Platelet Factor-4 Variant Chemokine CXCL4L1 Inhibits Melanoma and Lung Carcinoma Growth and Metastasis by Preventing Angiogenesis Sofie Struyf,1 Marie D

Research Article

Platelet Factor-4 Variant Chemokine CXCL4L1 Inhibits Melanoma and Lung Carcinoma Growth and Metastasis by Preventing Angiogenesis Sofie Struyf,1 Marie D. Burdick,2 Elke Peeters,1 Karolien Van den Broeck,1 Chris Dillen,1 Paul Proost,1 Jo Van Damme,1 and Robert M. Strieter2

1Laboratory of Molecular Immunology, Rega Institute, Leuven, Belgium and 2Department of Medicine, University of Virginia, Charlottesville, Virginia

Abstract CXCL8 (3). Subsequently, two functional receptors were identified The platelet factor-4 variant, designated PF-4var/CXCL4L1, is for IL-8/CXCL8 [i.e., CXC chemokine receptor 1 and 2 (CXCR1 and a recently described natural non-allelic gene variant of the CXCR2)]. Furthermore, IL-8/CXCL8 and other neutrophil-attracting CXC chemokine platelet factor-4/CXCL4. PF-4var/CXCL4L1 CXC chemokines binding to CXCR2 were shown to possess was cloned, and the purified recombinant protein strongly angiogenic activity (4–6). In contrast to IL-8/CXCL8, the CXCR3 g inhibited angiogenesis. Recombinant PF-4var/CXCL4L1 was ligands, monokine induced by IFN- (Mig)/CXCL9, IFN-inducible a angiostatically more active (at nanomolar concentration) than protein 10 (IP-10)/CXCL10, and IFN-inducible T-cell chemo- PF-4/CXCL4 in various test systems, including wound-healing attractant (I-TAC)/CXCL11 are angiostatic and predominantly and migration assays for microvascular endothelial cells and attract T lymphocytes and natural killer (NK) cells (7–10). The the rat cornea micropocket assay for angiogenesis. Further- fact that the existence of a functional GPCR for PF-4/CXCL4 has been difficult to elucidate allows us to speculate that its pleiotropic more, PF-4var/CXCL4L1 more efficiently inhibited tumor growth in animal models of melanoma and lung carcinoma biological activities, suchas promotion of neutrophiland monocyte than PF-4/CXCL4 at an equimolar concentration. For B16 cell adhesion to endothelium and inhibition of angiogenesis, are melanoma in nude mice, a significant reduction in tumor size mediated through different cellular mechanisms, including glycos- and the number of small i.t. blood vessels was obtained with aminoglycan in addition to GPCR binding (11–15). Indeed, PF-4/ i.t. applied PF-4var/CXCL4L1. For A549 adenocarcinoma in CXCL4 has significant antitumoral activity by inhibition of GPCR- severe combined immunodeficient mice, i.t. PF-4var/CXCL4L1 mediated endothelial cell chemotaxis, whereas its procoagulant reduced tumor growth and microvasculature more efficiently activity is mediated by heparin binding (16–19). Its role in than PF-4/CXCL4 and prevented metastasis to various organs thrombosis and in megakaryopoiesis was confirmed by generation better than the angiostatic IFN-inducible protein 10/CXCL10. of PF-4/CXCL4 knockout mice (20). However, for several biological Finally, in the syngeneic model of Lewis lung carcinoma, effects ascribed to PF-4/CXCL4 (e.g., in atherosclerosis and PF-4var/CXCL4L1 inhibited tumor growth equally well as hematopoiesis; refs. 21, 22), the precise underlying molecular monokine induced by IFN-; (Mig)/CXCL9, also known to mechanisms are complex and remain partially elusive. In a previous study, we isolated and identified the PF-4 variant attract effector T lymphocytes. Taken together, PF-4var/ CXCL4L1 is a highly potent antitumoral chemokine preventing CXCL4L1 from thrombin-stimulated platelets (23). It was shown development and metastasis of various tumors by inhibition that natural PF-4var/CXCL4L1 is a more potent inhibitor of of angiogenesis. These data confirm the clinical potential of endothelial cell chemotaxis and angiogenesis than the well- characterized PF-4/CXCL4, whereas other biological characteristics locally released chemokines in cancer therapy. [Cancer Res in vitro 2007;67(12):5940–8] of PF-4var/CXCL4L1 remain unknown. Here, we confirm activities withrecombinant PF-4var/CXCL4L1 at nanomolar concentrations and show that this angiostatic chemokine is a Introduction stronger inhibitor of tumor growth and metastasis than PF-4/ Platelet factor-4 (PF-4) has been biochemically characterized as CXCL4 using different tumor models. PF4var/CXCL4L1 was more a platelet product with high affinity for heparin long before the potent than IP-10/CXCL10 in preventing tumor metastasis in term chemokine was introduced to designate small inducible immunocompromised animals, whereas it had equal antitumoral chemotactic cytokines binding to G protein–coupled receptors activity as Mig/CXCL9 in immunocompetent mice. Finally, we (GPCR) and attracting various leukocyte subsets to inflammatory provide evidence that antitumoral effects of PF-4var/CXCL4L1 sites (1, 2). The position of the conserved cysteines has been used observed at low chemokine dose are predominantly mediated by to classify PF4/CXCL4 among the CXC chemokines along with the inhibition of angiogenesis. later discovered granulocyte chemoattractant interleukin-8 (IL-8)/ Materials and Methods Reagents and tumor cell lines. Natural human PF-4/CXCL4 and human Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). PF-4var/CXCL4L1 were purified to homogeneity as described (23). S. Struyf is a senior researchassistant of theFWO-Vlaanderen. Recombinant human basic fibroblast growth factor (bFGF), human IL-8/ Requests for reprints: Jo Van Damme, Laboratory of Molecular Immunology, Rega CXCL8, murine IP-10/CXCL10, and murine Mig/CXCL9 were purchased Institute, K.U. Leuven, Minderbroedersstraat 10, B-3000 Leuven, Belgium. Phone: from R&D Systems. 3216337348; Fax: 3216337340; E-mail: [email protected]. I2007 American Association for Cancer Research. B16 melanoma was orthotopically propagated in C57Bl/6 mice and doi:10.1158/0008-5472.CAN-06-4682 cultured in Eagle’s minimal essential medium withEarle’s salts buffered

