DOCSLIB.ORG

Platelet Factor-4 Variant Chemokine CXCL4L1 Inhibits Melanoma and Lung Carcinoma Growth and Metastasis by Preventing Angiogenesis Sofie Struyf,1 Marie D

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Platelet Factor-4 Variant Chemokine CXCL4L1 Inhibits Melanoma and Lung Carcinoma Growth and Metastasis by Preventing Angiogenesis Sofie Struyf,1 Marie D Research Article Platelet Factor-4 Variant Chemokine CXCL4L1 Inhibits Melanoma and Lung Carcinoma Growth and Metastasis by Preventing Angiogenesis Sofie Struyf,1 Marie D. Burdick,2 Elke Peeters,1 Karolien Van den Broeck,1 Chris Dillen,1 Paul Proost,1 Jo Van Damme,1 and Robert M. Strieter2 1Laboratory of Molecular Immunology, Rega Institute, Leuven, Belgium and 2Department of Medicine, University of Virginia, Charlottesville, Virginia Abstract CXCL8 (3). Subsequently, two functional receptors were identified The platelet factor-4 variant, designated PF-4var/CXCL4L1, is for IL-8/CXCL8 [i.e., CXC chemokine receptor 1 and 2 (CXCR1 and a recently described natural non-allelic gene variant of the CXCR2)]. Furthermore, IL-8/CXCL8 and other neutrophil-attracting CXC chemokine platelet factor-4/CXCL4. PF-4var/CXCL4L1 CXC chemokines binding to CXCR2 were shown to possess was cloned, and the purified recombinant protein strongly angiogenic activity (4–6). In contrast to IL-8/CXCL8, the CXCR3 g inhibited angiogenesis. Recombinant PF-4var/CXCL4L1 was ligands, monokine induced by IFN- (Mig)/CXCL9, IFN-inducible a angiostatically more active (at nanomolar concentration) than protein 10 (IP-10)/CXCL10, and IFN-inducible T-cell chemo- PF-4/CXCL4 in various test systems, including wound-healing attractant (I-TAC)/CXCL11 are angiostatic and predominantly and migration assays for microvascular endothelial cells and attract T lymphocytes and natural killer (NK) cells (7–10). The the rat cornea micropocket assay for angiogenesis. Further- fact that the existence of a functional GPCR for PF-4/CXCL4 has been difficult to elucidate allows us to speculate that its pleiotropic more, PF-4var/CXCL4L1 more efficiently inhibited tumor growth in animal models of melanoma and lung carcinoma biological activities, suchas promotion of neutrophiland monocyte than PF-4/CXCL4 at an equimolar concentration. For B16 cell adhesion to endothelium and inhibition of angiogenesis, are melanoma in nude mice, a significant reduction in tumor size mediated through different cellular mechanisms, including glycos- and the number of small i.t. blood vessels was obtained with aminoglycan in addition to GPCR binding (11–15). Indeed, PF-4/ i.t. applied PF-4var/CXCL4L1. For A549 adenocarcinoma in CXCL4 has significant antitumoral activity by inhibition of GPCR- severe combined immunodeficient mice, i.t. PF-4var/CXCL4L1 mediated endothelial cell chemotaxis, whereas its procoagulant reduced tumor growth and microvasculature more efficiently activity is mediated by heparin binding (16–19). Its role in than PF-4/CXCL4 and prevented metastasis to various organs thrombosis and in megakaryopoiesis was confirmed by generation better than the angiostatic IFN-inducible protein 10/CXCL10. of PF-4/CXCL4 knockout mice (20). However, for several biological Finally, in the syngeneic model of Lewis lung carcinoma, effects ascribed to PF-4/CXCL4 (e.g., in atherosclerosis and PF-4var/CXCL4L1 inhibited tumor growth equally well as hematopoiesis; refs. 21, 22), the precise underlying molecular monokine induced by IFN-; (Mig)/CXCL9, also known to mechanisms are complex and remain partially elusive. In a previous study, we isolated and identified the PF-4 variant attract effector T lymphocytes. Taken together, PF-4var/ CXCL4L1 is a highly potent antitumoral chemokine preventing CXCL4L1 from thrombin-stimulated platelets (23). It was shown development and metastasis of various tumors by inhibition that natural PF-4var/CXCL4L1 