10 CCR2:GAPDH

(100%control) 1

0.1 1h 1h 6h 6h β 24h 24h α α β β α Control IL-1 Control Control IL-1 TNF TNF IL-1 TNF CXCL8 1h CXCL8 6h CXCL8 24h

b 10000

1000

100

10 (100%control) CXCR1:GAPDH

1 1h 1h 6h 6h β 24h 24h α α β β α Control IL-1 Control Control IL-1 TNF TNF IL-1 TNF CXCL8 1h CXCL8 6h CXCL8 24h

Chapter 4. Myometrial chemokine receptor expression and regulations

c 1000

* 100 ** * * ** 10 (100%control) CXCR2:GAPDH

1 1h 1h 6h 6h β 24h 24h α α β β α Control IL-1 Control Control IL-1 TNF TNF IL-1 TNF CXCL8 1h CXCL8 6h CXCL8 24h

Figure 4.3 Cytokines reduced the expression of chemokine receptors.

4.3a-4.3c: Human uterine smooth muscle cells were incubated with or without 1ng/mL IL-1β, TNFα or IL-8 for 1, 6 and 24 hours. At the end of incubation RNA was extracted and converted to cDNA. Copy numbers of chemokine receptor mRNA were measured by quantitative rtPCR. n=6 for this experiment, data analysed using ANOVA Test if data distribution was parametric, and Friedman’s Test if data distribution was non-parametric, with a Dunn's Multiple Comparisons post hoc test. CCR2, Friedman<0.0001, Dunnett’s p<0.05 at 24 hours with IL-8 treatment, Fig.3a; CXCR2, Friedman<0.0001, Dunnett’s p<0.01 at 24 hours with IL-1β treatment, p<0.05 at 1 and 24 hours with TNFα treatment, p<0.01 at 1 hour and p<0.05 at 6hours with IL-8 treatment, Fig.3b. Data are shown as the median, the 25th and 75th percentiles and the range, and * indicates p<0.05. ** indicates p<0.01, *** indicates p<0.001.

4.2.4 Prostaglandins and oxytocin reduce the expression of myometrial chemokine receptors

Chemokine receptor mRNA expression was assessed after myometrial cells were exposed to PGE2, PGF2αand oxytocin (100nM). CCR2 mRNA expression was reduced by PGF2α at 6 and 24 hours (p<0.05 and p<0.01 respectively, Fig4.4a) and by oxytocin at 1, 6 and 24 hours (for all p<0.001, Fig4.4a). CXCR1 mRNA expression was reduced by PGE2 at 24 hours (p<0.05, Fig4.4b), by PGF2α at 6 and 24 hours (p<0.05 and p<0.01 respectively, Fig4.4b) and by oxytocin at 24 hours (p<0.01,

Chapter 4. Myometrial chemokine receptor expression and regulations

Fig4.4b). CXCR2 mRNA expression was reduced by PGE2 at 24 hours (p<0.001,

Fig4.4c), by PGF2α at 24 hours (p<0.05, Fig4.4c) and by oxytocin at 24 hours (p<0.001, Fig4.4c). I used western analysis to confirm the reduction in CCR2 induced by both PGF2α and oxytocin (Fig4.4d) and flow cytometry for each receptor for the reductions induced by oxytocin (Fig4.4e-g).

a 10000

1000 100 * 10 ** *** *** 1 *** %CONTROL CCR2:GAPDH 0.1

0.01 1h 6h 1h 6h 2 2 α α 24h 24h 2 2 2 α 2 PGE PGE PGF PGF PGE PGF CONTROL CONTROL CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

b 100000

10000

1000

100 * * ** ** 10 %CONTROL CXCR1:GAPDH 1

0.1 6h 1h 1h 6h 2 2 α α 24h 24h 2 2 2 α 2 PGE PGE PGF PGF PGE PGF CONTROL CONTROL CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

Chapter 4. Myometrial chemokine receptor expression and regulations

c 1000

100

10 ***

1 * 0.1

%CONTROL 0.01 *** CXCR2:GAPDH

0.001

0.0001 1h 6h 1h 6h 2 2 α α 24h 24h 2 2 2 α 2 PGE PGE PGF PGF PGE PGF CONTROL CONTROL CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

Chapter 4. Myometrial chemokine receptor expression and regulations

d CCR2 1 hour

6 hours

24hours IL#1β!!!!!!!!!!!!!!!!!!!!# ++++++++++++++++#+++++++++++# +++++++#+++++++++++#+ TNF#α #++++++++++#+++++++++++++++++++++++#++++++++++++#+++++++++++#+ IL#8+ #++++++++++#++++++++++++#+++++++++++++++++++++++#+++++++++++#+ PGF2α!!!!!!!!!!!!!!!!!!!!!!!#++++++++++#++++++++++++#++++++++++#++++++++++++++++++++++++#+ Oxytocin+!!!!!!!!!!!!!!!#++++++++++#++++++++++++#++++++++++#++++++++++++#+++++++++++++ 1h 6h

5000 24h

4000 * 3000

-actin * β 2000 **** CCR2:

1000

0 IL-8 IL-8 IL-8 IL-1b IL-1b IL-1b control control control TNF-a TNF-a TNF-a PGF2a PGF2a PGF2a Oxytocin Oxytocin Oxytocin

Chapter 4. Myometrial chemokine receptor expression and regulations

e f Human$myometrium$cells$ Human$myometrium$cells$

CCR2$ CXCR1$

g Human$myometrium$cells$

CXCR2$

Figure 4.4 The effect of pro-labour gene on chemokine receptors expression.

Human uterine smooth muscle cells were incubated with or without 10nM PGE2, PGF2a and 100nM oxytocin for 1, 6 and 24 hours. At the end of incubation mRNA was extracted and converted to cDNA. Copy numbers of chemokine receptor mRNA were measured by quantitative rtPCR. n=6 for this experiment, data analysed using ANOVA Test if data distribution was parametric, and Friedman’s Test if data distribution was non-parametric, with a Dunn's Multiple Comparisons post hoc test. CCR2,

Friedman<0.0001, Dunnett’s p<0.05 at PGF2a 6 hour, p<0.01 at PGF2a 24 hour, p<0.001 at oxytocin 1, 6 and 24 hours, Fig. 4a; CXCR1, Friedman<0.0001, Dunnett’s p<0.05 at PGE224 hours and PGF2a 6 hours, p<0.01 for both PGF2a at 24 hour and oxytocin at 24 hours, Fig.4b; CXCR2, Friedman<0.0001, Dunnett’s p<0.05 for PGF2a 24 hours, p<0.001 for PGE2 and oxytocin at 24 hours, Fig.4c. Data are shown as the median, the 25th and 75th percentiles and the range, and * indicates p<0.05. ** indicates p<0.01, ***

Chapter 4. Myometrial chemokine receptor expression and regulations

indicates p<0.001. 4.4d: Human uterine smooth muscle cells were incubated with or without 1ng/mL IL-

1β, TNFα or IL-8, 10nM PGF2a and 100nM oxytocin for 1, 6 and 24 hours. At the end of incubation protein was extracted. Protein expression of CCR2 was measured by Western blot. n=4 for this experiment, densitometry was measured and analysed using Paired t-test, p<0.05 at 6 hours and p<0.01 at 24 hours with

PGF2a and oxytocin. Data are shown as mean±SEM, and * indicates p<0.05. ** indicates p<0.01. 4.4e- 4.4g: Human uterine smooth muscle cells were pre-incubated with oxytocin for 0 and 24 hours. Cells were collected, and the CCR2 on cell surface was measured by FACS. n=4 for this experiment.

4.2.5 PGF2α and oxytocin down-regulate myometrial chemokine receptor mRNA expression via PLC and not PKC

Incubation of PGF2αand oxytocin (100nM) in the absence of U73122, a PLC inhibitor, at 6 and 24 hours prevented the reduction chemokine receptor expression (Fig4.5a- f), but GF109203X, a PKC inhibitor did not (Appendix 2).

a 1000 *

# # 100 (100%control) CCR2:GAPDH

10 CONTROL Oxytocin 6h Oxytocin 24h PLC inhibitor 6H PLC inhibitor 24H Oxytocin+ PLC inhibitor 6H Oxytocin+ PLC inhibitor 24H

Chapter 4. Myometrial chemokine receptor expression and regulations

b 1000 *

100 # # %CONTROL CXCR1:GAPDH

10 CONTROL Oxytocin 6h Oxytocin 24h PLC inhibitor 6H PLC inhibitor 24H Oxytocin+ PLC inhibitor 6H Oxytocin+ PLC inhibitor 24H

1000

** ## ## 100 %CONTROL CXCR2:GAPDH

10 CONTROL Oxytocin 6h Oxytocin 24h PLC inhibitor 6H PLC inhibitor 24H Oxytocin+ PLC inhibitor 6H Oxytocin+ PLC inhibitor 24H

Chapter 4. Myometrial chemokine receptor expression and regulations

d 1000

* # 100 # (100%control) CCR2:GAPDH

10 6h α 24h 2 α 2 PGF PGF CONTROL PLC inhibitor 6h PLC inhibitor 24h + PLC inhibitor 6h α + PLC inhibitor 24h 2 α 2 PGF PGF

e 1000 * *

# # 100 %CONTROL CXCR1:GAPDH

10 6h α 24h 2 α 2 PGF PGF CONTROL PLC inhibitor 6h PLC inhibitor 24h + PLC inhibitor 6h α + PLC inhibitor 24h 2 α 2 PGF PGF

Chapter 4. Myometrial chemokine receptor expression and regulations

f 1000

* # # 100 %CONTROL CXCR2:GAPDH

10 6h α 24h 2 α 2 PGF PGF CONTROL PLC inhibitor 6h PLC inhibitor 24h + PLC inhibitor 6h α + PLC inhibitor 24h 2 α 2 PGF PGF

Figure 4.5 Pro-labour protein reduced chemokine receptor expressions via PLC.

Human uterine smooth muscle cells were incubated with or without 10nM PGF2a, 100nM oxytocin, PGF2a +PLC inhibitor or oxytocin+ PLC inhibitor for 6 and 24 hours. At the end of incubation mRNA was extracted and converted to cDNA. Copy numbers of chemokine receptor mRNA were measured by quantitative rtPCR. n=6 for this experiment, data analysed using ANOVA Test if data distribution was parametric, and Friedman’s Test if data distribution was was non-parametric, with a Dunn's Multiple Comparisons post hoc test. CCR2, Friedman ＝ 0.0018, Dunnett’s p<0.05 at oxytocin 6 hours, oxytocin+PLC inhibitor 24 hours and PGF2a +PLC inhibitor 6 hours, p<0.01 at oxytocin 24 hours and

PGF2a +PLC inhibitor 24 hours, p<0.001 at PGF2a 6 and 24 hours, Fig. 5a and 5d; CXCR1,

Friedman=0.0022, Dunnett’s p<0.05 at oxytocin+PLC inhibitor 6 hours, PGF2a +PLC inhibitor 6 hours and

24 hours, p<0.01 for both PGF2a at 6 and 24 hour, p<0.001 for oxytocin at 6 and 24 hours, Fig.5b and 5e;

CXCR2, Friedman=0.0022, Dunnett’s p<0.05 for PGF2a +PLC inhibitor 24 hours, p<0.01 for oxytocin 6 hours, oxytocin+PLC inhibitor 24 hours and PGF2a 6 hours, p<0.001 for oxytocin at 24 hours, Fig.5c and 5f. Data are shown as the median, the 25th and 75th percentiles and the range, and * indicates p<0.05. ** indicates p<0.01, *** indicates p<0.001 when comparing gene expression under PGF2a alone with PGF2a

+PLC inhibitor at the same time point; # indicates p<0.05 when comparing control with PGF2a alone.

Chapter 4. Myometrial chemokine receptor expression and regulations

4.2.6 Cell culture

I found that myometrial chemokine receptor mRNA expression did not change in prolonged culture at 1, 6 and 24 hours (Appendix 3).

Chapter 4. Myometrial chemokine receptor expression and regulations

4.3 Discussion

In this study, I found that the expression of the myometrial chemokine receptors CCR2 CXCR1 and CXCR2 was reduced with TL, but unaffected by PTL. My in vitro studies showed that both oxytocin and PGF2a reduced chemokine receptor expression in cultured myometrial cells via PLC, while inflammatory cytokines had less marked, but still negative effect and mechanical stretch tended to increase expression. Previously, our group has shown that CXCR1/2 are functional and in this study I found that CXCL8 reduced the expression of CXCR2 consistent with the negative relationship observed between the expression of CXCL8 and CXCR2 in labouring myometrial samples. The reduction in chemokine receptor expression with the onset of labour suggests that these receptors may act as decoys during pregnancy, limiting the response to myometrial chemokines.

In an earlier chapter, I reported that a distinct pattern of expression of myometrial chemokine mRNA in relation to TL and PTL existed (Chapter 3), TL was characterised by an increase in CXCL8 and CCL-2 in both upper and lower segments, while PTL was associated with increases in CCL5, CXCL5 and CCL20 in the lower segment myometrium only. In this study, the expression of chemokine receptors was reduced in TL upper segment samples only, although there was a trend for the expression to be reduced in TL lower segment samples too. In contrast, PTL was not associated with any change in chemokine receptor expression, demonstrating again distinct patterns in TL and PTL. . Interestingly, in chapter 3, I found that both CCL2 and CXCL8 were increased in TL only 24 and in this study I found that their respective receptors, CCR2 for CCL2 and CXCR1 and CXCR2 for CXCL8, were also reduced in term labour only. Furthermore, there was a negative correlation between myometrial CXCL8 levels and those of CXCR1 and CXCR2, but in vitro, CXCL8 only down regulated CXCR2 mRNA expression. So, while the increase in

CXCL8 may play a role in the reduction in CXCR2, it seems likely that PGF2α and

Chapter 4. Myometrial chemokine receptor expression and regulations

oxytocin are the prime drivers for the repression of chemokine receptor expression acting via PLC.

CXCR1 and CXCR2 have both been suggested to act as decoys for their ligand, which is CXCL8 291. If myometrial chemokine receptors functioned in this manner, then their relatively high expression during pregnancy would limit the effect of any locally produced chemokines and the inverse when they decline with the onset of labour. This would be consistent with the marked inflammatory infiltration of the myometrium seen with the onset of human labour17. In addition, besides being central to the inflammatory process, chemokines also regulate cell proliferation, migration and angiogenesis 292. Indeed, CXCL8 has been suggested to act as an autocrine growth factor, increasing the proliferation of endometrial stromal cells 293 and fibroids 294. Consequently, CXCL8 may promote myometrial growth during pregnancy, however, with the onset of labour, myometrial cells would need to differentiate into a contractile phenotype and the reduction in the expression of both CXCR1/2 may play a role in this process.

The uterus is subjected to progressively greater stretch longitudinally. In chapter 3, I found that myometrial stretch induced the expression of several pro-labour proteins, such as CXCL8, oxytocin receptor, COX-2 and several chemokines 202,219,284. In this study, I found that stretch induced the expression of myometrial CCR2 and CXCR1 mRNA expression, suggesting that it does not play a role in the labour associated decline in chemokine receptor expression. Similarly, the effect of the cytokines was inconsistent, in the case of CXCR1; they had no effect, while in the case of CXCR2 both IL-1β and TNFα reduced its expression. Since both IL-1β and TNFα increase in labour 103 they may contribute to the decline in CXCR2 expression, interestingly, TNFα has been reported to down-regulate CXCR1 and CXCR2 expression in other cell types 295.

100

Chapter 4. Myometrial chemokine receptor expression and regulations

I have shown that chemokine receptors decline with the onset of labour, probably in

response primarily to increased levels of oxytocin and PGF2α , but with a less important effect of the inflammatory cytokines. In the case of CXCR2, the increased expression of CXCL8 may also repress its expression. The decline in myometrial chemokine receptor expression may increase the effect of locally produced chemokines or even promote the generation of a contractile phenotype.

101

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

102

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

5.1 Introduction

Since labour is an inflammatory process chemokines should be involved. Different chemokines act to recruit specific immune cells into areas of inflammation, so that chemokine (C-C motif) ligand 2 (CCL2), also known as monocyte chemotactic protein-1 (MCP-1) mainly recruits monocytes, memory T cells and dendritic cells

296,297 , and the CXC or CX3C chemokines recruit neutrophils primarily via CXCR1 and CXCR2 145. It seems likely that specific chemokines will increase prior to the onset of parturition to direct uterine and cervical leukocyte recruitment and activation. Indeed, CXC chemokines CXCL1, CXCL2, CXCL3, CXCL5 and CXCL8, CC chemokines CCL2, CCL5 and CCL20 have all be shown to be up-regulated in myometrium obtained at the time of term human labour 167 and are probably responsible for the labour associated neutrophil and monocyte myometrial infiltration.

As described in the introduction, the LPS-induced mouse model of PTL has been widely used by several groups. It reliably induces PTL within 24 hours of administration and is associated with high rates of pup death. Increased inflammatory cytokines have been found in myometrium, placenta and pup brain but the impact on chemokine expression has not been investigated. In this section, the expression of murine myometrial chemokines before, during and after normal murine (CD1) pregnancy and the constituents of the myometrial inflammatory infiltration have been described. Further, the effect of intra-uterine LPS injection on myometrial chemokine and cytokine mRNA expression, second messenger activation and COX-2 synthesis has been reported.

103

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

5.2 Results

5.2.1 Chemokine expression in the CD1 mouse uterus with gestation

In all cases except for CCL20, the pattern of myometrial chemokine expression was similar, with expression being reduced in day 6 myometrial samples compared to NP samples and thereafter progressively increasing to peak on day 18 and subsequently remaining static in labouring and postnatal samples (Fig.5.1a-e).

a 0.1 *** *** * 0.01 *

0.001 CCL2:GAPDH

0.0001 E6 E11 E16 E18 T36 during labour Non pregnant

104

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

b 1 **

0.1 * *

0.01

0.001 CCL5:GAPDH 0.0001

0.00001 E6 E11 E16 E18 T36 during labour Non-pregnant

c 0.1

0.01

0.001

CCL20:GAPDH 0.0001

0.00001 E6 E11 E16 E18 T36 during labour Non pregnant

10 5

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

d 0.1 *** ** 0.01 *

0.001

0.0001 CXCL1:GAPDH

0.00001 E6 E11 E16 E18 T36 during labour Non pregnant

e 1000 ** 100 ** 10

CXCL5:GAPDH 0.1

0.01 E6 E11 E16 E18 T36 during labour Non pregnant

Figure 5.1 CD1 mouse myometrial chemokine expression. a-e: Mice were sacrificed before pregnancy (non-pregnant), on days 6, 11, 16 and 18 of pregnancy (E6,11,16,18), in labour (after the birth of the first pup) or 36 hours post delivery (T36). Myometrium from both of the right and left horns was harvested, put on dry ice and stored at -70oC until RNA extraction. Myometrial chemokine mRNA expression was subsequently measured by rt-PCR and expressed as 106

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

median, interquartile range and range. In all cases except CCL20, chemokine expression declined between non-pregnant and E6 samples, and then rose to a peak at E18 and thereafter remained static in samples obtained during labour and 36 hours after delivery. Data were compared to E6 levels using ANOVA followed by Dunn’s post test. * indicates a difference of p<0.05, ** of p<0.01, *** of p<0.001, n=6 at each time point.

5.2.2 Myometrial macrophage and monocyte infiltration.

The changes in chemokine expression were associated with an increase between NP and day 18 samples, macrophages, labelled as CD45+/F4/80+/Gr1- and monocytes, labelled as CD45+/F4/80+/Gr1+ were significantly increased (p<0.05, Fig. 5.2). Neutrophils, labelled as CD45+/ F4/80-/Gr1+, tended to be higher as well (Fig. 5.2).

CD45+/F4/80+/Gr1- CD45+/F4/80-/Gr1+ CD45+/F4/80+/Gr1+ 1.0×1007 *

1.0×1006

1.0×1005 *

1.0×1004

1.0×1003

CELL/GRAM UTERUS 1.0×1002

1.0×1001

1.0×1000 NP NP NP E18 E18 E18

Figure 5.2 Inflammatory cells in non-pregnant and E18 mice myometrium.

At each time point, mice were sacrificed and myometrium harvested and stored in PBS at 4℃. Subsequently, myometrium was digested using collagenase and then incubated with different antibodies. Positive cells were detected by FACS and numbers compared between myometrium obtained from non- pregnant mice and pregnant mice on day 18 of pregnancy. The numbers of macrophages (labelled by CD45+/F4/80+/Gr1-) and monocytes (labelled CD45+/F4/80+/Gr1+) in E18 myometrium were

107

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

significantly higher (p<0.05), neutrophils (labelled CD45+/F4/80-/Gr1+) did not reach significance. Data were analyzed using Mann Whitney test. Data were presented as Mean with SEM, n=3-6. * indicates a significant difference of p<0.05.

5.2.3 Intrauterine LPS injection

A 20µg injection was initially used, however some of the transgenic animals became very sick on this dosage, consequently, on the grounds of animal welfare, the dose was reduced to 10µg. Using 10µg, parturition occurred at 13.9+3.1 hours post LPS injection and at 66.3+33 hours post PBS injection. At 7 hours post LPS, 6% of the pups were alive, 29% were barely alive and 65% were dead, while 100% pups were alive in the PBS injected mice (Chi-square, p<0.001). At the time of labour post LPS, all of the pups were dead, while 100% pups were alive in the PBS injected mice. After the initial analysis I also included a 3 hours time point to investigate pup viability in the LPS model and found that all pups were alive.

150

*** 100

50 delivery time post-op(hours) time delivery

0 CD1+LPS labouring time CD1+PBS labouring time

Figure 5.3 Time of labour.

After intrauterine PBS injection mean time to delivery was 66.3±6. hours and after LPS 13.9±3.9 hours (p<0.001, Fig.5.3a). n=6 for this experiment.

108

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

5.2.4 Myometrial chemokine and cytokine mRNA expression in response to LPS

Myometrial samples were taken at 7 hours and in labour after LPS or PBS injection and chemokine and cytokine mRNA expression compared. In the right (injected) horn at 7 hours, the expression of the chemokines CCL2 (p<0.05, Fig5.4a), was increased in the LPS injected as compared to PBS injected controls. In labouring samples, the expression of the chemokines CCL2, CCL5, CCL20 and CXCL1 and of the cytokines IL-1β and IL-6 was increased (p<0.05-0.01, Fig5.4b).

In the left (non-injected) horn at 7 hours post LPS injection, the expression of the chemokines, CCL5 and CXCL1 (p<0.05, Fig5.4c), was increased; in labouring samples, the expression of all of the chemokines and of IL-6 was increased (p<0.05-0.01, Fig5.4d) Subsequent analyses were performed on the left uterine horn to minimise the effect of the injection itself.

10000

1000 *

100

10 Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 1 IL-6 CCL2 CCL5 IL-1b CXCL1 CXCL5 TNF-a CCL20

LPS 7h right horn

PBS 7h right horn

109

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

b 100000 ** ** ** ** ** ** 10000 *

1000

100 Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 10 IL-6 CCL2 CCL5 IL-1b CXCL1 CXCL5 TNF-a CCL20

LPS labouring right horn

PBS labouring right horn c 100000

* 10000

* 1000

100

Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 1 IL-6 CCL2 CCL5 IL-1b CXCL1 CXCL5 TNF-a CCL20

LPS 7h left horn

PBS 7h left horn

110

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

d 1000000 ** ** 100000 * **

10000 ** **

1000

100 Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 10 IL-6 CCL2 CCL5 IL-1b CXCL1 CXCL5 TNF-a CCL20

LPS labouring left horn

PBS labouring left horn

Figure 5.4 Myometrial chemokine and cytokine mRNA expression in response to LPS.

Mice were sacrificed at 7 hours after injection of LPS or PBS and at the time of labour (after the birth of the first pup). Myometrium was harvested, put on dry ice and stored at -70oC until RNA extraction. Myometrial chemokine mRNA expression was subsequently measured by rt-PCR and expressed as median, interquartile range and range. In the right (injected) horn at 7 hours in the LPS injected as compared to PBS injected controls, the expression of the chemokines CCL2 (p<0.05, Fig5.4a) was increased; in labouring samples, the expression of all chemokines and cytokines was increased (all p<0.05, Fig5.4b). In the left (non-injected) horn at 7 hours post LPS injection, the expression of the chemokines, CCL5, CXCL1, CXCL5 (all p<0.05, Fig5.4c), was increased; in labouring samples, the expression of all chemokines and of IL-1β and IL-6 was increased (all p<0.05, Fig5.4d). Data were analyzed using Friedman test followed by Dunn’s post test, n=6 for this experiment.

111

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

5.2.5 The effect of LPS on the phosphorylation of ERK1/2, p65 and c-jun and the levels of COX in myometrium (left horn).

1. Non-pregnant and day 16 of pregnant mice.

The phosphorylation of ERK1/2 and the levels of COX-2 were increased (p<0.01 for all), while the phosphorylation of c-jun was reduced (p<0.01) and of p65 unchanged in the day 16 myometrial samples compared to the NP samples (Fig.5.5a).

2. LPS vs. PBS injected at 7 hours and in labour

At 7 hours post injection, LPS administration increased the phosphorylation of ERK1/2 and p65 (p<0.001 and p<0.01 respectively, Fig5.5b). The phosphorylation of c-jun and COX-2 levels were unaffected (Fig5.5b). In labouring samples, LPS administration increased the phosphorylation of ERK1/2 and COX-2 levels (p<0.01 and p<0.001 respectively, Fig5.5c). The phosphorylation of c-jun and p65 were unaffected (Fig5.5c).