Cancer Res 2007; 67: (12). June 15, 2007 5940 www.aacrjournals.org

withNaHCO 3 and supplemented with10% fetal bovine serum (FBS) and received an inhibition score and ranged from À3 (very broad) to 0. All L-glutamine. The A549 adenocarcinoma and weakly immunogenic Lewis samples were tested in triplicate in each24-well plate and were scored lung carcinoma (LLC) cell lines were obtained from the American Type double blind by three investigators. Digital pictures from representative Culture Collection and cultured as described (24, 25). wells were taken witha Canon G3 camera mounted on a Carl Zeiss Cloning and purification of recombinant PF-4var/CXCL4L1. The Axiovert 40 CFL microscope withan A-plan Â10/0.25 objective (Carl coding region of human PF-4var/CXCL4L1 cDNA was cloned from a human Zeiss). platelet cDNA preparation in two consecutive steps. First, a rather long The Boyden chamber assay for endothelial cells has been described PF-4var/CXCL4L1 cDNA fragment was amplified by primers specifically previously (28). For this assay, human lung microvascular endothelial cells binding PF-4var/CXCL4L1 and not PF-4/CXCL4 (5¶-TATAGAATTCCAG- (HMVEC-L; Cambrex Bio Science) were cultured following the manufac- GGAGTCACTGCCTGCAGAACC-3¶ as forward primer and 5¶-TATACTC- turer’s instructions. GAGGATTGAAAGTGCACACTTAGGCAGC -3¶ as backward primer; Cornea assay. Analysis of the in vivo angiostatic activity of recombinant respective EcoRI and XhoI sites are in italic). The amplicon (445 bp) was PF-4var/CXCL4L1 was done in hooded Long-Evans rat eyes as described cloned into the pBluescript II vector (Stratagene). The reconstructed previously (5, 23). phagemid was verified by both restriction analysis and DNA sequencing. Tumor models. Animal experiments were approved by the local This construct was used as a template to amplify the coding region of the animal ethics committees [University of Leuven and University of mature PF-4var/CXCL4L1 protein (5¶-TATACCATGGCCGAAGCTGAAGAA- California, Los Angeles (UCLA)] and conducted in conformity withthe AGATGGGGACCTG-3¶ as forward primer and 5¶-TATACTCGAGGCTAG- Belgian, European and U.S. guidelines for the protection of animals used GTAGCTAACTCTCCAAATGTTCC-3¶ as backward primer; respective NcoI for scientific purposes. B16 experiments were done with6- to 8-week-old and XhoI sites are in italic). The PCR reaction product was gel-purified, female athymic nu/nu mice (NMRI background) kept in a specific restriction-digested with NcoI and XhoI, and ligated into the corresponding pathogen-free environment (Elevage Janvier). B16 melanoma cells in log sites of the pHEN1 expression vector (26), which contained a LacZ phase (2 Â 106 cells resuspended in 200 AL of PBS) were injected s.c. on promoter and a PelB leader sequence to direct the expression product to day 0 in the right dorsal flank. Animals were injected at the tumor site the bacterial periplasm. Verification of the sequence of pHEN1 PF-4var/ with50 AL of test sample [i.e., endotoxin-free saline (0.9% NaCl, Baxter), CXCL4L1 was done on bothstrands. Theligation mixture was transformed 5 Ag of natural human PF-4/CXCL4, or 1 Ag of recombinant human PF- into Escherichia coli XL1-Blue cells (Stratagene). For recombinant protein 4var/CXCL4L1 in saline]. All animals were observed thrice a week, and production, the transformed cells were grown in SOC medium containing the tumor dimensions were measured with calipers. For immunohisto- ampicillin (100 Ag/mL) and supplemented with0.1% glucose at 37 jC with chemical analysis of tumor vasculature, tumors were harvested and snap A shaking to the mid-logarithmic phase ( 585, 0.55). At this cell density, frozen in liquid N2, and sections were analyzed for the presence of blood isopropyl-L-thio-B-D-galactopyranoside (final concentration, 0.5 mmol/L) vessels reacting withrat anti-mouse CD31 antibody (PharMingen/BD was added for induction of PF-4var/CXCL4L1 expression, and incubation Biosciences) using the anti-rat immunoglobulin horseradish peroxidase was continued for another 4 h followed by harvesting of the cells and detection kit from PharMingen and were microscopically evaluated on a preparation of the periplasmic fraction, as described (26). The harvested Carl Zeiss Axiovert-200M. Digital pictures from representative slides were periplasm was stabilized by addition of a bacterial protease inhibitor taken witha MRc5 camera (Carl Zeiss) and a Plan Apochromat Â20/0.8 cocktail and kept frozen at À20jC until purification. objective. Pure recombinant PF-4var/CXCL4L1 was obtained from the periplasmic CB-17 severe combined immunodeficient (SCID) mice (6–8 weeks old; fraction by a purification procedure previously described (23, 27). In a first UCLA Animal Core Facility, Los Angeles, CA) and C57Bl/6 mice (Jackson step, crude periplasmic recombinant PF-4var/CXCL4L1 was purified by Labs) were injected s.c. into the right flank with 106 A549 cells or 106 LLC heparin-Sepharose affinity chromatography and analyzed by SDS-PAGE and cells in 100 AL, respectively. Mice were treated withi.t. injections of 20 AL silver staining. Subsequently, fractions enriched in PF-4/CXCL4 immunore- of chemokine solution (or PBS supplemented with 1 mg/mL human serum activity were purified to homogeneity by reversed-phase high-performance albumin as vehicle control) thrice a week. Once palpable tumors were liquid chromatography (RP-HPLC). After adjustment of the pH [from pH 7.4 visible, tumors were measured in two dimensions withcalipers on a to pH 2.0 with1% trifluoroacetic acid (TFA) in H 2O], pooled heparin- weekly basis. At 4 weeks (LLC) or 8 weeks (A549) after tumor cell Sepharose fractions containing PF-4var/CXCL4L1 were injected on a RP- injection, animals were euthanized by pentobarbital overdose, and the

HPLC column equilibrated with0.1% TFA in H 2O (Source 5 RPC column, tumors were resected, removed of extraneous tissue, and measured. A Amersham Biosciences/GE Healthcare Bio-Sciences Corp.) and eluted in an portion of the resected tumors was fixed in 4% formaldehyde for acetonitrile (0–80%) gradient (1-mL fractions). Proteins eluting from the RP- histologic analysis. Another portion of the tumors was used for flow HPLC column were analyzed by mass spectrometry on an electrospray ion cytometry (29). Briefly, two 6-mm tumor punches (determination of trap mass spectrometer (Esquire, Bruker) and analyzed for endotoxin angiogenesis) or whole organs (determination of leukocyte influx or contamination by the Limulus amebocyte lysate test (Cambrex Bio Science). metastasis) were minced and digested in 5 mL of 1 mg/mL type IV Endothelial cell migration. Inhibition of endothelial cell migration collagenase (Roche Applied Sciences) for 45 min at 37jC withconstant in vitro was assayed in two different experimental settings. For the in vitro agitation in a water bath. Single-cell suspensions were obtained by wound-healing assay, human dermal microvascular endothelial cells repeatedly aspirating the cell suspensions through the bore of a 18-mL (HMVEC-d; Cambrex Bio Science) were cultured in 24-well plates in syringe. RBC lysis was done for 3 min at room temperature in lysis buffer