is a more potent inhibitor of of angiogenesis. These data confirm the clinical potential of endothelial cell chemotaxis and angiogenesis than the well- characterized PF-4/CXCL4, whereas other biological characteristics locally released chemokines in cancer therapy. [Cancer Res in vitro 2007;67(12):5940–8] of PF-4var/CXCL4L1 remain unknown. Here, we confirm activities withrecombinant PF-4var/CXCL4L1 at nanomolar concentrations and show that this angiostatic chemokine is a Introduction stronger inhibitor of tumor growth and metastasis than PF-4/ Platelet factor-4 (PF-4) has been biochemically characterized as CXCL4 using different tumor models. PF4var/CXCL4L1 was more a platelet product with high affinity for heparin long before the potent than IP-10/CXCL10 in preventing tumor metastasis in term chemokine was introduced to designate small inducible immunocompromised animals, whereas it had equal antitumoral chemotactic cytokines binding to G protein–coupled receptors activity as Mig/CXCL9 in immunocompetent mice. Finally, we (GPCR) and attracting various leukocyte subsets to inflammatory provide evidence that antitumoral effects of PF-4var/CXCL4L1 sites (1, 2). The position of the conserved cysteines has been used observed at low chemokine dose are predominantly mediated by to classify PF4/CXCL4 among the CXC chemokines along with the inhibition of angiogenesis. later discovered granulocyte chemoattractant interleukin-8 (IL-8)/ Materials and Methods Reagents and tumor cell lines. Natural human PF-4/CXCL4 and human Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). PF-4var/CXCL4L1 were purified to homogeneity as described (23). S. Struyf is a senior researchassistant of theFWO-Vlaanderen. Recombinant human basic fibroblast growth factor (bFGF), human IL-8/ Requests for reprints: Jo Van Damme, Laboratory of Molecular Immunology, Rega CXCL8, murine IP-10/CXCL10, and murine Mig/CXCL9 were purchased Institute, K.U. Leuven, Minderbroedersstraat 10, B-3000 Leuven, Belgium. Phone: from R&D Systems. 3216337348; Fax: 3216337340; E-mail: [email protected]. I2007 American Association for Cancer Research. B16 melanoma was orthotopically propagated in C57Bl/6 mice and doi:10.1158/0008-5472.CAN-06-4682 cultured in Eagle’s minimal essential medium withEarle’s salts buffered Cancer Res 2007; 67: (12). June 15, 2007 5940 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2007 American Association for Cancer Research. Novel Antitumoral PF-4/CXCL4 Chemokine Variant withNaHCO 3 and supplemented with10% fetal bovine serum (FBS) and received an inhibition score and ranged from À3 (very broad) to 0. All L-glutamine. The A549 adenocarcinoma and weakly immunogenic Lewis samples were tested in triplicate in each24-well plate and were scored lung carcinoma (LLC) cell lines were obtained from the American Type double blind by three investigators. Digital pictures from representative Culture Collection and cultured as described (24, 25). wells were taken witha Canon G3 camera mounted on a Carl Zeiss Cloning and purification of recombinant PF-4var/CXCL4L1. The Axiovert 40 CFL microscope withan A-plan Â10/0.25 objective (Carl coding region of human PF-4var/CXCL4L1 cDNA was cloned from a human Zeiss). platelet cDNA preparation in two consecutive steps. First, a rather long The Boyden chamber assay for endothelial cells has been described PF-4var/CXCL4L1 cDNA fragment was amplified by primers specifically previously (28). For this assay, human lung microvascular endothelial cells binding PF-4var/CXCL4L1 and not PF-4/CXCL4 (5¶-TATAGAATTCCAG- (HMVEC-L; Cambrex Bio Science) were cultured following the manufac- GGAGTCACTGCCTGCAGAACC-3¶ as forward primer and 5¶-TATACTC- turer’s instructions. GAGGATTGAAAGTGCACACTTAGGCAGC -3¶ as backward primer; Cornea assay. Analysis of the in vivo angiostatic activity of recombinant respective EcoRI and XhoI sites