112

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

NP& E16& a" Phospho$ERK1/2& Phospho$c$jun& Phospho$p65& COX$2&

ß$ac7n&

1.5 Phospho-ERK1 Phospho-ERK2 Phospho-c-jun Phospho-p65 COX-2 1.0 ***

** 0.5 ** ** protein expression/b-actin

0.0 E16 E16 E16 E16 E16

None pregnant None pregnant None pregnant None pregnant None pregnant

113

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

PBS) LPS) b" Phospho&ERK1/2) Phospho&c&jun) Phospho&p65) COX&2) ß-actin

phosph-ERK1 50000 *** phosph-ERK2 phosph-c-jun 40000 phosph-p65 COX-2

30000 ***

20000 **

protein expression/b-actin 10000

0 CD1+LPS 7h CD1+LPS 7h CD1+LPS 7h CD1+LPS 7h CD1+LPS 7h CD1+PBS 7h CD1+PBS 7h CD1+PBS 7h CD1+PBS 7h CD1+PBS 7h

114

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

PBS) LPS) c" Phospho&ERK1/2) Phospho&c&jun) Phospho&p65) COX&2) ß-actin phosph-ERK1

30000 phosph-ERK2 phosph-c-jun ** phosph-p65 COX-2

20000 ***

10000 protein expression/b-actin

0 CD1+LPS labouring CD1+LPS labouring CD1+LPS labouring CD1+LPS labouring CD1+LPS labouring CD1+PBS labouring CD1+PBS labouring CD1+PBS labouring CD1+PBS labouring CD1+PBS labouring

Figure 5.5 a-c The effect of LPS on the phosphorylation of ERK1/2, NF-κB and c-jun and the levels of COX in myometrium (left horn).

Mice were sacrificed before pregnancy (non-pregnant), on day 16 before and after injection (7 hours or, in labour [after the birth of the first pup]). Myometrium of the left horn was harvested, put on dry ice and stored at -70oC until protein extraction. In comparison to non-pregnant samples, myometrium obtained on day 16 of pregnancy showed increased phosphorylation of ERK1/2 (p<0.01 for ERK1, p<0.001 for ERK2) and the level of COX-2 (p<0.01), phosphorylation of c-jun decreased (p<0.01), and levels of phosphorylated NF-κB showed no change (Fig.5.5a). At 7 hours post injection, the myometrial samples obtained from mice after LPS administration showed increased phosphorylation of ERK1/2 and NF-κB (p<0.001 and p<0.01 respectively, Fig5.5b), while the phosphorylation of c-jun and COX-2 levels were unaffected (Fig5.5b). In labouring samples, LPS administration increased the phosphorylation of ERK1/2 and COX-2 levels (p<0.01 and p<0.001 respectively, Fig5.5c). The phosphorylation of c-jun and NF-κB were unaffected (Fig5.5c). Data are presented as mean + SEM and were analysed using an unpaired t test, n=6 for this experiment. * indicates a significant difference of p<0.05, ** indicates p<0.01, *** indicates p<0.001.

115

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

5.2.6 The maternal IL-6 response to PBS and LPS intra-uterine injection

Maternal plasma was collected at the time of sacrifice in 4 groups of animals, NP, untreated mice on day 16 of pregnancy and mice injected on day 16 with PBS (7 hours after injection and in labour) or LPS injected (7 hours after injection and in labour). There was no difference between the circulating levels of IL-6 in NP, day 16 and spontaneously labouring mice (Fig.5.6). Intrauterine injection with either PBS or LPS significantly increased circulating levels of IL-6 at 3 hours post injection compared to non-injected day 16 mice (Fig.5.6). The elevation in plasma IL-6 levels continued until the onset of labour in mice injected with LPS, but declined in mice injected with PBS, although it remained elevated at the time of labour compared to the levels found in spontaneously labouring mice (Fig.5.6, P<0.001).

10000

§§§ §§§ *** *** 1000

100 IL-6 (pg/ul) IL-6

1 CD1 NP CD1 E16 CD1+LPS 3H CD1+LPS 7H CD1+PBS 3H CD1+PBS 7H CD1 labouring CD1+LPS Labouring CD1+PBS Labouring

Figure 5.6 The maternal IL-6 response to PBS and LPS intrauterine injection.

4 groups of animals, non-pregnant, untreated mice on day 16 of pregnancy and mice injected on day 16 with PBS or LPS injected were sacrificed and maternal plasma was collected. There was no difference between the circulating levels of IL-6 in NP, day 16 and spontaneously labouring mice. PBS or LPS significantly increased circulating levels of IL-6 at 3 hours post injection (p<0.001). The elevation in IL-6 116

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

levels continued until the onset of labour in mice injected with LPS, but declined in mice injected with PBS, although it remained elevated at the time of labour compared to the levels found in normal labouring mice (p<0.001). Data are presented as mean+SEM and were analyzed using an unpaired t test, n=6 for this experiment. §§§ indicates a significant difference of p<0.001 between E16 and 3 hours. *** indicates a significant difference of p<0.001 between PBS and LPS group. ### indicates a significant difference of p<0.001 between normal and PBS labouring groups.

5.2.7 Pup brain chemokine and cytokine mRNA expression in response to LPS

Since at 7 hours post LPS 6% of the pups were alive, 29% were barely alive and 65% were dead, an earlier time point of 3 hours was chosen at which to examine the changes in chemokine and cytokine expression in the pup brain. Contrary to expectation, there were no differences in chemokine or cytokine mRNA expression between PBS and LPS injected mice (Fig.5.7a-c). In fact, there tended to be lower levels of both chemokine and cytokine expression in the pup brain of LPS treated mice. Similarly, at the later time point of 7 hours there were no significant differences (Fig.5.7b). Only in pup brains obtained from labouring animals was the expression of some chemokines, CCL2, CCL5, CCL20, and CXCL1, and of some cytokines, IL-1β and TNFα, increased (p<0.05-0.01, Fig.5.7c). a 200

150

100

50 Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 0

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

LPS 3h left horn

PBS 3h left horn

117

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

1500

1000

500

Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 0 IL-6 IL-1b CCL2 CCL5 TNF-a CCL20 CXCL1 CXCL5

LPS 7 hours left horn

PBS 7h left horn c

100000

* 10000 ** ** **

1000 *

100

Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 10 IL-6 IL-1b CCL2 CCL5 TNF-a CCL20 CXCL1 CXCL5

LPS labouring left horn

PBS labouring left horn

Figure 5.7 a-c Pup brain chemokine and cytokine mRNA expression in response to LPS.

Mice were sacrificed at 3 hours, 7 hours and labour after injection of LPS or PBS. Pup brains were harvested, put on dry ice and stored at -70oC until RNA extraction. Pup brain chemokine mRNA expression was subsequently measured by rt-PCR and expressed as mean+SEM, and were analyzed using an unpaired t test, n=6 for this experiment. Pup brains were collected from pups in the left (non-injected) horn. There were no differences in chemokine or cytokine mRNA expression between PBS and LPS injected mice at 3 and 7 hours (Figure a&b). CCL2, IL-1β and TNFα were increased in labour (p<0.05, Fig.5.7c). * indicates a significant difference of p<0.05.

118

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

5.2.8 Placental chemokine and cytokine mRNA expression in response to LPS

In contrast to the pup brain samples, at 3 hours the expression of the majority of the chemokines, CCL2, CCL5, CXCL1 and CXCL5, and of the cytokine IL-6 was increased (p<0.05, Fig5.8a). At 7 hours, similarly the expression of the majority of the chemokines, CCL2, CCL5 and CXCL1, and of the cytokines TNFα and IL-6 was increased (p<0.05-0.01, Fig5.8b). In labouring samples, the expression of the majority of the chemokines, CCL5, CCL20, CXCL1 and CXCL5, and of the cytokines IL-1β and IL-6 was markedly increased (p<0.05-0.001, Fig5.8c). a 10000 * * 1000 * * *

100

Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 1 α β IL-6 IL-1 CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CD1+LPS 3h left horn

CD1+PBS 3h left horn

119

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

10000

* * 1000 * **

100

Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 1 α β IL-6 IL-1 CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CD1+LPS 7h left horn

c CD1+PBS 7h left horn

10000 *** *** ** **** * ***

1000

100

Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 10 α β IL-6 IL-1 CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CD1+LPS labouring left horn

CD1+PBS labour left horn

Figure 5.8 a-c Placental chemokine and cytokine mRNA expression in response to LPS

Mice were sacrificed at 3 hours, 7 hours and labour after injection of LPS or PBS. Placentae were harvested, put on dry ice and stored at -70oC until RNA extraction. Chemokine mRNA expression was subsequently measured by rt-PCR and expressed as mean+SEM. Placentae were collected from the left (non-injected) horn. At 3 hours, with the exception of CCL20, the mRNA expression of all chemokines

120

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

was increased by LPS (p<0.05 for each); cytokine mRNA expression was not significantly increased (Figure 5.8a). At 7 hours, CXCL1, TNFα and IL-6 were increased by LPS (p<0.05, Figure 5.8b). At the time of labour, CCL5 (p<0.05), CCL20 (p<0.001), CXCL1 (p<0.01), CXCL5 (p<0.05) and IL- 1β (p<0.05) were increased by LPS (Figure 5.8c). * indicates a significant difference of p<0.05, ** indicates p<0.01, *** indicates p<0.001., n=6.

5.2.9 The effect of LPS on placental phosphorylation of ERK1/2, p65 and c-jun and the levels of COX-2.

At 3 hours post injection, LPS administration increased the phosphorylation of p65 and the levels of COX (p<0.01 and p<0.05 respectively, Fig5.9a). The phosphorylation of c-jun and ERK1/2 were unaffected (Fig5.9a). In labouring samples, LPS administration increased the phosphorylation of ERK1/2 (p<0.05 and p<0.01 respectively) and of p65 (p<0.01, Fig5.9b). The phosphorylation of c-jun and the levels of COX-2 were unaffected (Fig5.9b).

121

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

PBS) LPS) a" Phospho&ERK1/2) Phospho&c&jun) Phospho&p65) COX&2) ß&ac9n) 1.5 Phospho-ERK1 Phospho-ERK2 Phospho-c-jun Phospho-p65 1.0 COX-2

* 0.5 protein expression/b-actin **

0.0 CD1+LPS 3h CD1+LPS 3h CD1+LPS 3h CD1+LPS 3h CD1+LPS 3h CD1+PBS 3h CD1+PBS 3h CD1+PBS 3h CD1+PBS 3h CD1+PBS 3h

122

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

PBS& LPS& b" Phospho$ERK1/2& Phospho$c$jun&

Phospho$p65& COX$2& ß$ac4n&

Phospho-ERK1 2.5 ** Phospho-ERK2 Phospho-c-jun 2.0 Phospho-p65 COX-2

1.5

1.0 ** *

protein expression/b-actin 0.5

0.0 CD1+LPS labouring CD1+LPS labouring CD1+LPS labouring CD1+LPS labouring CD1+LPS labouring CD1+PBS labouring CD1+PBS labouring CD1+PBS labouring CD1+PBS labouring CD1+PBS labouring

Figure 5.9 a&b The effect of LPS on the phosphorylation of ERK1/2, NF-κB and c-jun and the levels of COX in the placenta (left horn).

Mice were sacrificed at 3 hours and labour after injection of LPS or PBS. Placentae were harvested, put on dry ice and stored at -70oC until protein extraction. At 3 hours, the placentae obtained from mice after LPS administration showed increased phosphorylation of NF-κB and COX levels (p<0.01 and p<0.05 respectively), while the phosphorylation of ERK1/2 and c-jun were unaffected. During labour, phosphorylation of ERK1 (p<0.05), ERK2 (p<0.01) and NF-κB (p<0.01) were increased. Data are presented as mean + SEM and were analysed using an unpaired t test, n=6 for this experiment. * indicates a significant difference of p<0.05, ** indicates p<0.01.

123

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

5.3 Discussion

LPS has been used to induce pregnancy loss or PTL in various models. The dosage and serotype used has varied widely and in rodent models, it varies from 0.1 to 500µg 258,263,264,298-300 and the site of administration, intra-uterine, between sacs 1 and 2, 258 or intraperitoneal 264. In those models where LPS is administered preterm, the impact on pregnancy outcomes seems to be similar, although the occurrence or interval to the onset of labour appears to be shorter the higher the dosage used 258,263,264. Pup mortality is typically 100% by the time of labour onset, although again this varies with dosage 258,263,264. However, the process leading to pup death is not clear but has been assumed to be due to pup inflammation 263. Certainly, previous studies found that there was phosphorylation of p65 and c-jun in the pup brain after intra-uterine LPS injection 263 and of fetal cytokine levels in the circulation and expression in the brain, lung, intestine and liver after intra-peritoneal injection 264. Given the primary role of inflammation in human PTL and importance of chemokines in all inflammatory processes the mouse model of LPS-induced PTL was chosen to investigate the impact of various chemokine knockout mice. However, before using the model the expression of chemokines and cytokines in normal pregnancy and in the LPS model were studied.

In general, the expression of chemokines in the mouse myometrium during pregnancy initially declined rapidly from the non-pregnant state to day 6 of pregnancy, around the time of embryo implantation, and then rose to day 18 prior to the onset of parturition. There was no change in chemokine expression between day 18 and the onset of parturition, or between parturition and 36 hours later, suggesting that chemokine expression increases prior to the onset of parturition and is not a consequence of parturition. Given the increase in chemokine expression with advancing gestation Iexpected to see increased activation of NF-κB and/or AP- 1 transcription factors as MAPK and NFκB were shown to drive chemokine expression (Chapter 3). However, although ERK1/2 phosphorylation was increased,

124

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

the phosphorylation of c-jun was reduced and NFκB unchanged in samples from non-pregnant and day 16 pregnant mice. Interestingly, COX-2 levels were increased in these samples suggesting that prostaglandin (PG) synthesis is increased. However, since PGs can act to promote myometrial quiescence or contraction the overall effect will be dependent on down stream PG synthetic enzyme activity.

The effects of the increased chemokine expression on monocyte and macrophage myometrial infiltration were studied and found that both increased in day 18 compared to non-pregnant myometrium consistent with observations in the rat 166,301,302. In the human, the increase in myometrial inflammatory cells seems to occur only after the onset of labour 17. Similar observations have been made in human decidua 302. In human cervical tissues, the numbers of neutrophils and monocytes increased at term and did not increase further with the onset of labour 9. Similarly, in the present study, the increases in myometrial inflammatory cell infiltration were seen prior to the onset of labour. The observations made in this study support the idea that the increase in chemokines and the resultant increase in myometrial inflammatory cell infiltration precede the onset of labour and therefore may have a role in its causation.

LPS increased maternal IL-6 levels as has previously been reported 275,303. In fact, laparotomy and PBS injection also increased maternal circulating IL-6 levels that remained elevated until the onset of labour some 56 hours post laparotomy. The myometrial response was interesting, in the right horn (injected) at 7 hours post injection there was no increase in inflammation as judged by the comparison of chemokine and/or cytokine expression between LPA and PBS injected tissues. However, in contrast, in the left horn (non-injected), chemokine expression was increased at 7 hours suggesting that the local response to the PBS injection masked any LPS-induced increase in chemokines in the right horn, but that these were clear in the left. In labouring samples, in both horns, the expression of all of the chemokines and of IL-1β and IL-6 in the right and of IL-6 only in the left was

125

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

increased. These data suggest that in the left horn chemokine expression increased first followed by increases in cytokine expression. This would be consistent with the observations of Young et al, who localised myometrial cytokine mRNA to infiltrating inflammatory cells in spontaneous labour 104. Together these data support the idea that the increased myometrial cytokine production is dependent on the chemokine- induced inflammatory cell infiltration. In terms of transcription factor activation, at 7 hours post injection in the left horn, ERK1/2 and p65 phosphorylation was increased, while c-jun phosphorylation and COX-2 levels were unchanged. By the onset of parturition, although the phosphorylation of ERK1/2 remained greater, the phosphorylation of p65 and c-jun was similar in PBS and LPS-injected mice. The levels of COX-2 were greater. These data are consistent with those reported by Pirianov et al, who showed that LPS increased myometrial p65, c-jun and cPLA2 (an ERK1/2 substrate) phosphorylation 263.

The high rates of pup death have been associated with increased pup brain inflammation 263 and this has been suggested to be the main cause of pup death. However, in this study there was no evidence of pup brain inflammation until after pup death. This contrast with earlier work from our own group 263 and the evidence from Elovitz et al, who showed that intrauterine LPS results in marked pup brain inflammation 298. The difference may be related to the different types of LPS used, Elovitz uses serotype O55 and Piranov used a salmonella derived LPS, as the different oligosaccharides in each form of LPS may alter placental transfer and so the fetal inflammatory response. In the current study, there was no evidence of fetal brain inflammation. Consistent with this observation, in arat study using the same type of LPS labelled with I125, none was detected in the fetus, suggesting that LPS 0111, does not cross the placenta 304.

Consequently, to understand whether placental dysfunction might be responsible for pup death, I studied the effect of LPS on placental inflammation. In addition, since some pups were dead by 7 hours, I used the earlier time point of 3 hours to

126

Chapter 5. The effects of LPS on E16 mouse regarding pregnancy outcome and molecular indicators of tissue inflammation.

assess placental changes. Chemokine expression was increased at 3 and 7 hours and markedly elevated in the labouring samples. In terms of the inflammatory cytokines, IL-6 expression was increased at all 3 time points, but like the chemokines the increase was greatest in labouring samples. TNFα mRNA expression was increased at 7 hours only and IL-1β in labouring samples only. These data suggest that placental chemokine mRNA expression increased initially followed by the inflammatory cytokines. The time course of placental inflammation was different in rats treated with approximately 4µg of the same type of LPS, the levels of TNFα were elevated at 2 hours only, of IL-1β at 4 hours and 8 hours and of IL-6 at 8 hours only, maternal serum levels showed acute increases in TNFα at 2 hours, IL-1β at 4 hours and IL-6 at both time points 304. The significance of the increase in chemokines and cytokines in terms of their role in pup demise is difficult to assess. In the rat studies, perfusion was markedly reduced at 45 minutes post LPS and infusion of the IL-1receptor antagonist protected the pups from the adverse effects of maternal LPS 305. This suggests that the maternal inflammation induced the reduction in placental perfusion and pup death. In my study, maternal IL-6 levels were markedly elevated by 3 hours and placental chemokine expression was increased at 3 hours, but peaked in the labouring samples, at least 7 hours after pup demise. At 3 hours, p65 phosphorylation and COX-2 levels were significantly increased, the changes in ERK1/2 and c-jun phosphorylation didn’t reach significance, only in labouring samples was ERK1/2 and p65 phosphorylation significantly increased.

These observations do not help us to understand the mechanisms responsible for pup death in this model. It seems unlikely that pup inflammation has a role, but whether there is a decline in maternal blood pressure that reduces placental perfusion or placental inflammation which restricts blood flow is uncertain. Although many groups have used and are currently using LPS to induce damage in the developing fetal brain, the mechanisms responsible for this damage are far from clear and need to be defined as a matter of urgency.

127

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Chapter 6. CCR2 knockout improves pup survival in a mouse model of preterm labour.

128

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

6.1 Introduction

Inflammation is the first response to tissue injury and is driven by a chemokine- dependent infiltration of immune cells into the area of injury. Labour is an inflammatory process, with a marked myometrial infiltration of monocytes/macrophages. The chemokine (C-C motif) ligand 2 (CCL2), also known as monocyte chemotactic protein-1 (MCP-1), is a CC chemokine that mainly recruits monocytes, memory T cells and dendritic cells to the sites of inflammation296,297. CCL2 has also been implicated in the pathogenesis of other diseases that involve monocyte infiltration. Its effects are mediated through the cell surface chemokine receptors CCR2 and CCR4, of the two, CCR2, is the prime mediator of the effects of CCL2 and as such has been suggested to be an important therapeutic target306. The level of CCL2 increases with the onset of labour suggesting that CCL2 may be one of the key mediators of this effect. Increased amniotic fluid CCL2 levels are found in preterm and term labouring samples168,307. In contrast, in rat studies, progesterone suppressed the expression of CCL2 and conversely, RU486, an anti-progestin, increased in CCL2 mRNA expression and induced preterm delivery308. Collectively, these data suggest that CCL2 could play a key role in the onset and progression of labour.

Several small molecule CCR2 antagonists exist; however, CCR2 knockout is an alternative approach to blocking CCR2 for in vivo studies. The CCR2 knockout mouse model has been used mainly in studies of respiratory system, where the CCR2 defect markedly impaired macrophage recruitment to the site of inflammation. In CCR2-/- mice, after a mycobacterium bovin challenge, IFN-γ producing cells in draining lymph node were 70% lower 309. Knockout of CCR2 also impaired dendritic cell trafficking and activation/maturation, again shown after mycobacterium bovine antigen challenge, when dendritic cells had lower MHCII and CD40 expression. Macrophage infiltration of the injected site decreased 50%. Nelson’s group found that CCR2 knockout had no impact on pregnancy outcomes, which was of a normal

129

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

duration, with similar litter sizes, and fetal and placenta weight in CCR2-/- and wild type (CD1) mice. However, on day 18 of pregnancy, CCR2 -/- mice did not display the increase in F4/80 transcripts observed in the wild type mice, suggesting defective macrophage trafficking, however, similar levels of Gr-1 (granulocytes) was observed between wild type and CCR2-/-310.

In this chapter, the behaviour of the CCR2-/- mouse in normal pregnancy and in an LPS-based model of preterm labour is reported. Specifically, CCR2-/- mice were used to test the hypothesis that CCR2 is a potential therapeutic target for the prevention of inflammation-induced preterm delivery.

130

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

6.2 Results

6.2.1 Chemokine expression in CCR2-/- mouse uterus with gestation

Small changes of chemokines were found in the myometrium of CCR2-/- mice at various gestations (Figure 6.1 a-g). As for the CD1 mice, the chemokine mRNA expression was compared to levels on E6, when the expression of most chemokines was at a nadir in the CD1 mice (Chapter 5). In contrast, in the CCR2-/- mice, chemokine mRNA expression did not decrease on E6 and no progressive increase in mRNA expression occurred over the course of pregnancy. The most striking difference was observed in the expression of CCL20, in the CD1 mice, CCL20 remained largely unchanged over pregnancy (Chapter 5), but in the CCR2-/-, CCL20 mRNA expression was highest on day 6, greater than either in the non-pregnant or at any other stage of pregnancy.

CCL2 mRNA expression in CCR2-/- mouse

a 1000

100

10 CCR2-/-

CCL2:GAPDH 1

0.1 E6 P2 E11 E16 E18 None

LABOURING

131

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

CCL5 mRNA expression in CCR2-/- mouse

b 1

0.1 CCR2-/- 0.01 CCL5:GAPDH

0.001 E6 P2 E11 E16 E18 None LABOURING

c 100 CCL20 mRNA expression in CCR2-/- mouse * 10 ** ** * **

1 CCR2-/-

0.1 CCL20:GAPDH

0.01 E6 P2 E11 E16 E18 None LABOURING

132

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

CXCL1 mRNA expression in CCR2-/- mouse

1000 d *

100

10 :GAPDH :GAPDH

1 CCR2-/-

CXCL1 0.1

0.01 E6 P2 E11 E16 E18 None

LABOURING

CXCL5 mRNA expression in CCR2-/- mouse e 100

1 CCR2-/-

0.1 CXCL5:GAPDH

0.01 E6 P2 E11 E16 E18 None

LABOURING

Figure 6.1 CCR2-/- mouse myometrial chemokine expressions.

CCR2-/- mice were put under anaesthetic and sacrificed before and after pregnancy and on specific days during pregnancy. Myometrium was harvested and put on dry ice. RNA was extracted and the level of

133

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

mouse chemokine mRNA expression measured by rt-PCR. CCL20 increased at E6 compare to non- pregnant and start to decrease at E11, E16, E18, labouring; CXCL1 increase at E16 compare to E6. n=6 for this experiment. Data were analyzed using ANOVA with Dunn’s post-test, and presented as median, interquartile range and range, * indicates a significant difference p<0.05, **indicates p<0.01

6.2.2 NF-κB p65 and ERK activations on E16, resulting the increase of COX-2 in left horn myometrium. Are the wild type and CCR2-/- the same?

NF-κB and MAPK pathways were activated in CD1 mice (wild type) with advancing gestation (Chapter 5). In CD1 mice, the phosphorylation of ERK1/2 and the levels of COX-2 were increased, while the phosphorylation of c-jun was reduced and of p65 unchanged in the day 16 myometrial samples compared to the NP samples. In order to assess the impact of CCR2 knockout, I sacrificed CCR2-/- mice before pregnancy and at the E16 stage and extracted protein from myometrium. On E16, in comparison to NP samples, both p65 and ERK were activated and this was associated with increased COX-2 synthesis in the CCR2-/- mice (Fig.6.2a, p<0.01 for all 3); c-jun phosphorylation was reduced at the same time-point (Fig.6.2a, p<0.01).

I then compared the myometrial samples from NP and E16 wild type and CCR2-/- mice and found in NP samples that p65 phosphorylation and COX-2 levels were similar (Fig.6.2.b), but that ERK1/2 phosphorylation was marginally greater (p<0.05, Fig.6.2.b). On day 16, the difference in ERK1/2 phosphorylation persisted, but was associated with increased COX-2 levels (p<0.05 and p<0.01 respectively, Fig.6.2.c). Again, levels of c-jun phosphorylation were reduced (p<0.01, Fig.6.2.c).