EBM-2 medium withtheEGM-2-MV Bulletkit (Cambrex Bio Science). [0.15 mol/L NH4Cl, 0.1 mmol/L KHCO3,0.1mmol/LNa2EDTA When HMVEC were grown to confluency, the culture medium was (pH 7.2)]. Intermediate washsteps were done using fluorescence-activated replaced with0.5 mL per well EBM-2 medium with40 Ag/mL mitomycin cell sorting (FACS) buffer (1% FBS and 0.1% sodium azide in PBS). Finally,

C, without EGM-2-MV Bulletkit. After 30 min at 37jC and 5% CO2,a cell suspensions were passed over a 70-Am nylon mesh; the total cell plastic pipette tip was used to draw a linear ‘‘wound’’ in the cell count was determined; and cells were resuspended in FACS buffer to monolayer of each well. The monolayers were washed twice with PBS to 1 Â 107 cells per milliliter. Samples (100 AL) were stained at 4jC for the remove the cells that were detached from the monolayer, and chemokines presence of endothelial cells using the panendothelial cell marker MECA- were added in EBM-2 medium withEGM-2-MV Bulletkit (0.5 mL per well). 32 (BD Biosciences) and analyzed by FACS. First, the percentage of After 36 to 48 h, HMVEC cultures were fixed and stained with Hemacolor endothelial cell marker–positive cells was determined. Subsequently, the staining solutions. In every 24-well plate, three control cultures were total number of endothelial cells inside a tumor was obtained by included to which no chemokine was added. The difference of the width multiplication withthedetermined tumor volume. Single-cell suspensions before and after treatment of the individual wounds were scored under a were also prepared to quantify leukocyte influx in tumors. Total leukocyte, microscope and set at zero for control cultures. A wound that was monocyte, and neutrophil counts were determined by FACS analysis using broader compared withcontrol scars (inhibitionof HMVEC migration) anti-CD45 (BD Biosciences), Moma-2 (AbD Serotec), and anti-Gr-1 www.aacrjournals.org 5941 Cancer Res 2007; 67: (12). June 15, 2007

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2007 American Association for Cancer Research. Cancer Research antibodies (BD Biosciences), respectively. For detection of metastasis immunoreactivity determined by ELISA. Recombinant PF-4var/ of human A549 cells, phycoerythrin-conjugated anti-human CD49b (BD CXCL4L1 was confirmed to have the correct molecular mass + Biosciences) was used. From the percentage of CD49b cells, the total upon SDS-PAGE and mass spectrometry analysis. Furthermore, the number of human cells per organ was calculated. For determination of the NH -terminal sequence was verified by Edman degradation on an number of metastatic cells in the circulation, the results are expressed per 2 automated protein sequencer (data not shown). The biological milliliter of blood. Statistical analysis. All data were analyzed using the Statview 4.5 activity of recombinant PF-4var/CXCL4L1 was evidenced in the in vitro statistical software package (Abacus Concepts, Inc.) or Statistica (StatSoft, wound-healing assay on mitomycin C–treated human Inc.). All animal group comparisons were evaluated by the ANOVA test with microvascular endothelial cells (Fig. 1A and B). Figure 1B shows Bonferroni/Dunn post hoc analysis, unless otherwise indicated in the figure that recombinant PF-4var/CXCL4L1 significantly inhibited endo- legend. Data are expressed as mean F SEM. thelial cell migration at 10 ng/mL, whereas natural PF-4/CXCL4 only did so at 200 and 1,000 ng/mL. Furthermore, in the endothelial cell migration assay using the Boyden chamber, recombinant Results PF-4var/CXCL4L1 very efficiently inhibited the chemotactic activity Functional characterization of recombinant PF-4var/ of bothIL-8/CXCL8 and bFGF from 5 ng/mL onwards, whereas CXCL4L1 in vitro and in vivo. PF-4var/CXCL4L1 expressed in natural PF-4/CXCL4 only marginally affected endothelial cell E. coli was purified to homogeneity by heparin-Sepharose affinity chemotaxis at 50 ng/mL (Fig. 1C). This stronger in vitro potency chromatography and subsequent RP-HPLC (data shown in of recombinant PF-4var/CXCL4L1 to inhibit endothelial cell Supplementary Data). Pure recombinant 8-kDa CXCL4L1 protein migration was finally confirmed in the rat cornea micropocket eluted from bothtypes of columns at a similar position as natural assay for angiogenesis (n = 6 for eachtreatment). In this in vivo PF-4var/CXCL4L1 and corresponded to the major peak of PF-4 test, angiogenic IL-8/CXCL8 (80 ng per pellet) or bFGF (50 ng per

Figure 1. In vitro characterization of recombinant PF-4var/CXCL4L1. Recombinant PF-4var/CXCL4L1 was tested in the in vitro wound-healing assayfor inhibition of endothelial cell migration (A and B). Confluent monolayers of HMVEC-d were scarred, and repair was monitored microscopically after 42-h treatment with recombinant CXCL4L1 (2 or 10 ng/mL) or CXCL4 (200 or 1,000 ng/mL). Zero scores correspond to the change in wound width for untreated control cultures (Co). A wound that retained a broader width compared with control wounds (inhibition of migration) received a negative score. A, representative photographs taken from two different experiments. B, columns, average changes in scores from three to five independent experiments; bars, SEM. *, P < 0.05; **, P < 0.01, statistically significant inhibition (Mann-Whitneytest). In the Boydenchamber assay( C), recombinant (rec) CXCL4L1 (1–50 ng/mL) was compared with natural (nat) CXCL4L1 (1–50 ng/mL) and CXCL4 (1–50 ng/mL) for its capacityto reduce migration of HMVEC-L toward bFGF (50 ng/mL) or CXCL8 (80 ng/mL). To show specific migrati on, background (unstimulated control) migration (45 cells per high-power field) was subtracted. Results are derived from two independent experiments in triplicate. Angiogenic activityof bFGF ( broken lines) and CXCL8 (dotted lines).