are in italic). The amplicon (445 bp) was PF-4var/CXCL4L1 was done in hooded Long-Evans rat eyes as described cloned into the pBluescript II vector (Stratagene). The reconstructed previously (5, 23). phagemid was verified by both restriction analysis and DNA sequencing. Tumor models. Animal experiments were approved by the local This construct was used as a template to amplify the coding region of the animal ethics committees [University of Leuven and University of mature PF-4var/CXCL4L1 protein (5¶-TATACCATGGCCGAAGCTGAAGAA- California, Los Angeles (UCLA)] and conducted in conformity withthe AGATGGGGACCTG-3¶ as forward primer and 5¶-TATACTCGAGGCTAG- Belgian, European and U.S. guidelines for the protection of animals used GTAGCTAACTCTCCAAATGTTCC-3¶ as backward primer; respective NcoI for scientific purposes. B16 experiments were done with6- to 8-week-old and XhoI sites are in italic). The PCR reaction product was gel-purified, female athymic nu/nu mice (NMRI background) kept in a specific restriction-digested with NcoI and XhoI, and ligated into the corresponding pathogen-free environment (Elevage Janvier). B16 melanoma cells in log sites of the pHEN1 expression vector (26), which contained a LacZ phase (2 Â 106 cells resuspended in 200 AL of PBS) were injected s.c. on promoter and a PelB leader sequence to direct the expression product to day 0 in the right dorsal flank. Animals were injected at the tumor site the bacterial periplasm. Verification of the sequence of pHEN1 PF-4var/ with50 AL of test sample [i.e., endotoxin-free saline (0.9% NaCl, Baxter), CXCL4L1 was done on bothstrands. Theligation mixture was transformed 5 Ag of natural human PF-4/CXCL4, or 1 Ag of recombinant human PF- into Escherichia coli XL1-Blue cells (Stratagene). For recombinant protein 4var/CXCL4L1 in saline]. All animals were observed thrice a week, and production, the transformed cells were grown in SOC medium containing the tumor dimensions were measured with calipers. For immunohisto- ampicillin (100 Ag/mL) and supplemented with0.1% glucose at 37 jC with chemical analysis of
Load more

Recommended publications
  • C-X-C Motif Chemokine Ligand 10 Produced by Mouse Sertoli Cells in Response to Mumps Virus Infection Induces Male Germ Cell Apoptosis
    Citation: Cell Death and Disease (2017) 8, e3146; doi:10.1038/cddis.2017.560 OPEN Macmillan Publishers Limited, part of Springer Nature. www.nature.com/cddis Corrected: Correction C-X-C motif chemokine ligand 10 produced by mouse Sertoli cells in response to mumps virus infection induces male germ cell apoptosis Qian Jiang1, Fei Wang1, Lili Shi1, Xiang Zhao1, Maolei Gong1, Weihua Liu1, Chengyi Song2, Qihan Li3, Yongmei Chen1, Han Wu*,1,2 and Daishu Han*,1 Mumps virus (MuV) infection usually results in germ cell degeneration in the testis, which is an etiological factor for male infertility. However, the mechanisms by which MuV infection damages male germ cells remain unclear. The present study showed that C-X-C motif chemokine ligand 10 (CXCL10) is produced by mouse Sertoli cells in response to MuV infection, which induces germ cell apoptosis through the activation of caspase-3. CXC chemokine receptor 3 (CXCR3), a functional receptor of CXCL10, is constitutively expressed in male germ cells. Neutralizing antibodies against CXCR3 and an inhibitor of caspase-3 activation significantly inhibited CXCL10-induced male germ cell apoptosis. Furthermore, the tumor necrosis factor-α (TNF-α) upregulated CXCL10 production in Sertoli cells after MuV infection. The knockout of either CXCL10 or TNF-α reduced germ cell apoptosis in the co-cultures of germ cells and Sertoli cells in response to MuV infection. Local injection of MuV into the testes of mice confirmed the involvement of CXCL10 in germ cell apoptosis in vivo. These results provide novel insights into MuV-induced germ cell apoptosis in the testis.