134

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Protein expression in non-pregnant and E16 CCR2-/- mouse a NP myometriumE16 Phospho-ERK1/2 Phospho-c-jun Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2 Phosph-c-jun 10 Phospho-p65 COX-2

1 *** *** ***

0.1 *** **

0.01 protein expression/b-actin

0.001 CCR2-/- NP CCR2-/- NP CCR2-/- NP CCR2-/- NP CCR2-/- NP CCR2-/- E16 CCR2-/- E16 CCR2-/- E16 CCR2-/- E16 CCR2-/- E16

135

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Protein expression in non-pregnant CD1 and CCR2-/- mouse myometrium CD1 CCR2-/- b Phospho-ERK1/2 Phospho-c-jun

Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2 Phosph-c-jun Phospho-p65 0.25 COX-2 *

0.20

0.15 *

0.10 protein expression/b-actin 0.05

0.00 CD1 NP CD1 NP CD1 NP CD1 NP CD1 NP

CCR2-/- NP CCR2-/- NP CCR2-/- NP CCR2-/- NP CCR2-/- NP

136

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Protein expression in E16 CD1 and CCR2-/- mouse myometrium

CD1 CCR2-/-

c Phospho-ERK1/2 Phospho-c-jun Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2 Phospho-c-jun Phospho-p65 COX-2 0.3 ** *

0.2 ** *

0.1 protein expression/b-actin

0.0 CD1 E16 CD1 E16 CD1 E16 CD1 E16 CD1 E16

CCR2-/- E16 CCR2-/- E16 CCR2-/- E16 CCR2-/- E16 CCR2-/- E16

Figure 6.2 The phosphorylation of myometrial NF-κB (p65), c-jun and ERK1/2 and COX-2 levels in CCR2-/- and CD1 mice.

Non-pregnant and E16 CD1 and CCR2-/- mice were sacrificed. Myometrium was harvested and protein was extracted from the left horn. a. Comparing NP to E16 samples from CCR2-/- mice, the phosphorylation of both NF-κB (p65) and ERK1/2 and COX levels were increased and the phosphorylation of c-jun reduced. b. In NP myometrial samples, phosphorylation of ERK1/2 was increased in samples from CCR2-/- compared with samples from CD1 mice. c. In E16 myometrial samples, ERK1/2 phosphorylation and COX levels were increased and c-jun phosphorylation reduced in samples from CCR2-/- compared with samples from CD1 mice. Data were analysed using unpaired t tests, n=6 for this experiment. Data were presented as mean with SEM. * indicates a significant difference of p<0.05, ** indicates p<0.01, *** indicates p<0.001.

137

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

6.2.3 Leukocyte infiltrated into myometrium.

Non-pregnant and E18 CCR2-/- and CD1 mice were sacrificed and myometrium harvested and stored in PBS at 4℃. Tissue was processed within 24 hour as follows, samples were digested by collagenase and then incubated with different antibodies in order to define whether CCR2-/- would prevent monocyte infiltration. After incubation, leukocytes were sorted by FACS. In an earlier chapter, leukocyte (CD45+ cells) numbers were greater in E18 samples obtained from CD1 mice (Chapter 5).

In CCR2-/- mice compared with NP animals, I found that on E18 macrophages, labelled as CD45+/F4/80+/Gr1- and monocytes, labelled as CD45+/F4/80+/Gr1+ were significantly increased (p<0.05, Fig. 6.3a). Neutrophils, labelled as CD45+/F4/80-/Gr1+, tended to be higher as well (Fig. 6.3a). There were fewer neutrophils in the myometrium of non-pregnant CCR2-/- mice (p<0.01, Fig.6.3b). The number of monocytes and macrophages was similar in the myometrium obtained from non-pregnant CD1 and CCR2-/- mice (Fig6.3b). In the samples obtained at E18, there were fewer macrophages in the CCR2-/- myometrium, but more monocytes (p<0.05, Figure 6.3b).

138

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Cell numbers in non-pregnant and E18 CCR2-/- mouse myometrium

CD45+/F4/80+/Gr1- CD45+/F4/80-/Gr1+ CD45+/F4/80+/Gr1+

1.0×1007 a *

1.0×1006 * 1.0×1005

1.0×1004

1.0×1003 CCR2-/- mouse

02 CELL/GRAM UTERUS 1.0×10

1.0×1001

1.0×1000 NP NP NP E18 E18 E18

139

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Cell numbers in non-pregnant and E18 CD1 and CCR2-/- mouse

myometrium CD45+/F4/80+/Gr1- b CD45+/F4/80-/Gr1+ CD45+/F4/80+/Gr1+ 1.0×1007 *

1.0×1006

** 1.0×1005 CD1vsCCR2-/- mice CELL/GRAM UTERUS 1.0×1004 **

1.0×1003 CD1 NP CD1 NP CD1 NP CD1 E18 CD1 E18 CD1 E18 CCR2-/- NP CCR2-/- NP CCR2-/- NP CCR2-/- E18 CCR2-/- E18 CCR2-/- E18

Figure 6.3 Inflammatory cells in NP and E18 myometrium from CD1 and CCR2-/- mice.

Myometrium was harvested and stored in PBS at 4. Tissues were digested with collagenase and then incubated with different antibodies. Positive cells were detected by FACS. a. When samples from CCR2-/- NP and E18 mice were compared, the density of macrophages (labelled by CD45+/F4/80+/Gr1-) and monocytes (labelled CD45+/F4/80+/Gr1+) in E18 myometrium were higher in E18 samples. Neutrophils (labelled CD45+/F4/80-/Gr1+) also tended to be increased in E18. b. There were no differences in the densities of monocytes or macrophages between NP CD1 and CCR2-/- mice, but less neutrophils in non- pregnant CCR2-/- mice. In E18 samples, the density of macrophages was greater in CD1 samples, but the density of monocytes was higher in CCR2-/- samples. Data were analyzed using unpaired t test. Data were presented as mean with SEM, n=3-6. * indicates a significant difference of p<0.05.

140

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

6.2.4 Time of labour after LPS treatment and pup survival

After LPS administration, the time of delivery of CD1 and CCR2-/- mice were observed. There is no difference between the two genotypes (Figure 6.4). At the two time points (7 hours and labour), the numbers of live or barely alive pups were recorded. At 7 hours, 6% of the CD1 pups were alive, 29% were barely alive and 65% were dead; 57% of the CCR2-/- pups were alive, 36% were barely alive and 7% were dead (Chi-square p<0.0001). At the time of labour, all of the CD1 pups were dead; 8% of the CCR2-/- mice were barely alive and 92% of them were dead (Chi-square p=0.007).

141

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Time of labour post-op of CD1 and CCR2-/- mouse

Post-op LPS delivery time

Post-op PBS delivery time 150

100

50 delivery time post-op(hours) time delivery

0 CD1 CD1 CCR2-/- CCR2-/-

Figure 6.4 Time of labour.

After operation, the time of delivery of CD1 and CCR2-/- mice was recorded. Preterm delivery occurred in both CD1 and CCR2-/- after intrauterine LPS injection. However, there was no difference between the two genotypes. n=6 for this experiment.

142

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

6.2.5 The effect of LPS on the myometrium of CCR2-/- mice

To investigate whether knock out of CCR2 would change the myometrial response to LPS, I challenged CCR2-/- mice with LPS. I took myometrial samples 7 hours after LPS and in labour and compared chemokine and cytokine expression to PBS treated controls. Left horn was used in this study to avoid the effect of injection on myometrium. At 7 hours, the expression of the chemokines CCL2, CCL5, CCL20, CXCL1, CXCL5 and cytokines IL-1β, TNFα, IL-6 was up regulated (Figure 6.5.1a, p<0.01 for CXCL5, p<0.05 for other genes). In labouring samples, CCL2, CCL5, CXCL1 were increased. (Figure 6.5.1b, p<0.05).

Myometrial chemokine and cytokine expression in a PBS/LPS treated CCR2-/- mice at 7h (left horn) 100000

* 10000 * ** * * * * 1000 *

100 Gene expression :GAPDH(% PBS control) PBS :GAPDH(% expression Gene 10 IL-6 CCL2 CCL5 IL-1b CCL20 CXCL1 CXCL5 TNF-a

LPS 7h left horn

PBS 7h left horn

143

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Myometrial chemokine and cytokine expression in PBS/LPS treated CCR2-/- mice in labour (left horn) b 100000

10000 * * 1000 *

100 Gene expression :GAPDH(% PBS control) PBS :GAPDH(% expression Gene

10 IL-6 CCL2 CCL5 IL-1b CCL20 CXCL1 CXCL5 TNF-a

LPS labouring left horn

PBS labouring left horn

Figure 6.5 The effect of LPS on the myometrium of CCR2-/- mice a&b: CCR2-/- mice were given an intrauterine injection of LPS or PBS. Mice were sacrificed at 7 hours post injection or after the onset of labour, defined as the birth of the first pup. The myometrium from the left horn was used in this study to avoid any effect of the injection. Compared to PBS injected CCR2-/- mice, at 7 hours, the expression of the chemokines CCL2, CCL5, CCL20, CXCL1, CXCL5 and cytokines IL-1β, TNFα, IL-6 was increased and in labouring samples, CCL2, CCL5, CXCL1 were increased. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01.

PBS treated CCR2-/- myometrial CCL2 (p<0.01), CCL20 (p<0.01), CXCL1 (p<0.05), IL-1β (p<0.01) and TNFα (p<0.01) were lower than CD1s at 7 hours post-op (Figure 6.6a) and, IL-1β (p<0.01) and TNFα (p<0.05) were lower than CD1s in labour (Figure 6.6c). After LPS injection, compared with the CD1s, CCR2-/- myometrial CCL2 (p<0.01) and CCL5 (p<0.05) were higher, IL-1β (p<0.01) and TNFα (p<0.05) was lower at 7 hours post-op (Figure 6.6b); at the time of labour, CCL5 (p<0.01) was higher and, CCL2 (p<0.05) and IL-1β (p<0.01) was lower in CCR2-/- (Figure 6.6d).

144

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Myometrial chemokine and cytokine expression in PBS treated CCR2-/- mice compared to wild-type a controls at 7h (left horn)

1000

100 ** ** * ** **

1 Gene expression :GAPDH(% mean of CD1+PBS control) CD1+PBS of mean :GAPDH(% expression Gene 0.1 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +PBS 7h

CD1+PBS 7h control

145

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Myometrial chemokine and cytokine expression in b LPS treated CCR2-/- mice compared to wild-type controls at 7h (left horn) 10000

** 1000 ***

100 ** *

Gene expression :GAPDH(% mean of CD1+LPS control) CD1+LPS of mean :GAPDH(% expression Gene 0.1 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +LPS 7h

CD1+LPS 7h control

Myometrial chemokine and cytokine expression in PBS treated CCR2-/- mice compared to wild-type

controls in labour (left horn) c

10000

1000

100 * **

10 Gene expression :GAPDH(% mean of CD1+PBS control) CD1+PBS of mean :GAPDH(% expression Gene 1 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +PBS labouring

CD1+PBS labour control

146

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Myometrial chemokine and cytokine expression in d LPS treated CCR2-/- mice compared to wild-type controls in labour (left horn) 1000

* 100

10 Gene expression :GAPDH(% mean of CD1+LPS control) CD1+LPS of mean :GAPDH(% expression Gene 1 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +LPS labouring

CD1+LPS labour control

Figure 6.6 Comparisons of the effect of LPS/PBS on CD1 and CCR2-/- mice myometrium a-d: CCR2-/- and wild type CD1 mice were given an intrauterine injection of LPS or PBS. Mice were sacrificed at 7 hours post injection or after the onset of labour, defined as the birth of the first pup. The myometrium from the left horn was used in this study to avoid any effect of the injection. At 7 hours in PBS treated mice, the myometrial expression of CCL2, CCL20, CXCL1, IL-1β and TNFα was lower in CCR2-/- mice than in CD1 mice. At 7 hours in LPS treated mice, the myometrial expression of CCL2 and CCL5 was higher and of IL-1β and TNFα was lower in the CCR2-/- mice than in CD1 mice.

In labouring samples from PBS treated mice, the myometrial expression of IL-1β and TNFα was lower in CCR2-/- compared with CD1 mice. In labouring samples from LPS treated mice, the myometrial expression of CCL5 was higher and of CCL2 and IL-1β was lower in CCR2-/- compared with CD1 mice. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01, *** indicates p<0.001.

147

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Then the effect of LPS on MAPK, p65, c-jun phosphorylation and COX-2 levels was assessed. Previously, in CD1 mice, LPS administration increased the phosphorylation of MAPK and p65 and COX-2 levels. To compare the effects of LPS and PBS in the CCR2-/- mice I took myometrial samples at 7 hours and in labour. As before, in order to avoid any direct effect caused by the injection, I only used myometrium from the left uterine horn. At 7 hours and in labour, both COX-2 levels and ERK activation tended to be increased, but neither were significantly higher than in PBS controls, phosphorylation of p65 and c-jun was the same at both time points (Figure 6.7a-b).

Phosphorylation of ERK1/2, c-jun, p65 and COX-2 levels in the myometrium (left horn) of PBS/LPS treated CCR2-/- mice at 7 hours PBS 7h at 7h (left horn)LPS 7h a

Phospho-ERK1/2 Phospho-c-jun

Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2 Phospho-c-jun 0.8 Phospho-p65 COX-2

0.6

0.4

0.2 protein expression/b-actin

0.0 LPS left horn 7h LPS left horn 7h LPS left horn 7h LPS left horn 7h LPS left horn 7h PBS left horn 7h PBS left horn 7h PBS left horn 7h PBS left horn 7h PBS left horn 7h

148

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Phosphorylation of ERK1/2, c-jun, p65 and COX-2 levels in the myometrium (left horn) of PBS/LPS treated labouring CCR2-/- mice b PBS labouring LPS labouring

Phospho-ERK1/2 Phospho-c-jun Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2 Phospho-c-jun Phospho-p65 0.6 COX-2

0.4

0.2 protein expression/b-actin

0.0 LPS left horn labouring LPS left horn labouring LPS left horn labouring LPS left horn labouring LPS left horn labouring PBS left horn labouring PBS left horn labouring PBS left horn labouring PBS left horn labouring PBS left horn labouring

Figure 6.7 The investigations of possible pathways involved in the effect of LPS to the myometrium of CCR2-/- mice a-b: CCR2-/- and wild type CD1 mice were given an intrauterine injection of LPS or PBS. Mice were sacrificed at 7 hours post injection or after the onset of labour, defined as the birth of the first pup. The myometrium from the left horn was used in this study to avoid any effect of the injection. Levels of COX-2 and phosphorylation of ERK, p65 and c-jun were similar in the LPS and PBS injected CCR2-/- mice at both 7 hours and in labour. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range.

149

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

I then compared myometrial samples from CCR2-/- and wild type mice treated with PBS and LPS at 7 hours and in labour. At 7 hours in the PBS treated mice, c-jun phosphorylation and COX-2 levels were lower in the CCR2-/- mice, while in the LPS treated mice, phosphorylation of p65 was reduced (p<0.05), ERK1/2 increased (p<0.01) and c-jun the same and the levels of COX-2 were reduced in the CCR2-/- mice (Fig.6.8a-b, p<0.05). In the PBS-treated labouring group, c-jun phosphorylation was again lower in the CCR2-/- myometrial samples (Fig.6.8c, p<0.05); and in the LPS-treated labouring group, ERK1/2 phosphorylation was higher and c-jun lower and in the CCR2-/- mice (Fig.6.8d, both p<0.01).

Phosphorylation of ERK1/2, c-jun, p65 and COX-2 levels in the myometrium (left horn) of PBS treated CD-1 and CCR2-/- mice at 7 hours

CD1 CCR2-/- a Phospho-ERK1/2 Phospho-c-jun Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2 2.5 Phospho-c-jun Phospho-p65 2.0 cox-2

1.5 * 1.0 * 0.5 protein expression/b-actin

0.0 CD1+PBS left horn 7h CD1+PBS left horn 7h CD1+PBS left horn 7h CD1+PBS left horn 7h CD1+PBS left horn 7h

CCR2-/-+PBS left horn 7h CCR2-/-+PBS left horn 7h CCR2-/-+PBS left horn 7h CCR2-/-+PBS left horn 7h CCR2-/-+PBS left horn 7h

150

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Phosphorylation of ERK1/2, c-jun, p65 and COX-2 levels in the myometrium (left horn) of LPS treated CD-1 and CCR2-/- mice at 7 hours

b CD1 CCR2-/- Phospho-ERK1/2 Phospho-c-Jun Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2 Phospho-c-jun 1.0 Phospho-p65 COX-2 0.8

0.6 * 0.4 ** *

protein expression/b-actin 0.2 *

0.0 CD1+LPS left horn 7h CD1+LPS left horn 7h CD1+LPS left horn 7h CD1+LPS left horn 7h CD1+LPS left horn 7h

CCR2-/-+LPS left horn 7h CCR2-/-+LPS left horn 7h CCR2-/-+LPS left horn 7h CCR2-/-+LPS left horn 7h CCR2-/-+LPS left horn 7h

151

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Phosphorylation of ERK1/2, c-jun, p65 and COX-2 levels in the myometrium (left horn) of PBS treated labouring CD-1 and CCR2-/- mice in labour

c CD1 CCR2-/-

Phospho-ERK1/2

Phospho-c-jun Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2

10 Phospho-c-jun Phospho-p65 COX-2

* 1 protein expression/b-actin

0.1 CD1+PBS left horn labouring CD1+PBS left horn labouring CD1+PBS left horn labouring CD1+PBS left horn labouring CD1+PBS left horn labouring

CCR2-/-+PBS left horn labouring CCR2-/-+PBS left horn labouring CCR2-/-+PBS left horn labouring CCR2-/-+PBS left horn labouring CCR2-/-+PBS left horn labouring

152

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Phosphorylation of ERK1/2, c-jun, p65 and COX-2 levels in the myometrium (left horn) of LPS treated labouring CD-1 and CCR2-/- mice

CD1 CCR2-/- d Phospho-ERK1/2 Phospho-c-jun Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2 10 Phospho-c-jun Phospho-p65 COX-2 ** 1 **

0.1

protein expression/b-actin **

0.01 CD1+LPS left horn labouring CD1+LPS left horn labouring CD1+LPS left horn labouring CD1+LPS left horn labouring CD1+LPS left horn labouring

CCR2-/-+LPS left horn labouring CCR2-/-+LPS left horn labouring CCR2-/-+LPS left horn labouring CCR2-/-+LPS left horn labouring CCR2-/-+LPS left horn labouring

Figure 6.8 The effect of LPS/PBS on myometrium of both CD1 and CCR2-/- a-b: In contrast in the PBS injected mice at 7 hours, COX-2 levels and c-jun phosphorylation were lower in the CCR2-/- myometrial samples. 7 hours after LPS administration, COX-2 levels and the phosphorylation of p65 were lower and ERK1/2 phosphorylation was higher in the CCR2-/- myometrial samples. c-d: In labouring samples, after PBS administration, only c-jun phosphorylation was lower in CCR2-/- myometrial samples. After LPS administration, the phosphorylation of ERK1/2 was increased and of c-jun was reduced. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01.

153

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

6.2.6 Investigations of the mechanism responsible for improved pup survival in CCR2-/- mice

Earlier in the chapter, pup survival was found to be improved at the intermediate time point, but at the time of onset of parturition it was similar. To investigate whether this was because there was a less marked inflammatory response to LPS, I assessed 1) pup brain inflammation, 2) placental inflammation and 3) maternal circulating cytokine levels.

1) Pup brain from the left horn was harvested at 3 hours, 7 hours and during labour after intrauterine PBS/LPS injection. Initially I compared the effect of PBS and LPS injections in CCR2-/- mice. At 3 hours, LPS induced a decrease of IL-1β in CCR2-/- pup brain (p<0.05, Figure 6.9a1). Chemokine or cytokine levels showed no change at 7 hours and in labour post-op.(Figure 6.9b1&c1).

Chemokine and cytokine expressions in CCR2-/- PBS/LPS a treated pup brain (3h left horn) 10000

1000

100 *

1 Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 0.1

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

LPS 3h left horn PBS 3h left horn

154

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

b Chemokine and cytokine expressions in CCR2-/- PBS/LPS

1000 treated pup brain (7h left horn )

100 *

Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 1 α β IL-6 IL-1 CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

LPS 7h left horn

CCR2-/-+PBS 7h

Chemokine and cytokine expressions in CCR2-/- PBS/LPS c treated pup brain (labouring left horn ) 1000

100

Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 1 α β IL-6 IL-1 CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

LPS labouring left horn

CCR2-/-+PBS in labour

Figure 6.9 The effect of LPS on CCR2-/- pup brain a-c: Pup brain from the left horn was harvested at 3 hours, 7 hours and during labour after intrauterine

155

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

PBS/LPS injection. LPS induced a decrease of IL-1β at 3 hours and a decrease of CXCL5 at 7 hours in CCR2-/- pup brain. n=6 for this experiment. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05.

Then I compared the effects of PBS injection in CCR2-/- and CD1 mice. At 3 hours, there was no difference of chemokine or cytokine expression in PBS treated samples (Figure 6.10a); At 7 hours, in PBS control group, there were higher levels of CCL2 (p<0.05), CCL20 (p<0.05), CXCL1 (p<0.01), CXCL5 (p<0.05), IL-1β (p<0.05), TNFα (p<0.05), and IL-6 (p<0.05) in CCR2-/- pup brain (Figure 6.10b). In the labouring samples, the pup brains taken from PBS treated CCR2-/- mice expressed more CCL2 (p<0.001), CCL20 (p<0.001), CXCL1 (p<0.001), IL-1β (p<0.001), TNFα (p<0.01), and IL-6 (p<0.05) in pup brain (Figure6.10c).

Chemokine and cytokine expressions in CD1 and CCR2-/- a PBS treated pup brain (3h left horn) 10000

1000

100

10 Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 1 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +PBS 3h

CD1+PBS 3h control

156

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Chemokine and cytokine expressions in CD1 and CCR2-/-

b PBS treated pup brain (7h left horn)

10000 * * * ** *

1000 * *

100

Gene expression :GAPDH(% mean of CD1+PBS control) CD1+PBS of mean :GAPDH(% expression Gene 10 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +PBS 7h

CD1+PBS 7h control

Chemokine and cytokine expressions in CD1 and CCR2-/-

c PBS treated pup brain (in labour left horn)

10000 *** *** *** *** **

1000

100

Gene expression :GAPDH(% mean of CD1+PBS control) CD1+PBS of mean :GAPDH(% expression Gene 10 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +PBS in labour

CD1+PBS labouring control

Figure 6.10 The effect of PBS on CD1 and CCR2-/- pup brain

157

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

a-c: Pup brain from the left horn was harvested at 3 hours, 7 hours and during labour after intrauterine PBS/LPS injection. At 3 hours, there was no difference of chemokine or cytokine expression. At 7 hours, in PBS control group, there were higher levels of CCL2, CCL20, CXCL1, CXCL5, IL-1β, TNFα and IL-6 in CCR2-/- pup brain. In the labouring samples, the pup brains taken from PBS treated CCR2-/- mice expressed more CCL2, CCL20, CXCL1, IL-1β, TNFα, and IL-6 in pup brain. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01, *** indicates p<0.001.

Finally, for the pup brains, I compared the effects of LPS treatment in CCR2-/- and CD1 mice. At 3 hours post injection, the pup brains taken from the LPS treated CCR2-/- mice showed higher CXCL1 (p<0.01) and lower IL-1β (p<0.05; Figure 6.11 a). At 7 hours, LPS exposed CCR2-/- pups expressed higher levels of CCL2 (p<0.05), CXCL1 (p<0.05) and IL-1β (p<0.01) (Figure6.11b). In labouring samples, LPS exposed CCR2-/- pups expressed higher levels of CCL2 (p<0.05), CCL20 (p<0.01), CXCL1 (p<0.05) and IL-1β (p<0.01), but lower levels of IL-6 (p<0.01; Figure 6.11c).

158

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

a Chemokine and cytokine expressions in CD1 and CCR2-/- LPS treated pup brain (3h left horn) 100000

** 10000

1000

* 100

10 Gene expression :GAPDH(% mean of CD1+LPS control) CD1+LPS of mean :GAPDH(% expression Gene 1 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +LPS 3h

CD1+LPS 3h control

Chemokine and cytokine expressions in CD1 and CCR2-/-

b LPS treated pup brain (7h left horn)

10000 ** * *

1000

100

Gene expression :GAPDH(% mean of CD1+LPS control) CD1+LPS of mean :GAPDH(% expression Gene 10 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +LPS 7h

CD1+LPS 7h control

159

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Chemokine and cytokine expressions in CD1 and CCR2-/- LPS treated pup brain (in labour left horn) ** c 1000 * ** *

100 **

Gene expression :GAPDH(% mean of CD1+LPS control) CD1+LPS of mean :GAPDH(% expression Gene 1 α β IL-6 IL1- CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +LPS in labour

CD1+LPS labouring control

Figure 6.11 The effect of LPS on CD1 and CCR2-/- pup brain

a-c: Pup brain from the left horn was harvested at 3 hours, 7 hours and during labour after intrauterine PBS/LPS injection. At 3 hours post injection, the pup brains taken from the LPS treated CCR2-/- mice showed higher CXCL1 and lower IL-1β. At 7 hours, LPS exposed CCR2-/- pups expressed higher levels of CCL2, CXCL1 and IL-1β. In labouring samples, LPS exposed CCR2-/- pups expressed higher levels of CCL2, CCL20, CXCL1 and IL-1β, but lower levels of IL-6. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01.

