bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Glioblastoma stem cells induce quiescence in surrounding neural stem cells via Notch signalling.

Katerina Lawlor1, Maria Angeles Marques-Torrejon2, Gopuraja Dharmalingham3, Yasmine El-Azhar1, Michael D. Schneider1, Steven M. Pollard2§ and Tristan A. Rodríguez1§

1National Heart and Lung Institute, Imperial College London, Hammersmith Hospital Campus, Du Cane Road, London W12 0NN, United Kingdom.

2 MRC Centre for Regenerative Medicine & Edinburgh Cancer Research UK Centre, University of Edinburgh, Edinburgh, UK.

3MRC London Institute of Medical Sciences, Institute of Clinical Sciences, Imperial College London, UK

§Authors for correspondence: [email protected] and [email protected]

Running title: Glioblastoma stem cell competition

Keyword: Neural stem cells, quiescence, glioblastoma, Notch, cell competition

1 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Abstract 2 There is increasing evidence suggesting that adult neural stem cells (NSCs) are a cell of 3 origin of glioblastoma, the most aggressive form of malignant glioma. The earliest stages of 4 hyperplasia are not easy to explore, but likely involve a cross-talk between normal and 5 transformed NSCs. How normal cells respond to this cross-talk and if they expand or are 6 outcompeted is poorly understood. Here we have analysed the interaction of transformed and 7 wild-type NSCs isolated from the adult mouse subventricular zone neural stem cell niche. We 8 find that transformed NSCs are refractory to quiescence-inducing signals. Unexpectedly, 9 however, we also demonstrate that these cells induce a quiescent-like state in surrounding 10 wild-type NSC. We find that this response is cell-cell contact-dependent and that transformed 11 cells activate the Notch pathway in adjacent wild-type NSCs, an event that stimulates their 12 entry into quiescence. Our findings therefore suggest that oncogenic mutations may be 13 propagated in the stem cell niche not just though cell-intrinsic advantages, but also by 14 outcompeting neighbouring stem cells through signalling repression of their proliferation.

15 Introduction 16 In the adult mammalian brain, neural stem cells (NSCs) can be primarily found in specific 17 neurogenic regions. In rodents these are the subgranular zone (SGZ) of the dentate gyrus 18 (DG) and the subventricular zone (SVZ), which lines the lateral ventricles (Doetsch et al., 19 1999; Quinones-Hinojosa et al., 2006; Sanai et al., 2004). In the SVZ there are both 20 quiescent NSCs and activated NSCs that coexist in the niche (Quinones-Hinojosa et al., 21 2006). The quiescent NSC subpopulation make up the majority of NSCs in the adult SVZ and 22 are capable of completely regenerating this niche following anti-mitotic drug treatment 23 (Doetsch et al., 1999; Giachino and Taylor, 2009; Pastrana et al., 2009). Tight regulation of 24 the switch between these two states is vital to ensure that the pool of NSCs does not 25 accumulate DNA damage or become exhausted over time and therefore understanding how 26 this is achieved is of great interest. One key event in NSC activation is the upregulation of 27 EGFR, which is highly expressed in activated NSCs and progenitor cells but absent in 28 quiescent NSCs. Thus, cell surface expression of EGFR is often used as a marker to 29 differentiate these two populations (Codega et al., 2014; Pastrana et al., 2009). What 30 feedback mechanisms exist between activated EGFR+ve NSCs and quiescent NSCs to ensure 31 stem cell homeostasis is poorly understood. 32 Over the last couple of decades, evidence has accumulated to suggest that adult NSCs are a 33 cell of origin in certain brain tumours. One possibility is that these cells accumulate driver 34 mutations over time, which compromise the normal controls on their proliferation and 35 migration. These transformed NSCs could then escape the niche and acquire further 36 mutations resulting in tumour formation. This has been hypothesised to be the case in 37 glioblastoma (GBM), the most aggressive subtype of malignant glioma (Louis et al., 2007; 38 Rispoli et al., 2014). In particular, the discovery of a subpopulation of cells within GBM 39 tumours with stem cell characteristics, known as glioblastoma stem cells (GSCs), has lent 40 weight to this notion. This GSC population in GBM tumours share many common features

2 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

41 with adult NSCs, including expression of stem and progenitor markers, such as CD133, 42 SOX2 and Nestin, self-renewal capacity, and the ability to generate multilineage progeny 43 (Cheng et al., 2013; Denysenko et al., 2010; Singh et al., 2003; Singh et al., 2004; Stieber et 44 al., 2014; Zhang et al., 2006). Most importantly, GSCs are also able to generate tumours in 45 mice which recapitulate all the classical features of GBM, even when injected in very small 46 numbers (Galli et al., 2004; Singh et al., 2004). For this reason, they are sometimes also 47 referred to as brain tumour initiating cells. 48 Adult NSCs can be isolated from the SVZ of murine brains and cultured as 3D neurospheres 49 or adherent cultures under conditions that promote symmetric self-renewal and prevent 50 differentiation (Conti et al., 2005; Pollard et al., 2006; Pollard et al., 2009). Furthermore, by 51 using NSCs engineered with oncogenic drivers, these in vitro culture systems can also be 52 useful to model brain tumour development and cross-comparison with wild-type 53 counterparts. Here we exploit this system to understand how transforming mutations affect 54 the quiescent or activation status of NSCs. We find that transformed NSCs are refractory to 55 quiescent inducing signals. Importantly, we also demonstrate that transformed NSCs signal 56 via Notch and RBPJ to induce a quiescent-like state in surrounding wild-type NSCs. These 57 results therefore provide new insight into how oncogenic mutations affect not only the 58 proliferative potential of transformed cells, but also provide them with a competitive 59 advantage in the niche by suppressing the proliferation of surrounding cells.

60 Results 61 Transformed NSCs are refractory to quiescence-inducing signals. 62 To understand how transforming mutations affect the quiescent or activation status of NSCs 63 we compared NSCs derived from wild-type mice to those isolated from Ink4a/Arf-/- mice and 64 transduced with a retrovirus expressing the EGFRvIII mutation (Bruggeman et al., 2007). 65 This combination of mutations is frequently observed in human GBM (Crespo et al., 2015) 66 and induces transformation in NSCs, as indicated by their ability to generate tumours in vivo 67 that recapitulate many of the features of human GBM tumours (Bruggeman et al., 2007; 68 Marques-Torrejon et al., 2018). We first compared the proliferative potential of both these 69 cell types. We observed that, when grown in conditions that promote the 70 activated/proliferative NSC state (Pollard et al., 2006), transformed NCSs displayed a small 71 growth advantage (Figure 1A). Analysis of the prevalence of BrdU incorporation revealed 72 that this difference was most likely accounted for by a small difference in the rate of cell 73 division at day four of culture, when transformed cells divided faster (Supplementary Figure 74 1A-B). However, overall these results indicate that the pattern of proliferation of wild-type 75 and Ink4a/Arf-/-; EGFRvIII NSCs (IE-NSCs) in growth-promoting conditions was remarkably 76 similar. 77 We next investigated if IE-NSCs have a similar response to quiescence-inducing signals 78 when compared to wild-type NSCs. BMP signalling is known to induce a reversible 79 quiescent-like state in hippocampal and embryonic stem cell-derived NSCs (Martynoga et al.,

3 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

80 2013; Mira et al., 2010) and the BMP antagonist Noggin enhances NSC expansion both in 81 vitro and in vivo (Lim et al., 2000; Mira et al., 2010; Yousef et al., 2015). For this reason, we 82 treated wild-type and transformed NSCs with 50ng/ml BMP4. We observed that, although 83 this induced similar levels of SMAD1/5/8 phosphorylation in both cell types (Supplementary 84 Figure 1C) and efficiently suppressed the proliferation of wild-type cells, it had little effect 85 on the growth of the transformed cells (Supplementary Figure 1D). This suggests that IE- 86 NSCs cells are refractory to the induction of quiescence by BMP signalling activation.

87 Transformed NSCs suppress the proliferation of surrounding NSCs. 88 The experiments described above allowed us to test the proliferative potential of wild-type 89 and transformed cells as isolated cell populations. However, we postulated that in the niche 90 these cell types are likely to co-exist. For this reason, we next studied the proliferation 91 patterns of both cell types in a 50:50 co-culture and compared these proliferative patterns to 92 the growth of the cells in homotypic (separate) cultures. IE-NSCs were GFP-labelled, 93 allowing us to quantify the relative cell proliferation rates in co-culture using flow cytometry. 94 Unexpectedly, we observed that, in contrast to the exponential growth observed for both cell 95 types in separate culture, in co-culture wild-type NSCs showed a significant growth arrest 96 (Figure 1B). Transformed NSCs therefore do not facilitate normal NSC growth as might be 97 anticipated; rather, they deploy some active mechanism to suppress their expansion and 98 outcompete them. 99 Quantification of the fold change in cell number indicated that the wild-type NSCs increased 100 their cell number only around 15-fold over six days in co-culture, compared to more than 50- 101 fold when cultured separately (Figure 1C). This dramatic reduction in the proliferation of 102 wild-type NSCs in the co-culture condition was also confirmed using BrdU incorporation 103 assays and quantifying expression mitotic marker phospho-Histone3 (Figure 1D-E and 104 Supplementary Figure 1C-D). These results suggest that IE-NSCs have an inhibitory effect 105 on the proliferation of wild-type NSCs. To test this possibility further, co-cultures were 106 established with varying proportions of each cell type, ranging from 10 to 90%, and the total 107 number of cells present in co-culture was kept constant. Analysis of the fold change in wild- 108 type NSC number revealed that the reduction in their proliferation was directly proportional 109 to the percentage of transformed NSCs present (Figure 1F), to the extent that, when 75% of 110 the cells in co-culture were transformed, the wild-type NSCs barely increased in number 111 during the 6-day experiment. Together, these results indicate that IE-NSCs suppress the 112 proliferation of wild-type NSCs.