    [Show full text]
  • Enhanced Monocyte Migration to CXCR3 and CCR5 Chemokines in COPD
    ERJ Express. Published on March 10, 2016 as doi: 10.1183/13993003.01642-2015 ORIGINAL ARTICLE IN PRESS | CORRECTED PROOF Enhanced monocyte migration to CXCR3 and CCR5 chemokines in COPD Claudia Costa1, Suzanne L. Traves1, Susan J. Tudhope1, Peter S. Fenwick1, Kylie B.R. Belchamber1, Richard E.K. Russell2, Peter J. Barnes1 and Louise E. Donnelly1 Affiliations: 1Airway Disease, National Heart and Lung Institute, Imperial College London, London, UK. 2Chest Clinic, King Edward King VII Hospital, Windsor, UK. Correspondence: Louise E. Donnelly, Airway Disease, National Heart and Lung Institute, Dovehouse Street, London, SW3 6LY, UK. E-mail: [email protected] ABSTRACT Chronic obstructive pulmonary disease (COPD) patients exhibit chronic inflammation, both in the lung parenchyma and the airways, which is characterised by an increased infiltration of macrophages and T-lymphocytes, particularly CD8+ cells. Both cell types can express chemokine (C-X-C motif) receptor (CXCR)3 and C-C chemokine receptor 5 and the relevant chemokines for these receptors are elevated in COPD. The aim of this study was to compare chemotactic responses of lymphocytes and monocytes of nonsmokers, smokers and COPD patients towards CXCR3 ligands and chemokine (C-C motif) ligand (CCL)5. Migration of peripheral blood mononuclear cells, monocytes and lymphocytes from nonsmokers, smokers and COPD patients toward CXCR3 chemokines and CCL5 was analysed using chemotaxis assays. There was increased migration of peripheral blood mononuclear cells from COPD patients towards all chemokines studied when compared with nonsmokers and smokers. Both lymphocytes and monocytes contributed to this enhanced response, which was not explained by increased receptor expression.
    [Show full text]
  • Regulation of CCR7-Dependent Cell Migration Through CCR7 Homodimer Formation
    www.nature.com/scientificreports OPEN Regulation of CCR7-dependent cell migration through CCR7 homodimer formation Received: 6 September 2016 Daichi Kobayashi 1,2,6,7, Masataka Endo2, Hirotaka Ochi2, Hironobu Hojo3, Accepted: 24 July 2017 Masayuki Miyasaka4,5,6 & Haruko Hayasaka2 Published: xx xx xxxx The chemokine receptor CCR7 contributes to various physiological and pathological processes including T cell maturation, T cell migration from the blood into secondary lymphoid tissues, and tumor cell metastasis to lymph nodes. Although a previous study suggested that the efcacy of CCR7 ligand-dependent T cell migration correlates with CCR7 homo- and heterodimer formation, the exact extent of contribution of the CCR7 dimerization remains unclear. Here, by inducing or disrupting CCR7 dimers, we demonstrated a direct contribution of CCR7 homodimerization to CCR7-dependent cell migration and signaling. Induction of stable CCR7 homodimerization resulted in enhanced CCR7- dependent cell migration and CCL19 binding, whereas induction of CXCR4/CCR7 heterodimerization did not. In contrast, dissociation of CCR7 homodimerization by a novel CCR7-derived synthetic peptide attenuated CCR7-dependent cell migration, ligand-dependent CCR7 internalization, ligand-induced actin rearrangement, and Akt and Erk signaling in CCR7-expressing cells. Our study indicates that CCR7 homodimerization critically regulates CCR7 ligand-dependent cell migration and intracellular signaling in multiple cell types. Recruitment of lymphocytes from the blood into secondary lymphoid tissues is a process contributing to con- tinuous immune surveillance. Tis process is tightly regulated by the interaction between lymphoid chemokines expressed in lymphoid tissues and their specifc G-protein-coupled receptors in migrating cells1, 2. CCR7 is one of the major chemokine receptors preferentially expressed in a wide range of immune cells, including naïve T and B cells, central memory T cells, mature dendritic cells3, and plasmacytoid dendritic cells4, 5.
