Research Article Platelet Factor-4 Variant Chemokine CXCL4L1 Inhibits Melanoma and Lung Carcinoma Growth and Metastasis by Preventing Angiogenesis Sofie Struyf,1 Marie D. Burdick,2 Elke Peeters,1 Karolien Van den Broeck,1 Chris Dillen,1 Paul Proost,1 Jo Van Damme,1 and Robert M. Strieter2 1Laboratory of Molecular Immunology, Rega Institute, Leuven, Belgium and 2Department of Medicine, University of Virginia, Charlottesville, Virginia Abstract CXCL8 (3). Subsequently, two functional receptors were identified The platelet factor-4 variant, designated PF-4var/CXCL4L1, is for IL-8/CXCL8 [i.e., CXC chemokine receptor 1 and 2 (CXCR1 and a recently described natural non-allelic gene variant of the CXCR2)]. Furthermore, IL-8/CXCL8 and other neutrophil-attracting CXC chemokine platelet factor-4/CXCL4. PF-4var/CXCL4L1 CXC chemokines binding to CXCR2 were shown to possess was cloned, and the purified recombinant protein strongly angiogenic activity (4–6). In contrast to IL-8/CXCL8, the CXCR3 g inhibited angiogenesis. Recombinant PF-4var/CXCL4L1 was ligands, monokine induced by IFN- (Mig)/CXCL9, IFN-inducible a angiostatically more active (at nanomolar concentration) than protein 10 (IP-10)/CXCL10, and IFN-inducible T-cell chemo- PF-4/CXCL4 in various test systems, including wound-healing attractant (I-TAC)/CXCL11 are angiostatic and predominantly and migration assays for microvascular endothelial cells and attract T lymphocytes and natural killer (NK) cells (7–10). The the rat cornea micropocket assay for angiogenesis. Further- fact that the existence of a functional GPCR for PF-4/CXCL4 has been difficult to elucidate allows us to speculate that its pleiotropic more, PF-4var/CXCL4L1 more efficiently inhibited tumor growth in animal models of melanoma and lung carcinoma biological activities, suchas promotion of neutrophiland monocyte than PF-4/CXCL4 at an equimolar concentration. For B16 cell adhesion to endothelium and inhibition of angiogenesis, are melanoma in nude mice, a significant reduction in tumor size mediated through different cellular mechanisms, including glycos- and the number of small i.t. blood vessels was obtained with aminoglycan in addition to GPCR binding (11–15). Indeed, PF-4/ i.t. applied PF-4var/CXCL4L1. For A549 adenocarcinoma in CXCL4 has significant antitumoral activity by inhibition of GPCR- severe combined immunodeficient mice, i.t. PF-4var/CXCL4L1 mediated endothelial cell chemotaxis, whereas its procoagulant reduced tumor growth and microvasculature more efficiently activity is mediated by heparin binding (16–19). Its role in than PF-4/CXCL4 and prevented metastasis to various organs thrombosis and in megakaryopoiesis was confirmed by generation better than the angiostatic IFN-inducible protein 10/CXCL10. of PF-4/CXCL4 knockout mice (20). However, for several biological Finally, in the syngeneic model of Lewis lung carcinoma, effects ascribed to PF-4/CXCL4 (e.g., in atherosclerosis and PF-4var/CXCL4L1 inhibited tumor growth equally well as hematopoiesis; refs. 21, 22), the precise underlying molecular monokine induced by IFN-; (Mig)/CXCL9, also known to mechanisms are complex and remain partially elusive. In a previous study, we isolated and identified the PF-4 variant attract effector T lymphocytes. Taken together, PF-4var/ CXCL4L1 is a highly potent antitumoral chemokine preventing CXCL4L1 from thrombin-stimulated platelets (23). It was shown development and metastasis of various tumors by inhibition that natural PF-4var/CXCL4L1 is a more potent inhibitor of of angiogenesis. These data confirm the clinical potential of endothelial cell chemotaxis and angiogenesis than the well- characterized PF-4/CXCL4, whereas other biological characteristics locally released chemokines in cancer therapy. [Cancer Res in vitro 2007;67(12):5940–8] of PF-4var/CXCL4L1 remain unknown. Here, we confirm activities withrecombinant PF-4var/CXCL4L1 at nanomolar concentrations and show that this angiostatic chemokine is a Introduction stronger inhibitor of tumor growth and metastasis than PF-4/ Platelet factor-4 (PF-4) has been biochemically characterized as CXCL4 using different tumor models. PF4var/CXCL4L1 was more a platelet product with high affinity for heparin long before the potent than IP-10/CXCL10 in preventing tumor metastasis in term chemokine was introduced to designate small inducible immunocompromised animals, whereas it had equal antitumoral chemotactic cytokines binding to G protein–coupled receptors activity as Mig/CXCL9 in immunocompetent mice. Finally, we (GPCR) and attracting various leukocyte subsets to inflammatory provide evidence that antitumoral effects of PF-4var/CXCL4L1 sites (1, 2). The position of the conserved cysteines has been used observed at low chemokine dose are