113 Transformed cells induce a quiescent-like state in wild-type NSCs 114 To gain a deeper insight into the mechanism of proliferative arrest of co-cultured wild-type 115 NSCs, we compared their transcriptional profile to wild-type NSCs grown in separate culture. 116 Cells were isolated by FACS after 5 days of co-culture, and RNA-seq was performed. 117 Analysis of the differential gene expression yielded 1441 differentially expressed genes that 118 were then studied by Ingenuity Pathway Analysis, which uses functional annotations and 119 interactions of genes to identify enriched pathways and upstream regulators. It was

4 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

120 immediately apparent that the majority of the top canonical pathways that were enriched in 121 this comparison were related to cell cycle control and DNA repair (Figure 2A). For example, 122 the top enriched pathway was ‘cell cycle control of chromosomal replication’, which includes 123 important cell cycle-associated genes, such as multiple CDKs, MCM proteins and PCNA. 124 The genes in this pathway were broadly downregulated in wild-type NSCs in co-culture 125 compared to separately cultured cells (Figure 2B), consistent with a proliferation arrest when 126 surrounded by transformed cells. 127 One possible explanation for this cell cycle arrest is differentiation into a post-mitotic cell 128 types, such as immature neurons. The expression of NSC markers, together with markers for 129 intermediate progenitors and differentiated cell types (Zhang and Jiao, 2015), was therefore 130 explored in our RNA-seq data-set. No broad downregulation of classical NSC markers, such 131 as Nestin, Gfap and Pax6 was observed in co-cultured wild-type NSCs compared to their 132 separate counterparts. Likewise, markers of intermediate or differentiated cell types, such as 133 Doublecortin, Olig2, S100b or Tubb3, were not upregulated (Supplementary Figure 2A), 134 indicating there was no increase in differentiation, an observation that was consistent with the 135 morphology of these cells that was not that of oligodentrocyte progenitor cells, 136 oligodentrocytes or neurons. Interestingly, we did observe an upregulation in the expression 137 of the glial markers, Gfap, Glt1 and Glast, which are enriched in quiescent radial glia-like 138 NSCs (Codega et al., 2014; Llorens-Bobadilla et al., 2015). These observations suggest that 139 wild-type NSCs are not differentiating, but instead may be driven into a quiescent state. 140 To explore this last possibility we analysed our RNA-seq data-set for the expression of a 141 broader set of quiescent and activated NSC markers. We found that the quiescence-associated 142 transcriptional regulators, Sox9, Id2, Id3 and Klf9, which are upregulated in quiescent SVZ 143 NSCs (Llorens-Bobadilla et al., 2015; Morizur et al., 2018), were all also upregulated in the 144 co-cultured wild-type NSCs (Figure 2C). We also observed that the markers of 145 activated/proliferating NSCs Ascl1, Egr1, Fos and Sox11 (Andersen et al., 2014; Llorens- 146 Bobadilla et al., 2015; Morizur et al., 2018) were downregulated in these cells. When we 147 compared our RNA-seq data-set with a list of transcription factors and co-factors that have 148 been found to be differentially expressed between activated and quiescent SVZ NSCs 149 (Morizur et al., 2018), we found that of the 14 genes enriched in quiescent cells in this study, 150 10 were upregulated in co-cultured wild-type NSCs, and of the 61 genes enriched in activated 151 NSCs, 50 were downregulated (Supplementary Figure 2B). Together these findings therefore 152 support the hypothesis that the co-cultured NSCs are adopting a quiescent phenotype rather 153 than becoming senescent. 154 A key feature of a quiescent phenotype is its reversibility. To test if the proliferation arrest of 155 wild-type NSCs in co-culture is reversible, we sorted wild-type and transformed cells after 5 156 days in co-culture and re-plated them. In parallel, wild-type NSCs that had been cultured 157 separately were mixed with transformed cells just before sorting and then re-plated. 158 Importantly, we observed that previously co-cultured wild-type NSCs displayed a similar 159 proliferation rate to NSCs that had been separately cultured throughout, as judged by their 160 growth curves and rate of BrdU incorporation (Figure 2E-F). The reversible nature of the

5 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

161 proliferation arrest of co-cultured wild-type NSCs provides further evidence that they are 162 entering a quiescent state.

163 Cell contact is required for the inhibitory effect of transformed cells 164 To understand the mechanisms underlying the interaction between wild-type and transformed 165 NSCs, we first analysed the possible involvement of the mTOR signalling pathway. mTOR is 166 a metabolic regulator that senses growth factor and nutrient inputs, is activated in transit 167 amplifying progenitor cells and its inhibition induces a reversible quiescence-like phenotype 168 in adult NSCs (Paliouras et al., 2012). Analysis of the expression of ribosomal protein S6 169 phosphorylation (p-S6), a read-out of mTOR activity indicated that mTOR signalling levels 170 were reduced in the co-cultured wild-type NSCs, not only relative to these same cells in 171 separate culture, but also to transformed NSCs in co-culture (Figure 3A). We next tested if 172 constitutive mTOR activation was sufficient to prevent these wild-type NSCs from entering 173 quiescence in co-culture. For this we mutated Tsc2, an mTOR repressor in wild-type NSCs, 174 using CRISPR-Cas9 targeting (Supplementary Figure 2C). However, we found that, although 175 this was sufficient to sustain strong mTOR pathway activation, Tsc2-/- NSCs still entered a 176 proliferation arrest when co-cultured with transformed NSCs (Supplementary Figure 2D-F). 177 This indicates that mTOR inhibition is not the primary reason for the quiescent phenotype of 178 co-cultured wild-type NSCs. 179 Next, we investigated an alternative possibility that cell contact is required to induce the 180 growth arrest of wild-type NSCs. We first used a transwell assay, where the two cell types 181 are cultured in the same well, separated by a permeable membrane that allows the exchange 182 of factors in the media while physically separating the cells. When wild-type cells were co- 183 cultured with transformed cells separated by a transwell, they grew similarly to wild-type 184 cells in homotypic cultures (Figure 3B). This suggests a requirement for cell-cell contact and 185 that secreted paracrine factors are not sufficient to induce the quiescence. We further tested 186 this possibility by using fences, which are metal inserts that divide the well into an inner and 187 outer ring One cell type is plated in the inner ring and the second in the outer ring (Figure 3C) 188 and once they are growing adherently, the inserts can be removed leaving behind a small gap 189 between the two populations. Using this system we compared the proliferation rate of wild- 190 type NSCs that were separated from transformed NSCs to their proliferation when separated 191 from other wild-type NSCs or when mixed with transformed cells. We found that the rate of 192 BrdU incorporation of the wild-type NSCs only decreased when these cells were in physical 193 contact with transformed cells (Figure 3C). This indicates that cell-cell contact is most likely 194 required for transformed cells to inhibit the proliferation of wild-type NSCs.

195 Transformed cells signal via Notch and Rbpj to induce quiescence in wild-type NCSs 196 The Notch pathway is a highly conserved signalling pathway requiring cell-cell contact that 197 plays a central role in the regulation of embryonic and adult neurogenesis (Ables et al., 2011; 198 Urban and Guillemot, 2014). To test the potential role for Notch signalling we first explored 199 the expression of Notch signalling pathway components in our RNA-seq data. Interestingly, 200 genes related to the Notch signalling pathway were enriched in the comparison between co-

6 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

201 cultured wild-type and transformed NSCs (p-value = 5.94E-6, 21/38 genes differentially 202 expressed with adjusted p-value <0.1). Overall, the majority of Notch-related genes were 203 upregulated in wild-type NSCs compared to transformed NSCs, including Notch targets and 204 receptors, while there was some evidence that Notch ligands were more highly expressed on 205 transformed NSCs in co-culture (Figure 3D). Analysis by real-time qPCR of sorted samples 206 also revealed that the expression of the Notch target genes Hes1, Hes5, Hes7, Hey1, Hey2 207 and Nrarp are upregulated in co-cultured wild-type NSCs (Figure 3E). This suggests that 208 Notch pathway activity is higher in co-cultured wild-type NSCs than in transformed cells and 209 raises the possibility that transformed cells may be signalling to wild-type NSCs via this 210 pathway. 211 To test the functional significance of this difference in Notch activation, two complementary 212 γ-secretase inhibitors were used to block Notch signalling. We observed that both LY411575 213 (LY) and crenigacestat not only reduced Notch target gene expression in NSCs, but also 214 partially rescued the proliferation arrest of wild-type NSCs in co-culture with transformed 215 cells. Evidence for this is that the growth curves and BrdU incorporation rates of co-cultured 216 NSCs treated with the γ-secretase inhibitors were only slightly lower than their growth is 217 separate culture (Figure 3G-H and Supplementary Figure 3A-E). This suggests that Notch 218 signalling is required for the induction of quiescence in wild-type NSCs by transformed cells. 219 To further test the requirement of Notch signalling in wild-type NSCs we mutated Rbpj, a 220 key effector of this pathway, as well as Notch1 and Notch2 by CRISPR/Cas9 targeting 221 (Figure 4A, D and G). Importantly, we found that Rbpj-/-, Notch1-/- or Notch2-/- NSCs were 222 not susceptible to proliferation arrest when co-cultured with IE-NSCs. For example, we 223 observed that all three Notch pathway mutant cell lines displayed similar growth rates in 224 separate and co-culture (Supplementary Figure 4A-D). Similarly, the fold change in cell 225 number and BrdU incorporation rates of co-cultured Rbpj-/-, Notch1-/- and Notch2-/- NSCs was 226 similar to separate culture and significantly higher than that of wild-type NSCs co-cultured 227 with IE-NSCs (Figure 4B-C, E-F and H-I). Interestingly, both the growth curves and final 228 cell counts of Rbpj-/- NSCs indicated that these cell types even out-grew IE-NSCs in co- 229 culture (Figure 4B and Supplementary Figure 4B), suggesting that disrupting Notch 230 signalling may be sufficient to provide NSCs with a competitive advantage against 231 transformed NSCs. Together, these data indicate that Notch signalling is required for the 232 suppression of proliferation of wild-type NSCs by transformed cells. 233 Finally, to exclude the possibility that Notch signalling is required in transformed NSCs, we 234 mutated Rbpj in this cell type (Supplementary Figure 4E). We observed that IE-NSCs still 235 induced the proliferation arrest of wild-type NSCs, as shown by the growth curves, final cell 236 numbers and rate of BrdU incorporation (Supplementary Figure 4F-H). Therefore Notch 237 signalling is not required in transformed cells for their growth inhibition of wild-type NSCs.