2) The chemokine/cytokine mRNA expression in the placenta was measured to assess the level of inflammation. At 3 hours, LPS induced increase of chemokines and cytokines expression in CD1 mice (chapter 5), but there is no change in placenta of CCR2-/- mice (Figure 6.12a). At 7 hours after LPS, the placentae CCR2-/- mice had increased CCL5 (p<0.05), CCL20 (p<0.01), CXCL1 (p<0.01), CXCL5 (p<0.05) and TNFα (p<0.05) (Figure 6.12b). In labour after LPS, the placentae CCR2-/- mice had increased CCL2 (p<0.01), CCL5 (p<0.05), CCL20 (p<0.05) and IL-6 (p<0.05) (Figure 6.12c).

160

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Chemokine and cytokine expressions in PBS/LPS treated a CCR2-/- placenta (3h left horn) 10000

1000

100

Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 10

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

LPS 3h left horn PBS 3h control

Chemokine and cytokine expressions in PBS/LPS treated b CCR2-/- placenta (7h left horn) 10000

** * 1000 * ** *

100 Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 10

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

LPS 7h left horn PBS 7h control

161

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Chemokine and cytokine expressions in PBS/LPS treated c CCR2-/- placenta (in labour left horn) 10000

* * 1000 * **

100

10 Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 1

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

LPS labouring left horn PBS labouring control

Figure 6.12 The effect of LPS on CCR2-/- placenta a-c: The chemokine/cytokine mRNA expression in the placenta was measured to assess the level of inflammation. At 3 hours, LPS induced increase of chemokines and cytokines expression in CD1 mice. There is no change in placenta of CCR2-/- mice. At 7 hours after LPS, the placentae CCR2-/- mice had increased chemokine CCL5, CCL20, CXCL1, CXCL5 and TNFα. In labour, CCL2, CCL5, CCL20 and IL-6 were increased in LPS injected CCR2-/- mice placentae. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01.

162

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Next I compared the response to PBS injection in placentae taken from CCR2-/- and CD1 mice. At 3 hours after PBS treatment, the expression of CCL20 (p<0.05) and IL- 1β (p<0.01) was lower in CCR2-/- placentae (Figure 6.13a). At 7 hours, the expression of IL-1β, TNFα and IL-6 was lower in CCR2-/- placentae (p<0.05, Figure 6.13b). In placentae obtained from labouring mice after PBS injection, the expression of CCL2 (p<0.01) was lower in the CCR2-/- samples (Figure 6.13c).

Chemokine and cytokine expressions in PBS treated CD1 and a CCR2-/- placentae (3h left horn) 1000

100 * *

Gene expression :GAPDH(% mean of CD1+PBS control) CD1+PBS of mean :GAPDH(% expression Gene 1

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +PBS 3h

CD1+PBS 3h control

163

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Chemokine and cytokine expressions in PBS treated CD1 and b CCR2-/- placentae (7h left horn) 10000

1000

* 100 * *

Gene expression :GAPDH(% mean of CD1+PBS control) CD1+PBS of mean :GAPDH(% expression Gene 10

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +PBS 7h

CD1+PBS 7h control

164

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

c Chemokine and cytokine expressions in PBS treated CD1 and

1000 CCR2-/- placentae (in labour left horn)

100 **

Gene expression :GAPDH(% mean of CD1+PBS control) CD1+PBS of mean :GAPDH(% expression Gene 10

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +PBS labouring

CD1+PBS labouring control

Figure 6.13 Comparisons of chemokine/cytokine expression in placenta between PBS treated CD1 and CCR2-/- mice a-c: At 3 hours after PBS treatment, the expression of CCL20 and IL-1β was lower in CCR2-/- placentae. At 7 hours, the expression of IL-1β, TNFα and IL-6 was lower in CCR2-/- placentae. In placentae obtained from labouring mice after PBS injection, the expression of CCL2 was lower in the CCR2-/- samples. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01.

Finally for the placental analysis, I assessed the response to LPS injection in placentae taken from CCR2-/- and CD1 mice. At 3 hours after LPS treatment there was no difference in chemokine or cytokine mRNA expression in placentae taken from CCR2-/- and CD1 mice. At 7 hours, the expression of CXCL1 was less in CCR2- /- when treated with LPS (p<0.01, Figure 6.14b). In placentae obtained from labouring mice after LPS injection, the expression of CCL2 (p<0.01), CCL5 (p<0.05), CCL20 (p<0.05) and CXCL1 (p<0.01) was lower in the CCR2-/- samples (Figure 6.14c)

165

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

Chemokine and cytokine expressions in LPS treated CD1 and a CCR2-/- placentae (3h left horn) 1000

100

Gene expression :GAPDH(% mean of CD1+LPS control) CD1+LPS of mean :GAPDH(% expression Gene 1

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +LPS 3h

b CD1+LPS 3h control Chemokine and cytokine expressions in LPS treated CD1 and

1000 CCR2-/- placentae (7h left horn)

100 **

Gene expression :GAPDH(% mean of CD1+LPS control) CD1+LPS of mean :GAPDH(% expression Gene 1

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +LPS 7h

CD1+LPS 7h control

166

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

c Chemokine and cytokine expressions in LPS treated CD1 and 1000 CCR2-/- placentae (in labour left horn)

* 100 * * **

Gene expression :GAPDH(% mean of CD1+LPS control) CD1+LPS of mean :GAPDH(% expression Gene 1

α β IL-6 CCL2 CCL5 IL-1 TNF- CCL20 CXCL1 CXCL5

CCR2-/- +LPS labouring CD1+LPS labouring control

Figure 6.14 The effect of LPS on CD1 and CCR2-/- placentae a-c: At 3 hours after LPS treatment there was no difference in chemokine or cytokine mRNA expression in placentae taken from CCR2-/- and CD1 mice. At 7 hours, the expression of CXCL1 was less in CCR2-/- when treated with LPS. In placentae obtained from labouring mice after LPS injection, the expression of CCL2, CCL5, CCL20 and CXCL1 was lower in the CCR2-/- samples. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01

.In order to assess the pathways involved in LPS induced chemokine/cytokine expression, the activation of NF-κB (p65) and MAPK pathways have been measured and compared between the two genotypes. At 3 hours after the PBS injection, the level of phosphorylated NF-κB (p65; p<0.01) and c-jun (p<0.05) were higher in CCR2-/- mice (Figure 6.15a). At the time of labour after PBS treatment, the level of phosphorylated ERK2 (p<0.001), phosphorylated NF-κB (p65; p<0.001) and c-jun

167

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

(p<0.05) were higher, but the level of COX-2 (p<0.01) was lower than CD1s (Figure 6.15b).

CD1 j2 CCR2-/- Phospho-ERK1/2 Phospho-c-jun Phospho-p65 COX-2 β-actin Phospho-ERK1 Phospho-ERK2 Phospho-c-jun Phospho-p65 COX-2 0.8

0.6

0.4 * **

0.2 protein expression/b-actin

0.0 CD1+PBS 3h placenta CD1+PBS 3h placenta CD1+PBS 3h placenta CD1+PBS 3h placenta CD1+PBS 3h placenta

CCR2-/-+PBS 3h placenta CCR2-/-+PBS 3h placenta CCR2-/-+PBS 3h placenta CCR2-/-+PBS 3h placenta CCR2-/-+PBS 3h placenta

168

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

k2 CD1 CCR2-/- Phospho-ERK1/2 Phospho-c-jun Phospho-p65 COX-2 β-actin Phospho-ERK1

1.5 Phospho-ERK2 * Phospho-c-jun Phospho-p65 COX-2

1.0 ***

0.5 *** ** protein expression/b-actin

0.0 CD1+PBS labouring placenta CD1+PBS labouring placenta CD1+PBS labouring placenta CD1+PBS labouring placenta CD1+PBS labouring placenta

CCR2-/-+PBS labouring placenta CCR2-/-+PBS labouring placenta CCR2-/-+PBS labouring placenta CCR2-/-+PBS labouring placenta CCR2-/-+PBS labouring placenta

Figure 6.15 The effect of PBS to CD1 and CCR2-/- placentae a-b: At 3 hours after the PBS injection, the level of phosphorylated NF-κB p65 and c-jun were higher in CCR2-/- mice. At the time of labour after PBS treatment, the level of phosphorylated ERK2, phosphorylated NF-κB and c-jun were higher, but the level of COX-2 was lower than CD1s. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01, *** indicates p<0.001.

169

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

At 3 hours after LPS injection, COX-2, phosphorylated NF-κB (p65), c-jun and ERK1 were lower in CCR2-/- placenta (p<0.05, Figure 6.16a). At the time of labour after LPS injection, the phosphorylation of NF-κB (p65) (p<0.01) and ERK1 (p<0.001) and ERK2 (p<0.01) and the levels of COX2 (p<0.01) were lower in CCR2-/- placenta (Figure 6.16b).

a CD1 CCR2-/-

Phospho-ERK1/2 Phospho-c-jun Phospho-p65 COX-2 β-actin Phospho-ERK1 0.6 Phospho-ERK2 Phospho-c-jun Phospho-p65 COX-2 0.4

* 0.2 * * protein expression/b-actin

* 0.0 CD1+LPS 3h placenta CD1+LPS 3h placenta CD1+LPS 3h placenta CD1+LPS 3h placenta CD1+LPS 3h placenta

CCR2-/-+LPS 3h placenta CCR2-/-+LPS 3h placenta CCR2-/-+LPS 3h placenta CCR2-/-+LPS 3h placenta CCR2-/-+LPS 3h placenta

170

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

b CD1 CCR2-/- Phospho-ERK1/2 Phospho-c-jun Phospho-p65 COX-2 β-actin

Phospho-ERK1 1.0 Phospho-ERK2 Phospho-c-jun Phospho-p65 0.8 COX-2

0.6

0.4 **

protein expression/b-actin 0.2 *** *** ** 0.0 CD1+LPS labouring placenta CD1+LPS labouring placenta CD1+LPS labouring placenta CD1+LPS labouring placenta CD1+LPS labouring placenta

CCR2-/-+LPS labouring placenta CCR2-/-+LPS labouring placenta CCR2-/-+LPS labouring placenta CCR2-/-+LPS labouring placenta CCR2-/-+LPS labouring placenta

Figure 6.16 The effect of LPS on CD1 and CCR2-/- a-b: At 3 hours after LPS injection, COX-2, phosphorylated NF-κB (p65), c-jun and ERK1 were lower in CCR2-/- placenta. At the time of labour after LPS injection, the phosphorylation of NF-κB (p65) and ERK1 and ERK2 and the levels of COX2 were lower in CCR2-/- placenta. Data were analyzed using unpaired t test or Mann Whitney test if data were not normally distributed. n=6 for this experiment. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01, *** indicates p<0.001.

171

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

3) Plasma IL-6 level in both CD1 and CCR2-/- mother was measured in order to assess the effect of LPS at 3 hours, 7 hours and the time of labour. Firstly, the basal level of IL-6 was measured and showed no change through the gestation and in labour. At 3 hours, there is no change of plasma IL-6 in both PBS and LPS treated CD1 or CCR2-/- mice. However, plasma IL-6 level in PBS treated CD1 and CCR2-/- mice declined at 7 hours and in labour and there was no difference between genotypes. In the LPS treated mice, the levels of IL-6 remained elevated at 7 hours and at the time of labour. There was no difference between the two genotypes (p<0.001,Figure 6.17).

172

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

10000 *** *** *** *** 1000

100 IL-6 (pg/ul) IL-6

1 CD1 NP CD1 E16 CCR2-/- NP CCR2-/- E16 CD1+LPS 3H CD1+LPS 7H CD1+PBS 3H CD1+PBS 7H CD1 labouring CCR2-/-+LPS 3H CCR2-/-+LPS 7H CCR2-/-+PBS 3H CCR2-/-+PBS 7H CCR2-/- labouring CD1+LPS Labouring CD1+PBS Labouring CCR2-/-+LPS Labouring CCR2-/-+PBS Labouring

Figure 6.17 The effect of LPS/PBS on CD1 and CCR2-/- plasma IL-6 level

Throughout the gestation, labour and 3 hours, there is no change of plasma IL-6 in both PBS and LPS treated CD1 or CCR2-/- mice. However, plasma IL-6 level in both PBS treated CD1 and CCR2-/- mice at 3 hours is much higher than the level in PBS treated mice at 7 hours, the time point that I consider as basal. At 7 hours and the time of labour, IL-6 in LPS treated CD1 and CCR2-/- mice is significantly higher in PBS treated ones. There is no difference between the two genotypes. Unpaired t test were used when data are normally distributed, Mann Whitney test were used for non-parametric data. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05, ** indicates p<0.01.

173

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

6.3 Discussion

In this chapter, I have investigated the impact of LPS intra-uterine injection in CCR2- /- pregnant mice. In contrast to CD1 mice, only small changes in chemokine expression were evident through pregnancy in the CCR2-/- mouse. However, ERK1/2, NF-κB (p65) phosphorylation and COX-2 levels did increase with advancing gestation as did the numbers of total and myeloid macrophages, monocytes, and neutrophils in CCR2-/- mice myometrium. Compared to CD1 mice, there was less leukocyte and macrophage infiltration in CCR2-/- myometrium. However, monocyte numbers were higher in CCR2-/- myometrium. After LPS injection, CCR2-/- mice went into labour at the same time as the CD1 wild type mice. However, CCR2 knockout did improved pup survival, although the mechanism responsible remains unclear.

Unlike results in the previous studies on CD1 mice (chapter 5) which showed the myometrial chemokine level going down on E6 of pregnancy and rising from E6 till the time of labour, CCR2-/- myometrial chemokines didn’t very much changes, or even decreased from E6. In human myometrium, ERK1/2 and p65 pathways were showed to involve in the regulation of chemokine expressions (chapter 3). The differences in chemokine expressions in mouse myometrium may be a result of the different pathways being activated.

In CCR2-/- mouse myometrium, phosphorylation of ERK1/2 increased and c-jun decreased in E16, which is the same in CD1s, however p65 phosphorylation increased in CCR2-/- mice, in contrast to the CD1s. ERK1/2 phosphorylation is increased in CCR2-/- mice in non-pregnant and E16 samples compared to the wild type, which may be a result of the infiltration of different leukocyte subtypes. The activation of ERK pathways is required for neutrophil extracellular trap formation 311 and the ERK pathway is also involved in the adhesion of neutrophils 312. The change of COX-2 expressions in my study may be secondary to the increased ERK1/2 activation202 or may be a consequence of the greater inflammatory

174

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

infiltration. However, whether the increase in COX-2 in both of the strains has pro- contractile or pro-relaxant effects will be determined by the expression and activity of the downstream prostaglandin synthetic enzymes. NF-κB (p65) phosphorylation is relatively increased in E16 CCR2-/- mouse myometrium and may be important in the increased chemokine expression as p65 has a key role in chemokine expression 278, allowing the process of pregnancy and parturition to occur normally

Several studies have showed that CCR2-/- mice have similar or lower levels of monocytes/macrophages than observed in wild type mice, both basally and after stimulation 266,313-315. It has been postulated that a negative feedback loop exists between chemokines and their receptors. In CCR2-/- mice challenged by LPS, the level of CCL2 dramatically increased in the lung in association with lower numbers of trafficking monocytes266. In my study, I observed a higher level of myometrial CCL2 mRNA expression in CCR2-/- mice than in wild type CD1s during pregnancy. Furthermore, other chemokines, such as CCL5, CCL20, CXCL1 and CXCL5 are also higher in CCR2-/- mice. This is consistent with the observation that PMN and lymphocyte infiltration into inflammatory sites is normal in CCR2-/-, probably because neutrophils lack CCR2 and so are unaffected by CCR2-/- knockdwon 316,317. Indeed, occasionally, PMN have been reported to infiltrate in greater numbers in CCR2-/- mice 266,315. In an influenza mouse models on CCR2-/- mice, higher numbers of local granulocytes as well as neutrophils was observed after viral infection, which normally requires a local expression of soluble CC and CXC chemokines. In same model, the greater neutrophil count may have been due to their increased expression of CXCR2, perhaps increased via the elevated levels of eotaxin 318,319. Furthermore, expression of the chemokines CCL2, CCL10, MIP-3 and MIP-2α were also reported to be greater in CCR2-/- mice315,316,320. In chapter 5, I found that myometrial leukocyte numbers increased on E18 as compared to non-pregnant levels in agreement with other studies 9,17. I found the same increase in CCR2-/- mice. However, as would be expected, on day 18, CCR2-/- mice had lower numbers of macrophages, but there was a trend for PMNs to be increased and there was a

175

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

significant increase of Gr1high monocytes. It has been reported previously that only Gr1+ monocytes infiltrated inflammatory sites in CCR2-/- mice 313. The increased Gr1+ monocytes in my study might be due to activation of the parallel CSF-1- regulated system, which also regulates tissue monocytes trafficking. Consistent with this, several studies did not find any evidence that these cells required CCR2 to enter inflammatory sites. Instead, it seemed that the local infiltration of Gr1+ monocytes was primarily regulated by the level of egress from the bone marrow compartment. Consequently, it may be worthwhile assessing the level of CFS-1 in both CD1 and CCR2-/- mice.

In the LPS induced preterm labour model in the CD1 mouse, LPS is injected into the uterus on E16 and parturition starts about 14 hours later. This is similar to other reports 165,263,321. The time of onset was not delayed in CCR2-/- mice, perhaps because despite the CCR2 deficiency, LPS is still able to induce neutrophil myometrial infiltration and the increase in the expression of other chemokines. Although the total leukocyte and macrophage count was lower in CCR2-/- mice other mechanisms were able to more than compensate to induce parturition 11,17. Compared to wild type mice, LPS induced a higher level of granulocytes and neutrophils in CCR2-/- mice 315. Compared to CD1, LPS induced similar increase of chemokines and cytokines in CCR2-/- myometrium. At the time of labour post-op, chemokine levels remain high and cytokine levels were back to normal in CCR2-/-, but IL-6 remained increased in CD1s. After PBS injection, inflammation in CCR2-/- myometrium was relatively lower than CD1s at 7 hours as well as in labour. Cytokine levels were lower in CCR2-/- myometrium with LPS injection, which indicates an anti-inflammatory effect of CCR2 deletion. However, in CCR2-/-, LPS induced more CCL2 mRNA expression at 7 hours, but less at in labour. The relatively greater expression of CCL5 at both LPS time points may drive a relatively greater infiltration of granulocytes 322, allowing LPS-parturition to proceed in a similar manner to that observed in the CD1 mice.

176

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

At 7 hours, after LPS treatment, CCR2-/- mice had low COX-2 and phosphorylated p65, but a higher level of ERK phosphorylation compared to PBS controls; during labour, both PBS and LPS treated CCR2-/- mice showed low c-jun phosphorylation. However, CCR2-/- mice had higher ERK activation. This may mean that infiltrating leucocytes could activate distinct intracellular signalling pathways, however, this possibility requires further study.

In this study I found that CCR2-/- had a better pup survival rate than CD1s with LPS, however LPS treatment did not increase pup brain inflammation in CD1 mice at 3 and 7 hours. After all the pups were dead, at the time of labour, there was a marked inflammatory change. Nevertheless, I investigated the possibility that inflammation was lower in the pups of CCR2-/- mice. Interestingly, the chemokine and cytokine levels were relatively higher in CCR2-/- pups than the CD1 pups at 7 hours and in labour. These observations probably reflect the differences in the timing of CCR2-/- and CD1 pup death. At 3 hours with LPS when all pups were still alive, the level of IL-1β is lower than the CD1s, which indicates a protection to the pup brain inflammation from CCR2 deletion as both IL-1β and IL-6 are mediators of maternal immune activation induced pup death and behavioural abnormality 323,324. Since both of the two strains were mated with wild type studs, their pups were heterozygous and homozygous, respectively. The differences in genotypes of the pups may have influenced their response to LPS, resulting in different pup survival. In order to investigate this further, we plan to mate heterozygous males and females to give wild type, heterozygous and homozygous pups in the same litter to see if pup genotype influences survival.

I studied inflammation in placenta to understand whether it played a role in pup brain damage. LPS administration also induced chemokine and cytokine expression in the placenta of CD1 mice in agreement with the findings of several researchers who reported that LPS injection activated NF-κB and increased IL-1β, IL-6 and TNFα expression 325,326. CCR2-/- placenta exposed to LPS showed no increase in

177

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

chemokines or cytokines at 3 hours, by 7 hours, the expression of some chemokines and of TNFα were increased, and remained elevated in labouring samples (albeit with slightly less marked increases). These changes were reflected in the activation of the MAPK and NF-κB pathways. In comparison to the CD1 mice, LPS-induced placental inflammation was less marked in terms of chemokine expression and activation of the MAPK and NF-κB pathways. The lower level of cytokine and chemokine level in the placentae may be the reason of higher pup survival of CCR2- /- mice. Injection of LPS (IP) elevated the placental and amniotic fluid IL-1β, IL-6 and TNFα 325. Other studies have shown that maternal immune activation is associated with pup brain inflammation and injury with increased IL-1β and TNFα mRNA expression. Furthermore, several stress related factors were up regulated as well327,328. In my study, CD1 pup brain CCL2, IL-1β, IL-6 expression was increased after LPS injection during labour. However, there is no change of chemokine or cytokine in CCR2-/- pup brain. However, these differences do not relate to the improved pup survival observed in the CCR2-/- mice, which is probably mediated through reduced placental damage, which could be the consequence of differences in genotypes of pups.

In agreement with other studies328-330, the IL-6 in maternal plasma are up regulated in CD1 mouse. Along with the up-regulated chemokines induced by LPS, CCR2 knockdown did not prevent the effect of LPS on plasma IL-6 expression. Interestingly, at the 3 hours, IL-6 is much higher than the rest two time-points both in PBS and LPS group, which indicates that there is an acute inflammatory effect caused by the surgery.

This study shows that CCR2-/- does not prevent LPS-induced preterm delivery but is associated with improved pup survival. In general, there was less marked cytokine and chemokine expression in CCR2-/-. However, basal level of phosphor- ERK was higher in CCR2-/- mice, which may relate to high level of neutrophils, CCL5 and CCL2, which require a further study. These data indicate that although CCR2 is

178

Chapter 6. CCR2 knockout improved pup survival in a mouse model of preterm labour

a major mediator inflammation, that it is not indispensible to LPS-induced preterm delivery, rather the system possesses sufficient redundancy to be able to respond normally to LPS in terms of labour induction.

179

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

Chapter 7. CCL20/CCR6 system in human and mouse labour: preliminary findings

180

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

7.1 Introduction

In my human studies, I found that CCL20 expression was increased in the lower uterine segment with the onset of PTL. It has been implicated in the innate immune response and is thought to regulate dendritic cell and lymphocyte function 331. CCL20 is also called liver and activation-regulated chemokine (LARC), macrophage inflammatory protein-3α (MIP-3α) or Exodus-1 and is the only chemokine that interacts with its receptor, CCR6. Dendritic cells are bone marrow-derived “sentinels” of the immune system, which express functional CCR6. When inflammation occurs, chemokines stimulate dendritic cells to leave the bone marrow and migrate via the blood stream to the target site. Similarly, some breast cancers express increased levels of CCL20 and this is associated with the infiltration of a high number of immature dendritic cells into the tumour 332. Recently, an in vitro study demonstrated that when hematopoietic progenitor cells are incubated with an appropriate mixture of cytokines and monocytes that they develop into dendritic cells with functional CCR6 333. CCR6 is also expressed on both CD4+ and CD8+T cells 271,272,334, while in B-lymphocytes, CCR6 expression is restricted to functionally mature cells capable of responding to antigen challenge 272.

CCL20 expression is regulated by cytokines and other inflammatory factors via a variety of transcription factors including NF-κB, AP-1 and C-EBP 335-337. In vitro studies showed that NF-κB activation increases the expression of CCL20 mRNA in human myometrial cells 278 and the intradermal injection of IL-1 and TNFα induce a rapid increase in both CCL20 and CCR6 mRNA in mouse epidermal keratinocytes 338. While the administration of IL-10 suppresses the expression of CCL20 and reduces the number of dendritic cells in human papilloma virus infected cervix tissues 339. CCL20 levels increase in the amniotic fluid (AF) with the gestational age and are higher in spontaneous labour and in patients with intra-amniotic infection/inflammation 182. Myometrial gene array studies found that CCL20 expression is greater in samples from woman in labour at term 167 and similar results were found in labouring chorioamniotic membranes at term 340. In this chapter I have investigated the expression and regulation of CCR6 in human

181

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

myometrium and myometrial cells and the role of CCL20/CCR6 in LPS-induced PTL in the mouse.

182

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

7.2 Results

7.2.1 Human myometrial expression of CCR6 in pregnancy and labour

Myometrial chemokine receptors CCR6 decreased in term labour (TL) when compared to term non-labour in both upper and lower segment myometrium (p<0.05, Figure 7.1).

a 100 *

1 *

CCR6:GAPDH 0.1

0.01 TL-lower TL-upper PTL-lower TNL-lower PTL-upper TNL-upper PTNL-lower PTNL-upper

Figure 7.1 Expression of human myometrial CCR6

Paired upper and lower segment human myometrial samples were obtained from four groups of women (mean gestational age ± SD in each case), at preterm no labour (PTNL; 31.5 ± 3.5 wks; mean ± SD; n=8), PTL (32.3 ± 4.1 wks; n=8), term no labour (TNL; 38.0 ± 1.2 wks; n=8) or TL (39.4 ± 0.5 wks; n=8). See table 2.3 for details regarding phenotypes of these samples. Messenger RNA expression was measured by quantitative rtPCR. There is a decrease of CCR6 in lower segment myometrium at term labour when compare to preterm labour. n=8 for this experiment. Comparisons were made between groups using a Mann Whitney test for non-parametric data and a t test for parametric data. Data were presented as median with interquartile range. * indicates a significant difference of p<0.05.