Cancer Res 2007; 67: (12). June 15, 2007 5942 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2007 American Association for Cancer Research. Novel Antitumoral PF-4/CXCL4 Chemokine Variant pellet) were 70% to 80% inhibited by both natural and recombinant CXCL4L1, or vehicle control. After 4 weeks, tumors were clearly PF-4var/CXCL4L1 at 50 ng per pellet, whereas natural PF-4/CXCL4 larger in control mice, and in particular, for the PF-4var/CXCL4L1 (50 ng per pellet) had no inhibitory effect on bFGF-induced group, reduced tumor growthwas most pronounced after 8 weeks, angiogenesis (data not shown). Applied as single stimulus, IL-8/ when mice were sacrificed (Fig. 3A). The resected PF-4var/ CXCL8 and bFGF triggered neovascularization in five or six of six CXCL4L1–treated tumors were on average less than half the size corneas, respectively. Taken together, it can be concluded that of the control tumors, whereas the PF-4/CXCL4 treatment did not recombinant PF-4var/CXCL4L1, tested in three different assays, is provide a statistically significant decrease in tumor size (Fig. 3B). an at least 10-fold more potent inhibitor of angiogenesis than PF-4/ Nevertheless, determination of the angiostatic effect of PF-4 CXCL4. Based on these findings, we aimed to verify whether PF- treatment by flow cytometric analysis of single-cell tumoral 4var/CXCL4L1 could also exert a more pronounced antitumoral suspensions revealed significant decreases in MECA-32+ endothe- activity. lial cells and confirmed reduced angiogenesis in boththePF-4/ Comparison of PF-4/CXCL4, PF-4var/CXCL4L1, and angio- CXCL4 (P = 0.045) and PF-4var/CXCL4L1 (P = 0.026) groups versus static CXCR3 ligands for the inhibition of melanoma and lung control mice (Fig. 3C). carcinoma growth and metastasis. To assess the antitumoral We next compared PF-4var/CXCL4L1 withtheangiostatic activity of PF-4var/CXCL4L1, different experimental settings were CXCR3 ligand IP-10/CXCL10 upon i.t. injection (0.1 Ag; thrice per used. To exclude that leukocyte influx is necessary for the possible week) to inhibit growth of human A549 adenocarcinoma in SCID antitumoral effect, nude mice lacking functional T cells and SCID mice. After 8 weeks, tumors in control mice reached volumes beige mice, which lack T and B cells and which also have NK cell (>2,000 mm3), which were significantly (P < 0.05) larger than those dysfunction, were used first, allowing also to evaluate human (F1,000 mm3) in mice treated withPF-4var/CXCL4L1 or IP-10/ tumor cells (A549 adenocarcinoma). In addition, PF-4var/CXCL4L1 CXCL10 (Fig. 4A). The resected tumor volume was also significantly was analyzed in parallel withchemokinesknown to attract effector smaller (P < 0.017) for the PF-4var/CXCL4L1 and IP-10/CXCL10 T lymphocytes in an immunocompetent mouse system with groups versus control mice (Fig. 4B), the effect of PF-4var/ syngeneic tumors (LLC in C56Bl/6 mice). Withregard to the CXCL4L1 being more pronounced. Moreover, flow cytometric injected chemokine dose, two different approaches were applied. In analysis of tumor cell suspensions confirmed the angiostatic the first animal model (B16 melanoma), the antitumoral potency of potential of the two chemokines, as evidenced by the significantly PF-4var/CXCL4L1 was evaluated in direct comparison withPF-4/ (P < 0.01) reduced number of MECA-32+ endothelial cells in tumors CXCL4, for which high doses (50 Ag per injection) have previously treated withPF-4var/CXCL4L1 or IP-10/CXCL10 (Fig. 4 C). This been applied to obtain antitumoral effects (17, 30). Second, in more angiostatic effect was confirmed by the detection of increased prolonged tumor models (lung carcinoma), PF4var/CXCL4L1 was tumor cell necrosis in chemokine-treated animals (data not injected at lower doses in comparison withCXCR3 ligands, to shown). Finally, it was observed that metastasis of A549 which angiostatic activity has been ascribed at much lower doses adenocarcinoma cells to brain, adrenal gland, lung, liver, and (0.1 Ag per injection; refs. 31, 32). blood was significantly (P < 0.017) prevented by i.t. PF4var/CXCL4, In a first experimental setting, three groups of 12 to 14 athymic whereas IP-10/CXCL10 inhibited the number of metastatic cells in nude mice were eachinjected s.c. with2 Â 106 B16 melanoma the brain only (Table 1). Thus, the antitumoral activity of human cells and were then i.t. treated (thrice per week; six or seven PF-4var/CXCL4L1 was found to be more pronounced than that of injections in total) with5 Ag natural PF-4/CXCL4, 1 Ag IP-10/CXCL10 and PF-4/CXCL4 in this SCID/A549 chimeric model recombinant PF-4var/CXCL4L1, or physiologic saline. Tumor of non–small-cell lung cancer. To know whether the antitumoral growth, determined by external measurement (thrice per week) effect of CXCL4L1/PF-4var is solely based on its angiostatic activity, of the tumor size, was found to be reduced in the PF-4/CXCL4 the influx of leukocytes was excluded. Because SCID mice are and PF-4var/CXCL4L1 groups compared withcontrol mice over devoid of T-cell, B-cell, and NK cell activity, monocyte and the whole period of 17 days, when mice were killed (Fig. 2A). neutrophil infiltration was evaluated in this model. FACS analysis Figure 2B shows that the resected tumor volume was also of single-cell suspensions prepared from resected tumors of PF- significantly reduced (P = 0.035) in the PF-4var/CXCL4L1 group 4var/CXCL4L1–treated mice revealed no significant changes in (median, 556 mm3) versus saline-treated mice (median, 940 mm3), CD45+ leukocytes, whereas in IP-10/CXCL10–treated animals, the whereas the effect of PF-4/CXCL4 (median, 803 mm3) was yet not number of total leukocytes per tumor volume was doubled significant at a 5-fold higher dose, indicating a stronger (Fig. 4D). Because no clearly enhanced influx of Moma-2+ antitumoral potency of the variant PF-4 form. It was next verified monocytes and Gr-1+ granulocytes was observed in PF-4var/ whether this antitumoral activity could be mediated by inhibition CXCL4L1–injected tumors, it can be concluded that leukocyte of angiogenesis. This was evidenced by immunohistochemical infiltration (granulocytes, monocytes, T cells, B cells, and NK cells) evaluation of the i.t. microvasculature using anti-CD31 staining is not a major determinant in the antitumoral effect of this (Fig. 2C and D). Indeed, the number of small i.t. blood vessels was angiostatic chemokine. significantly lower in PF-4var/CXCL4L1-treated mice compared In a third syngeneic model (i.e., LLC in C57Bl/6 mice), the withthePF-4/CXCL4 or saline control group ( P = 0.01 and 0.02, antitumoral potential of PF-4var/CXCL4L1 was compared withthat respectively). The fact that we did not observe a significant of the angiostatic chemokine Mig/CXCL9 in immunocompetent antitumoral effect for PF-4/CXCL4 in this tumor model could be mice. Figure 5A shows that both CXC chemokines (at an i.t. dose of due to the lower dose of PF-4/CXCL4 applied compared with 0.1 Ag; thrice per week) gradually inhibited tumor growth over time previous studies (daily injections of 50 Ag) withthisangiostatic compared withcontrol mice. A significant reduction ( P < 0.02) in chemokine (17, 30). tumor size was reached 4 weeks after injection of tumor cells. This Second, in a model of non–small-cell lung cancer, SCID mice antitumoral effect was confirmed on resected tumors (Fig. 5B) were injected s.c. with10 6 A549 adenocarcinoma cells and treated from mice treated withPF-4var/CXCL4L1 ( P = 0.022) or Mig/ i.t. (0.1 Ag; thrice a week), with either PF-4/CXCL4, PF-4var/ CXCL9 (P = 0.018). Tumor growthretardation was again due to www.aacrjournals.org 5943 Cancer Res 2007; 67: (12). June 15, 2007