238 Discussion 239 In conclusion, our data indicate that transformed cells activate Notch signalling in adjacent 240 wild-type NSCs to induce in these a quiescent state. Importantly, the role of Notch signalling

7 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

241 in regulating the activated versus quiescent state of NSCs is borne out by the work of others. 242 Increased expression of Notch signalling pathway components in quiescent NSCs compared 243 to activated NSCs has been widely reported in RNA-sequencing studies (Andersen et al., 244 2014; Llorens-Bobadilla et al., 2015; Morizur et al., 2018). Additionally, NOTCH receptor 245 and RBPJ expression have been previously confirmed in both quiescent and activated NSC 246 populations in the SVZ, and NOTCH2 has been shown to mediate signals promoting NSC 247 quiescence within the niche (Engler et al., 2018). The Notch ligand Dll1 has also been 248 reported to be expressed exclusively in activated NSCs and transit-amplifying cells 249 (Kawaguchi et al., 2013) and its deletion resulted in excessive production of activated NSCs 250 and a depletion of the quiescent NSC pool. Similar observations have also been made in 251 zebrafish, where activated radial glial cells were shown to revert to a quiescent state by Notch 252 pathway activation (Chapouton et al., 2010). Therefore our results imply that transformed 253 cells highjack an evolutionarily conserved pathway regulating vertebrate NSC quiescence 254 and use it to gain a competitive advantage over other NSCs in the niche. 255 Our work also has implications for glioblastoma tumour progression. The SVZ has been 256 shown to be a permissive region for glioblastoma growth, as tumours in contact with this 257 region are associated with decreased patient survival and increased recurrence (Khalifa et al., 258 2017; Mistry et al., 2017). This niche has also been suggested to serve as a reservoir for 259 malignant cells away from the tumour mass and may therefore support tumour recurrence 260 (Piccirillo et al., 2015). In humans it has been shown that glioblastoma can arise from SVZ 261 cells with low-level driver mutations (Lee et al., 2018), further highlighting the importance of 262 the SVZ for oncogenic cell propagation. We therefore speculate that the mechanisms we 263 describe operate during early premalignant disease to support tumorigenesis. Here, 264 transformed NSCs provide negative feedback signals to surrounding normal NSCs limiting 265 their self-renewal and enforcing their quiescence. By this mechanism, oncogenic NSCs can 266 ensure their preferential self-renewal and differentiation, therefore increasing both their cell 267 number and their likelihood of giving rise to progenitor cells and exiting the niche. This 268 competitive advantage may be an important early step in the development of glioma and 269 glioblastoma and therefore understanding it may help develop therapeutic approaches.

270 Materials and Methods 271 Neural Stem Cell Cultures 272 Adult murine NSCs were derived from the SVZ by the protocol described in [5]. 273 Transformed Ink4a/Arf-/-; EGFRvIII NSCs (IE-NSCs) were generated by the Maarten van 274 Lohuizen laboratory (Netherlands Cancer Institute). NSCs were isolated from Ink4a/Arf-/- 275 mice and transduced with EGFRvIII pMSCV retrovirus (Bruggeman et al., 2007). All cells 276 were cultured at 37°C in an atmosphere with 5% CO2. NSCs were maintained in serum-free 277 adherent growth conditions on poly-L-lysine-coated plates (Sigma). 1µg/ml Laminin (Sigma) 278 was also added to the growth media to promote adherent growth. Growth medium was 279 Dulbecco’s Modified Eagle Medium: Nutrient Mixture F12 (DMEM/F12) (Gibco)

8 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

280 supplemented with N2 (1:200, Invitrogen), B27 (1:100, Invitrogen), 1x non-essential amino 281 acids (Invitrogen), 0.1% BSA (Gibco), 100µM β-mercaptoethanol (Invitrogen), 1.5mg/ml 282 glucose (Sigma), 15mM HEPES (Gibco), 2mM L-glutamine (Gibco), 100U/ml penicillin- 283 streptomycin (Gibco), 20ng/ml EGF and 10ng/ml bFGF (both Peprotech).

284 Co-culture assays 285 For six-day co-culture assays, 40,000 cells per well were seeded in a 24-well plate either 286 separately or as a 50:50 mix of WT and transformed NSCs. Standard growth media was used 287 throughout and was changed on days three, four and five. The proportion of each cell type 288 was assessed by determining the percentage of GFP-positive cells by flow cytometry. Cells 289 were harvested with accutase and resuspended in PBS containing 3% FCS. All samples were 290 transferred into strainer-cap flow cytometer tubes for analysis and 100ng/ml propidium 291 iodide (PI) was added. Flow cytometry was performed on an LSR-II Analyser (BD 292 Biosciences) with FACS Diva software (BD Biosciences). Gates were applied to exclude 293 cellular debris, cell doublets and non-viable PI-positive cells. The percentage of GFP-positive 294 and GFP-negative cells was determined with gates set using separate cell preparations. 295 Separate cultures were also mixed and analysed by flow cytometry. Viable cell counts at each 296 time point were performed using a Vi-Cell XR counter (Beckman Coulter) and calculated for 297 each cell type in separate and co-culture by applying the percentages from the flow cytometry 298 analysis. 299 For transwell assays, cell culture inserts with 0.4µm pores (Merck Millipore) were placed in a 300 6-well plate and coated with PLL. 140,000 NSCs were seeded in NSC growth media either 301 onto the insert or below in the well. The growth of WT NSCs seeded below either WT or 302 transformed NSCs or a 50:50 mix was evaluated over six days. For fence assays, 24-well 303 plates were coated with PLL and fences (Aix-Scientifics) were placed in each well. 100,000 304 NSCs were seeded in the inner ring and 400,000 in the outer ring. The fences were removed 305 24 hours later and the media was replaced. The following day, 10µM BrdU was added to the 306 wells for two hours. The fences were then replaced into the well and the cells in the inner ring 307 were detached with accutase and harvested. The cells were then fixed in 2% formaldehyde 308 and analysed for BrdU expression by flow cytometry as described below.

309 Flow cytometry immunolabelling 310 Cells were fixed in 2% formaldehyde and permeabilised in ice-cold 90% methanol. Cells 311 were incubated with the primary antibody (anti-p-rpS6, CST 5364, 1:200, anti-BrdU, CST 312 5292, 1:200) for one hour in PBS with 1% BSA. AlexaFluor 546 secondary antibodies 313 (Molecular Probes) were used for detection) diluted 1:2000 in PBS containing 1% BSA. 314 Secondary incubation was for 30 minutes. Cell debris and doublets were excluded and 315 controls with the primary antibody omitted were used to gate positive and negative cells. 316 Flow cytometry was performed on an LSR-II Analyser (BD Biosciences) with FACS Diva 317 software (BD Biosciences) and data were analysed using FlowJo software. 318 For BrdU analysis NSCs were incubated for two hours with 10µM BrdU prior to fixation. 319 Before blocking, NSCs were then incubated for 45 minutes at 37°C in DNase I solution

9 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

320 consisting of 20µl DNase I (Promega RQ1) in 250µl DNase buffer solution. The 321 immunolabelling protocol was then followed as detailed above.

322 FACS 323 180,000 cells per well were seeded in a 6 well plate either separately or as a 50:50 mix of WT 324 and transformed NSCs and cultured under the standard assay conditions until day five. GFP- 325 negative WT NSCs were sorted using a FACS Aria cell sorter (BD Biosciences) from both 326 separate and mix samples. Gates were applied to exclude cell debris and doublets. Cells were 327 recovered into growth media at room temperature. Cells were then either lysed for 328 RNA/protein extraction or, for replating experiments, counted and replated into a 24-well 329 plate at 100,000 cells per well.