183

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

7.2.2 The regulations of human myometrial CCR6 expression

Myometrial cell CCR6 mRNA expression was unaltered by 16% of stretch for 0, 1, 3 and 6 hours, while of the cytokines only IL-1β (10ng/ml) increased the expression of CCR6 at 1 hour only (Fig 7.2a, p<0.01). Incubation of myometrial cells with PGE2, PGF2α and oxytocin (100nM/ml) had an inhibitory effect on CCR6 mRNA expression (Fig 7.2c, p<0.05-0.01). CCR6 protein levels, as assessed by western blotting, showed no change in response to the cytokines, but were consistently reduced by oxytocin, consistent with the mRNA data (Fig 7.2d. p<0.05-0.01). Oxytocin induced a decrease of CCR6 protein level at 6 and 24 hours. The western analysis data were supported by a similar reduction in myometrial cell CCR6 by oxytocin as assessed by flow cytometry (Figure 7.2 e).

a 250

200

150

100 (100%control) CCR6:GAPDH 50

0 CONTROL

STRETCH 1h STRETCH 3h STRETCH 6h STRETCH

184

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

b 1.0×1007 ** 1.0×1006

1.0×1005

1.0×1004

1.0×1003

CCR6:GAPDH 02 (100%control) 1.0×10

1.0×1001 1h 1h 6h 6h β 24h 24h α α β β α Control IL-1 IL-1 TNF TNF IL-1 TNF CXCL8 1h CXCL8 6h CXCL8 24h

c 10000

1000

100

10 * ** ** ** 1 %CONTROL CCR6:GAPDH

0.1

0.01 1h 6h 1h 6h 2 2 α α 24h 24h 2 2 2 α 2 PGE PGE PGF PGF PGE PGF CONTROL Oxytocin 1h Oxytocin 6h Oxytocin 24h

185

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

1"hour

6"hours

24"hours

IL+1β!!!!!!!!!!!!!!!!!!!!+ """+""""""""""""+"""""""""""+ """""""+"""""""""""+" TNF+α +""""""""""+""""""""""""+""""""""""+""""""""""""+"""""""""""+" CXCL8" +""""""""""+""""""""""""+""""""""""+""""""""""""+"""""""""""+"

PGF2α!!!!!!!!!!!!!!!!!!!!!!!+""""""""""+""""""""""""+""""""""""+""""""""""""+"""""""""""+" Oxytocin"!!!!!!!!!!!!!!!+""""""""""+""""""""""""+""""""""""+""""""""""""+"""""""""""+" 1h 6h 8000 24h

6000 -actin

β 4000 *

CCR6: * ** 2000

0 α α α α α α β β β 2 2 2 IL-1 IL-1 IL-1 TNF- TNF- TNF- control PGF control PGF control PGF CXCL8 CXCL8 CXCL8 Oxytocin Oxytocin Oxytocin

186

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

$cells$

myometrium myometrium

Human$ Human$

CCR2$ CCR6$

Figure 7.2 The regulations of human myometrial CCR6 e $cells$ $cells$ a-c: Human myometrial cells were 1) exposed to 16% stretch for 0, 1, 3 and 6 hours; 2) incubated with or

without 1ng/mL IL-1β, TNFα or CXCL8, 10nM PGE2, PGF2α and 100nM oxytocin for 1, 6 and 24 hours. At the end of incubation RNA was extracted and converted to cDNA. Copy numbers of CCR6 myometrium myometrium mRNA were measured by quantitative rtPCR. CCR6 mRNA was increased by IL-1β, decreased by PGF2α and oxytocin. n=6 for this experiment, data analysed using ANOVA Test if data distribution was

parametric, and Human$ Friedman’s Test if data distribution was non-parametric, with a Dunn's Multiple Human$ Comparisons post test. Data were presented as Min and Max. * indicates a significant difference of CXCR1$ p<0.05, ** indicates a significant difference of p<0.01. CXCR2$ d: Human myometrial cells were incubated with or without 1ng/mL IL-1β, TNFα or CXCL-8, 10nM

PGE2, PGF2α and 100nM oxytocin for 1, 6 and 24 hours. At the end of incubation protein was extracted. Protein expression of CCR6 was measured by Western blot. n=4 for this experimentFig.4$, densitometry was measured and analysed using Friedman test was used with Dunn's Multiple Comparisons post hoc test. p<0.05 at 1 and 6 hours and p<0.01 at 24 hours with oxytocin treatment. Data are shown as madian with interquartile range, and * indicates p<0.05. ** indicates p<0.01.

e: Human myometrial cells were pre-incubated with oxytocin for 0 and 24 hours. Cells were collected, and the CCR6 on cell surface was measured by FACS. n=4 for this experiment.

187

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

7.2.3 PGF2α and oxytocin down-regulation of human myometrial CCR6 mRNA expression via PLC

The PLC inhibitor, U73122, reversed the effects of oxytocin and PGF2α on CCR6 mRNA expression, which indicates that PLC is involved in PGF2α and oxytocin down-regulation of CCR6 expression (p<0.05, Figure 7.3 a-b).

a 1000 *

100 # # (100%control) CCR6:GAPDH

10 CONTROL Oxytocin 6h Oxytocin 24h PLC inhibitor 6H PLC inhibitor 24H Oxytocin+ PLC inhibitor 6H Oxytocin+ PLC inhibitor 24H

188

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

b 100000

10000 * *

1000 (100%control)

CCR6:GAPDH # # 100

10 6h α 24h 2 α 2 PGF PGF CONTROL PLC inhibitor 6h PLC inhibitor 24h + PLC inhibitor 6h α + PLC inhibitor 24h 2 α 2 PGF PGF

Figure 7.3 PGF2α and oxytocin down-regulation of human myometrial CCR6 mRNA expression via PLC

Human myometrial cells were incubated with or without 10nM PGF2α, 100nM oxytocin, PGF2α+PLC inhibitor or oxytocin+ PLC inhibitor for 6 and 24 hours. At the end of incubation mRNA was extracted and converted to cDNA. Copy numbers of CCR6 mRNA were measured by quantitative rtPCR. n=6 for this experiment, data analysed using ANOVA Test if data distribution was parametric, and Friedman’s Test if data distribution was non-parametric, with a Dunn's Multiple Comparisons post hoc test. Data are shown as the median, the 25th and

75th percentiles and the range, and * indicates CCR6 down regulated by PGF2a or oxytocin, p<0.05. # indicates the down regulation is inhibited by PLC inhibitor, p<0.05.

7.2.4 The effect of CCL20 on myometrial chemokine expression

Myometrial CCL20 expression is increased with labour and, as shown above, myometrial cells express CCR6. Consequently, in the next series of studies, I have investigated

189

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

whether CCL20 affects myometrial cell function. Previously, different concentrations of CCL20 have been used in vitro 341-343, I therefore decided to incubate human myometrial cells with 1ng/ml, 10ng/ml and 100ng/ml for 6 and 24 hours. Myometrial cells were then harvested and RNA extracted and converted into cDNA. The levels of chemokines were measured by rtPCR. IL-1β treatment (1ng/mL) was used as a positive control in this experiment. At 6 hours, CXCL5 mRNA expression was increased by 100ng/ml of CCL20 (p<0.05), at 24 hours, CCL2 (p<0.001 with 1ng/ml, p<0.01 with 10ng/ml, p<0.001 with 100ng/ml) and CCL5 (p<0.05 with all three different concentrations) mRNA levels were increased.

1500 a

1000 ** *

500 CCL2:GAPDH CCL2:GAPDH (100%control) *** **

0 6h 24h β β IL-1 IL-1 CONTROL CCL20 Ing/ml 6h CCL20 I0ng/ml 6h CCL20 Ing/ml 24h CCL20 I00ng/ml 6h CCL20 I0ng/ml 24h CCL20 I00ng/ml 24h

190

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

b 2000 **

1500

** *

:GAPDH 1000 *

CCL5 *

(100%CONTROL) 500

0 6h 24h β β IL-1 IL-1 CONTROL CCL20 Ing/ml 6h CCL20 I0ng/ml 6h CCL20 Ing/ml 24h CCL20 I00ng/ml 6h CCL20 I0ng/ml 24h CCL20 I00ng/ml 24h

c 800 *

600

400 (100%control)

CXCL1:GAPDH 200

0 6h 24h β β IL-1 IL-1 CONTROL CCL20 Ing/ml 6h CCL20 I0ng/ml 6h CCL20 Ing/ml 24h CCL20 I00ng/ml 6h CCL20 I0ng/ml 24h CCL20 I00ng/ml 24h

191

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

d 1500 *

1000

500 (100%control)

CXCL5:GAPDH * *

0 6h 24h β β IL-1 IL-1 CONTROL CCL20 Ing/ml 6h CCL20 I0ng/ml 6h CCL20 Ing/ml 24h CCL20 I00ng/ml 6h CCL20 I0ng/ml 24h CCL20 I00ng/ml 24h

e 10000

* * 1000

100 (100%control) CXCL8:GAPDH

10 6h 24h β β IL-1 IL-1 CONTROL CCL20 Ing/ml 6h CCL20 I0ng/ml 6h CCL20 Ing/ml 24h CCL20 I00ng/ml 6h CCL20 I0ng/ml 24h CCL20 I00ng/ml 24h Figure 7.4 The effect of CCL20 on other myometrial chemokines

Human myometrial cells were incubated with 1ng/ml, 10ng/ml and 100ng/ml CCL20 for 6 and 24 hours. Cells were harvested and RNA were extracted and converted into cDNA. The levels of chemokines were measured afterwards by rtPCR. The treatment of IL-1β was used as a positive control to this experiment. At 6 hours, 100ng/ml of CCL20 increased the expression of CXCL5. At 24 hours, both CCL2 and CCL5 were increased with the three different concentrations of CCL20. n=6 for this experiment, data analyzed using ANOVA Test with a Dunn's Multiple Comparisons post hoc test. Data are shown as the median with interquartile range, and * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001.

192

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

7.2.5 Time of delivery after LPS treatment and pup outcomes of CCR6-/- mice

Next I used CCR6-/- mice to determine the role of CCL20/CCR6 axis in in LPS-induced PTL. After intrauterine LPS/PBS injection, the delivery time of CCR6-/- mothers was observed and, the numbers of live or dead pups were recorded. LPS induced preterm delivery in CCR6-/- mice (p<0.01, Figure 7.5a). However, the delivery time of CCR6-/- mothers was delayed by 20±9 hours compared to wild-type animals (p<0.01, Figure 7.5b). Furthermore, LPS treated CCR6-/- mice still had 26% pups alive at the time of labour, when all the CD1 pups were dead (Chi-square p<0.001, Figure 7.5 c-d).

a 60 **

20 CCR6KO LPS/PBS delivery time(hours) delivery LPS/PBS CCR6KO 0 CCR6KO-/-+LPS CCR6KO-/-+PBS

193

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

b 40 **

10 CCR6KO vs CD1 delivery time(hours) delivery CD1 vs CCR6KO

0 CD1+LPS

CCR6KO-/-+LPS

194

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

Figure 7.5 Time of delivery and pup outcome of CCR6-/- mice. a: After intrauterine LPS injection, CCR6-/- mothers had preterm delivery when compared to PBS injected control ones. b: Compared to CD1 wild type mice with intrauterine LPS injection, CCR6-/- mothers had a 20±9 hours longer delivery time. Data were analyzed using unpaired T test. n=6 for this experiment. Data were presented as mean with SEM. * indicates a significant difference of p<0.05, ** indicates p<0.01. c-d: LPS treated CCR6-/- mice had 26% alive pups and 74% dead pups, when all the CD1 pups were dead during labour (Chi-square p<0.001).

7.2.6 Myometrial chemokine and cytokine expression of LPS treated CCR6- /- mice

To investigate whether knock out of CCR6 changed the myometrial response to LPS, I challenged CCR6-/- mice with LPS. I took myometrial samples in labour after LPS and compared chemokine and cytokine expression to PBS treated controls. To avoid any effect of the injection, only left horn was used in this experiment. In left horn of CCR6-/- mice, CCL5 was increased after LPS treatment during labour (Figure 7.6a, p<0.05). Compared to CD1, myometrial expression of CCL2 (p<0.05) and IL-6 (p<0.01) were lower in CCR6-/- mice. (p<0.05, Figure 7.6b)

195

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

10000

* 1000

100 Gene expression :GAPDH(% mean of PBS control) PBS of mean :GAPDH(% expression Gene 10 α β IL-6 IL-1 CCL2 CCL5 TNF- CCL20 CXCL1 CXCL5

LPS labouring left horn

CCR6-/-+PBS Labouring

196

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

PBS labouring left horn CCL2 labouring CCL5 labouring CCL20 labouring CXCL1 labouring CXCL5 labouring b IL-1b labouring TNF-a labouring 100000 IL-6 labouring

10000

1000 *

100 **

chemokine expression:GAPDH(%PBS control) 1 CD1 CD1 CD1 CD1 CD1 CD1 CD1 CD1 CD1

CCR6-/- CCR6-/- CCR6-/- CCR6-/- CCR6-/- CCR6-/- CCR6-/- CCR6-/- CCR6-/-

Figure 7.6 Myometrial chemokine and cytokine expressions in CCR6-/- mice.

Both CD1 and CCR6-/- mice were given intrauterine injection of LPS or PBS. At the time of labour post-op, animals were sacrificed and left horn myometrium was harvested and snap frozen at -70°C. RNA was extracted and converted into cDNA. In left horn uterus of CCR6-/- mice, CCL5 is increased after LPS treatment during labour. Compared to CD1, myometrial expression of CCL2 and IL-6 were lower in CCR6-/- mice. Data were analyzed using unpaired t test. n=6 for this experiment. Data were presented as Mean with SEM. * indicates a significant difference of p<0.05.

197

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

7.2.7 Plasma IL-6 level in CD1 and CCR6-/- mice

The level of IL-6 in CCR6-/- mice were measured in various time points and compared with CD1 wild types. There was no difference of IL-6 in CCR6-/- and CD1 mice at NP, E6 and E16. After LPS injection, the level of plasma IL-6 was increased in CCR6-/- mice compared with PBS control. The level was also lower in LPS treated CCR6-/- mice when compared with LPS treated CD1 ones (Figure 7.7).

a 15

5 Plasma IL-6(pg/ul) Plasma

0 CD1 E6 CD1 NP CD1 E16 CCR6-/- E6 CCR6-/- NP CCR6-/- E16 CD1 labouring

CCR6-/- labouring

198

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

b 10000

***

1000

$$$ 100 ** Plasma IL-6(pg/ul) Plasma

10 CD1+LPS Labouring CD1+PBS Labouring CCR6-/-+LPS Labouring CCR6-/-+PBS Labouring

Figure 7.7 Plasma IL-6 in CCR6-/- mice.

There was no difference of IL-6 in CCR6-/- and CD1 mice at NP, E6 and E16. After LPS injection, the level of plasma IL-6 was increased in CCR6-/- mice compared with PBS control. The level was also lower in LPS treated CCR6-/- mice when compared with LPS treated CD1 ones. Data were analyzed using unpaired T test. n=6 for this experiment. Data were presented as Mean with SEM. ** indicates a significant difference of p<0.01, *** indicates p<0.001 when LPS treated CCR6-/- mice are compared with PBS control. $$$ indicates p<0.001 when LPS treated CCR6-/- mice are compared with LPS treated CD1 mice.

199

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

7.3 Discussion

In an earlier chapter, I found that human myometrial CCL20 mRNA expression was increased in the lower segment in women in preterm labour. In this chapter, I demonstrated that in human myometrium, CCR6 mRNA expression was reduced in the upper and lower uterine segments in term labour. CCR6 expression was not changed by myometrial cell stretch and inflammatory cytokines generally had no effect, although IL- 1β treatment did result in a transient increase in CCR6 mRNA expression at 1 hour. In contrast, treatment with oxytocin resulted in a marked down regulation of CCR6 mRNA expression and this effect was mediated via the PLC pathway. Since CCR6 is expressed on myometrial cells I investigated the effect of CCL20 on myometrial chemokine expression and found that CCL20 treatment increased the expression of both CCL5 and CCL2, suggesting that CCL20 may influence myometrial cell function as well as acting as a chemokine to inflammatory cells. Given the specific changes in CCL20 and CCR6, I then used the CCR6 KO mouse to study the response to LPS. PTL was delayed in the CCR6-/- mouse, with improved pup survival. These changes were associated with a less marked inflammatory change in the myometrium and maternal circulation.

Normal labour is an inflammatory process with large numbers of leukocytes infiltrating the myometrium. It is clear from previous studies that CCL20/CCR6 axis has a critical, non-redundant role in the control of immune response by regulating the migration of immature DCs and lymphocytes271 and in a previous chapter I found the CCL20 increased at preterm labour in lower segment myometrium suggesting that it may have a role in the inflammatory infiltration of the myometrium that occurs in labour. Interestingly, its receptor CCR6 showed no change in preterm labour and a decrease at term labour in both upper and lower segment myometrium. Chemokine receptors, which are structurally identical to signaling receptors but which do not transduce an activation signal, were termed “decoy” receptors and act to bind and sequester chemokines 344. CCR6 on B cells has been shown to behave as a decoy receptor 271. If myometrial CCR6 behaved in this manner, a reduction in expression at term would result in greater amounts of free CCL20, which could promote the inflammatory infiltration of the

200

Chapter 7. CCL20/CCR6 system in human and mouse labourpreliminary findings

myometrium. The labour-associated decline seems to be induced by the combination of prostaglandins and oxytocin acting via PLC.

Primary cultured myometrial cells can produce CCL20. Myometrial CCL20 mRNA expression increased with advancing gestation and again with the onset of labour. In other cell types, CCL20 increased CXCL8 synthesis, and in this chapter I found that CCL20 increased CCL5, CCL2 and CXCL8 expression, suggesting that CCL20 may have other functions other than acting as a chemokine and raising the possibility that chemokines in general may modulate myometrial function.

In the CCR6-/- studies, I observed that LPS-induced preterm delivery was delayed and pup survival improved. Similarly, in a mouse model of LPS induced peritonitis, the deletion of CCR6 caused lower chemokine and cytokine expression and was associated with an improved outcome. The number of monocytes and dendritic cells were also lower in CCR6-/- mice compared to wild type274. My results agree with this study and the decreased chemokine and cytokine levels in both myometrium and plasma suggest that CCL20/CCR6 has an important role in LPS-induced parturition and may suggest a potential role for CCR6 antagonists in the management of human PTL and chorioamnionitis.

201

Chapter 8. Summary and Discussion

202

Chapter 8. Summary and Discussion

8.1 Final summary and discussion

Preterm delivery is a critical problem, which is the most important cause of prenatal mortality and morbidity. To date, the clinical management of preterm labour is limited and relatively unsuccessful in terms of improving neonatal outcomes. Recently, human labour has been discovered to be associated with a marked leukocyte infiltration into myometrium. As a key mediators of leukocyte trafficking, chemokines are very likely to play a role in this inflammatory process, indeed, myometrial expression increases in term labour167. Therefore, the studies in this thesis focus on the expression and regulation of chemokine/chemokine receptors in human myometrial cells as well as their role in the inflammatory infiltration of the myometrium associated with labour.

In the studies of chemokine expression and regulation in human myometrium, I found that chemokines CCL2, CCL5, CCL20, CXCL1, CXCL5 and CXCL8 are increased in human labour and also with the advancing gestational age. However, I observed different patterns of increase in chemokine expression in upper and lower segment myometrium, preterm and term labour, which suggest potentially different roles (inducing contraction, remodeling) in human labour as well as attracting different subtypes of leukocytes. These changes may be driven by inflammation and mechanical stretch since in myometrial cultures, stretch, IL-1β and TNFα all increased chemokine expression via both NF-κB and MAPK pathways. In contrast, the pro-labour factors, PGF2α and oxytocin, reduced the expression of myometrial chemokines. These data suggest that myometrial chemokine expression increases before the onset of human labour, potentially in response to stretch and/or inflammatory cytokines and may therefore play an important role in its onset and progression. Increased chemokine expression first followed by an influx of inflammatory cells, which then increase local cytokine levels. These inflammatory cytokines may then act to increase myometrial contractility directly and/or through increased PG synthesis.

203

Chapter 8. Summary and Discussion

In contrast to the behaviour of the chemokines, the chemokine receptors CCR2, CXCR1 and CXCR2 behave differently in human myometrium. Their expression is not affected by preterm labour, but reduced in term labour samples. Some chemokine receptors act as decoys, for example the CCR6 receptor on lymphocytes, it is possible that myometrial chemokine receptors have this role, however there is no evidence to support this. The alternative is that the receptors are functional, mediating the effects of chemokines on myometrial cell function. Certainly, I have shown that both CCL20 and CXCL8 affect myometrial cell function. Chemokine receptor expression is minimally modulated by stretch and cytokines, but markedly down-regulated by oxytocin, suggesting that the labour-induced decline is primarily mediated through oxytocin. However, in the case of CXCR2, I found a negative association with CXCL8 expression in myometrial tissues and in vitro, CXCL8 down- regulated myometrial CXCR2 expression suggesting that in the case of CXCR2, CXCL8 may also have a role in its reduction in labouring samples. This reduction with labour would favour the idea of the myometrial receptors acting as decoys, limiting the effect of locally released chemokines.

In order to better understand the role played by chemokines during spontaneous and LPS-induced labour, I studied three mice genotypes (wild type, CCR2-/- and CCR6-/-). In wild type mice, I found that myometrial chemokine expression initially declined at E6, but then increased during pregnancy, resulting increased densities of monocytes, macrophages and neutrophils in the myometrium. LPS induced a marked increased inflammation in the myometrium as well as in the placenta, which caused a preterm delivery and was associated with pup death. The intrauterine injection and laparotomy procedure caused a systemic and local inflammatory reaction, as shown by the increased circulating levels of IL-6 and higher IL-6 in plasma of PBS group. This will cause the limitation of the use of this model. Therefore, the IVT methods will be worth to be developed in this study.

However, CCR2-/- showed limited changes in chemokine expression during pregnancy and the myometrial leucocyte infiltration was generally less in CCR2-/-

204

Chapter 8. Summary and Discussion

mice, with the exception of a higher neutrophil count. An LPS induced preterm delivery mouse model was used in all of three genotypes. In wild type mice, 10mg intrauterine LPS injection on E16 caused preterm delivery and 100% fetal death within 14 hours of the treatment. LPS induced markedly increase of chemokines and cytokines in the myometrium and placenta with activation of NF-κB and MAPK pathways. The CCR2 knockout did not delayed LPS induced preterm labour. The basal chemokine CCL2, CCL5 levels in CCR2-/- myometrium were higher than in CD1 mice; this may be a result of the loss of CCR2 and so the usual negative feedback. The greater neutrophil infiltration, which have compensated for the lower levels of other leucocytes. However, generally, Despite the greater neutrophils, the cytokine levels were relatively lower in the CCR2-/- mice. The deletion of CCR2 was associated with lower phosphorylation of p65 and c-jun after LPS treatment. However, the phosphorylated ERK is higher in CCR2-/- myometrium and this may be associated with the increased chemokine levels and neutrophils. Furthermore, the inflammation in CCR2-/- placentae was much lower than in wild type mice, which may explain the improved pup survival. These results suggested an important role of the deletion of CCR2 in blocking the maternal-fetal inflammatory response to LPS.

Because of the importance of dendritic cells in the immune system, a further study of CCL20/CCR6 axis, which is a key regulator of dendritic cell trafficking, was performed. Human myometrial CCR6 expression behaved in a similar manner to the other chemokine receptors and was down regulated by PGs and oxytocin via PLC. CCL20 has an effect of inducing the expression of other chemokines in human myometrium. According to my preliminary studies, compared to wild type mice, the LPS induced preterm labour was delayed and pup survival was improved as well. The inflammation in myometrium and plasma are all much lower than the wild types. These data suggest an important role of CCL20/CCR6 system in regulating the LPS induced inflammation.

205

Chapter 8. Summary and Discussion

In conclusion, my results suggested that chemokines/chemokine receptors have a role in the process of labour. CCL20/CCR6 plays a major role in the inflammatory response and its inhibition may be an effective treatment of preterm labour, both inhibiting labour and improving neonatal outcomes. Although CCR2 knockdown did improve fetal survival, but the effects were less marked than found with CCR6 knockdown.

8.2 Future work

The future work will be:

1) Investigation the changes of different leukocytes subtype in human myometrium through gestation and labour. 2) The effect of LPS/PBS on the inflammatory cells (ie, monocytes/macrophages, dendritic cells and neutrophils) infiltration of CD1, CCR2-/- and CCR6-/- mice, as in myometrium, placenta and pup brain at different time points (ie. 3h, 7h and in labour). 3) Investigation of other potential pathways regulating the migration of CCL2/CCR2 drived cells (ie. CSF-1 pathways) 4) Behavioural test on CD1, CCR2-/- and CCR6-/- survived pups in order to investigate and compare the damage caused by maternal inflammatory, and how the deletion of CCR2 and CCR6 protect pup brain damage. 5) Longitudinal chemokine expression in CCR6-/- myometrium. 6) The effect of LPS/PBS on CCR6-/- (myometrium, placenta, pup brain) in different time points. 7) Investigate the possibility of using CCR2 and/or CCR6 antagonist to stop prematurity.