    [Show full text]
  • Following Ligation of CCL19 but Not CCL21 Arrestin 3 Mediates
    Arrestin 3 Mediates Endocytosis of CCR7 following Ligation of CCL19 but Not CCL21 Melissa A. Byers, Psachal A. Calloway, Laurie Shannon, Heather D. Cunningham, Sarah Smith, Fang Li, Brian C. This information is current as Fassold and Charlotte M. Vines of September 25, 2021. J Immunol 2008; 181:4723-4732; ; doi: 10.4049/jimmunol.181.7.4723 http://www.jimmunol.org/content/181/7/4723 Downloaded from References This article cites 82 articles, 45 of which you can access for free at: http://www.jimmunol.org/content/181/7/4723.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Arrestin 3 Mediates Endocytosis of CCR7 following Ligation of CCL19 but Not CCL211 Melissa A. Byers,* Psachal A. Calloway,* Laurie Shannon,* Heather D. Cunningham,* Sarah Smith,* Fang Li,† Brian C.
    [Show full text]
  • Inhibition of CCL7 Derived from Mo-Mdscs Prevents Metastatic
    Ren et al. Cell Death and Disease (2021) 12:484 https://doi.org/10.1038/s41419-021-03698-5 Cell Death & Disease ARTICLE Open Access Inhibition of CCL7 derived from Mo-MDSCs prevents metastatic progression from latency in colorectal cancer Xiaoli Ren1,2, Jianbiao Xiao1,3, Wanning Zhang1,3,FeifeiWang1,3, Yongrong Yan1,3,XuehuiWu 1,3, Zhicheng Zeng1,3, Yumei He4,WeiYang1,3, Wangjun Liao5,YanqingDing1,3 and Li Liang 1,3 Abstract In colorectal cancer (CRC), overt metastases often appear after years of latency. But the signals that cause micro- metastatic cells to remain indolent, thereby enabling them to survive for extended periods of time, are unclear. Immunofluorescence and co-immunoprecipitation assays were used to explore the co-localization of CCL7 and CCR2. Immunohistochemical (IHC) assays were employed to detect the characters of metastatic HT29 cells in mice liver. Flow cytometry assays were performed to detect the immune cells. Bruberin vivo MS FX Pro Imager was used to observe the liver metastasis of CRC in mice. Quantitative real-time PCR (qRT-PCR) and western blot were employed to detect the expressions of related proteins. Trace RNA sequencing was employed to identify differentially expressed genes in MDSCs from liver micro-M and macro-M of CRC in mice. Here, we firstly constructed the vitro dormant cell models and metastatic dormant animal models of colorectal cancer. Then we found that myeloid-derived suppressor cells (MDSCs) were increased significantly from liver micro-metastases to macro-metastases of CRC in mice. Moreover, monocytic MDSCs (Mo-MDSC) significantly promoted the dormant activation of micro-metastatic cells compared to 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; polymorphonuclear MDSCs (PMN-MDSC).
    [Show full text]
  • The Unexpected Role of Lymphotoxin Β Receptor Signaling
    Oncogene (2010) 29, 5006–5018 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc REVIEW The unexpected role of lymphotoxin b receptor signaling in carcinogenesis: from lymphoid tissue formation to liver and prostate cancer development MJ Wolf1, GM Seleznik1, N Zeller1,3 and M Heikenwalder1,2 1Department of Pathology, Institute of Neuropathology, University Hospital Zurich, Zurich, Switzerland and 2Institute of Virology, Technische Universita¨tMu¨nchen/Helmholtz Zentrum Mu¨nchen, Munich, Germany The cytokines lymphotoxin (LT) a, b and their receptor genesis. Consequently, the inflammatory microenviron- (LTbR) belong to the tumor necrosis factor (TNF) super- ment was added as the seventh hallmark of cancer family, whose founder—TNFa—was initially discovered (Hanahan and Weinberg, 2000; Colotta et al., 2009). due to its tumor necrotizing activity. LTbR signaling This was ultimately the result of more than 100 years of serves pleiotropic functions including the control of research—indeed—the first observation that tumors lymphoid organ development, support of efficient immune often arise at sites of inflammation was initially reported responses against pathogens due to maintenance of intact in the nineteenth century by Virchow (Balkwill and lymphoid structures, induction of tertiary lymphoid organs, Mantovani, 2001). Today, understanding the underlying liver regeneration or control of lipid homeostasis. Signal- mechanisms of why immune cells can be pro- or anti- ing through LTbR comprises the noncanonical/canonical carcinogenic in different types of tumors and which nuclear factor-jB (NF-jB) pathways thus inducing cellular and molecular inflammatory mediators (for chemokine, cytokine or adhesion molecule expression, cell example, macrophages, lymphocytes, chemokines or proliferation and cell survival.