Figure 2. Inhibition of tumor growth and angiogenesis bytreatment of B16-melanoma with the angiostatic chemokines PF-4/CXCL4 or PF-4var/CXCL4L1. Mice (nu/nu NMRI background, n = 38, compilation of two independent experiments) were injected on day0 with 2 Â 106 B16 melanoma cells and divided into three groups, which received 9 g/L NaCl saline (n = 14), 5 Ag CXCL4 (n = 12), or 1 Ag CXCL4L1 (n = 12) per injection, respectively. Treatment started on day 1 (experiment 2) or day3 (experiment 1), and saline or chemokines were injected i.t. thrice a week. In total, six (experiment 1) or seven (experiment 2) injections were ad ministered. Tumor dimensions were measured on everydayof chemokine injection. Mean values per group were calculated ( A). At these time points, the tumor volume was calculated using the formula: (4pab 2)/3(a and b, largest and smallest radius, respectively). On day 17, tumors were resected, and the dimensions were measured to determine the tumor volume more exactly( B), which was calculated bythe formula: (4 pabc)/3(a, b,orc, measured radii). Points/columns, mean tumor sizes (mm3) per treatment group; bars, SEM. On day17, resected tumors from the CXCL4L1-treated group were significantlysmaller (*, P = 0.035) than those from the vehicle-treated group (Mann-Whitneytest). The microvasculature in B16 tumors in the 20 mice of experiment 1 treated with 0.9% NaCl saline ( n = 8), 5 Ag CXCL4 (n = 6), or 1 Ag CXCL4L1 (n = 6) per injection was evaluated. Per tumor, four biopsies were frozen and evaluated byimmunohistochemistry.Blood vessels were visualized in frozen tissue sections bystaining with anti-CD31 (red reaction product localizes to endothelial cells lining blood vessels) fol lowed bya faint counterstain with Mayer’s hematoxylin. Per tumor biopsy, 6 high-power fields were evaluated in one representative section by counting the number of vessels present, making a distinction between large and small vessels. Per representative section, the mean number of small and large blood vessels was calculated per high-power field. C, box-whisker plot of statistical analysis of the differences in the number of small blood vessels in the three groups of tumor treatment. D, representative photographs taken. Bar, f100 Am. The Kruskal-Wallis test (C) indicated that the three groups are statisticallydifferent ( P = 0.017). The number of small blood vessels in the group treated with CXCL4L1 was significantlylower than in the groups treated with saline or CXCL4 (Mann-Whitneytest, P = 0.01 and P = 0.02, respectively). Treatment with 5 Ag CXCL4 did not significantlyinfluence the number of small blood vessels, when compared with the saline control group. There was no significant difference in the number of large blood vessels per high-power field among the three groups (data not shown, Kruskal-Wallis test). inhibition of angiogenesis (Fig. 5C) as evidenced by the signifi- tumor models using immunocompromised or immunocompetent cantly reduced numbers of MECA-32+ endothelial cells by mice, a clear cut angiostatic effect for PF-4var/CXCL4L1 was treatment withPF-4var/CXCL4L1 ( P = 0.016) or Mig/CXCL9 noticed, resulting in significant inhibition of tumor growth and (P = 0.021). Taken together, these data show that in three different metastasis.

Cancer Res 2007; 67: (12). June 15, 2007 5944 www.aacrjournals.org

Discussion Chemokines can indirectly stimulate or inhibit tumor growth by their angiogenic or angiostatic activity, respectively (33). Alterna- tively, chemokines also affect tumor development by attracting immunocompetent cells withprotumoral or antitumoral activities. Indeed, tumor-infiltrating leukocytes, such as macrophages, might promote tumor growthand progression (34, 35). However, effector T lymphocytes and NK cells are considered to exert antitumor activity. In this context, CXCR3 ligands, attracting T lymphocytes and NK cells, can inhibit tumor growth. Moreover, these chemokines are also antitumoral by inhibiting endothelial cell proliferation and migration through GAG and/or CXCR3 binding (13, 33). In contrast, tumor growthinhibitionby PF-4/CXCL4 is expected to occur predominantly via its angiostatic activity, rather than by attracting effector lymphocytes. In this study, the recently identified PF-4var/CXCL4L1 (23) was compared withauthentic

Figure 4. Treatment of A549 adenocarcinoma with the angiostatic chemokines PF-4var/CXCL4L1 or IP-10/CXCL10. Mice (SCID Beige) were injected s.c. on day0 with A549 adenocarcinoma cells and divided into three groups, which received vehicle control (n = 10), 0.1 Ag human CXCL4L1 (n = 10), or 0.1 Ag murine CXCL10 (n = 10) per injection, respectively. Treatment started at the time of tumor inoculation. Chemokines were injected i.t. thrice a week, and tumor dimensions were measured everyweek ( A). After 8 wks, mice were sacrificed, and exact tumor dimensions were determined (B). The formulas used to calculate tumor volumes are mentioned in Fig. 3 legend. Points/columns, mean tumor size (mm3) per treatment group; bars, SEM. Per group, five tumors were minced into single-cell suspensions for flow cytometric analysis. In these cell Figure 3. Inhibition of tumor growth and angiogenesis bytreatment of A549 suspensions, % endothelial cells (MECA-32+) was determined to monitor adenocarcinoma with PF-4var/CXCL4L1 in comparison with PF-4/CXCL4. angiogenesis in the tumors (C). In addition, the cell suspensions were analyzed CB-17 SCID mice were injected s.c. on day0 with A549 adenocarcinoma cells for leukocyte content by FACS analysis (D). The total number of leukocytes and divided into three groups, which received vehicle control (n = 10), 0.1 Ag (CD45+ cells), monocytes/macrophages (Moma-2+ cells), and granulocytes CXCL4L1 (n = 10), or 0.1 Ag CXCL4 (n = 10) per injection, respectively. (Gr-1+ cells) was determined per tumor volume. *, P < 0.05, statistically Treatment started at the time of tumor inoculation. Chemokines were injected significant difference between the control group and the mice treated with i.t. thrice a week, and tumor dimensions were measured everyweek ( A). At CXCL4L1 or CXCL10. these time points, the tumor volume was calculated using the formula: (4pab 2)/3 (a and b, largest and smallest radius, respectively). After 8 wks, mice were sacrificed, and exact tumor dimensions were determined (B), which was PF-4/CXCL4 and the CXCR3 ligands Mig/CXCL9 and IP-10/CXCL10 calculated bythe formula: (4 pabc)/3(a, b,orc, measured radius). Points/columns, mean tumor size (mm3) per treatment group; bars, SEM. and was found to inhibit tumor growth and angiogenesis more Per group, six tumors were minced into single-cell suspensions for flow efficiently in different animal models. cytometric analysis. In these cell suspensions, % MECA-32+ endothelial cells First, it was shown that recombinant PF-4var/CXCL4L1 is at was determined to monitor angiogenesis in the tumors (C). *, P < 0.05, statisticallysignificant difference between the control group and the mice least 10-fold more potent than PF-4/CXCL4 in preventing treated with CXCL4L1 or CXCL4. endothelial cell migration, as tested in the in vitro wound-healing www.aacrjournals.org 5945 Cancer Res 2007; 67: (12). June 15, 2007