206

Appendix

Appendices

Appendix 1 Chemokine expression in prolonged cell culture at 6,24 and 54 hours

207

Appendix

Appendix 2 Pro-labour proteins down regulated chemokine receptor expressions was not via PKC

1000 1000

# 100 100 # (100%control) (100%control) CCR2:GAPDH CXCR1:GAPDH

10 10 CONTROL CONTROL Oxytocin 6h Oxytocin 6h Oxytocin 24h Oxytocin 24h PKC inhibitor 6h PKC inhibitor 6h PKC inhibitor 24h PKC inhibitor 24h Oxytocin+PKCinhibitor 6h Oxytocin+PKCinhibitor 6h Oxytocin+PKCinhibitor 24h Oxytocin+PKCinhibitor 24h

208

Appendix

1000 150

## 100 100 ### ###

10 50 (100%control) (100%control) CCR2:GAPDH CXCR2:GAPDH

1 0 CONTROL Oxytocin 6h PGF2a 6h Oxytocin 24h CONTROL PGF2a 24h PKC inhibitor 6h PKC inhibitor 24h PKC inhibitor 6h PKC inhibitor 24h Oxytocin+PKCinhibitor 6h PGF2a+PKCinhibitor 6h Oxytocin+PKCinhibitor 24h PGF2a+PKCinhibitor 24h

1000 1000

# ### ## 100 100

(100%control) 10

CXCR1:GAPDH 10 (100%control) CXCR1:GAPDH

1 1 PGF2a 6h PGF2a 6h CONTROL PGF2a 24h CONTROL PGF2a 24h PKC inhibitor 6h PKC inhibitor 6h PKC inhibitor 24h PKC inhibitor 24h PGF2a+PKCinhibitor 6h PGF2a+PKCinhibitor 6h PGF2a+PKCinhibitor 24h PGF2a+PKCinhibitor 24h

209

Appendix

Appendix 3 Chemokine receptor expression in prolonged cell culture

CCR2 CXCR1 CXCR2 0.15

0.10

0.05 Gene expression :GAPDH expression Gene

0.00 1h 6h 1h 6h 1h 6h 24h 24h 24h

210

References

211

References

1. Wen SW, Smith G, Yang Q, Walker M. Epidemiology of preterm birth and neonatal outcome. Semin Fetal Neonatal Med 2004;9:429-35. 2. Hack M FA. Outcomes of children of extremely low birthweight and gestational age in the 1990s. . Early Hum Dev 1999;53:193-218. 3. Ward RM, Beachy JC. Neonatal complications following preterm birth. BJOG 2003;110 Suppl 20:8-16. 4. Premature CoU, Birth and Assuring Healthy Outcomes, Policy. BoHS. Preterm birth: causes, consequences, and prevention. In. Washington, DC: National Academies Press,; 2006. 5. Ahman E ZJ. Neonatal and perinatal mortality: country, regional, and global estimates 2004. . In: World, Organization H, eds. Geneva:; 2007. 6. Mackenzie R, Walker M, Armson A, Hannah ME. Progesterone for the prevention of preterm birth among women at increased risk: a systematic review and meta-analysis of randomized controlled trials. Am J Obstet Gynecol 2006;194:1234-42. 7. Muglia LJ, Katz M. The enigma of spontaneous preterm birth. N Engl J Med;362:529-35. 8. Ragusa A, Mansur M, Zanini A, Musicco M, Maccario L, Borsellino G. Diagnosis of labor: a prospective study. MedGenMed : Medscape general medicine 2005;7:61. 9. Bokstrom H, Brannstrom M, Alexandersson M, Norstrom A. Leukocyte subpopulations in the human uterine cervical stroma at early and term pregnancy. Hum Reprod 1997;12:586- 90. 10. Ledingham MA, Thomson AJ, Jordan F, Young A, Crawford M, Norman JE. Cell adhesion molecule expression in the cervix and myometrium during pregnancy and parturition. Obstet Gynecol 2001;97:235-42. 11. Osman I, Young A, Ledingham MA, et al. Leukocyte density and pro-inflammatory cytokine expression in human fetal membranes, decidua, cervix and myometrium before and during labour at term. Mol Hum Reprod 2003;9:41-5. 12. Romero R, Espinoza J, Goncalves LF, Kusanovic JP, Friel LA, Nien JK. Inflammation in preterm and term labour and delivery. Semin Fetal Neonatal Med 2006;11:317-26. 13. Winkler M, Kemp B, Fischer DC, Ruck P, Rath W. Expression of adhesion molecules in the lower uterine segment during term and preterm parturition. Microsc Res Tech 2003;60:430- 44. 14. Junqueira LC, Zugaib M, Montes GS, Toledo OM, Krisztan RM, Shigihara KM. Morphologic and histochemical evidence for the occurrence of collagenolysis and for the role of neutrophilic polymorphonuclear leukocytes during cervical dilation. Am J Obstet Gynecol 1980;138:273-81. 15. Halgunset J, Johnsen H, Kjollesdal AM, Qvigstad E, Espevik T, Austgulen R. Cytokine levels in amniotic fluid and inflammatory changes in the placenta from normal deliveries at term. Eur J Obstet Gynecol Reprod Biol 1994;56:153-60. 16. Rosenberg MK. Preoperative pregnancy testing in ambulatory surgery. Anesthesiology 1996;84:1260; author reply 1. 17. Thomson AJ, Telfer JF, Young A, et al. Leukocytes infiltrate the myometrium during human parturition: further evidence that labour is an inflammatory process. Hum Reprod 1999;14:229-36. 18. Gomez-Lopez N, Estrada-Gutierrez G, Jimenez-Zamudio L, Vega-Sanchez R, Vadillo- Ortega F. Fetal membranes exhibit selective leukocyte chemotaxic activity during human labor. Journal of reproductive immunology 2009;80:122-31.

212

References

19. Vega-Sanchez R, Gomez-Lopez N, Flores-Pliego A, et al. Placental blood leukocytes are functional and phenotypically different than peripheral leukocytes during human labor. Journal of reproductive immunology 2010;84:100-10. 20. Pihl K, Larsen T, Rasmussen S, Krebs L, Christiansen M. The proform of eosinophil major basic protein: a new maternal serum marker for adverse pregnancy outcome. Prenatal diagnosis 2009;29:1013-9. 21. Timmons BC, Fairhurst AM, Mahendroo MS. Temporal changes in myeloid cells in the cervix during pregnancy and parturition. J Immunol 2009;182:2700-7. 22. Jones RK, Bulmer JN, Searle RF. Immunohistochemical characterization of stromal leukocytes in ovarian endometriosis: comparison of eutopic and ectopic endometrium with normal endometrium. Fertility and sterility 1996;66:81-9. 23. Mincheva-Nilsson L, Baranov V, Yeung MM, Hammarstrom S, Hammarstrom ML. Immunomorphologic studies of human decidua-associated lymphoid cells in normal early pregnancy. Adv Exp Med Biol 1995;371A:367-71. 24. Bulmer JN, Morrison L, Longfellow M, Ritson A, Pace D. Granulated lymphocytes in human endometrium: histochemical and immunohistochemical studies. Hum Reprod 1991;6:791-8. 25. Van Landuyt KB, Jones EA, McGonagle D, Luyten FP, Lories RJ. Flow cytometric characterization of freshly isolated and culture expanded human synovial cell populations in patients with chronic arthritis. Arthritis research & therapy 2010;12:R15. 26. Saito S, Tsukaguchi N, Hasegawa T, Michimata T, Tsuda H, Narita N. Distribution of Th1, Th2, and Th0 and the Th1/Th2 cell ratios in human peripheral and endometrial T cells. American journal of reproductive immunology 1999;42:240-5. 27. Vargas ML, Santos JL, Ruiz C, et al. Comparison of the proportions of leukocytes in early and term human decidua. American journal of reproductive immunology 1993;29:135-40. 28. Vassiliadou N, Bulmer JN. Quantitative analysis of T lymphocyte subsets in pregnant and nonpregnant human endometrium. Biol Reprod 1996;55:1017-22. 29. Abadia-Molina AC, Ruiz C, Montes MJ, King A, Loke YW, Olivares EG. Immune phenotype and cytotoxic activity of lymphocytes from human term decidua against trophoblast. Journal of reproductive immunology 1996;31:109-23. 30. Aluvihare VR, Kallikourdis M, Betz AG. Regulatory T cells mediate maternal tolerance to the fetus. Nat Immunol 2004;5:266-71. 31. Somerset DA, Zheng Y, Kilby MD, Sansom DM, Drayson MT. Normal human pregnancy is associated with an elevation in the immune suppressive CD25+ CD4+ regulatory T-cell subset. Immunology 2004;112:38-43. 32. Jonuleit H, Schmitt E, Stassen M, Tuettenberg A, Knop J, Enk AH. Identification and functional characterization of human CD4(+)CD25(+) T cells with regulatory properties isolated from peripheral blood. J Exp Med 2001;193:1285-94. 33. Nacher M, Blazquez AB, Shao B, et al. Physiological contribution of CD44 as a ligand for E-Selectin during inflammatory T-cell recruitment. Am J Pathol 2011;178:2437-46. 34. Sindram-Trujillo AP, Scherjon SA, van Hulst-van Miert PP, Kanhai HH, Roelen DL, Claas FH. Comparison of decidual leukocytes following spontaneous vaginal delivery and elective cesarean section in uncomplicated human term pregnancy. Journal of reproductive immunology 2004;62:125-37. 35. Brandes M, Willimann K, Moser B. Professional antigen-presentation function by human gammadelta T Cells. Science 2005;309:264-8.

213

References

36. Moser B, Eberl M. gammadelta T cells: novel initiators of adaptive immunity. Immunological reviews 2007;215:89-102. 37. Kitaya K, Nakayama T, Daikoku N, Fushiki S, Honjo H. Spatial and temporal expression of ligands for CXCR3 and CXCR4 in human endometrium. The Journal of clinical endocrinology and metabolism 2004;89:2470-6. 38. Schall TJ, Bacon K, Toy KJ, Goeddel DV. Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature 1990;347:669-71. 39. Hirota Y, Osuga Y, Koga K, et al. The expression and possible roles of chemokine CXCL11 and its receptor CXCR3 in the human endometrium. J Immunol 2006;177:8813-21. 40. Hua R, Pease JE, Sooranna SR, et al. Stretch and Inflammatory Cytokines Drive Myometrial Chemokine Expression Via NF-kappaB Activation. Endocrinology 2011. 41. Swirski FK, Nahrendorf M, Etzrodt M, et al. Identification of splenic reservoir monocytes and their deployment to inflammatory sites. Science 2009;325:612-6. 42. Gomez-Lopez N, Guilbert LJ, Olson DM. Invasion of the leukocytes into the fetal- maternal interface during pregnancy. J Leukoc Biol 2010;88:625-33. 43. Mackler AM, Iezza G, Akin MR, McMillan P, Yellon SM. Macrophage trafficking in the uterus and cervix precedes parturition in the mouse. Biol Reprod 1999;61:879-83. 44. Hunt JS. Immunologically relevant cells in the uterus. Biol Reprod 1994;50:461-6. 45. Choi SJ, Oh S, Kim JH, Roh CR. Changes of nuclear factor kappa B (NF-kappaB), cyclooxygenase-2 (COX-2) and matrix metalloproteinase-9 (MMP-9) in human myometrium before and during term labor. Eur J Obstet Gynecol Reprod Biol 2007;132:182-8. 46. Vadillo-Ortega F, Gonzalez-Avila G, Furth EE, et al. 92-kd type IV collagenase (matrix metalloproteinase-9) activity in human amniochorion increases with labor. Am J Pathol 1995;146:148-56. 47. Xu P, Alfaidy N, Challis JR. Expression of matrix metalloproteinase (MMP)-2 and MMP-9 in human placenta and fetal membranes in relation to preterm and term labor. The Journal of clinical endocrinology and metabolism 2002;87:1353-61. 48. Gardner L, Moffett A. Dendritic cells in the human decidua. Biol Reprod 2003;69:1438- 46. 49. Heikkinen J, Mottonen M, Komi J, Alanen A, Lassila O. Phenotypic characterization of human decidual macrophages. Clin Exp Immunol 2003;131:498-505. 50. Singh U, Nicholson G, Urban BC, Sargent IL, Kishore U, Bernal AL. Immunological properties of human decidual macrophages--a possible role in intrauterine immunity. Reproduction 2005;129:631-7. 51. Hunt JS, Pollard JW. Macrophages in the uterus and placenta. Current topics in microbiology and immunology 1992;181:39-63. 52. Chwalisz K, Benson M, Scholz P, Daum J, Beier HM, Hegele-Hartung C. Cervical ripening with the cytokines interleukin 8, interleukin 1 beta and tumour necrosis factor alpha in guinea- pigs. Hum Reprod 1994;9:2173-81. 53. Huang Y, Zhu XY, Du MR, Li DJ. Human trophoblasts recruited T lymphocytes and monocytes into decidua by secretion of chemokine CXCL16 and interaction with CXCR6 in the first-trimester pregnancy. J Immunol 2008;180:2367-75. 54. Hunt JS, Manning LS, Mitchell D, Selanders JR, Wood GW. Localization and characterization of macrophages in murine uterus. J Leukoc Biol 1985;38:255-65. 55. Kruse A, Merchant MJ, Hallmann R, Butcher EC. Evidence of specialized leukocyte- vascular homing interactions at the maternal/fetal interface. Eur J Immunol 1999;29:1116-26.

214

References

56. Langenkamp A, Messi M, Lanzavecchia A, Sallusto F. Kinetics of dendritic cell activation: impact on priming of TH1, TH2 and nonpolarized T cells. Nat Immunol 2000;1:311-6. 57. Sallusto F, Lanzavecchia A. Mobilizing dendritic cells for tolerance, priming, and chronic inflammation. J Exp Med 1999;189:611-4. 58. Kammerer U, Schoppet M, McLellan AD, et al. Human decidua contains potent immunostimulatory CD83(+) dendritic cells. Am J Pathol 2000;157:159-69. 59. Blois SM, Alba Soto CD, Tometten M, Klapp BF, Margni RA, Arck PC. Lineage, maturity, and phenotype of uterine murine dendritic cells throughout gestation indicate a protective role in maintaining pregnancy. Biol Reprod 2004;70:1018-23. 60. Starkey PM, Sargent IL, Redman CW. Cell populations in human early pregnancy decidua: characterization and isolation of large granular lymphocytes by flow cytometry. Immunology 1988;65:129-34. 61. Lash GE, Robson SC, Bulmer JN. Review: Functional role of uterine natural killer (uNK) cells in human early pregnancy decidua. Placenta 2010;31 Suppl:S87-92. 62. Tabiasco J, Rabot M, Aguerre-Girr M, et al. Human decidual NK cells: unique phenotype and functional properties -- a review. Placenta 2006;27 Suppl A:S34-9. 63. Koopman LA, Kopcow HD, Rybalov B, et al. Human decidual natural killer cells are a unique NK cell subset with immunomodulatory potential. J Exp Med 2003;198:1201-12. 64. Saito S, Nakashima A, Myojo-Higuma S, Shiozaki A. The balance between cytotoxic NK cells and regulatory NK cells in human pregnancy. Journal of reproductive immunology 2008;77:14-22. 65. Jeziorska M, Salamonsen LA, Woolley DE. Mast cell and eosinophil distribution and activation in human endometrium throughout the menstrual cycle. Biol Reprod 1995;53:312-20. 66. Mori A, Nakayama K, Suzuki J, Nikaido T, Isobe M, Fujii S. Analysis of stem cell factor for mast cell proliferation in the human myometrium. Mol Hum Reprod 1997;3:411-8. 67. Cabanillas-Saez A, Schalper JA, Nicovani SM, Rudolph MI. Characterization of mast cells according to their content of tryptase and chymase in normal and neoplastic human uterine cervix. International journal of gynecological cancer : official journal of the International Gynecological Cancer Society 2002;12:92-8. 68. Padilla L, Reinicke K, Montesino H, et al. Histamine content and mast cells distribution in mouse uterus: the effect of sexual hormones, gestation and labor. Cell Mol Biol 1990;36:93-100. 69. Rudolph MI, Rojas IG, Penissi AB. Uterine mast cells: a new hypothesis to understand how we are born. Biocell : official journal of the Sociedades Latinoamericanas de Microscopia Electronica et al 2004;28:1-11. 70. Rudolph MI, de los Angeles Garcia M, Sepulveda M, et al. Ethodin: pharmacological evidence of the interaction between smooth muscle and mast cells in the myometrium. The Journal of pharmacology and experimental therapeutics 1997;282:256-61. 71. Kuther K, Audige L, Kube P, Welle M. Bovine mast cells: distribution, density, heterogeneity, and influence of fixation techniques. Cell and tissue research 1998;293:111-9. 72. Logue JP, Hale RJ, Wilcox FL, Hunter RD, Buckley CH, Tindall VR. Carcinoma of the cervix: an analysis of prognostic factors, treatment and patterns of failure following Wertheims hysterectomy. International journal of gynecological cancer : official journal of the International Gynecological Cancer Society 1992;2:323-7. 73. Nilsson G, Nilsson K. Effects of interleukin (IL)-13 on immediate-early response gene expression, phenotype and differentiation of human mast cells. Comparison with IL-4. Eur J Immunol 1995;25:870-3.

215

References

74. Walsh LJ, Trinchieri G, Waldorf HA, Whitaker D, Murphy GF. Human dermal mast cells contain and release tumor necrosis factor alpha, which induces endothelial leukocyte adhesion molecule 1. Proceedings of the National Academy of Sciences of the United States of America 1991;88:4220-4. 75. Cocchiara R, Albeggiani G, Di Trapani G, et al. Oestradiol enhances in vitro the histamine release induced by embryonic histamine-releasing factor (EHRF) from uterine mast cells. Hum Reprod 1992;7:1036-41. 76. Szukiewicz D, Szukiewicz A, Maslinska D, Gujski M, Poppe P, Mazurek-Kantor J. Mast cell number, histamine concentration and placental vascular response to histamine in preeclampsia. Inflammation research : official journal of the European Histamine Research Society [et al] 1999;48 Suppl 1:S39-40. 77. Szukiewicz D, Szukiewicz A, Maslinska D, Poppe P, Gujski M, Olszewski M. Mast cells and histamine in intrauterine growth retardation--relation to the development of placental microvessels. Inflammation research : official journal of the European Histamine Research Society [et al] 1999;48 Suppl 1:S41-2. 78. Juremalm M, Nilsson G. Chemokine receptor expression by mast cells. Chemical immunology and allergy 2005;87:130-44. 79. Cruz MA, Gonzalez C, Acevedo CG, Sepulveda WH, Rudolph MI. Effects of histamine and serotonin on the contractility of isolated pregnant and nonpregnant human myometrium. Gynecol Obstet Invest 1989;28:1-4. 80. Rudolph MI, Reinicke K, Cruz MA, Gallardo V, Gonzalez C, Bardisa L. Distribution of mast cells and the effect of their mediators on contractility in human myometrium. Br J Obstet Gynaecol 1993;100:1125-30. 81. Cassatella MA. The production of cytokines by polymorphonuclear neutrophils. Immunology today 1995;16:21-6. 82. Osmers R, Rath W, Adelmann-Grill BC, et al. Origin of cervical collagenase during parturition. Am J Obstet Gynecol 1992;166:1455-60. 83. Kruse A, Martens N, Fernekorn U, Hallmann R, Butcher EC. Alterations in the expression of homing-associated molecules at the maternal/fetal interface during the course of pregnancy. Biol Reprod 2002;66:333-45. 84. Gomez-Lopez N, Olson, D. M., Cubeiro-Arreola, K., Vadillo-Ortega, F. T cell recruitment and contribution to an inflammatory microenvironment in the choriodecidua during human labor. In: Reprod Sci 17, 69A; 2010. 85. Rajabi MR, Dean DD, Beydoun SN, Woessner JF, Jr. Elevated tissue levels of collagenase during dilation of uterine cervix in human parturition. Am J Obstet Gynecol 1988;159:971-6. 86. Helmig BR, Romero R, Espinoza J, et al. Neutrophil elastase and secretory leukocyte protease inhibitor in prelabor rupture of membranes, parturition and intra-amniotic infection. J Matern Fetal Neonatal Med 2002;12:237-46. 87. Challis JR, Lockwood CJ, Myatt L, Norman JE, Strauss JF, 3rd, Petraglia F. Inflammation and pregnancy. Reprod Sci 2009;16:206-15. 88. Yellon SM, Burns AE, See JL, Lechuga TJ, Kirby MA. Progesterone withdrawal promotes remodeling processes in the nonpregnant mouse cervix. Biol Reprod 2009;81:1-6. 89. Nenadic DB, Pavlovic MD. Cervical fluid cytokines in pregnant women: Relation to vaginal wet mount findings and polymorphonuclear leukocyte counts. Eur J Obstet Gynecol Reprod Biol 2008;140:165-70.

216

References

90. Marvin KW, Keelan JA, Eykholt RL, Sato TA, Mitchell MD. Use of cDNA arrays to generate differential expression profiles for inflammatory genes in human gestational membranes delivered at term and preterm. Mol Hum Reprod 2002;8:399-408. 91. Trundley A, Moffett A. Human uterine leukocytes and pregnancy. Tissue antigens 2004;63:1-12. 92. Blidaru I, Zugun F, Cianga C, Carasevici E. [Maternal immunophenotypic profile in normal pregnancy and preterm birth]. Revista medico-chirurgicala a Societatii de Medici si Naturalisti din Iasi 2002;107:343-7. 93. Nhan-Chang CL, Romero R, Kusanovic JP, et al. A role for CXCL13 (BCA-1) in pregnancy and intra-amniotic infection/inflammation. J Matern Fetal Neonatal Med 2008;21:763-75. 94. Bowen JM, Chamley L, Keelan JA, Mitchell MD. Cytokines of the placenta and extra- placental membranes: roles and regulation during human pregnancy and parturition. Placenta 2002;23:257-73. 95. Steinborn A, Niederhut A, Solbach C, Hildenbrand R, Sohn C, Kaufmann M. Cytokine release from placental endothelial cells, a process associated with preterm labour in the absence of intrauterine infection. Cytokine 1999;11:66-73. 96. Oleszczuk J, Wawrzycka B, Maj JG. Interleukin-6 and neopterin levels in serum of patients with preterm labour with and without infection. Eur J Obstet Gynecol Reprod Biol 1997;74:27-30. 97. El-Shazly S, Makhseed M, Azizieh F, Raghupathy R. Increased expression of pro- inflammatory cytokines in placentas of women undergoing spontaneous preterm delivery or premature rupture of membranes. Am J Reprod Immunol 2004;52:45-52. 98. Hillier SL, Witkin SS, Krohn MA, Watts DH, Kiviat NB, Eschenbach DA. The relationship of amniotic fluid cytokines and preterm delivery, amniotic fluid infection, histologic chorioamnionitis, and chorioamnion infection. Obstet Gynecol 1993;81:941-8. 99. Mazor M, Chaim W, Horowitz S, Romero R, Glezerman M. The biomolecular mechanisms of preterm labor in women with intrauterine infection. Israel journal of medical sciences 1994;30:317-22. 100. Gery I, Gershon RK, Waksman BH. Potentiation of the T-lymphocyte response to mitogens. I. The responding cell. J Exp Med 1972;136:128-42. 101. van der Poll T, Keogh CV, Guirao X, Buurman WA, Kopf M, Lowry SF. Interleukin-6 gene- deficient mice show impaired defense against pneumococcal pneumonia. The Journal of infectious diseases 1997;176:439-44. 102. Febbraio MA, Pedersen BK. Contraction-induced myokine production and release: is skeletal muscle an endocrine organ? Exercise and sport sciences reviews 2005;33:114-9. 103. Tattersall M, Engineer N, Khanjani S, et al. Pro-labour myometrial gene expression: are preterm labour and term labour the same? Reproduction 2008;135:569-79. 104. Young A, Thomson AJ, Ledingham M, Jordan F, Greer IA, Norman JE. Immunolocalization of proinflammatory cytokines in myometrium, cervix, and fetal membranes during human parturition at term. Biol Reprod 2002;66:445-9. 105. Fortunato SJ, Menon RP, Swan KF, Menon R. Inflammatory cytokine (interleukins 1, 6 and 8 and tumor necrosis factor-alpha) release from cultured human fetal membranes in response to endotoxic lipopolysaccharide mirrors amniotic fluid concentrations. Am J Obstet Gynecol 1996;174:1855-61; discussion 61-2. 106. Gomez R, Ghezzi F, Romero R, Munoz H, Tolosa JE, Rojas I. Premature labor and intra- amniotic infection. Clinical aspects and role of the cytokines in diagnosis and pathophysiology. Clinics in perinatology 1995;22:281-342.