330 Western blot analysis 331 Cells were lysed directly in Laemmli buffer (50mM Tris-HCl (pH 6.8), 2% SDS, 10%

332 glycerol in ddH2O) and heated at 95°C for 10 minutes. Protein quantification was carried out 333 using a BCA Protein Assay kit (Pierce) according to the manufacturer’s instructions. 15-20μg 334 denatured protein from each sample was run in XT sample buffer (BioRad) with 0.25% β- 335 mercaptoethanol on 10% or 12% SDS-PAGE Bis-Tris gels (pre-cast BioRad). Proteins were 336 then blotted onto PVDF membranes (Thermo Fisher Scientific) using vertical wet transfer at 337 100V for one hour at 4°C. Blocking was performed in 5% milk in TBST buffer and primary 338 antibody incubation was done overnight at 4oC in TBST containing 5% BSA. The following 339 antibodies were used at the stated concentration: anti-α-tubulin (CST 3873, 1:1000), anti-β- 340 actin (CST 5970, 1:1000), anti-RBPJ (CST 5313, 1:1000), anti-Notch1 (CST 3608, 1:1000), 341 anti-Notch2 (CST 5732, 1:1000), anti-p-SMAD1/5/8 (CST 9511, 1:000), anti-TSC2 (CST 342 4308, 1:1000). Horseradish peroxidase-conjugated secondary antibodies (Abcam) diluted 343 1:5000 in 5% milk in TBST were used for detection by the addition of an enhanced 344 chemiluminescence (ECL) substrate (Promega). Western blot quantification was performed 345 using Fiji software (Schindelin et al., 2012).

346 RNA Extraction and Quantitative RT-PCR 347 RNA was extracted with the RNeasy mini kit (Qiagen) and SuperScript III reverse 348 transcriptase (Thermo Fisher Scientific) was used for cDNA synthesis according to 349 manufacturer’s instructions. RT-qPCR was performed using SYBR-Green Mastermix with 350 ROX reference dye (Sigma). A list of all primer sequences used can be found in Table 1 351 below. RT-qPCR was performed on an ABI 7900HT Fast Real Time PCR machine (Applied 352 Biosystems) and analysed on SDS Biosystem software. Relative gene expression was 353 calculated using the ΔΔCt method normalised to β-actin expression (Livak and Schmittgen, 354 2001).

355 RNA-sequencing analysis 356 Sorting was performed by FACS at day five of the six-day assay as described above for three 357 biological repeats. PI was added to exclude non-viable cells. Cells were recovered into 358 growth media and then resuspended in RLT lysis buffer (Qiagen). RNA extraction was

10 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

359 performed using the Qiagen RNeasy kit according to the manufacturer’s instructions. RNA 360 samples were quantified using a Qubit fluorometer (Thermo Fisher Scientific) and the quality 361 assessed by TapeStation electrophoresis (Agilent). mRNA was isolated using oligo dT beads. 362 mRNA was then fragmented, converted to cDNA and ligated to Illumina adapters. Following 363 sample indexing, the quality of cDNA libraries was also assessed by TapeStation. 364 Sequencing was performed using the HiSeq 4000 system (Illumina). Sequencing reads were 365 aligned to the mouse genome (mm9) using TopHat2 (Kim et al., 2013) and differential 366 expression was analysed using the DESeq2 package (Love et al., 2014). The resulting gene 367 sets were analysed using Ingenuity Pathway Analysis (IPA) software (Qiagen) (Kramer et al., 368 2014). This utilises the Ingenuity Knowledge Base for functional annotations and interactions 369 of genes. A ‘Core Analysis’ was performed for each comparison on genes differentially 370 expressed with a padj cut-off <0.1, corresponding to a false discovery rate (FDR) of 10%. 371 This identified enriched Canonical Pathways and Upstream Regulators in each comparison.

372 Generation of Rbpj-/-, Notch1-/-, Notch2-/- and Tsc2-/- NSCs 373 gRNAs for targeting of Rbpj, Notch1 and Notch2 were cloned into the pX330-U6- 374 Chimeric_BB-CBh-hSpCas9 (PX330) expression plasmid (gift from Feng Zhang, Addgene 375 plasmid #42230) using the protocol provided by the Zhang laboratory (Ran et al., 2013). 376 gRNAs for targeting Tsc2 were cloned into gRNA expression plasmids (gift from George 377 Church, Addgene plasmid #41824) (Mali et al., 2013). These were then co-transfected with 378 an hCas9 plasmid (gift from George Church, Addgene plasmid #41815). gRNA sequences 379 can be found in Supplementary Table 2. NSCs were transfected with plasmids by 380 nucleofection (AMAXA 2B, Lonza) using programme A-033. NSCs were harvested with 381 Accutase and 2-3x106 cells were resuspended in 100µl mouse neural stem cell nucleofector 382 buffer (Lonza) with 2µg plasmid DNA. NSCs were either transfected with 2ug PX330 vector 383 containing gRNAs targeted to Rbpj, Notch1 or Notch2 or 0.6µg each of hCas9 and the two 384 gRNA expression plasmids containing the Tsc2-targeting gRNAs. NSCs were also co- 385 transfected with 0.125ug of Puro-pPyCAGIP vector or linear hygromycin marker (Clontech 386 631625) for selection. Empty vector or Cas9 only controls were also performed. Cells were 387 recovered post-transfection with pre-warmed NSC growth media into a 10cm2 dish. Selection 388 with 0.25ug/ml puromycin or 250ug/ml hygromycin was performed from 48 hours post- 389 transfection until the emergence of resistant colonies. These were then picked manually with 390 a p20 pipette and transferred to a 48 well plate for expansion and analysis.

391 Quantification and Statistical Analysis 392 Statistical analysis and data representation were performed using GraphPad Prism software. 393 Statistical methods used are indicated in the relevant figure legends. No randomisation or 394 blinding was used in experiments. Sample sizes were selected based on the observed effects 395 and listed in the figure legends. The sample size (n) is described in the figure legends and 396 refers to the number of independent replicate experiments performed. Adjusted p values are 397 displayed as * p<0.05, ** p<0.01 and *** p<0.001.

11 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

398 Data and Code availability 399 The raw data for the RNA-sequencing of wild-type and transformed NSCs are being 400 deposited in the arrayexpress database and an accession code that will be made available 401 prior to acceptance. The authors declare that all data supporting the findings of this study are 402 available within the article and its supplementary information files or from the corresponding 403 author upon reasonable request.

404 Key Resources Table REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies BrdU Cell Signalling Cat#5292, RRID:AB_10548898 Technologies NOTCH1 Cell Signalling Cat#3608, RRID:AB_2153354 Technologies NOTCH2 Cell Signalling Cat#5732, RRID:AB_10693319 Technologies p-H3 Merck Millipore Cat#07-145, RRID:AB_11214453 p-rpS6 Cell Signalling Cat#5364, RRID:AB_10694233 Technologies P-SMAD1/5/9 Cell Signalling Cat#9511, RRID:AB_331671 Technologies RBPJ Cell Signalling Cat#5313, RRID:AB_2665555 Technologies TSC2 Cell Signalling Cat#4308, RRID:AB_10547134 Technologies β-Actin Cell Signalling Cat#4970, RRID:AB_2223169 Technologies Goat anti-rabbit 546 Thermo Fisher Scientific Cat#A-11010, RRID:AB_2534077 Goat anti-mouse 546 Thermo Fisher Scientific Cat#A-11003, RRID:AB_2534071 Goat anti-rabbit HRP Santa Cruz Biotechnology Cat#sc-2357, RRID:AB_628497 Goat anti-mouse HRP Santa Cruz Biotechnology Cat#sc-516102, RRID:AB_2687626 Chemicals, Peptides, and Recombinant Proteins LY411575 Selleckchem Cat#S2714 Crenigacestat Selleckchem Cat#S7169 EGF Peprotech Cat#315-09 FGF Peprotech Cat#100-18b Laminin Sigma Cat#L2020 Poly-L-Lysine Sigma Cat#P1274 Critical Commercial Assays RNeasy Mini Kit Qiagen Cat #74104 BCA Protein Assay Kit Pierce Cat #23225 Mouse neural stem cell Lonza Cat #VPG-1004 nucleofector kit

12 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Deposited Data RNA seq data of NSCs in This paper GEO: separate or co-culture Experimental Models: Cell Lines Wild-type NSCs Pollard Lab, ‘ANS7’ Ink4a/Arf-/-, EGFRvIII NSCs Lohuizen Lab, ‘IENS’ [8] Oligonucleotides qRT-PCR primers This paper Supplementary Table 1 gRNA oligonucleotides This paper Supplementary Table 2 Recombinant DNA pX330-U6-Chimeric_BB-CBh- Feng Zhang via Addgene Addgene #42230 [35] hSpCas9 gRNA cloning plasmid George Church via Addgene #41824 [37] Addgene hCas9 expression plasmid George Church via Addgene #41815 [37] Addgene Linear hygromycin marker Clontech Cat #631625 Puro-pPyCAGIP Rodriguez laboratory pPyCAGIP Software and Algorithms GraphPad Prism GraphPad www.graphpad.com/ scientificsoftware/prism FIJI (ImageJ) [38] Imagej.net/fiji R https://www.r-project.org/ TopHat2 [32] https://ccb.jhu.edu/software/topha t/index.shtml DESeq2 [33] https://bioconductor.org/packages /release/bioc/html/DESeq2.html Ingenuity Pathway Analysis Qiagen, [34] https://www.qiagenbioinformatic s.com/products/ingenuity- pathway-analysis/ 405 406 Acknowledgments 407 We would like to thank Stephen Rothery for guidance and advice with confocal microscopy. 408 Gratitude also goes to James Elliot for performing cell sorts. Research in Tristan Rodriguez 409 lab was supported by the MRC project grant (MR/N009371/1), by the Rosetrees Trust grant 410 (M693) and by the British Heart Foundation centre for research excellence. Katerina Lawlor 411 was supported by an NHLI PhD studentship.