Table 1. Impaired metastasis of A549 adenocarcinoma treated with the angiostatic chemokines PF-4var/CXCL4L1 or IP-10/ CXCL10

Group Total no. metastatic cells per organ F SEM*

Brain (Â106) Adrenal gland (Â104) Lung (Â106) Liver (Â105) Blood (Â103/mL) Bone Marrow (Â104)

Control 3.1 F 0.4 1.1 F 0.2 1.5 F 0.1 4.1 F 0.4 2.9 F 8.8 2.0 F 0.2 c CXCL10 2.1 F 0.2 0.6 F 0.2 1.2 F 0.1 3.5 F 0.5 1.9 F 2.3 1.9 F 0.3 c c c c c CXCL4L1 1.7 F 0.3 0.4 F 0.1 1.0 F 0.2 1.3 F 0.4 1.1 F 1.8 1.7 F 0.3

*Mice were injected with A549 cells and divided into three groups, which received vehicle control (n = 10), 0.1 Ag human CXCL4L1 (n = 10), 0.1 Ag murine CXCL10 (n = 10) per injection, respectively, as indicated in Fig. 4 legend. Different organs known to be invaded by A549 lung adenocarcinoma cells were minced into single-cell suspensions for flow cytometric analysis (six mice per group), and the number of human cells was determined. cP < 0.0167, statistically significant difference between the control group and the mice treated with CXCL4L1 or CXCL10.

assay and the Boyden chamber migration assay on human of IL-8/CXCL8 and other CXC chemokines using this receptor (28). microvascular endothelial cells. This finding was confirmed by However, it is still unknown how angiostatic CXCR3 ligands can the in vivo rat cornea micropocket assay for angiogenesis. Second, molecularly prevent angiogenesis induced by CXCR2 ligands. this stronger potency of PF-4var/CXCL4L1 compared with PF-4/ Yang and Richmond indicate that for the angiostatic activity of CXCL4 was also shown upon i.t. injection in the rapidly progressing IP-10/CXCL10 in tumors, CXCR3 receptor binding but not B16 melanoma model (2 weeks) using athymic nude mice in which glycosaminoglycan binding is essential (37). Alternatively, Soejima the effect of infiltrating lymphocytes is excluded. Furthermore, and Rollins found a functional receptor for IP-10/CXCL10 on reduction in tumor size by PF-4var/CXCL4L1 was paralleled by a endothelial cells, which is neither CXCR3 nor glycosaminoglycan significantly lowered presence of i.t. microvasculature as evidenced by CD31 staining. Similar results were obtained in a slower progressing model of non–small-cell lung carcinoma (8 weeks), in which PF-4var/CXCL4L1 inhibited the growth of human A549 cells in SCID mice more efficiently than PF-4/CXCL4. Angiostasis again accounted for the antitumoral effect of both PF-4 forms as evidenced by flow cytometric analysis of the tumors. I.t. injection of PF4var/CXCL4L1 or IP-10/CXCL10 at equimolar concentrations revealed a comparable reduction in A549 tumor size, paralleled withan equal inhibitionof tumoral angiogenesis. However, upon injection of PF-4var/CXCL4L1, the metastatic behavior of the tumor was more impaired compared withIP-10/CXCL10 or buffer treatment. Because SCID beige mice have deficiencies in the lymphocyte lineage functions (lacking T and B cells and having impaired NK cell function), these data show that lymphocyte recruitment is not required for the inhibition of tumor growth and metastasis by PF-4var/CXCL4L1. In addition, analysis of tumor- associated leukocytes in the A549/SCID beige model revealed no statistically significant difference in the number of monocytes and granulocytes in the PF-4var/CXCL4L1–treated tumors compared with buffer treated tumors. Finally, it was found that in the syngeneic model of LLC (4 weeks) PF-4var/CXCL4L1 and the CXCR3 ligand Mig/CXCL9 bothsignificantly inhibited tumor growth, which was paralleled with an equal reduction in i.t. endothelial cells. In this model using immunocompetent mice, the Figure 5. Reduced tumor growth and vascularityafter treatment of LLC with effect of infiltrating tumor-associated leukocytes can not be the angiostatic chemokines PF-4var/CXCL4L1 or Mig/CXCL9. Mice (C57Bl/6; excluded, especially withregard to thepotential attraction of n = 30) were injected s.c. on day0 with LLC cells and divided into three groups, antitumoral Th1 effector cells by Mig/CXCL9. which received vehicle control (n = 10), 0.1 Ag human CXCL4L1 (n = 10), or 0.1 Ag murine CXCL9 (n = 10) per injection, respectively. Treatment started The molecular basis of the angiostatic and antitumoral activities at the time of tumor inoculation. Chemokines were injected i.t. thrice a week, of the PF-4 forms remains an enigma, although for CXCL4, several and tumor dimensions were measured everyweek ( A). After 4 wks, mice were sacrificed, and exact tumor dimensions were determined (Panel B). mechanisms have been proposed (36). The findings that PF-4var/ The formulas used to calculate tumor volumes are mentioned in Fig. 3 legend. CXCL4L1 and the CXCR3 ligands IP-10/CXCL10 and Mig/CXCL9 Points/columns, mean tumor size (mm3) per treatment group; bars, SEM. can inhibit the angiogenic effect of IL-8/CXCL8 indicate that GPCR To assess tumor vascularity, six tumors per group were minced into single-cell suspensions for flow cytometric analysis using the panendothelial cell marker are probably implicated (33). Indeed, CXCR2 is expressed on MECA-32 (C). *, P < 0.05, statisticallysignificant difference between the endothelial cells and could be responsible for the angiogenic activity control group and the mice treated with CXCL4L1 or CXCL9.