217

References

107. Menon R, Fortunato SJ. Fetal membrane inflammatory cytokines: a switching mechanism between the preterm premature rupture of the membranes and preterm labor pathways. J Perinat Med 2004;32:391-9. 108. Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 2001;104:487-501. 109. Pennica D, Nedwin GE, Hayflick JS, et al. Human tumour necrosis factor: precursor structure, expression and homology to lymphotoxin. Nature 1984;312:724-9. 110. Ismair MG, Ries C, Lottspeich F, Zang C, Kolb HJ, Petrides PE. Autocrine regulation of matrix metalloproteinase-9 gene expression and secretion by tumor necrosis factor-alpha (TNF- alpha) in NB4 leukemic cells: specific involvement of TNF receptor type 1. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, UK 1998;12:1136-43. 111. Bradley JR, Pober JS. Tumor necrosis factor receptor-associated factors (TRAFs). Oncogene 2001;20:6482-91. 112. Beg AA, Baltimore D. An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. Science 1996;274:782-4. 113. Nelson DM. Apoptotic changes occur in syncytiotrophoblast of human placental villi where fibrin type fibrinoid is deposited at discontinuities in the villous trophoblast. Placenta 1996;17:387-91. 114. Levy R, Nelson DM. To be, or not to be, that is the question. Apoptosis in human trophoblast. Placenta 2000;21:1-13. 115. Seki H, Zosmer A, Elder MG, Sullivan MH. The regulation of progesterone and hCG production from placental cells by interleukin-1beta. Biochimica et biophysica acta 1997;1336:342-8. 116. Li Y, Matsuzaki N, Masuhiro K, et al. Trophoblast-derived tumor necrosis factor-alpha induces release of human chorionic gonadotropin using interleukin-6 (IL-6) and IL-6-receptor- dependent system in the normal human trophoblasts. The Journal of clinical endocrinology and metabolism 1992;74:184-91. 117. Masuhiro K, Matsuzaki N, Nishino E, et al. Trophoblast-derived interleukin-1 (IL-1) stimulates the release of human chorionic gonadotropin by activating IL-6 and IL-6-receptor system in first trimester human trophoblasts. The Journal of clinical endocrinology and metabolism 1991;72:594-601. 118. Petraglia F, Garuti GC, De Ramundo B, Angioni S, Genazzani AR, Bilezikjian LM. Mechanism of action of interleukin-1 beta in increasing corticotropin-releasing factor and adrenocorticotropin hormone release from cultured human placental cells. Am J Obstet Gynecol 1990;163:1307-12. 119. Makrigiannakis A, Margioris AN, Zoumakis E, Stournaras C, Gravanis A. The transcription of corticotropin-releasing hormone in human endometrial cells is regulated by cytokines. Neuroendocrinology 1999;70:451-9. 120. Gunn L, Hardiman P, Tharmaratnam S, Lowe D, Chard T. Measurement of interleukin-1 alpha and interleukin-6 in pregnancy-associated tissues. Reproduction, fertility, and development 1996;8:1069-73. 121. Romero R, Mazor M, Sepulveda W, Avila C, Copeland D, Williams J. Tumor necrosis factor in preterm and term labor. Am J Obstet Gynecol 1992;166:1576-87. 122. Steinborn A, Kuhnert M, Halberstadt E. Immunmodulating cytokines induce term and preterm parturition. J Perinat Med 1996;24:381-90. 123. Denison FC, Kelly RW, Calder AA, Riley SC. Cytokine secretion by human fetal membranes, decidua and placenta at term. Hum Reprod 1998;13:3560-5.

218

References

124. Bry K, Lappalainen U. Interleukin-4 and transforming growth factor-beta 1 modulate the production of interleukin-1 receptor antagonist and of prostaglandin E2 by decidual cells. Am J Obstet Gynecol 1994;170:1194-8. 125. Sato TA, Keelan JA, Mitchell MD. Critical paracrine interactions between TNF-alpha and IL-10 regulate lipopolysaccharide-stimulated human choriodecidual cytokine and prostaglandin E2 production. J Immunol 2003;170:158-66. 126. Jones CA, Finlay-Jones JJ, Hart PH. Type-1 and type-2 cytokines in human late-gestation decidual tissue. Biol Reprod 1997;57:303-11. 127. Terrone DA, Rinehart BK, Granger JP, Barrilleaux PS, Martin JN, Jr., Bennett WA. Interleukin-10 administration and bacterial endotoxin-induced preterm birth in a rat model. Obstet Gynecol 2001;98:476-80. 128. Hanna N, Hanna I, Hleb M, et al. Gestational age-dependent expression of IL-10 and its receptor in human placental tissues and isolated cytotrophoblasts. J Immunol 2000;164:5721-8. 129. Simpson KL, Keelan JA, Mitchell MD. Labor-associated changes in interleukin-10 production and its regulation by immunomodulators in human choriodecidua. The Journal of clinical endocrinology and metabolism 1998;83:4332-7. 130. Fortunato SJ, Menon R, Lombardi SJ. Interleukin-10 and transforming growth factor- beta inhibit amniochorion tumor necrosis factor-alpha production by contrasting mechanisms of action: therapeutic implications in prematurity. Am J Obstet Gynecol 1997;177:803-9. 131. Bry K, Hallman M. Transforming growth factor-beta opposes the stimulatory effects of interleukin-1 and tumor necrosis factor on amnion cell prostaglandin E2 production: implication for preterm labor. Am J Obstet Gynecol 1992;167:222-6. 132. Adamson S, Edwin SS, LaMarche S, Mitchell MD. Actions of interleukin-4 on prostaglandin biosynthesis at the chorion-decidual interface. Am J Obstet Gynecol 1993;169:1442-7. 133. Simpson KL, Keelan JA, Mitchell MD. Labour-associated changes in the regulation of production of immunomodulators in human amnion by glucocorticoids, bacterial lipopolysaccharide and pro-inflammatory cytokines. Journal of reproduction and fertility 1999;116:321-7. 134. Hansen WR, Keelan JA, Skinner SJ, Mitchell MD. Key enzymes of prostaglandin biosynthesis and metabolism. Coordinate regulation of expression by cytokines in gestational tissues: a review. Prostaglandins & other lipid mediators 1999;57:243-57. 135. Kunkel EJ, Butcher EC. Plasma-cell homing. Nat Rev Immunol 2003;3:822-9. 136. Fernandez EJ, Lolis E. Structure, function, and inhibition of chemokines. Annual review of pharmacology and toxicology 2002;42:469-99. 137. Bacon K, Baggiolini M, Broxmeyer H, et al. Chemokine/chemokine receptor nomenclature. J Interferon Cytokine Res 2002;22:1067-8. 138. Moser B, Loetscher P. Lymphocyte traffic control by chemokines. Nat Immunol 2001;2:123-8. 139. Ebert LM, Schaerli P, Moser B. Chemokine-mediated control of T cell traffic in lymphoid and peripheral tissues. Mol Immunol 2005;42:799-809. 140. Rossi D, Zlotnik A. The biology of chemokines and their receptors. Annu Rev Immunol 2000;18:217-42. 141. Olson TS, Ley K. Chemokines and chemokine receptors in leukocyte trafficking. Am J Physiol Regul Integr Comp Physiol 2002;283:R7-28.

219

References

142. Bonecchi R, Polentarutti N, Luini W, et al. Up-regulation of CCR1 and CCR3 and induction of chemotaxis to CC chemokines by IFN-gamma in human neutrophils. J Immunol 1999;162:474-9. 143. Su SB, Mukaida N, Wang J, Nomura H, Matsushima K. Preparation of specific polyclonal antibodies to a C-C chemokine receptor, CCR1, and determination of CCR1 expression on various types of leukocytes. J Leukoc Biol 1996;60:658-66. 144. Zhang S, Youn BS, Gao JL, Murphy PM, Kwon BS. Differential effects of leukotactin-1 and macrophage inflammatory protein-1 alpha on neutrophils mediated by CCR1. J Immunol 1999;162:4938-42. 145. Baggiolini M. Chemotactic and inflammatory cytokines--CXC and CC proteins. Adv Exp Med Biol 1993;351:1-11. 146. Baggiolini M, Dewald B, Moser B. Human chemokines: an update. Annu Rev Immunol 1997;15:675-705. 147. Hamm HE. The many faces of G protein signaling. J Biol Chem 1998;273:669-72. 148. Maghazachi AA, Al-Aoukaty A. Chemokines activate natural killer cells through heterotrimeric G-proteins: implications for the treatment of AIDS and cancer. FASEB J 1998;12:913-24. 149. Greenlee KJ, Corry DB, Engler DA, et al. Proteomic identification of in vivo substrates for matrix metalloproteinases 2 and 9 reveals a mechanism for resolution of inflammation. J Immunol 2006;177:7312-21. 150. Nagasawa T, Hirota S, Tachibana K, et al. Defects of B-cell lymphopoiesis and bone- marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 1996;382:635-8. 151. Zou YR, Kottmann AH, Kuroda M, Taniuchi I, Littman DR. Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 1998;393:595-9. 152. Sallusto F, Baggiolini M. Chemokines and leukocyte traffic. Nat Immunol 2008;9:949-52. 153. Forster R, Schubel A, Breitfeld D, et al. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 1999;99:23- 33. 154. Gunn MD, Kyuwa S, Tam C, et al. Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J Exp Med 1999;189:451-60. 155. Luther SA, Cyster JG. Chemokines as regulators of T cell differentiation. Nat Immunol 2001;2:102-7. 156. Bleul CC, Schultze JL, Springer TA. B lymphocyte chemotaxis regulated in association with microanatomic localization, differentiation state, and B cell receptor engagement. J Exp Med 1998;187:753-62. 157. Bowman EP, Campbell JJ, Soler D, et al. Developmental switches in chemokine response profiles during B cell differentiation and maturation. J Exp Med 2000;191:1303-18. 158. Mackay CR. Chemokines: immunology's high impact factors. Nat Immunol 2001;2:95- 101. 159. Rot A, Krieger M, Brunner T, Bischoff SC, Schall TJ, Dahinden CA. RANTES and macrophage inflammatory protein 1 alpha induce the migration and activation of normal human eosinophil granulocytes. J Exp Med 1992;176:1489-95. 160. Dieu MC, Vanbervliet B, Vicari A, et al. Selective recruitment of immature and mature dendritic cells by distinct chemokines expressed in different anatomic sites. J Exp Med 1998;188:373-86.

220

References

161. Sallusto F, Schaerli P, Loetscher P, et al. Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur J Immunol 1998;28:2760-9. 162. Sozzani S, Allavena P, D'Amico G, et al. Differential regulation of chemokine receptors during dendritic cell maturation: a model for their trafficking properties. J Immunol 1998;161:1083-6. 163. Allavena P, Sica A, Vecchi A, Locati M, Sozzani S, Mantovani A. The chemokine receptor switch paradigm and dendritic cell migration: its significance in tumor tissues. Immunological reviews 2000;177:141-9. 164. Gu L, Tseng S, Horner RM, Tam C, Loda M, Rollins BJ. Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1. Nature 2000;404:407-11. 165. Diamond AK, Sweet LM, Oppenheimer KH, Bradley DF, Phillippe M. Modulation of monocyte chemotactic protein-1 expression during lipopolysaccharide-induced preterm delivery in the pregnant mouse. Reprod Sci 2007;14:548-59. 166. Shynlova O, Tsui P, Dorogin A, Lye SJ. Monocyte chemoattractant protein-1 (CCL-2) integrates mechanical and endocrine signals that mediate term and preterm labor. J Immunol 2008;181:1470-9. 167. Bollapragada S, Youssef R, Jordan F, Greer I, Norman J, Nelson S. Term labor is associated with a core inflammatory response in human fetal membranes, myometrium, and cervix. Am J Obstet Gynecol 2009;200:104 e1-11. 168. Esplin MS, Romero R, Chaiworapongsa T, et al. Amniotic fluid levels of immunoreactive monocyte chemotactic protein-1 increase during term parturition. J Matern Fetal Neonatal Med 2003;14:51-6. 169. Esplin MS, Romero R, Chaiworapongsa T, et al. Monocyte chemotactic protein-1 is increased in the amniotic fluid of women who deliver preterm in the presence or absence of intra-amniotic infection. J Matern Fetal Neonatal Med 2005;17:365-73. 170. Laham N, Rice GE, Bishop GJ, Ransome C, Brennecke SP. Interleukin 8 concentrations in amniotic fluid and peripheral venous plasma during human pregnancy and parturition. Acta endocrinologica 1993;129:220-4. 171. Athayde N, Romero R, Maymon E, et al. A role for the novel cytokine RANTES in pregnancy and parturition. Am J Obstet Gynecol 1999;181:989-94. 172. Keelan JA, Marvin KW, Sato TA, Coleman M, McCowan LM, Mitchell MD. Cytokine abundance in placental tissues: evidence of inflammatory activation in gestational membranes with term and preterm parturition. Am J Obstet Gynecol 1999;181:1530-6. 173. Veleminsky M, Jr., Stransky P, Veleminsky M, Sr., Tosner J. Relationship of IL-6, IL-8, TNF and sICAM-1 levels to PROM, pPROM, and the risk of early-onset neonatal sepsis. Neuro endocrinology letters 2008;29:303-11. 174. Witczak M, Torbe A, Czajka R. [Maternal serum and amniotic fluid IL-1 alpha, IL-1 beta, IL-6 and IL-8 levels in preterm and term labor complicated by PROM]. Ginekologia polska 2003;74:1343-7. 175. Larsen CG, Anderson AO, Appella E, Oppenheim JJ, Matsushima K. The neutrophil- activating protein (NAP-1) is also chemotactic for T lymphocytes. Science 1989;243:1464-6. 176. Hebisch G, Grauaug AA, Neumaier-Wagner PM, Stallmach T, Huch A, Huch R. The relationship between cervical dilatation, interleukin-6 and interleukin-8 during term labor. Acta obstetricia et gynecologica Scandinavica 2001;80:840-8. 177. Winkler M, Fischer DC, Ruck P, et al. Parturition at term: parallel increases in interleukin-8 and proteinase concentrations and neutrophil count in the lower uterine segment. Hum Reprod 1999;14:1096-100.

221

References

178. Syssoev KA, Kulagina NV, Chukhlovin AB, Morozova EB, Totolian AA. Expression of mRNA for chemokines and chemokine receptors in tissues of the myometrium and uterine leiomyoma. Bull Exp Biol Med 2008;145:84-9. 179. Mulayim N, Palter SF, Kayisli UA, Senturk L, Arici A. Chemokine receptor expression in human endometrium. Biol Reprod 2003;68:1491-5. 180. Furuya M, Suyama T, Usui H, et al. Up-regulation of CXC chemokines and their receptors: implications for proinflammatory microenvironments of ovarian carcinomas and endometriosis. Hum Pathol 2007;38:1676-87. 181. Vicari AP, Vanbervliet B, Massacrier C, et al. In vivo manipulation of dendritic cell migration and activation to elicit antitumour immunity. Novartis Found Symp 2004;256:241-54; discussion 54-69. 182. Hamill N, Romero R, Gotsch F, et al. Exodus-1 (CCL20): evidence for the participation of this chemokine in spontaneous labor at term, preterm labor, and intrauterine infection. J Perinat Med 2008;36:217-27. 183. Wessels JM, Linton NF, van den Heuvel MJ, et al. Expression of chemokine decoy receptors and their ligands at the porcine maternal-fetal interface. Immunology and cell biology 2011;89:304-13. 184. Martinez de la Torre Y, Buracchi C, Borroni EM, et al. Protection against inflammation- and autoantibody-caused fetal loss by the chemokine decoy receptor D6. Proceedings of the National Academy of Sciences of the United States of America 2007;104:2319-24. 185. Mantovani A, Locati M, Vecchi A, Sozzani S, Allavena P. Decoy receptors: a strategy to regulate inflammatory cytokines and chemokines. Trends in immunology 2001;22:328-36. 186. Chandrasekar B, Smith JB, Freeman GL. Ischemia-reperfusion of rat myocardium activates nuclear factor-KappaB and induces neutrophil infiltration via lipopolysaccharide- induced CXC chemokine. Circulation 2001;103:2296-302. 187. Chandrasekar B, Melby PC, Sarau HM, et al. Chemokine-cytokine cross-talk. The ELR+ CXC chemokine LIX (CXCL5) amplifies a proinflammatory cytokine response via a phosphatidylinositol 3-kinase-NF-kappa B pathway. J Biol Chem 2003;278:4675-86. 188. Carter SL, Muller M, Manders PM, Campbell IL. Induction of the genes for Cxcl9 and Cxcl10 is dependent on IFN-gamma but shows differential cellular expression in experimental autoimmune encephalomyelitis and by astrocytes and microglia in vitro. Glia 2007;55:1728-39. 189. Oh JW, Schwiebert LM, Benveniste EN. Cytokine regulation of CC and CXC chemokine expression by human astrocytes. Journal of neurovirology 1999;5:82-94. 190. Liggins GC, Fairclough RJ, Grieves SA, Kendall JZ, Knox BS. The mechanism of initiation of parturition in the ewe. Recent progress in hormone research 1973;29:111-59. 191. Karalis K, Goodwin G, Majzoub JA. Cortisol blockade of progesterone: a possible molecular mechanism involved in the initiation of human labor. Nature medicine 1996;2:556- 60. 192. Kayisli UA, Mahutte NG, Arici A. Uterine chemokines in reproductive physiology and pathology. American journal of reproductive immunology 2002;47:213-21. 193. Coulomb-L'Hermin A, Amara A, Schiff C, et al. Stromal cell-derived factor 1 (SDF-1) and antenatal human B cell lymphopoiesis: expression of SDF-1 by mesothelial cells and biliary ductal plate epithelial cells. Proceedings of the National Academy of Sciences of the United States of America 1999;96:8585-90. 194. Hannan NJ, Jones RL, Critchley HO, et al. Coexpression of fractalkine and its receptor in normal human endometrium and in endometrium from users of progestin-only contraception

222

References

supports a role for fractalkine in leukocyte recruitment and endometrial remodeling. The Journal of clinical endocrinology and metabolism 2004;89:6119-29. 195. Vassiliadou N, Tucker L, Anderson DJ. Progesterone-induced inhibition of chemokine receptor expression on peripheral blood mononuclear cells correlates with reduced HIV-1 infectability in vitro. J Immunol 1999;162:7510-8. 196. Belot MP, Abdennebi-Najar L, Gaudin F, et al. Progesterone reduces the migration of mast cells toward the chemokine stromal cell-derived factor-1/CXCL12 with an accompanying decrease in CXCR4 receptors. American journal of physiology Endocrinology and metabolism 2007;292:E1410-7. 197. Cook JL, Zaragoza DB, Sung DH, Olson DM. Expression of myometrial activation and stimulation genes in a mouse model of preterm labor: myometrial activation, stimulation, and preterm labor. Endocrinology 2000;141:1718-28. 198. Lockwood CJ, Kuczynski E. Markers of risk for preterm delivery. J Perinat Med 1999;27:5-20. 199. Ou CW, Orsino A, Lye SJ. Expression of connexin-43 and connexin-26 in the rat myometrium during pregnancy and labor is differentially regulated by mechanical and hormonal signals. Endocrinology 1997;138:5398-407. 200. Papiernik E, Zeitlin J, Delmas D, et al. Differences in outcome between twins and singletons born very preterm: results from a population-based European cohort. Hum Reprod;25:1035-43. 201. Mohan AR, Sooranna SR, Lindstrom TM, Johnson MR, Bennett PR. The effect of mechanical stretch on cyclooxygenase type 2 expression and activator protein-1 and nuclear factor-kappaB activity in human amnion cells. Endocrinology 2007;148:1850-7. 202. Sooranna SR, Engineer N, Liang Z, Bennett PR, Johnson MR. Stretch and interleukin 1 beta: pro-labour factors with similar mitogen-activated protein kinase effects but differential patterns of transcription factor activation and gene expression. Journal of cellular physiology 2007;212:195-206. 203. Lin L, DeMartino GN, Greene WC. Cotranslational biogenesis of NF-kappaB p50 by the 26S proteasome. Cell 1998;92:819-28. 204. Hayden MS, Ghosh S. Signaling to NF-kappaB. Genes & development 2004;18:2195-224. 205. Heissmeyer V, Krappmann D, Wulczyn FG, Scheidereit C. NF-kappaB p105 is a target of IkappaB kinases and controls signal induction of Bcl-3-p50 complexes. The EMBO journal 1999;18:4766-78. 206. Heissmeyer V, Krappmann D, Hatada EN, Scheidereit C. Shared pathways of IkappaB kinase-induced SCF(betaTrCP)-mediated ubiquitination and degradation for the NF-kappaB precursor p105 and IkappaBalpha. Molecular and cellular biology 2001;21:1024-35. 207. Lindstrom TM, Bennett PR. The role of nuclear factor kappa B in human labour. Reproduction 2005;130:569-81. 208. Albensi BC, Mattson MP. Evidence for the involvement of TNF and NF-kappaB in hippocampal synaptic plasticity. Synapse 2000;35:151-9. 209. Thompson WL, Van Eldik LJ. Inflammatory cytokines stimulate the chemokines CCL2/MCP-1 and CCL7/MCP-3 through NFkB and MAPK dependent pathways in rat astrocytes [corrected]. Brain Res 2009;1287:47-57. 210. Viemann D, Goebeler M, Schmid S, et al. Transcriptional profiling of IKK2/NF-kappa B- and p38 MAP kinase-dependent gene expression in TNF-alpha-stimulated primary human endothelial cells. Blood 2004;103:3365-73.

223

References

211. Neurath MF, Becker C, Barbulescu K. Role of NF-kappaB in immune and inflammatory responses in the gut. Gut 1998;43:856-60. 212. Cho ML, Kang JW, Moon YM, et al. STAT3 and NF-kappaB signal pathway is required for IL-23-mediated IL-17 production in spontaneous arthritis animal model IL-1 receptor antagonist- deficient mice. J Immunol 2006;176:5652-61. 213. Zhang Z, Andoh A, Yasui H, et al. Interleukin-1beta and tumor necrosis factor-alpha upregulate interleukin-23 subunit p19 gene expression in human colonic subepithelial myofibroblasts. Int J Mol Med 2005;15:79-83. 214. Elliott CL, Allport VC, Loudon JA, Wu GD, Bennett PR. Nuclear factor-kappa B is essential for up-regulation of interleukin-8 expression in human amnion and cervical epithelial cells. Mol Hum Reprod 2001;7:787-90. 215. Lappas M, Rice GE. The role and regulation of the nuclear factor kappa B signalling pathway in human labour. Placenta 2007;28:543-56. 216. Belt AR, Baldassare JJ, Molnar M, Romero R, Hertelendy F. The nuclear transcription factor NF-kappaB mediates interleukin-1beta-induced expression of cyclooxygenase-2 in human myometrial cells. Am J Obstet Gynecol 1999;181:359-66. 217. Kniss DA, Rovin B, Fertel RH, Zimmerman PD. Blockade NF-kappaB activation prohibits TNF-alpha-induced cyclooxygenase-2 gene expression in ED27 trophoblast-like cells. Placenta 2001;22:80-9. 218. Reznikov LL, Shames BD, Barton HA, et al. Interleukin-1beta deficiency results in reduced NF-kappaB levels in pregnant mice. Am J Physiol Regul Integr Comp Physiol 2000;278:R263-70. 219. Terzidou V, Sooranna SR, Kim LU, Thornton S, Bennett PR, Johnson MR. Mechanical stretch up-regulates the human oxytocin receptor in primary human uterine myocytes. The Journal of clinical endocrinology and metabolism 2005;90:237-46. 220. Olson DM. The role of prostaglandins in the initiation of parturition. Best practice & research Clinical obstetrics & gynaecology 2003;17:717-30. 221. Yan X, Wu Xiao C, Sun M, Tsang BK, Gibb W. Nuclear factor kappa B activation and regulation of cyclooxygenase type-2 expression in human amnion mesenchymal cells by interleukin-1beta. Biol Reprod 2002;66:1667-71. 222. King AE, Critchley HO, Kelly RW. The NF-kappaB pathway in human endometrium and first trimester decidua. Mol Hum Reprod 2001;7:175-83. 223. Condon JC, Jeyasuria P, Faust JM, Mendelson CR. Surfactant protein secreted by the maturing mouse fetal lung acts as a hormone that signals the initiation of parturition. Proceedings of the National Academy of Sciences of the United States of America 2004;101:4978-83. 224. Stjernholm-Vladic Y, Stygar D, Mansson C, et al. Factors involved in the inflammatory events of cervical ripening in humans. Reproductive biology and endocrinology : RB&E 2004;2:74. 225. Condon JC HDMCE. Temporal and spatial activation of NF-kB in human fundal myometrium and in mouse uterus near term causes upregulated expression of the inhibitory progesterone receptor (PR)-C isoform and a withdrawal of PR function leading to labor. Program & Abstracts The Endo- crine Society’s 87th Annual Meeting OR13–14, p 90 2005 226. Allport VC, Pieber D, Slater DM, Newton R, White JO, Bennett PR. Human labour is associated with nuclear factor-kappaB activity which mediates cyclo-oxygenase-2 expression and is involved with the 'functional progesterone withdrawal'. Mol Hum Reprod 2001;7:581-6.