412 Conflicts of interests 413 The authors declare no competing financial or non-financial interests. 414

13 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

415 Figure Legends 416 Figure 1. WT NSCs show reduced proliferation in the presence of transformed NSCs. 417 A Growth curves of WT and transformed IE NSCs cultured separately over six days. B 418 Growth curves of wild-type and transformed NSCs in a 50:50 co-culture. C Quantification of 419 fold change in cell number relative to seeding density for each culture condition. WT NSCs 420 dramatically reduce their proliferation while transformed cells increase their proliferation 421 relative to separate culture. N>10, ANOVA followed by Sidak’s multiple comparisons test. D 422 Proportion of BrdU-positive cells in each culture condition at day five following a two-hour 423 BrdU chase. WT NSCs show greatly reduced BrdU incorporation in co-culture. N=10, 424 ANOVA followed by Sidak’s multiple comparisons test. E Representative western blot for 425 phospho-histone-3 (p-H3) in WT NSCs sorted at day five and quantification of p-H3 density 426 relative to β-actin. p-H3 expression is markedly reduced in co-cultured WT NSCs. N=3, 427 Student’s paired T test. F Fold change cell number of WT NSCs cultured in co-cultures with 428 varying proportions of transformed NSCs. WT NSCs show smaller increases in cell number 429 in co-cultures with a greater proportion of transformed NSCs. N=3.

430 Figure 2. Wild-type NSCs adopt a quiescent phenotype in the presence of transformed 431 NSCs 432 A RNA sequencing was performed on NSCs sorted by FACS following five days’ culture in 433 either homogenous or co-culture conditions. Differential gene expression analysis was 434 performed on these samples from three independent experiments. The top canonical 435 pathways enriched in the comparison of WT NSCs in separate or mixed culture. Pathways 436 related to cell cycle and DNA repair are highly enriched. B Heat map showing the fold 437 change values for all genes in the ‘Cell Cycle Control of Chromosomal Replication’ pathway 438 for this comparison with an adjusted p-value <0.1. C Heat map showing the change in gene 439 expression of certain transcription factors (TFs) between the WT NSCs cultured separately or 440 in co-culture. These transcription factors have been particularly highlighted by transcriptional 441 profiling studies that sought to compare quiescent and activated NSCs. Quiescence- 442 associated genes were broadly upregulated in the co-cultured NSCs, while activation- 443 associated genes were broadly downregulated. E Growth curves showing cell numbers for 444 three days following replating. F Proportion of BrdU-positive cells at day three after re- 445 plating. No difference could be found in the growth of WT NSCs which had previously been 446 co-cultured compared to cells grown separately. N=3. E and F WT NSCs were cultured for 5 447 days either in co-culture or separately and then sorted by FACS and replated at 100,000 448 cells/well.

449 Figure 3. Quiescence of WT NSCs is induced by direct contact with transformed NSCs 450 and is associated with increased Notch activation 451 A Flow cytometry plot showing p-rpS6 staining in WT and transformed NSCs in separate 452 and mixed culture and quantification of median fluorescence intensity. WT NSCs show 453 reduced expression specifically in the co-culture condition. N=6, ANOVA followed by 454 Sidak’s multiple comparisons test. B Growth curves of WT NSCs cultured below transwell

14 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

455 inserts with WT, transformed or mixed cultures. No difference was observed between 456 conditions. N=3. C Percentage of BrdU-positive WT NSCs from the inner ring of the three 457 different cultures shown. When cells were mixed in each well WT NSCs showed a decrease 458 in the proportion of proliferating cells (Mix/Mix). However, WT NSCs surrounded by a ring 459 of transformed NSCs (Trans/WT) did not show a reduction in proliferation relative to WT 460 NSCs surrounded by WT NSCs (WT/WT). N=3, one-way ANOVA followed by Tukey’s 461 multiple comparisons test. Direct cell contact is therefore required for reduced WT NSC 462 proliferation D Heat map showing changes in gene expression in co-cultured transformed and 463 WT NSCs. Notch target genes and receptors are upregulated in WT NSCs, while Notch 464 ligands show a more mixed expression with several downregulated relative to transformed 465 NSCs. E RT-qPCR validation of Notch target gene expression in WT NSCs relative to 466 transformed NSCs sorted from the co-culture. N=3, two-way ANOVA followed by Sidak’s 467 multiple comparisons test. F Fold change cell number quantification of NSC growth with and 468 without addition of LY411575 at 2µM. N=8, two-way ANOVA with Sidak’s multiple 469 comparisons test. G Proportion of BrdU positive cells following a 24 hour incubation with 470 LY411575. N=4, two-way ANOVA with Sidak’s multiple comparisons test. WT NSCs in co- 471 culture show increased proliferation in the presence of the γ-secretase inhibitor, LY411575.

472 Figure 4. Disruption of Notch signalling rescues WT NSC proliferation in co-culture. 473 A Western blot showing absence of RBPJ protein in both Rbpj-/- clones. B Fold change cell 474 number quantification of EV and Rbpj-/- NSCs in separate and co-culture with transformed 475 NSCs. EV control NSCs show decreased growth in co-culture but this is not the case for the 476 Rbpj-/- NSCs. N=4, two-way ANOVA followed by Sidak’s multiple comparisons test. C 477 Proportion of BrdU-positive cells in separate and co-culture showing decrease in EV control 478 but not in Rbpj-/- NSCs. N=5, two-way ANOVA followed by Sidak’s multiple comparisons 479 test. D Western blot showing absence of NOTCH1 protein in both Notch1-/- clones. E Fold 480 change cell number quantification of EV and Rbpj-/- NSCs in separate and co-culture with 481 transformed NSCs. EV control NSCs show decreased growth in co-culture but this is not the 482 case for the Notch1-/- NSCs. N=4, two-way ANOVA followed by Sidak’s multiple 483 comparisons test. F Proportion of BrdU-positive cells in separate and co-culture showing 484 decrease in EV control but not in Notch1-/- NSCs. N=5, two-way ANOVA followed by 485 Sidak’s multiple comparisons test. G Western blot showing absence of NOTCH2 protein in 486 both Notch2-/- clones. H Fold change cell number quantification of EV and Notch2-/- NSCs in 487 separate and co-culture with transformed NSCs. EV control NSCs show decreased growth in 488 co-culture but this is not the case for the Notch2-/- NSCs. N=4, two-way ANOVA followed 489 by Sidak’s multiple comparisons test. I Proportion of BrdU-positive cells in separate and co- 490 culture showing decrease in EV control but not in Notch2-/- NSCs. N=5, two-way ANOVA 491 followed by Sidak’s multiple comparisons test.

492 Supplemental Figure 1 493 A Representative flow cytometry plot of BrdU staining in separately cultured NSCs at day 494 five. B Time-course of BrdU staining throughout the assay in separate culture. N=5, ANOVA

15 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

495 followed by SIdak’s multiple comparisons test. C Fold change cell number quantification of 496 NSCs cultured in the presence or absence of 50ng/ml BMP4. BMP4 treatment reduces the 497 growth of WT, but not transformed, NSCs. N=4, two-way ANOVA followed by Sidak’s 498 multiple comparisons test. D Western blot showing increased p-SMAD1/5/8 expression in 499 NSCs treated with 50ng/ml BMP4 for 24 hours relative to control NSCs (Con). E 500 Representative flow cytometry plot of BrdU staining in co-cultured NSCs at day five. F 501 Time-course of BrdU staining throughout the assay in co-culture showing reduction in BrdU 502 incorporation in WT NSCs. N=5, ANOVA followed by Sidak’s multiple comparisons test.

503 Supplemental Figure 2 504 A Heat map showing changes in gene expression in the ‘WT Mix vs WT Sep’ comparison. 505 Classical marker genes for different cell populations are shown including those used

506 commonly to identify adult NSCs. GFAP log2 fold change is off the scale at 5.4. B 507 Comparison to published transcriptional analysis of quiescent and activated NSCs. Left - 508 Transcription factors and co-factors differentially expressed in quiescent and activated NSCs 509 from [18]. Right – Heat map showing the expression of the genes identified by Morizur et al 510 in the comparison of WT NSCs in separate (WT Sep) or co-culture (WT Mix). Genes 511 enriched in quiescent NSCs were broadly upregulated in co-cultured WT NSCs, while those 512 enriched in activated NSCs were broadly downregulated. C Western blot showing absence of 513 TSC2 expression in Tsc2-/- clones. The control Cas9 clone was transfected with Cas9 only 514 without the gRNAs. D Growth curves of transformed NSCs and Tsc2-/- or Cas9 control NSCs 515 in separate or co-culture. Tsc2-/- clones grow more slowly than control and still show reduced 516 growth in co-culture. N=4. E Fold change cell number quantification of growth curves. N=4, 517 two-way ANOVA followed by Sidak’s multiple comparisons test. F Expression of p-rpS6 in 518 Cas9 and Tsc2-/- clones as determined by flow cytometry. mTOR activation is increased in 519 Tsc2-/- NSCs and remains high in co-culture despite reduced growth. N=3.

520 Supplemental Figure 3 521 A RT-qPCR analysis of the Notch target genes, Hes1, Hes5 and Nrarp in WT NSCs treated

522 with 2µM LY411575. Log2 fold change relative to control NSCs. N=3. B Growth curves of 523 WT and transformed NSCs cultured in the standard assay with or without LY411575 addition 524 from day three. C RT-qPCR analysis of the Notch target genes, Hes1, Hes5 and Nrarp in WT

525 NSCs treated with 1µM crenigacestat. Log2 fold change relative to control NSCs. N=3. D 526 Growth curves of WT and transformed NSCs cultured in the standard assay with or without 527 crenigacestat addition from day three. N=8, two-way ANOVA followed by Sidak’s multiple 528 comparisons test. E Proportion of BrdU positive cells following a 24 hour incubation with 529 crenigacestat. N=4, two-way ANOVA with Sidak’s multiple comparisons test. The γ- 530 secretase inhibitor crenigacestat also increases WT NSC proliferation in co-culture.