Cancer Res 2007; 67: (12). June 15, 2007 5946 www.aacrjournals.org

(38). The report that human PF-4/CXCL4 is a ligand for a variant of (refs. 34, 35; e.g., by attracting leukocytes loaded withproteases that CXCR3 (i.e., CXCR3B; ref. 15) does not clarify the issue because there can promote tumor invasion and metastasis; ref. 43). In addition, is no evidence for the existence of CXCR3B in mice, and human PF-4 the expression of chemokine receptors contributes to metastasis of forms are angiostatic in mice against bothhuman and mouse tumor cells to the organs where the corresponding chemokine is tumors. Furthermore, the NH2-terminal part of chemokines has been produced (44). Antitumoral activity of locally delivered chemokine considered as essential for receptor binding (39). In this context, it is has been tested for several CXC and CC chemokines. Application of surprising that COOH-terminal fragments of PF-4/CXCL4 are equally engineered tumor cells or oncotropic viruses (e.g., parvovirus) to or more angiostatic compared withintact chemokine (40). Because locally release chemokines, such as monocyte chemotactic protein- the COOH-terminal part of CXCL4 interacts with glycosaminogly- 3 (MCP-3)/CCL7 and Mig/CXCL9 in melanoma and lung carcino- cans, it has been suggested that this part is important for the ma, confirms their potential clinical value in anticancer therapy angiostatic activity of PF-4/CXCL4 by preventing the binding of (32, 45). Furthermore, suchapproachcan be applied as a growthfactors to their receptor (13, 36). However, PF-4var/CXCL4L1 combination therapy in which chemokines (e.g., CXCR3 ligands) has less affinity for heparin than PF-4/CXCL4 while being more and cytokines (suchas IL-2 and IL-12) are co-delivered to reach angiostatic, indicating that a combined effect of binding to both bothan optimal angiostatic and immunogenic antitumoral effect GAG and GPCR might be implicated. Finally, it has been shown (46, 47). that PF-4/CXCL4 can form inactive complexes with IL-8/CXCL8 (41) as well as withbFGF (42). Theangiogenic activity of IL-8/CXCL8 Acknowledgments and bFGF is strongly inhibited by PF-4var/CXCL4L1 (23), and one could speculate that PF-4var/CXCL4L1 is more efficiently complexed Received 12/20/2006; revised 3/16/2007; accepted 4/17/2007. Grant support: Center of Excellence (credit no. EF/05/15) of K.U. Leuven, the with these angiogenic factors. Definitively, further experimental Concerted Research Actions of the Regional Government of Flanders, the Fund for work is necessary to elucidate the molecular mechanisms through Scientific Researchof Flanders (FWO-Vlaanderen), theInteruniversity Attraction Poles Program-Belgian Science Policy, the European Union 6FP EC contract INNOCHEM, which PF-4 variants inhibit angiogenesis, exploring chemokine, and NIH grants CA87879, P50CA90388, HL66027, and P50HL67665 (R.M. Strieter). GAG, as well as GPCR binding. The costs of publication of this article were defrayed in part by the payment of page It is generally accepted that chemokines can be detrimental charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate thisfact. for tumor development and progression, despite the fact that We thank Rene´ Conings and Jean-Pierre Lenaerts for their expert technical tumor cell–derived chemokines may be beneficial for tumor growth assistance.

References thelium under flow conditions. J Leukoc Biol 2005;78: 23. Struyf S, Burdick MD, Proost P, Van Damme J, 435–41. Strieter RM. Platelets release CXCL4L1, a nonallelic 1. Deuel TF, Keim PS, Farmer M, Heinrikson RL. Amino 12. Kasper B, Brandt E, Ernst M, Petersen F. Neutrophil variant of the chemokine platelet factor-4/CXCL4 and acid sequence of human platelet factor 4. Proc Natl adhesion to endothelial cells induced by platelet factor 4 potent inhibitor of angiogenesis. Circ Res 2004;95: Acad Sci U S A 1977;74:2256–8. requires sequential activation of Ras, Syk, and JNK MAP 855–7. 2. Brandt E, Ludwig A, Petersen F, Flad HD. Platelet- kinases. Blood 2006;107:1768–75. 24. Addison CL, Belperio JA, Burdick MD, Strieter RM. derived CXC chemokines: old players in new games. 13. Luster AD, Greenberg SM, Leder P. The IP-10 Overexpression of the duffy antigen receptor for Immunol Rev 2000;177:204–16. chemokine binds to a specific cell surface heparan chemokines (DARC) by NSCLC tumor cells results in 3. Van Damme J, Van Beeumen J, Opdenakker G, Billiau sulfate site shared with platelet factor 4 and inhibits increased tumor necrosis. BMC Cancer 2004;4:28. A. A novel, NH2-terminal sequence-characterized hu- endothelial cell proliferation. J Exp Med 1995;182: 25. Sharma S, Yang SC, Hillinger S, et al. SLC/CCL21- man monokine possessing neutrophil chemotactic, 219–31. mediated anti-tumor responses require IFNgamma, skin-reactive, and granulocytosis-promoting activity. 14. Petersen F, Bock L, Flad HD, Brandt E. A chondroitin MIG/CXCL9 and IP-10/CXCL10. Mol Cancer 2003;2:22. J Exp Med 1988;167:1364–76. sulfate proteoglycan on human neutrophils specifically 26. Van Coillie E, Van Aelst I, Wuyts A, et al. Tumor 4. Murphy PM, Tiffany HL. Cloning of complementary binds platelet factor 4 and is involved in cell activation. angiogenesis induced by granulocyte chemotactic pro- DNA encoding a functional human interleukin-8 recep- J Immunol 1998;161:4347–55. tein-2 as a countercurrent principle. Am J Pathol 2001; tor. Science 1991;253:1280–3. 15. Lasagni L, Francalanci M, Annunziato F, et al. An 159:1405–14. 5. Strieter RM, Polverini PJ, Kunkel SL, et al. The alternatively spliced variant of CXCR3 mediates the 27. Van Damme J, Proost P, Lenaerts J-P, Opdenakker G. functional role of the ELR motif in CXC chemo- inhibition of endothelial cell growth induced by IP-10, Structural and functional identification of two human, kine-mediated angiogenesis. J Biol Chem 1995;270: Mig, and I-TAC, and acts as functional receptor for tumor-derived monocyte chemotactic proteins (MCP-2 27348–57. platelet factor 4. J Exp Med 2003;197:1537–49. and MCP-3) belonging to the chemokine family. J Exp 6. Rot A, Von Andrian UH. Chemokines in innate and 16. Maione TE, Gray GS, Petro J, et al. Inhibition of Med 1992;176:59–65. adaptive host defense: basic chemokinese grammar for angiogenesis by recombinant human platelet factor-4 28. Addison CL, Daniel TO, Burdick MD, et al. The CXC immune cells. Annu Rev Immunol 2004;22:891–928. and related peptides. Science 1990;247:77–9. chemokine receptor 2, CXCR2, is the putative receptor 7. Luster AD, Unkeless JC, RavetchJV. Gamma-interferon 17. Sharpe RJ, Byers HR, Scott CF, Bauer SI, Maione TE. for ELR+ CXC chemokine-induced angiogenic activity. transcriptionally regulates an early-response gene con- Growth inhibition of murine melanoma and human J Immunol 2000;165:5269–77. taining homology to platelet proteins. Nature 1985;315: colon carcinoma by recombinant human platelet factor 29. Burdick MD, Murray LA, Keane MP, et al. CXCL11 672–6. 4. J Natl Cancer Inst 1990;82:848–53. attenuates bleomycin-induced pulmonary fibrosis via 8. Farber JM. HuMig: a new human member of the 18. Slungaard A. Platelet factor 4: a chemokine enigma. inhibition of vascular remodeling. Am J Respir Crit Care chemokine family of cytokines. Biochem Biophys Res Int J Biochem Cell Biol 2005;37:1162–67. Med 2005;171:261–8. Commun 1993;192:223–30. 19. Dana B, Carvalho AC, Ellman L. Plasma heparin 30. Maione TE, Gray GS, Hunt AJ, Sharpe RJ. Inhibition of 9. Arenberg DA, Kunkel SL, Polverini PJ, et al. Interferon- neutralizing activity. Its use in the evaluation of tumor growthin mice by an analogue of platelet factor 4 gamma-inducible protein 10 (IP-10) is an angiostatic thrombocytopenia and thrombocytosis. Am J Clin that lacks affinity for heparin and retains potent factor that inhibits human non-small cell lung cancer Pathol 1976;65:964–9. angiostatic activity. Cancer Res 1991;51:2077–83. (NSCLC) tumorigenesis and spontaneous metastases. 20. Eslin DE, Zhang C, Samuels KJ, et al. Transgenic 31. Arenberg DA, White ES, Burdick MD, Strom SR, J Exp Med 1996;184:981–92. mice studies demonstrate a role for platelet factor 4 Strieter RM. Improved survival in tumor-bearing SCID 10. Hensbergen PJ, Wijnands PG, Schreurs MW, et al. The in thrombosis: dissociation between anticoagulant mice treated withinterferon-gamma-inducible protein CXCR3 targeting chemokine CXCL11 has potent anti- and antithrombotic effect of heparin. Blood 2004; 10 (IP-10/CXCL10). Cancer Immunol Immunother 2001; tumor activity in vivo involving attraction of CD8+ T 104:3173–80. 50:533–8. lymphocytes but not inhibition of angiogenesis. 21. Weber C. Platelets and chemokines in atherosclero- 32. Addison CL, Arenberg DA, Morris SB, et al. The CXC J Immunother 2005;28:343–51. sis: partners in crime. Circ Res 2005;96:612–6. chemokine, monokine induced by interferon-gamma, 11. Baltus T, von Hundelshausen P, Mause SF, et al. 22. Gewirtz AM, Zhang J, Ratajczak J, et al. Chemokine inhibits non-small cell lung carcinoma tumor growth Differential and additive effects of platelet-derived regulation of human megakaryocytopoiesis. Blood 1995; and metastasis. Hum Gene Ther 2000;11:247–61. chemokines on monocyte arrest on inflamed endo- 86:2559–67. 33. Strieter RM, Burdick MD, Gomperts BN, Belperio JA, www.aacrjournals.org 5947 Cancer Res 2007; 67: (12). June 15, 2007