    [Show full text]
  • In Sickness and in Health: the Immunological Roles of the Lymphatic System
    International Journal of Molecular Sciences Review In Sickness and in Health: The Immunological Roles of the Lymphatic System Louise A. Johnson MRC Human Immunology Unit, MRC Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, Headington, Oxford OX3 9DS, UK; [email protected] Abstract: The lymphatic system plays crucial roles in immunity far beyond those of simply providing conduits for leukocytes and antigens in lymph fluid. Endothelial cells within this vasculature are dis- tinct and highly specialized to perform roles based upon their location. Afferent lymphatic capillaries have unique intercellular junctions for efficient uptake of fluid and macromolecules, while expressing chemotactic and adhesion molecules that permit selective trafficking of specific immune cell subsets. Moreover, in response to events within peripheral tissue such as inflammation or infection, soluble factors from lymphatic endothelial cells exert “remote control” to modulate leukocyte migration across high endothelial venules from the blood to lymph nodes draining the tissue. These immune hubs are highly organized and perfectly arrayed to survey antigens from peripheral tissue while optimizing encounters between antigen-presenting cells and cognate lymphocytes. Furthermore, subsets of lymphatic endothelial cells exhibit differences in gene expression relating to specific func- tions and locality within the lymph node, facilitating both innate and acquired immune responses through antigen presentation, lymph node remodeling and regulation of leukocyte entry and exit. This review details the immune cell subsets in afferent and efferent lymph, and explores the mech- anisms by which endothelial cells of the lymphatic system regulate such trafficking, for immune surveillance and tolerance during steady-state conditions, and in response to infection, acute and Citation: Johnson, L.A.
    [Show full text]
  • Microrna-155 Modulates Bile Duct Inflammation by Targeting the Suppressor of Cytokine Signaling 1 in Biliary Atresia
    nature publishing group Basic Science Investigation | Articles MicroRNA-155 modulates bile duct inflammation by targeting the suppressor of cytokine signaling 1 in biliary atresia Rui Zhao1, Rui Dong1, Yifan Yang1, Yuqing Wang1, Jin Ma2, Jiang Wang1, Hao Li1 and Shan Zheng1 BACKGROUND: Biliary atresia (BA) is an etiologically etiology and pathogenesis of BA remains largely unknown. A perplexing disease, manifested by neonatal cholestasis, leading hypothesis for the pathogenesis of BA is a virus repeated cholangitis, and progressive biliary fibrosis. MiR-155 infection-initiated bile duct injury (possibly prenatal), which has been implicated to modulate the immune response, is then followed by an exaggerated inflammatory or which contributes to biliary injury. However, its potential role autoimmune response targeting the bile duct epithelium. in the pathogenesis of BA has not been addressed so far. This ultimately results in progressive bile duct injury, METHODS: The microRNA changes from BA patients and obliteration, and secondary biliary cirrhosis (3,4). controls were identified via microarray. The immunomodula- Gene expression is primarily regulated at a post- tory function of miR-155 was investigated via cell transfection transcriptional level by microRNAs (miRNAs), which exert and reporter assay. The lentiviral vector pL-miR-155 inhibitor their function by targeting complementary mRNA molecules, was transfected into a mouse model to investigate its thus inhibiting their translation by binding to the 3′ role in BA. untranslated region (UTR) (5). Many miRNAs have been RESULTS: The expression of miR-155 in livers of BA patients reported to be differentially expressed in autoimmune diseases was significantly increased, and an inverse correlation and consequently may have a pivotal role in the regulation of between miR-155 and suppressor of cytokine signaling 1 both immune responses and autoimmunity.