531 Supplemental Figure 4 532 A Growth curves of control EV clone cultured separately or in co-culture with transformed 533 NSCs. B Growth curves of Rbpj-/- clones cultured separately or in co-culture with 534 transformed NSCs. C Growth curves of Notch1-/- clones cultured separately or in co-culture

16 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

535 with transformed NSCs. D Growth curves of Notch2-/- clones cultured separately or in co- 536 culture with transformed NSCs. N>4. E Western blot showing absence of RBPJ protein from 537 Rbpj-/- transformed NSCs. F Fold change cell number of WT NSCs in separate or co-culture 538 with EV or Rbpj-/- transformed NSCs. N=5, two-way ANOVA followed by Sidak’s multiple 539 comparisons test. G Proportion of BrdU-positive WT NSCs in separate or co-culture with EV 540 or Rbpj-/- transformed cells. N=3, two-way ANOVA followed by Sidak’s multiple 541 comparisons test. H Growth curves of transformed EV and Rbpj-/- clones cultured separately 542 or in co-culture with WT NSCs. Both Rbpj-/- clones suppress the proliferation of WT NSCs to 543 a comparable degree to the EV control transformed cells.

544 Supplementary Table 1. Primers used in qPCR 545 Target Forward primer Reverse primer gene Hes1 GGAAATGACTGTGAAGCACCTCC GAAGCGGGTCACCTCGTTCATG Hes5 GCCCGGGGTTCTATGATATT GAGTTCGGCCTTCACAAAAG Hes7 CATCAACCGCAGCCTAGAAGAG CACGGCGAACTCCAGTATCTCC Hey1 CCAACGACATCGTCCCAGGTTT CTGCTTCTCAAAGGCACTGGGT Hey2 TGAAGATGCTCCAGGCTACAGG CCTTCCACTGAGCTTAGGTACC Nrarp CAGACAGCACTACACCAGTCAG CCGAAAGCGGCGATGTGTAGC β-actin GGCACCACACCTTCTACAATG GGGGTGTTGAAGGTCTCAAAC 546

547 Supplementary Table 2. gRNA sequences for deletion 548 Target gene gRNA1 gRNA2 Rbpj TGCAGTGGACGACGACGAGT GTGGACGACGACGAGTCGGA Notch1 GGCGTTCAGTGCCTACACAA Notch2 GTCCACCTGCATTGACCGCG AAGTGCATCGATCACCCGAA Tsc2 GAAGGCCGGCCTACCTCATT GCATGGCTCTTACAGGTACA 549 550

17 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

551 References 552 Ables, J.L., Breunig, J.J., Eisch, A.J., and Rakic, P. (2011). Not(ch) just development: Notch 553 signalling in the adult brain. Nat Rev Neurosci 12, 269-283. 554 Andersen, J., Urban, N., Achimastou, A., Ito, A., Simic, M., Ullom, K., Martynoga, B., 555 Lebel, M., Goritz, C., Frisen, J., et al. (2014). A transcriptional mechanism integrating inputs 556 from extracellular signals to activate hippocampal stem cells. Neuron 83, 1085-1097. 557 Bruggeman, S.W., Hulsman, D., Tanger, E., Buckle, T., Blom, M., Zevenhoven, J., van 558 Tellingen, O., and van Lohuizen, M. (2007). Bmi1 controls tumor development in an 559 Ink4a/Arf-independent manner in a mouse model for glioma. Cancer Cell 12, 328-341. 560 Chapouton, P., Skupien, P., Hesl, B., Coolen, M., Moore, J.C., Madelaine, R., Kremmer, E., 561 Faus-Kessler, T., Blader, P., Lawson, N.D., et al. (2010). Notch activity levels control the 562 balance between quiescence and recruitment of adult neural stem cells. J Neurosci 30, 7961- 563 7974. 564 Cheng, L., Huang, Z., Zhou, W., Wu, Q., Donnola, S., Liu, J.K., Fang, X., Sloan, A.E., Mao, 565 Y., Lathia, J.D., et al. (2013). Glioblastoma stem cells generate vascular pericytes to support 566 vessel function and tumor growth. Cell 153, 139-152. 567 Codega, P., Silva-Vargas, V., Paul, A., Maldonado-Soto, A.R., Deleo, A.M., Pastrana, E., 568 and Doetsch, F. (2014). Prospective identification and purification of quiescent adult neural 569 stem cells from their in vivo niche. Neuron 82, 545-559. 570 Conti, L., Pollard, S.M., Gorba, T., Reitano, E., Toselli, M., Biella, G., Sun, Y., Sanzone, S., 571 Ying, Q.L., Cattaneo, E., et al. (2005). Niche-independent symmetrical self-renewal of a 572 mammalian tissue stem cell. PLoS Biol 3, e283. 573 Crespo, I., Vital, A.L., Gonzalez-Tablas, M., Patino Mdel, C., Otero, A., Lopes, M.C., de 574 Oliveira, C., Domingues, P., Orfao, A., and Tabernero, M.D. (2015). Molecular and Genomic 575 Alterations in Glioblastoma Multiforme. Am J Pathol 185, 1820-1833. 576 Denysenko, T., Gennero, L., Roos, M.A., Melcarne, A., Juenemann, C., Faccani, G., Morra, 577 I., Cavallo, G., Reguzzi, S., Pescarmona, G., et al. (2010). Glioblastoma cancer stem cells: 578 heterogeneity, microenvironment and related therapeutic strategies. Cell Biochem Funct 28, 579 343-351. 580 Doetsch, F., Caille, I., Lim, D.A., Garcia-Verdugo, J.M., and Alvarez-Buylla, A. (1999). 581 Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97, 582 703-716. 583 Engler, A., Rolando, C., Giachino, C., Saotome, I., Erni, A., Brien, C., Zhang, R., Zimber- 584 Strobl, U., Radtke, F., Artavanis-Tsakonas, S., et al. (2018). Notch2 Signaling Maintains 585 NSC Quiescence in the Murine Ventricular-Subventricular Zone. Cell Rep 22, 992-1002. 586 Galli, R., Binda, E., Orfanelli, U., Cipelletti, B., Gritti, A., De Vitis, S., Fiocco, R., Foroni, 587 C., Dimeco, F., and Vescovi, A. (2004). Isolation and characterization of tumorigenic, stem- 588 like neural precursors from human glioblastoma. Cancer Res 64, 7011-7021. 589 Giachino, C., and Taylor, V. (2009). Lineage analysis of quiescent regenerative stem cells in 590 the adult brain by genetic labelling reveals spatially restricted neurogenic niches in the 591 olfactory bulb. Eur J Neurosci 30, 9-24. 592 Kawaguchi, D., Furutachi, S., Kawai, H., Hozumi, K., and Gotoh, Y. (2013). Dll1 maintains 593 quiescence of adult neural stem cells and segregates asymmetrically during mitosis. Nat 594 Commun 4, 1880. 595 Khalifa, J., Tensaouti, F., Lusque, A., Plas, B., Lotterie, J.A., Benouaich-Amiel, A., Uro- 596 Coste, E., Lubrano, V., and Cohen-Jonathan Moyal, E. (2017). Subventricular zones: new 597 key targets for glioblastoma treatment. Radiat Oncol 12, 67.

18 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

598 Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013). 599 TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and 600 gene fusions. Genome Biol 14, R36. 601 Kramer, A., Green, J., Pollard, J., Jr., and Tugendreich, S. (2014). Causal analysis approaches 602 in Ingenuity Pathway Analysis. Bioinformatics 30, 523-530. 603 Lee, J.H., Lee, J.E., Kahng, J.Y., Kim, S.H., Park, J.S., Yoon, S.J., Um, J.Y., Kim, W.K., 604 Lee, J.K., Park, J., et al. (2018). Human glioblastoma arises from subventricular zone cells 605 with low-level driver mutations. Nature 560, 243-247. 606 Lim, D.A., Tramontin, A.D., Trevejo, J.M., Herrera, D.G., Garcia-Verdugo, J.M., and 607 Alvarez-Buylla, A. (2000). Noggin antagonizes BMP signaling to create a niche for adult 608 neurogenesis. Neuron 28, 713-726. 609 Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using 610 real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408. 611 Llorens-Bobadilla, E., Zhao, S., Baser, A., Saiz-Castro, G., Zwadlo, K., and Martin-Villalba, 612 A. (2015). Single-Cell Transcriptomics Reveals a Population of Dormant Neural Stem Cells 613 that Become Activated upon Brain Injury. Cell Stem Cell 17, 329-340. 614 Louis, D.N., Ohgaki, H., Wiestler, O.D., Cavenee, W.K., Burger, P.C., Jouvet, A., 615 Scheithauer, B.W., and Kleihues, P. (2007). The 2007 WHO classification of tumours of the 616 central nervous system. Acta Neuropathol 114, 97-109. 617 Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and 618 dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550. 619 Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and 620 Church, G.M. (2013). RNA-guided human genome engineering via Cas9. Science 339, 823- 826. 621 826. 622 Marques-Torrejon, M.A., Gangoso, E., and Pollard, S.M. (2018). Modelling glioblastoma 623 tumour-host cell interactions using adult brain organotypic slice co-culture. Dis Model Mech 624 11. 625 Martynoga, B., Mateo, J.L., Zhou, B., Andersen, J., Achimastou, A., Urban, N., van den 626 Berg, D., Georgopoulou, D., Hadjur, S., Wittbrodt, J., et al. (2013). Epigenomic enhancer 627 annotation reveals a key role for NFIX in neural stem cell quiescence. Genes Dev 27, 1769- 628 1786. 629 Mira, H., Andreu, Z., Suh, H., Lie, D.C., Jessberger, S., Consiglio, A., San Emeterio, J., 630 Hortiguela, R., Marques-Torrejon, M.A., Nakashima, K., et al. (2010). Signaling through 631 BMPR-IA regulates quiescence and long-term activity of neural stem cells in the adult 632 hippocampus. Cell Stem Cell 7, 78-89. 633 Mistry, A.M., Hale, A.T., Chambless, L.B., Weaver, K.D., Thompson, R.C., and Ihrie, R.A. 634 (2017). Influence of glioblastoma contact with the lateral ventricle on survival: a meta- 635 analysis. J Neurooncol 131, 125-133. 636 Morizur, L., Chicheportiche, A., Gauthier, L.R., Daynac, M., Boussin, F.D., and Mouthon, 637 M.A. (2018). Distinct Molecular Signatures of Quiescent and Activated Adult Neural Stem 638 Cells Reveal Specific Interactions with Their Microenvironment. Stem Cell Reports 11, 565- 577. 639 577. 640 Paliouras, G.N., Hamilton, L.K., Aumont, A., Joppe, S.E., Barnabe-Heider, F., and 641 Fernandes, K.J. (2012). Mammalian target of rapamycin signaling is a key regulator of the 642 transit-amplifying progenitor pool in the adult and aging forebrain. J Neurosci 32, 15012- 643 15026. 644 Pastrana, E., Cheng, L.C., and Doetsch, F. (2009). Simultaneous prospective purification of 645 adult subventricular zone neural stem cells and their progeny. Proc Natl Acad Sci U S A 106, 646 6387-6392.