Keane MP. CXC chemokines in angiogenesis. Cytokine CXCR3 nor glycosaminoglycan. J Immunol 2001;167: Recent insights on the roles of chemokines. Int J Dev GrowthFactor Rev 2005;16:593–609. 6576–82. Biol 2004;48:519–27. 34. Mantovani A, Allavena P, Sozzani S, et al. Chemo- 39. Murphy PM, Baggiolini M, Charo IF, et al. Interna- 44. Mu¨ller A, Homey B, Soto H, et al. Involvement of kines in the recruitment and shaping of the leukocyte tional union of pharmacology. XXII. Nomenclature for chemokine receptors in breast cancer metastasis. infiltrate of tumors. Semin Cancer Biol 2004;14:155–60. chemokine receptors. Pharmacol Rev 2000;52:145–76. Nature 2001;410:50–6. 35. Conti I, Rollins BJ. CCL2 (monocyte chemoattrac- 40. Hagedorn M, Zilberberg L, Wilting J, et al. Domain 45. Wetzel K, Struyf S, Van Damme J, et al. MCP-3 tant protein-1) and cancer. Semin Cancer Biol 2004;14: swapping in a COOH-terminal fragment of platelet (CCL7) delivered by parvovirus MVMp reduces tumor- 149–54. factor 4 generates potent angiogenesis inhibitors. igenicity of mouse melanoma cells through activation 36. Bikfalvi A, Gimenez-Gallego G. The control of Cancer Res 2002;62:6884–90. of T lymphocytes and NK cells. Int J Cancer 2007;120: angiogenesis and tumor invasion by platelet factor-4 41. Nesmelova IV, Sham Y, Dudek AZ, et al. Platelet factor 1364–71. and platelet factor-4-derived molecules. Semin Thromb 4 and interleukin-8 CXC chemokine heterodimer forma- 46. Pan J, Burdick MD, Belperio JA, et al. CXCR3/CXCR3 Hemost 2004;30:137–44. tion modulates function at the quaternary structural ligand biological axis impairs RENCA tumor growthby a 37. Yang J, Richmond A. The angiostatic activity of level. J Biol Chem 2005;280:4948–58. mechanism of immunoangiostasis. J Immunol 2006;176: interferon-inducible protein-10/CXCL10 in human mel- 42. Perollet C, Han ZC, Savona C, Caen JP, Bikfalvi A. 1456–64. anoma depends on binding to CXCR3 but not to Platelet factor 4 modulates fibroblast growthfactor 2 47. Narvaiza I, Mazzolini G, Barajas M, et al. Intra- glycosaminoglycan. Mol Ther 2004;9:846–55. (FGF-2) activity and inhibits FGF-2 dimerization. Blood tumoral coinjection of two adenoviruses, one encoding 38. Soejima K, Rollins BJ. A functional IFN-gamma- 1998;91:3289–99. the chemokine IFN-gamma-inducible protein-10 and inducible protein-10/CXCL10-specific receptor expres- 43. Opdenakker G, Van Damme J. The countercurrent another encoding IL-12, results in marked antitumoral sed by epithelial and endothelial cells that is neither principle in invasion and metastasis of cancer cells. synergy. J Immunol 2000;164:3112–22.

Cancer Res 2007; 67: (12). June 15, 2007 5948 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2007 American Association for Cancer Research. Platelet Factor-4 Variant Chemokine CXCL4L1 Inhibits Melanoma and Lung Carcinoma Growth and Metastasis by Preventing Angiogenesis

Sofie Struyf, Marie D. Burdick, Elke Peeters, et al.

Cancer Res 2007;67:5940-5948.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/67/12/5940

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2007/06/13/67.12.5940.DC1

Cited articles This article cites 47 articles, 24 of which you can access for free at: http://cancerres.aacrjournals.org/content/67/12/5940.full#ref-list-1

Citing articles This article has been cited by 11 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/67/12/5940.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/67/12/5940. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.