predominantly mediated by to classify PF4/CXCL4 among the CXC chemokines along with the inhibition of angiogenesis. later discovered granulocyte chemoattractant interleukin-8 (IL-8)/ Materials and Methods Reagents and tumor cell lines. Natural human PF-4/CXCL4 and human Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). PF-4var/CXCL4L1 were purified to homogeneity as described (23). S. Struyf is a senior researchassistant of theFWO-Vlaanderen. Recombinant human basic fibroblast growth factor (bFGF), human IL-8/ Requests for reprints: Jo Van Damme, Laboratory of Molecular Immunology, Rega CXCL8, murine IP-10/CXCL10, and murine Mig/CXCL9 were purchased Institute, K.U. Leuven, Minderbroedersstraat 10, B-3000 Leuven, Belgium. Phone: from R&D Systems. 3216337348; Fax: 3216337340; E-mail: [email protected]. I2007 American Association for Cancer Research. B16 melanoma was orthotopically propagated in C57Bl/6 mice and doi:10.1158/0008-5472.CAN-06-4682 cultured in Eagle’s minimal essential medium withEarle’s salts buffered Cancer Res 2007; 67: (12). June 15, 2007 5940 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2007 American Association for Cancer Research. Novel Antitumoral PF-4/CXCL4 Chemokine Variant withNaHCO 3 and supplemented with10% fetal bovine serum (FBS) and received an inhibition score and ranged from À3 (very broad) to 0. All L-glutamine. The A549 adenocarcinoma and weakly immunogenic Lewis samples were tested in triplicate in each24-well plate and were scored lung carcinoma (LLC) cell lines were obtained from the American Type double blind by three investigators. Digital pictures from representative Culture Collection and cultured as described (24, 25). wells were taken witha Canon G3 camera mounted on a Carl Zeiss Cloning and purification of recombinant PF-4var/CXCL4L1. The Axiovert 40 CFL microscope withan A-plan Â10/0.25 objective (Carl coding region of human PF-4var/CXCL4L1 cDNA was cloned from a human Zeiss). platelet cDNA preparation in two consecutive steps. First, a rather long The Boyden chamber assay for endothelial cells has been described PF-4var/CXCL4L1 cDNA fragment was amplified by primers specifically previously (28). For this assay, human lung microvascular endothelial cells binding PF-4var/CXCL4L1 and not PF-4/CXCL4 (5¶-TATAGAATTCCAG- (HMVEC-L; Cambrex Bio Science) were cultured following the manufac- GGAGTCACTGCCTGCAGAACC-3¶ as forward primer and 5¶-TATACTC- turer’s instructions. GAGGATTGAAAGTGCACACTTAGGCAGC -3¶ as backward primer; Cornea assay. Analysis of the in vivo angiostatic activity of recombinant respective EcoRI and XhoI sites are in italic). The amplicon (445 bp) was PF-4var/CXCL4L1 was done in hooded Long-Evans rat eyes as described cloned into the pBluescript II vector (Stratagene). The reconstructed previously (5, 23). phagemid was verified by both restriction analysis and DNA sequencing. Tumor models. Animal experiments were approved by the local This construct was used as a template to amplify the coding region of the animal ethics committees [University of Leuven and University of mature PF-4var/CXCL4L1 protein (5¶-TATACCATGGCCGAAGCTGAAGAA- California, Los Angeles (UCLA)] and conducted in conformity withthe AGATGGGGACCTG-3¶ as forward primer and 5¶-TATACTCGAGGCTAG- Belgian, European and U.S. guidelines for the protection of animals used GTAGCTAACTCTCCAAATGTTCC-3¶ as backward primer; respective NcoI for scientific purposes. B16 experiments were done with6- to 8-week-old and XhoI sites are in italic). The PCR reaction product was gel-purified, female athymic nu/nu mice (NMRI background) kept in a specific restriction-digested with NcoI and XhoI, and ligated into the corresponding pathogen-free environment (Elevage Janvier). B16 melanoma cells in log sites of the pHEN1 expression vector (26), which contained a LacZ phase (2 Â 106 cells resuspended in 200 AL of PBS) were injected s.c. on promoter and a PelB leader sequence to direct the expression product to day 0 in the right dorsal flank. Animals were injected at the tumor site the bacterial periplasm. Verification of the sequence of pHEN1 PF-4var/ with50 AL of test sample [i.e., endotoxin-free saline (0.9% NaCl, Baxter), CXCL4L1 was done on bothstrands. Theligation mixture was transformed 5 Ag of natural human PF-4/CXCL4, or 1 Ag of recombinant human PF- into Escherichia coli XL1-Blue cells (Stratagene). For recombinant protein 4var/CXCL4L1 in saline]. All animals were observed thrice a week, and production, the transformed cells were grown in SOC medium containing the tumor dimensions were measured with calipers. For immunohisto- ampicillin (100 Ag/mL) and supplemented with0.1% glucose at 37 jC with chemical analysis of
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages10 Page
-
File Size-