19 bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

647 Piccirillo, S.G., Spiteri, I., Sottoriva, A., Touloumis, A., Ber, S., Price, S.J., Heywood, R., 648 Francis, N.J., Howarth, K.D., Collins, V.P., et al. (2015). Contributions to drug resistance in 649 glioblastoma derived from malignant cells in the sub-ependymal zone. Cancer Res 75, 194- 202. 650 202. 651 Pollard, S.M., Conti, L., Sun, Y., Goffredo, D., and Smith, A. (2006). Adherent neural stem 652 (NS) cells from fetal and adult forebrain. Cereb Cortex 16 Suppl 1, i112-120. 653 Pollard, S.M., Yoshikawa, K., Clarke, I.D., Danovi, D., Stricker, S., Russell, R., Bayani, J., 654 Head, R., Lee, M., Bernstein, M., et al. (2009). Glioma stem cell lines expanded in adherent 655 culture have tumor-specific phenotypes and are suitable for chemical and genetic screens. 656 Cell Stem Cell 4, 568-580. 657 Quinones-Hinojosa, A., Sanai, N., Soriano-Navarro, M., Gonzalez-Perez, O., Mirzadeh, Z., 658 Gil-Perotin, S., Romero-Rodriguez, R., Berger, M.S., Garcia-Verdugo, J.M., and Alvarez- 659 Buylla, A. (2006). Cellular composition and cytoarchitecture of the adult human 660 subventricular zone: a niche of neural stem cells. J Comp Neurol 494, 415-434. 661 Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., and Zhang, F. (2013). Genome 662 engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308. 663 Rispoli, R., Conti, C., Celli, P., Caroli, E., and Carletti, S. (2014). Neural stem cells and 664 glioblastoma. Neuroradiol J 27, 169-174. 665 Sanai, N., Tramontin, A.D., Quinones-Hinojosa, A., Barbaro, N.M., Gupta, N., Kunwar, S., 666 Lawton, M.T., McDermott, M.W., Parsa, A.T., Manuel-Garcia Verdugo, J., et al. (2004). 667 Unique astrocyte ribbon in adult human brain contains neural stem cells but lacks chain 668 migration. Nature 427, 740-744. 669 Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., 670 Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an open-source 671 platform for biological-image analysis. Nat Methods 9, 676-682. 672 Singh, S.K., Clarke, I.D., Terasaki, M., Bonn, V.E., Hawkins, C., Squire, J., and Dirks, P.B. 673 (2003). Identification of a cancer stem cell in human brain tumors. Cancer Res 63, 5821- 674 5828. 675 Singh, S.K., Hawkins, C., Clarke, I.D., Squire, J.A., Bayani, J., Hide, T., Henkelman, R.M., 676 Cusimano, M.D., and Dirks, P.B. (2004). Identification of human brain tumour initiating 677 cells. Nature 432, 396-401. 678 Stieber, D., Golebiewska, A., Evers, L., Lenkiewicz, E., Brons, N.H., Nicot, N., Oudin, A., 679 Bougnaud, S., Hertel, F., Bjerkvig, R., et al. (2014). Glioblastomas are composed of 680 genetically divergent clones with distinct tumourigenic potential and variable stem cell- 681 associated phenotypes. Acta Neuropathol 127, 203-219. 682 Urban, N., and Guillemot, F. (2014). Neurogenesis in the embryonic and adult brain: same 683 regulators, different roles. Front Cell Neurosci 8, 396. 684 Yousef, H., Morgenthaler, A., Schlesinger, C., Bugaj, L., Conboy, I.M., and Schaffer, D.V. 685 (2015). Age-Associated Increase in BMP Signaling Inhibits Hippocampal Neurogenesis. 686 Stem Cells 33, 1577-1588. 687 Zhang, J., and Jiao, J. (2015). Molecular Biomarkers for Embryonic and Adult Neural Stem 688 Cell and Neurogenesis. Biomed Res Int 2015, 727542. 689 Zhang, Q.B., Ji, X.Y., Huang, Q., Dong, J., Zhu, Y.D., and Lan, Q. (2006). Differentiation 690 profile of brain tumor stem cells: a comparative study with neural stem cells. Cell Res 16, 691 909-915. 692

20 Figure 1 A B bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Separate Mix 4 2.5 ) )

6 Wild-type 6 Wild-type 0 0 1 Transformed 1 2.0 Transformed x 3 x ( ( r r e e 1.5 b 2 b m m u u 1.0 n n l l l l

e 1 e

C 0.5 C

0 0.0 0 2 4 6 0 2 4 6 Day Day C D ** r 125 25 e Separate b *** Separate m Mix u 100 20 ** Mix n l l sitive e 75 o 15 c *** p e U g d n 50 r 10 a B h % c 25 d 5 l o F 0 0 e d e d p e p e y m y -T r -T rm d fo d o il s il f n s W a W n r ra T T E F p-H3 Wild-type growth WT r 100 2.0 e b m

Sep Mix y * u t i n

s 1.5 l l n e e c

d

p-H3 e

50

1.0 g e n v a i t h a c

l 0.5 d e l o

β-ACTIN R F 0.0 0 p e ix 0 0 5 0 5 0 S M 1 2 5 7 9 T T W W % Trans. seeded Figure 2 A B Wild-type Mix vs Wild-type Sep WT Mix vs bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for thisWT Seppreprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Cdc6 Cdc7 Cdc45 Cell Cycle Control of Chromosomal Replication Cdk1 Cdk2 Cdk4 Role of BRCA1 in DNA Damage Response Cdk6 1 Cdk10 Mitotic Roles of Polo-Like Kinase Cdk12 Cdt1 Chek2 Hereditary Breast Cancer Signaling Dbf4 Dna2 Lig1 GADD45 Signaling Mcm2 Mcm3 Cell Cycle: G2/M DNA Damage Checkpoint Regulation Mcm4 0 Mcm5 Mcm6 Role of CHK Proteins in Cell Cycle Checkpoint Control Mcm7 Mcm8 Estrogen-mediated S-phase Entry Orc1 Orc6 Pcna ATM Signaling Pola1 Pola2 Pold1 -1 Cyclins and Cell Cycle Regulation Pole Prim1 Prim2 Rpa2 Rpa3 Top2a

C WT Mix vs D E WT Sep Sox9 1.2 40

) WT (from Sep) 6

Id2 0 1.0 Quiescence 1 1 WT (from Mix)

x 30 ( -associated sitive

r 0.8

Id3 o e

TFs p b 0.6

U 20 Klf9 m d u r n

0.4 B l Ascl1 0 l

e 10 %

C 0.2 Egr1 Activation- 0.0 0 associated Fos 1 2 3 WT WT (from Sep) (from Mix) TFs Day Sox11 -1

Dlx1 Figure 3

A WT p-S6 bioRxiv preprint doi: https://doi.org/10.1101/856062; thisTrans version posted3000 November 26, 2019. The copyright holder for this preprint (which was

not certified by peer review) is the author/funder. All rights reserved.* No reuse allowed without permission.Separate Separate L Mix Mix 2000 MFI

1000

0 e d p e y T rm d- fo il s W n ra T

B C Transwell assays 30 ** 10 ** WT/WT ) 6

0 8

Trans/WT sitive 20 1 o x ( p

r Mix/WT U e 6 d b r m B 10 u 4 % n l l e

C 2 0 WT TRANS MIX 0 WT WT MIX 0 2 4 6 Day

D WT Mix vs E Trans Mix 2 WT Mix vs Trans Mix Hes1 Hes5 4 *** Target Hes7 Hey1 genes 1 e 3 Hey2 g n

a ** **

Nrarp h c

d 2 Notch1 l o f

Notch2 0 2

Receptors g Notch3 o 1 L Notch4 Jag1 -1 0 Jag2 1 5 7 1 2 s s s y y rp Ligands e e e e e ra Dll1 H H H H H N Dll3 Dll4 -2