    [Show full text]
  • Predictive Biomarkers for the Ranking of Pulmonary Toxicity of Nanomaterials
    nanomaterials Article Predictive Biomarkers for the Ranking of Pulmonary Toxicity of Nanomaterials Chinatsu Nishida 1, Hiroto Izumi 2, Taisuke Tomonaga 2 , Jun-ichi Takeshita 3 , Ke-Yong Wang 4, Kei Yamasaki 1, Kazuhiro Yatera 1 and Yasuo Morimoto 2,* 1 Department of Respiratory Medicine, University of Occupational and Environmental Health, Japan. 1-1 Iseigaoka, Yahata-nishi-ku, Kitakyushu, Fukuoka 807-8555, Japan; [email protected] (C.N.); [email protected] (K.Y.); [email protected] (K.Y.) 2 Department of Occupational Pneumology, Institute of Industrial Ecological Sciences, University of Occupational and Environmental Health, Japan. 1-1 Iseigaoka, Yahata-nishi-ku, Kitakyushu, Fukuoka 807-8555, Japan; [email protected] (H.I.); [email protected] (T.T.) 3 Research Institute of Science for Safety and Sustainability, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Japan. 16-1 Onogawa, Tsukuba, Ibaraki 305-8569, Japan; [email protected] 4 Shared-Use Research Center, University of Occupational and Environmental Health, Japan. 1-1 Iseigaoka, Yahata-nishi-ku, Kitakyushu, Fukuoka 807-8555, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-93-691-7136 Received: 3 September 2020; Accepted: 9 October 2020; Published: 15 October 2020 Abstract: We analyzed the mRNA expression of chemokines in rat lungs following intratracheal instillation of nanomaterials in order to find useful predictive markers of the pulmonary toxicity of nanomaterials. Nickel oxide (NiO) and cerium dioxide (CeO2) as nanomaterials with high pulmonary toxicity, and titanium dioxide (TiO2) and zinc oxide (ZnO) as nanomaterials with low pulmonary toxicity, were administered into rat lungs (0.8 or 4 mg/kg BW).
    [Show full text]
  • DIL — Rm R2328 Lab Hours: Monday – Friday, 8 Am – 5 Pm EST 3333 Burnet Avenue • [email protected] Cincinnati, OH 45229-3039
    DIAGNOSTIC IMMUNOLOGY LABORATORY Ship First Overnight to: CCHMC — Julie Beach Phone: 513-636-4685 • Fax: 513-636-3861 DIL — Rm R2328 Lab Hours: Monday – Friday, 8 am – 5 pm EST 3333 Burnet Avenue www.cincinnatichildrens.org/DIL • [email protected] Cincinnati, OH 45229-3039 DIL — TEST REQUISITION FORM Patient Information MUST BE RECEIVED MONDAY – FRIDAY WITHIN 1 DAY OF COLLECTION UNLESS OTHERWISE INDICATED Patient Name (Last, First) , Date of Birth: / / Medical Record Number: Collection Date: / / Time of Sample: Gender: Male Female Relevant Medications: BMT: Yes — Date: / / No Unknown Diagnosis/reason for testing: TESTS OFFERRED: MAX VOLUME LISTED IS THE PREFERRED WHOLE BLOOD VOLUME 2–3 mL Sodium Heparin Mitogen Stimulation See #1 on page 2 Alemtuzumab Plasma Level See #5 on page 2 1–3ml EDTA or 0.5-1ml CSF, See #3 or ALPS Panel by Flow Need CBC/Diff result 1–3 ml EDTA, See #2 on page 2 Neopterin, Plasma or CSF #4 on page 2 Antigen Stimulation See #1 on page 2 Neutrophil Adhesion Mrkrs: CD18/11b 1–3ml EDTA Apoptosis (Fas, mediated) 10-20ml ACD-A Neutrophil Oxidative Burst (DHR) 1–3ml EDTA Note: Only draw Apoptosis on Wed. for Thurs. delivery NK Function (STRICT 28 HOUR CUT-OFF) See #1 on page 2 B Cell Panel Need CBC/Diff result 1–3ml EDTA, See #2 on page 2 1–3ml EDTA BAFF 1–3ml EDTA, See #4 on page 2 Perforin/Granzyme B 1–3ml EDTA CD40L / ICOS 3–5ml Sodium Heparin pSTAT5 2 (0.3mL) Gold serum aliquots, frozen CD45RA/RO 1–3ml EDTA S100A8/A9 Heterodimer w/in 4 hours of collection CD52 Expression 1–3ml EDTA 2 (0.3mL) Gold serum aliquots, frozen S100A12 w/in 4 hours of collection CD107a Mobilization (NK Cell Degran) See #1 on page 2 Note: Only draw CD107a Mon.