224

References

227. Pearson G, Robinson F, Beers Gibson T, et al. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocrine reviews 2001;22:153-83. 228. Qi M, Elion EA. Formin-induced actin cables are required for polarized recruitment of the Ste5 scaffold and high level activation of MAPK Fus3. Journal of cell science 2005;118:2837- 48. 229. Douglas AJ, Clarke EW, Goldspink DF. Influence of mechanical stretch on growth and protein turnover of rat uterus. Am J Physiol 1988;254:E543-8. 230. Macphee DJ, Lye SJ. Focal adhesion signaling in the rat myometrium is abruptly terminated with the onset of labor. Endocrinology 2000;141:274-83. 231. Loch-Caruso RK, Criswell KA, Grindatti CM, Brant KA. Sustained inhibition of rat myometrial gap junctions and contractions by lindane. Reproductive biology and endocrinology : RB&E 2003;1:62. 232. Oldenhof AD, Shynlova OP, Liu M, Langille BL, Lye SJ. Mitogen-activated protein kinases mediate stretch-induced c-fos mRNA expression in myometrial smooth muscle cells. American journal of physiology Cell physiology 2002;283:C1530-9. 233. Otun HA, MacDougall MW, Bailey J, Europe-Finner GN, Robson SC. Spatial and temporal expression of the myometrial mitogen-activated protein kinases p38 and ERK1/2 in the human uterus during pregnancy and labor. Journal of the Society for Gynecologic Investigation 2005;12:185-90. 234. Zhong M, Yang M, Sanborn BM. Extracellular signal-regulated kinase 1/2 activation by myometrial oxytocin receptor involves Galpha(q)Gbetagamma and epidermal growth factor receptor tyrosine kinase activation. Endocrinology 2003;144:2947-56. 235. Sehringer B, Zahradnik HP, Simon M, Ziegler R, Noethling C, Schaefer WR. mRNA expression profiles for corticotrophin-releasing hormone, urocortin, CRH-binding protein and CRH receptors in human term gestational tissues determined by real-time quantitative RT-PCR. Journal of molecular endocrinology 2004;32:339-48. 236. Ohmichi M, Koike K, Kimura A, et al. Role of mitogen-activated protein kinase pathway in prostaglandin F2alpha-induced rat puerperal uterine contraction. Endocrinology 1997;138:3103-11. 237. Kimura A, Ohmichi M, Takeda T, et al. Mitogen-activated protein kinase cascade is involved in endothelin-1-induced rat puerperal uterine contraction. Endocrinology 1999;140:722-31. 238. Robin P, Boulven I, Bole-Feysot C, Tanfin Z, Leiber D. Contribution of PKC-dependent and -independent processes in temporal ERK regulation by ET-1, PDGF, and EGF in rat myometrial cells. American journal of physiology Cell physiology 2004;286:C798-806. 239. Ruzycky AL. Down-regulation of the mitogen-activated protein kinase cascade immediately before parturition in the rat myometrium. Journal of the Society for Gynecologic Investigation 1998;5:304-10. 240. Li Y, Je HD, Malek S, Morgan KG. Role of ERK1/2 in uterine contractility and preterm labor in rats. Am J Physiol Regul Integr Comp Physiol 2004;287:R328-35. 241. Liu Y, Dong W, Chen L, et al. BCL10 mediates lipopolysaccharide/toll-like receptor-4 signaling through interaction with Pellino2. J Biol Chem 2004;279:37436-44. 242. Molnar M, Rigo J, Jr., Romero R, Hertelendy F. Oxytocin activates mitogen-activated protein kinase and up-regulates cyclooxygenase-2 and prostaglandin production in human myometrial cells. Am J Obstet Gynecol 1999;181:42-9. 243. Eude I, Dallot E, Ferre F, Breuiller-Fouche M. Protein kinase Calpha is required for endothelin-1-induced proliferation of human myometrial cells. Biol Reprod 2002;66:44-9.

225

References

244. Arntzen KJ, Kjollesdal AM, Halgunset J, Vatten L, Austgulen R. TNF, IL-1, IL-6, IL-8 and soluble TNF receptors in relation to chorioamnionitis and premature labor. J Perinat Med 1998;26:17-26. 245. Rehman KS, Yin S, Mayhew BA, Word RA, Rainey WE. Human myometrial adaptation to pregnancy: cDNA microarray gene expression profiling of myometrium from non-pregnant and pregnant women. Mol Hum Reprod 2003;9:681-700. 246. Strakova Z, Copland JA, Lolait SJ, Soloff MS. ERK2 mediates oxytocin-stimulated PGE2 synthesis. Am J Physiol 1998;274:E634-41. 247. Dodge KL, Sanborn BM. Evidence for inhibition by protein kinase A of receptor/G alpha(q)/phospholipase C (PLC) coupling by a mechanism not involving PLCbeta2. Endocrinology 1998;139:2265-71. 248. Phaneuf S, Carrasco MP, Europe-Finner GN, Hamilton CH, Lopez Bernal A. Multiple G proteins and phospholipase C isoforms in human myometrial cells: implication for oxytocin action. The Journal of clinical endocrinology and metabolism 1996;81:2098-103. 249. Sanborn BM, Qian A, Ku CY, et al. Mechanisms regulating oxytocin receptor coupling to phospholipase C in rat and human myometrium. Adv Exp Med Biol 1995;395:469-79. 250. Wen Y, Anwer K, Singh SP, Sanborn BM. Protein kinase-A inhibits phospholipase-C activity and alters protein phosphorylation in rat myometrial plasma membranes. Endocrinology 1992;131:1377-82. 251. Sourla A, Reyes-Moreno C, Koutsilieris M. Characterization of KW smooth muscle-like human myometrial cells. Anticancer research 1994;14:1887-92. 252. Monga M, Ku CY, Dodge K, Sanborn BM. Oxytocin-stimulated responses in a pregnant human immortalized myometrial cell line. Biol Reprod 1996;55:427-32. 253. Greider CW. Telomere length regulation. Annual review of biochemistry 1996;65:337- 65. 254. Vaziri H, Benchimol S. Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Current biology : CB 1998;8:279- 82. 255. Soloff MS, Jeng YJ, Ilies M, et al. Immortalization and characterization of human myometrial cells from term-pregnant patients using a telomerase expression vector. Mol Hum Reprod 2004;10:685-95. 256. Elovitz M, Wang Z. Medroxyprogesterone acetate, but not progesterone, protects against inflammation-induced parturition and intrauterine fetal demise. Am J Obstet Gynecol 2004;190:693-701. 257. Hirsch E, Muhle R. Intrauterine bacterial inoculation induces labor in the mouse by mechanisms other than progesterone withdrawal. Biol Reprod 2002;67:1337-41. 258. Elovitz MA, Wang Z, Chien EK, Rychlik DF, Phillippe M. A new model for inflammation- induced preterm birth: the role of platelet-activating factor and Toll-like receptor-4. Am J Pathol 2003;163:2103-11. 259. Wang H, Hirsch E. Bacterially-induced preterm labor and regulation of prostaglandin- metabolizing enzyme expression in mice: the role of toll-like receptor 4. Biol Reprod 2003;69:1957-63. 260. Jiang Z, Georgel P, Du X, et al. CD14 is required for MyD88-independent LPS signaling. Nat Immunol 2005;6:565-70. 261. Huber M, Kalis C, Keck S, et al. R-form LPS, the master key to the activation ofTLR4/MD- 2-positive cells. Eur J Immunol 2006;36:701-11.

226

References

262. Buhimschi IA, Buhimschi CS, Weiner CP. Protective effect of N-acetylcysteine against fetal death and preterm labor induced by maternal inflammation. Am J Obstet Gynecol 2003;188:203-8. 263. Pirianov G, Waddington SN, Lindstrom TM, Terzidou V, Mehmet H, Bennett PR. The cyclopentenone 15-deoxy-delta 12,14-prostaglandin J(2) delays lipopolysaccharide-induced preterm delivery and reduces mortality in the newborn mouse. Endocrinology 2009;150:699- 706. 264. Salminen A, Paananen R, Vuolteenaho R, et al. Maternal endotoxin-induced preterm birth in mice: fetal responses in toll-like receptors, collectins, and cytokines. Pediatr Res 2008;63:280-6. 265. Fidel PL, Jr., Romero R, Cutright J, et al. Treatment with the interleukin-I receptor antagonist and soluble tumor necrosis factor receptor Fc fusion protein does not prevent endotoxin-induced preterm parturition in mice. Journal of the Society for Gynecologic Investigation 1997;4:22-6. 266. Maus UA, Wellmann S, Hampl C, et al. CCR2-positive monocytes recruited to inflamed lungs downregulate local CCL2 chemokine levels. American journal of physiology Lung cellular and molecular physiology 2005;288:L350-8. 267. Kuziel WA, Morgan SJ, Dawson TC, et al. Severe reduction in leukocyte adhesion and monocyte extravasation in mice deficient in CC chemokine receptor 2. Proceedings of the National Academy of Sciences of the United States of America 1997;94:12053-8. 268. Greaves DR, Wang W, Dairaghi DJ, et al. CCR6, a CC chemokine receptor that interacts with macrophage inflammatory protein 3alpha and is highly expressed in human dendritic cells. J Exp Med 1997;186:837-44. 269. Yang D, Howard OM, Chen Q, Oppenheim JJ. Cutting edge: immature dendritic cells generated from monocytes in the presence of TGF-beta 1 express functional C-C chemokine receptor 6. J Immunol 1999;163:1737-41. 270. Lukacs NW, Prosser DM, Wiekowski M, Lira SA, Cook DN. Requirement for the chemokine receptor CCR6 in allergic pulmonary inflammation. J Exp Med 2001;194:551-5. 271. Liao F, Rabin RL, Smith CS, Sharma G, Nutman TB, Farber JM. CC-chemokine receptor 6 is expressed on diverse memory subsets of T cells and determines responsiveness to macrophage inflammatory protein 3 alpha. J Immunol 1999;162:186-94. 272. Krzysiek R, Lefevre EA, Bernard J, et al. Regulation of CCR6 chemokine receptor expression and responsiveness to macrophage inflammatory protein-3alpha/CCL20 in human B cells. Blood 2000;96:2338-45. 273. Yang D, Chertov O, Bykovskaia SN, et al. Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 1999;286:525-8. 274. Wen H, Hogaboam CM, Lukacs NW, Cook DN, Lira SA, Kunkel SL. The chemokine receptor CCR6 is an important component of the innate immune response. Eur J Immunol 2007;37:2487-98. 275. Elovitz MA, Mrinalini C, Sammel MD. Elucidating the early signal transduction pathways leading to fetal brain injury in preterm birth. Pediatr Res 2006;59:50-5. 276. Hunt JS, Petroff MG, Burnett TG. Uterine leukocytes: key players in pregnancy. Semin Cell Dev Biol 2000;11:127-37. 277. Mittal P, Romero R, Kusanovic JP, et al. CXCL6 (granulocyte chemotactic protein-2): a novel chemokine involved in the innate immune response of the amniotic cavity. Am J Reprod Immunol 2008;60:246-57.

227

References

278. Khanjani S, Kandola MK, Lindstrom TM, et al. NF-kappaB regulates a cassette of immune/inflammatory genes in human pregnant myometrium at term. Journal of cellular and molecular medicine 2011;15:809-24. 279. Shynlova O, Dorogin A, Lye S. Monocyte chemoattractant protein-1 integrates mechanical and endocrine signals that mediate term and preterm labour. Reproductive Sciences 2007;14:209A. 280. Sooranna SR, Engineer N, Loudon JA, Terzidou V, Bennett PR, Johnson MR. The mitogen- activated protein kinase dependent expression of prostaglandin H synthase-2 and interleukin-8 messenger ribonucleic acid by myometrial cells: the differential effect of stretch and interleukin- 1{beta}. J Clin Endocrinol Metab 2005;90:3517-27. 281. Bonecchi R, Bianchi G, Bordignon PP, et al. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J Exp Med 1998;187:129-34. 282. Bisits AM, Smith R, Mesiano S, et al. Inflammatory aetiology of human myometrial activation tested using directed graphs. PLoS Comput Biol 2005;1:132-6. 283. Condon JC, Hardy DB, Kovaric K, Mendelson CR. Up-regulation of the progesterone receptor (PR)-C isoform in laboring myometrium by activation of nuclear factor-kappaB may contribute to the onset of labor through inhibition of PR function. Mol Endocrinol 2006;20:764- 75. 284. Loudon JA, Sooranna SR, Bennett PR, Johnson MR. Mechanical stretch of human uterine smooth muscle cells increases IL-8 mRNA expression and peptide synthesis. Mol Hum Reprod 2004;10:895-9. 285. Sooranna SR, Lee Y, Kim LU, Mohan AR, Bennett PR, Johnson MR. Mechanical stretch activates type 2 cyclooxygenase via activator protein-1 transcription factor in human myometrial cells. Mol Hum Reprod 2004;10:109-13. 286. Clodi M, Vila G, Geyeregger R, et al. Oxytocin alleviates the neuroendocrine and cytokine response to bacterial endotoxin in healthy men. Am J Physiol Endocrinol Metab 2008;295:E686-91. 287. Mehats C, Schmitz T, Oger S, Herve R, Cabrol D, Leroy MJ. PDE4 as a target in preterm labour. BMC Pregnancy Childbirth 2007;7 Suppl 1:S12. 288. Nath CA, Ananth CV, Smulian JC, Peltier MR. Can sulfasalazine prevent infection- mediated pre-term birth in a murine model? Am J Reprod Immunol 2010;63:144-9. 289. Senturk LM, Sozen I, Gutierrez L, Arici A. Interleukin 8 production and interleukin 8 receptor expression in human myometrium and leiomyoma. Am J Obstet Gynecol 2001;184:559-66. 290. Hatthachote P, Gillespie JI. Complex interactions between sex steroids and cytokines in the human pregnant myometrium: evidence for an autocrine signaling system at term. Endocrinology 1999;140:2533-40. 291. Comerford I, Nibbs RJ. Post-translational control of chemokines: a role for decoy receptors? Immunology letters 2005;96:163-74. 292. Garcia-Vicuna R, Gomez-Gaviro MV, Dominguez-Luis MJ, et al. CC and CXC chemokine receptors mediate migration, proliferation, and matrix metalloproteinase production by fibroblast-like synoviocytes from rheumatoid arthritis patients. Arthritis and rheumatism 2004;50:3866-77. 293. Arici A, Seli E, Zeyneloglu HB, Senturk LM, Oral E, Olive DL. Interleukin-8 induces proliferation of endometrial stromal cells: a potential autocrine growth factor. The Journal of clinical endocrinology and metabolism 1998;83:1201-5.

228

References

294. Maybin JA, Critchley HO, Jabbour HN. Inflammatory pathways in endometrial disorders. Molecular and cellular endocrinology 2011;335:42-51. 295. Tikhonov I, Doroshenko T, Chaly Y, Smolnikova V, Pauza CD, Voitenok N. Down- regulation of CXCR1 and CXCR2 expression on human neutrophils upon activation of whole blood by S. aureus is mediated by TNF-alpha. Clin Exp Immunol 2001;125:414-22. 296. Carr MW, Roth SJ, Luther E, Rose SS, Springer TA. Monocyte chemoattractant protein 1 acts as a T-lymphocyte chemoattractant. Proceedings of the National Academy of Sciences of the United States of America 1994;91:3652-6. 297. Xu LL, Warren MK, Rose WL, Gong W, Wang JM. Human recombinant monocyte chemotactic protein and other C-C chemokines bind and induce directional migration of dendritic cells in vitro. J Leukoc Biol 1996;60:365-71. 298. Elovitz MA, Brown AG, Breen K, Anton L, Maubert M, Burd I. Intrauterine inflammation, insufficient to induce parturition, still evokes fetal and neonatal brain injury. International journal of developmental neuroscience : the official journal of the International Society for Developmental Neuroscience 2011;29:663-71. 299. Asiaei M, Solati J, Salari AA. Prenatal exposure to LPS leads to long-lasting physiological consequences in male offspring. Developmental psychobiology 2011;53:828-38. 300. Enayati M, Solati J, Hosseini MH, Shahi HR, Saki G, Salari AA. Maternal infection during late pregnancy increases anxiety- and depression-like behaviors with increasing age in male offspring. Brain research bulletin 2012;87:295-302. 301. Padykula HA, Tansey TR. The occurrence of uterine stromal and intraepithelial monocytes and heterophils during normal late pregnancy in the rat. The Anatomical record 1979;193:329-56. 302. Hamilton A, Holscher C. The effect of ageing on neurogenesis and oxidative stress in the APP(swe)/PS1(deltaE9) mouse model of Alzheimer's disease. Brain research 2012. 303. Harvey L, Boksa P. A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy. Neuropharmacology 2012;62:1767-76. 304. Ashdown H, Dumont Y, Ng M, Poole S, Boksa P, Luheshi GN. The role of cytokines in mediating effects of prenatal infection on the fetus: implications for schizophrenia. Molecular psychiatry 2006;11:47-55. 305. Ahmed A, Singh J, Khan Y, Seshan SV, Girardi G. A new mouse model to explore therapies for preeclampsia. PloS one 2010;5:e13663. 306. Horuk R. Development and evaluation of pharmacological agents targeting chemokine receptors. Methods 2003;29:369-75. 307. Jacobsson B, Holst RM, Wennerholm UB, Andersson B, Lilja H, Hagberg H. Monocyte chemotactic protein-1 in cervical and amniotic fluid: relationship to microbial invasion of the amniotic cavity, intra-amniotic inflammation, and preterm delivery. Am J Obstet Gynecol 2003;189:1161-7. 308. Shynlova O, Tsui P, Jaffer S, Lye SJ. Integration of endocrine and mechanical signals in the regulation of myometrial functions during pregnancy and labour. Eur J Obstet Gynecol Reprod Biol 2009;144 Suppl 1:S2-10. 309. Peters W, Dupuis M, Charo IF. A mechanism for the impaired IFN-gamma production in C-C chemokine receptor 2 (CCR2) knockout mice: role of CCR2 in linking the innate and adaptive immune responses. J Immunol 2000;165:7072-7. 310. Menzies FM, Khan AH, Higgins CA, Nelson SM, Nibbs RJ. The Chemokine Receptor CCR2 Is Not Required for Successful Initiation of Labor in Mice. Biol Reprod 2012.

229

References

311. Hakkim A, Fuchs TA, Martinez NE, et al. Activation of the Raf-MEK-ERK pathway is required for neutrophil extracellular trap formation. Nature chemical biology 2011;7:75-7. 312. Capodici C, Pillinger MH, Han G, Philips MR, Weissmann G. Integrin-dependent homotypic adhesion of neutrophils. Arachidonic acid activates Raf-1/Mek/Erk via a 5- lipoxygenase- dependent pathway. J Clin Invest 1998;102:165-75. 313. Engel DR, Maurer J, Tittel AP, et al. CCR2 mediates homeostatic and inflammatory release of Gr1(high) monocytes from the bone marrow, but is dispensable for bladder infiltration in bacterial urinary tract infection. J Immunol 2008;181:5579-86. 314. Gaupp S, Pitt D, Kuziel WA, Cannella B, Raine CS. Experimental autoimmune encephalomyelitis (EAE) in CCR2(-/-) mice: susceptibility in multiple strains. Am J Pathol 2003;162:139-50. 315. Wareing MD, Lyon A, Inglis C, Giannoni F, Charo I, Sarawar SR. Chemokine regulation of the inflammatory response to a low-dose influenza infection in CCR2-/- mice. J Leukoc Biol 2007;81:793-801. 316. Maus U, von Grote K, Kuziel WA, et al. The role of CC chemokine receptor 2 in alveolar monocyte and neutrophil immigration in intact mice. American journal of respiratory and critical care medicine 2002;166:268-73. 317. Maus UA, Waelsch K, Kuziel WA, et al. Monocytes are potent facilitators of alveolar neutrophil emigration during lung inflammation: role of the CCL2-CCR2 axis. J Immunol 2003;170:3273-8. 318. Sakai S, Kawamata H, Mantani N, et al. Therapeutic effect of anti-macrophage inflammatory protein 2 antibody on influenza virus-induced pneumonia in mice. Journal of virology 2000;74:2472-6. 319. Goser S, Andrassy M, Buss SJ, et al. Cardiac troponin I but not cardiac troponin T induces severe autoimmune inflammation in the myocardium. Circulation 2006;114:1693-702. 320. Dawson TC, Beck MA, Kuziel WA, Henderson F, Maeda N. Contrasting effects of CCR5 and CCR2 deficiency in the pulmonary inflammatory response to influenza A virus. Am J Pathol 2000;156:1951-9. 321. Wang X, Hagberg H, Zhu C, Jacobsson B, Mallard C. Effects of intrauterine inflammation on the developing mouse brain. Brain Res 2007;1144:180-5. 322. Mantovani A. The chemokine system: redundancy for robust outputs. Immunology today 1999;20:254-7. 323. Liverman CS, Kaftan HA, Cui L, et al. Altered expression of pro-inflammatory and developmental genes in the fetal brain in a mouse model of maternal infection. Neuroscience letters 2006;399:220-5. 324. Lee SC, Liu W, Dickson DW, Brosnan CF, Berman JW. Cytokine production by human fetal microglia and astrocytes. Differential induction by lipopolysaccharide and IL-1 beta. J Immunol 1993;150:2659-67. 325. Urakubo A, Jarskog LF, Lieberman JA, Gilmore JH. Prenatal exposure to maternal infection alters cytokine expression in the placenta, amniotic fluid, and fetal brain. Schizophrenia research 2001;47:27-36. 326. Briscoe T, Duncan J, Cock M, et al. Activation of NF-kappaB transcription factor in the preterm ovine brain and placenta after acute LPS exposure. Journal of neuroscience research 2006;83:567-74. 327. Cai Z, Pan ZL, Pang Y, Evans OB, Rhodes PG. Cytokine induction in fetal rat brains and brain injury in neonatal rats after maternal lipopolysaccharide administration. Pediatr Res 2000;47:64-72.

230

References

328. Gayle DA, Beloosesky R, Desai M, Amidi F, Nunez SE, Ross MG. Maternal LPS induces cytokines in the amniotic fluid and corticotropin releasing hormone in the fetal rat brain. Am J Physiol Regul Integr Comp Physiol 2004;286:R1024-9. 329. Schlafer DH, Yuh B, Foley GL, Elssaser TH, Sadowsky D, Nathanielsz PW. Effect of Salmonella endotoxin administered to the pregnant sheep at 133-142 days gestation on fetal oxygenation, maternal and fetal adrenocorticotropic hormone and cortisol, and maternal plasma tumor necrosis factor alpha concentrations. Biol Reprod 1994;50:1297-302. 330. Fortier ME, Joober R, Luheshi GN, Boksa P. Maternal exposure to bacterial endotoxin during pregnancy enhances amphetamine-induced locomotion and startle responses in adult rat offspring. Journal of psychiatric research 2004;38:335-45. 331. Schutyser E, Struyf S, Van Damme J. The CC chemokine CCL20 and its receptor CCR6. Cytokine & growth factor reviews 2003;14:409-26. 332. Bell D, Chomarat P, Broyles D, et al. In breast carcinoma tissue, immature dendritic cells reside within the tumor, whereas mature dendritic cells are located in peritumoral areas. J Exp Med 1999;190:1417-26. 333. Banchereau J, Briere F, Caux C, et al. Immunobiology of dendritic cells. Annu Rev Immunol 2000;18:767-811. 334. Homey B, Dieu-Nosjean MC, Wiesenborn A, et al. Up-regulation of macrophage inflammatory protein-3 alpha/CCL20 and CC chemokine receptor 6 in psoriasis. J Immunol 2000;164:6621-32. 335. Nelson RT, Boyd J, Gladue RP, et al. Genomic organization of the CC chemokine mip- 3alpha/CCL20/larc/exodus/SCYA20, showing gene structure, splice variants, and chromosome localization. Genomics 2001;73:28-37. 336. Harant H, Eldershaw SA, Lindley IJ. Human macrophage inflammatory protein- 3alpha/CCL20/LARC/Exodus/SCYA20 is transcriptionally upregulated by tumor necrosis factor- alpha via a non-standard NF-kappaB site. FEBS letters 2001;509:439-45. 337. Sugita S, Kohno T, Yamamoto K, et al. Induction of macrophage-inflammatory protein- 3alpha gene expression by TNF-dependent NF-kappaB activation. J Immunol 2002;168:5621-8. 338. Nakayama T, Fujisawa R, Yamada H, et al. Inducible expression of a CC chemokine liver- and activation-regulated chemokine (LARC)/macrophage inflammatory protein (MIP)-3 alpha/CCL20 by epidermal keratinocytes and its role in atopic dermatitis. International immunology 2001;13:95-103. 339. Giannini SL, Hubert P, Doyen J, Boniver J, Delvenne P. Influence of the mucosal epithelium microenvironment on Langerhans cells: implications for the development of squamous intraepithelial lesions of the cervix. International journal of cancer Journal international du cancer 2002;97:654-9. 340. Haddad R, Tromp G, Kuivaniemi H, et al. Human spontaneous labor without histologic chorioamnionitis is characterized by an acute inflammation gene expression signature. Am J Obstet Gynecol 2006;195:394 e1-24. 341. Fujii H, Itoh Y, Yamaguchi K, et al. Chemokine CCL20 enhances the growth of HuH7 cells via phosphorylation of p44/42 MAPK in vitro. Biochem Biophys Res Commun 2004;322:1052-8. 342. Beider K, Abraham M, Begin M, et al. Interaction between CXCR4 and CCL20 pathways regulates tumor growth. PloS one 2009;4:e5125. 343. Yang CC, Ogawa H, Dwinell MB, McCole DF, Eckmann L, Kagnoff MF. Chemokine receptor CCR6 transduces signals that activate p130Cas and alter cAMP-stimulated ion transport in human intestinal epithelial cells. American journal of physiology Cell physiology 2005;288:C321-8.

231

References

344. D'Amico G, Frascaroli G, Bianchi G, et al. Uncoupling of inflammatory chemokine receptors by IL-10: generation of functional decoys. Nat Immunol 2000;1:387-91.

232