    [Show full text]
  • Responses During Sepsis Interactions Exacerbate Innate Immune CCR1
    The Journal of Immunology CCR1 and CC Chemokine Ligand 5 Interactions Exacerbate Innate Immune Responses during Sepsis1 Traci L. Ness,* Kristin J. Carpenter,* Jillian L. Ewing,* Craig J. Gerard,† Cory M. Hogaboam,2* and Steven L. Kunkel* CCR1 has previously been shown to play important roles in leukocyte trafficking, pathogen clearance, and the type 1/type 2 cytokine balance, although very little is known about its role in the host response during sepsis. In a cecal ligation and puncture model of septic peritonitis, CCR1-deficient (CCR1؊/؊) mice were significantly protected from the lethal effects of sepsis when compared with wild-type (WT) controls. The peritoneal and systemic cytokine profile in CCR1؊/؊ mice was characterized by a robust, but short-lived and regulated antibacterial response. CCR1 expression was not required for leu- -kocyte recruitment, suggesting critical differences extant in the activation of WT and CCR1؊/؊ resident or recruited peri toneal cells during sepsis. Peritoneal macrophages isolated from naive CCR1؊/؊ mice clearly demonstrated enhanced cytokine/chemokine generation and antibacterial responses compared with similarly treated WT macrophages. CCR1 and CCL5 interactions markedly altered the inflammatory response in vivo and in vitro. Administration of CCL5 increased sepsis-induced lethality in WT mice, whereas neutralization of CCL5 improved survival. CCL5 acted in a CCR1-dependent manner to augment production of IFN-␥ and MIP-2 to damaging levels. These data illustrate that the interaction between CCR1 and CCL5 modulates the innate immune response during sepsis, and both represent potential targets for therapeutic intervention. The Journal of Immunology, 2004, 173: 6938–6948. epsis is the most common cause of death in noncoronary mune response to sepsis (7, 8).
    [Show full text]
  • CCL21 Modulates the Migration of NSCL Cancer by Changing the Concentration of Intracellular Ca2+
    ONCOLOGY REPORTS 27: 481-486, 2012 CCL21 modulates the migration of NSCL cancer by changing the concentration of intracellular Ca2+ JUN LIU, LEI ZHANG and CHANGLI WANG Lung Cancer Center, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, P.R. China Received September 23, 2011; Accepted October 31, 2011 DOI: 10.3892/or.2011.1528 Abstract. Recurrence and metastasis are the major factors with more than 1.1 million new cases of NSCLC reported associated with the poor prognosis of non-small cell lung annually and nearly 1.2 million deaths each year (1-3) and the cancer (NSCLC). It has been shown that multiple chemokines incidence continues to increase (4). After clinical diagnosis and their receptors are related to the progression and metastasis of lung cancer, only about 20% patients benefit from curative of NSCLC. The aim of this study was to conduct an investiga- surgical therapies such as lung resection. Furthermore, a tion into whether CCL21 and its receptor, CCR7, play a role in recurrence rate as high as around 65% is seen within five NSCLC invasion and metastasis. We used Western blotting, years and the survival rate is only 30-40% at five years immunocytochemistry and flow cytometry to detect CCR7 post-operatively. NSCLC recurrence and metastasis are the protein expression in four NSCLC cell lines EKVX, HOP-62, main causes of treatment failure and the high fatality rate NCI-H23 and Slu-01; and we conducted a cell migration of this cancer. So the major factors associated with the poor experiment to observe the pseudopodia formation and mobility prognosis of NSCLC are the high frequency of tumor recur- of the lung cancer cells.
    [Show full text]