F G 60 *

r 40 e ** Separate ** Separate b

m Mix Mix u 30 n 40 l l sitive e o c p

e 20 U g d n r

a 20 B h

c 10 % d l o F 0 0 l l o Y o Y tr L tr L n n o o C C Figure 4

A ** bioRxiv preprint doi: https://doi.org/10.1101/856062B ; this version posted November 26, 2019. CThe copyright holder for this preprint (which was r ** 120 * not certified by peer review)e is the author/funder. All rights reserved. No reuse allowed40 without permission. b Separate -/- Separate -/- m 100 ** EV Rbpj 1 Rbpj 2 u Mix n ** 30 Mix l l 80 sitive e o c

RBPJ p

e 60 20 U g d n r a

40 B h

β-ACTIN c 10 % d

l 20 o F 0 0 - - V /- 1 /- 2 V -/ 1 -/ 2 E - - E

Rbpj Rbpj Rbpj Rbpj

D E * F -/- -/- 35 *** EV N1 1 N1 2 r 100 * e Separate *** Separate b 30 m 80 Mix Mix u

n 25 * l sitive l e NOTCH1 60 o 20 c p e U g

d 15 r n 40 a B

h 10 c 20 % d

ɑ-TUB l 5 o F 0 0

- - - - V / 1 -/ 2 V -/ 1 -/ 2 E - E 1 1 1 1 h h h h tc tc tc tc o o o o G H N N I N N

-/- -/- r 100 40 EV N2 1 N2 2 e Separate ** Separate b **

m ** 80 Mix u ** Mix

n 30 l l sitive NOTCH2 e 60 o c p

e 20 U g d n 40 r a B h

c 10 ɑ-TUB 20 % d l o F 0 0

V /- 1 /- 2 V /- 1 /- 2 E - - E - - 2 2 2 h 2 h h c h tc tc t tc o o o o N N N N Supplementary Figure 1

A Separate B bioRxiv preprint doi: https://doi.org/10.1101/856062; this version posted November Separate26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. 50All rights reserved. No reuse allowed without permission. Wild-Type ** 40 Transformed sitive

o 30 p U

d 20 r B

% 10

0 3 4 5 6 D D D D C D r 8 e * Wild-type Trans b Control m

u BMP4

n 6

Con BMP4 Con BMP4 l l e c

p-SMAD1/5/8 e 4 g n a h

c 2

d

PCNA l o

F 0 . T s W n ra T E F Mix Mix 50 Wild-Type ** **** 40 Transformed sitive

o 30 p *** U d

r 20 B

% 10

0 3 4 5 6 D D D D Supplementary Figure 2 B A WT Mix vs WT Mix vs bioRxiv preprintMarkers doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyright holder for thisWT Sep preprint (which was WT Sep Dmp1 not certified by peer review) is the author/funder. All rights reserved. No reuse allowed withoutRora permission. Sox2 Id2 Klf9 Zfp40 Nes Nr1d1 Crym Pax6 Epas1 Rorb NSC Gfap 1 Pttg1ip Sox9 Olig1 Vim Hlf 1 Fabp7 Rbl2 Dlx1 Prom1 Ascl1 Insm1 Myt1 aNSC Egfr Otx1 Foxm1 Dcx Brca1 Tgif2 NPC Bcl11a Tbr2 0 Hes6 Mycn Cspg4 Tox3 E2f1 Pdgfra Rbl1 Oligodendrocyte Trip11 Whsc1 Olig2 E2f2 Trp53 Glast Sox11 Tead2 Mta2 Astrocyte Glt1 Gmnn Hmgb2 0 S100b Pknox1 -1 Zfp707 Tubb3 Rcor2 Hmgb3 Zfp161 Neuron Neurod1 Cited2 Mycl1 Rbfox3 Tcerg1 Creb1 Zbtb12 Fos Zfp617 Zfp948 Camta1 C Ybx1 Ccne1 -/- Zfp956 Tsc2 Usp21 Zfp260 Tfdp1 Cas9 1 2 Nsd1 Zeb2 Supt3h Rnf2 -1 TSC2 Arid2 Arx Sp1 Rlim Hmgb1 Tead1 α-TUB Nfix Smad5 Ran Ctnnb1 Gtf2ird1 Mll5 D E

Cas9 Sep 3 Cas9 Mix r 100 4 Wild-type e ** b Separate

3 Transformed m u 80 2 Mix n * l 2 l e 60 1 c 0.07 1 e g

n 40 0 0 a h 0 2 4 6

0 2 4 6 c 20 d l

-/- -/- o )

Tsc2 1 Sep Tsc2 1 Mix F 6 4 3 0 0 1 9 -/- 1 -/- 2 x s ( 3 a 2 2 C c c r 2 s s

e T T

b 2

m 1 F u 1 20000 n

l Separate l

e 0 0

C Mix 0 2 4 6 0 2 4 6 15000 6 S

-/- -/- -

Tsc2 2 Sep Tsc2 2 Mix p 10000 4 3 I F M 3 2 5000

2 1 0 1 9 -/- 1 -/- 2 s a 2 2 c c 0 0 C s s 0 2 4 6 0 2 4 6 T T Day Supplementary Figure 3

A B Separate Mix bioRxiv preprintNotch doi: targets https://doi.org/10.1101/856062; this3.0 version posted November 26,2.5 2019. The copyright holder forWild-Type this preprint (which was 0 not certified by peer review) is the author/funder.2.5 All rights reserved.2.0 No reuse allowed without permission.Transformed e Hes1

g 2.0 1.5

n Hes5

a 1.5

h Nrarp 1.0

-2 )

c 1.0 6 0

d 0.5

l 0.5 1 o x f ( 0.0 0.0

-4 r 2 0 2 4 6 0 2 4 6 e g b o L m Separate +LY Mix +LY -6 u 3.0 2.5 n l

Y l L 2.5 2.0 e 2.0 C 1.5 1.5 1.0 C 1.0 0.5 Notch targets 0.5

0 0.0 0.0 e Hes1 0 2 4 6 0 2 4 6 g

n Hes5 a -2 Day h Nrarp c

d

l -4 D o f

Separate 3.5 Mix 2 2.5 Wild-Type

g -6 3.0 o 2.0

L 2.5 Transformed -8 2.0 1.5 N 1.5 E 1.0 R ) 1.0 C 6

0 0.5 0.5 1

x 0.0 0.0 (

E r 0 2 4 6 0 2 4 6 e

* b

40 m Separate +Cren Mix +Cren ** Separate u 3.5 2.5 n

Mix l 30 l 3.0 2.0 e sitive 2.5 o C

p 1.5 20 2.0 U 1.5 1.0 d r 1.0 B 10 0.5 0.5 % 0.0 0.0 0 0 2 4 6 0 2 4 6 Control Cren Day Supplementary Figure 4

A EV Sep B Rbpj-/- 1 Sep Rbpj -/- 2 Sep 4 4 4 Wild-Type bioRxiv3 preprint doi: https://doi.org/10.1101/856062; this version posted November 26, 2019. The copyrightTransformed holder for this preprint (which was not certified by peer3 review) is the author/funder. All3 rights reserved. No reuse allowed without permission.

2 2 2 ) ) 6 6

0 1 0 1 1 1 1 x x ( (

r 0 r 0 0 e e

b 0 2 4 6 b 0 2 4 6 0 2 4 6

m m -/- u EV Mix u Rbpj-/- 1 Mix Rbpj 2 Mix n 3 n 2.5 2.5 l l l l

e e 2.0 2.0 C C 2 1.5 1.5

1.0 1.0 1 0.5 0.5

0 0.0 0.0 0 2 4 6 0 2 4 6 0 2 4 6 Day Day

C Notch1-/- 1 Sep Notch1-/- 2 Sep D Notch2-/- 1 Sep Notch2-/- 2 Sep 4 4 4 4 Wild-Type

3 3 3 3 Transformed

2 2 2 2 ) )

6 1 1 6 1 1 0 0 1 1 x x

( 0 0 ( 0 0

r 0 2 4 6 0 2 4 6 r 0 2 4 6 0 2 4 6 e e b b

m -/- -/- m -/- -/- 2.0 Notch1 1 Mix 2.0 Notch1 2 Mix 2.5 Notch2 1 Mix 2.5 Notch2 2 Mix u u n n l l

l l 2.0 2.0 1.5 1.5 e e

C C 1.5 1.5 1.0 1.0 1.0 1.0 0.5 0.5 0.5 0.5

0.0 0.0 0.0 0.0 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6 Day Day

E F Wild-type growth G Wild-type BrdU r

e 100 20 EV Rbpj-/- 1 Rbpj-/- 2 b **** * * * m **** Separate u 80 Separate

n **** 15

l Mix Mix l e RBPJ sitive o

c 60 p

e 10 U g d n 40 r

ɑ-TUB a B h % c 5 20 d l o

F 0 0 /- 1 /- 2 - - V - - V -/ 1 -/ 2 E E

Rbpj Rbpj Rbpj Rbpj H Trans EV Sep Trans Rbpj-/- 1 Sep Trans Rbpj-/- 2 Sep 3.5 3.5 3.5 Wild-Type 3.0 3.0 3.0 Transformed 2.5 2.5 2.5 2.0 2.0 2.0 1.5 1.5 1.5 1.0 1.0 1.0 )

6 0.5 0.5 0.5 0

1 0.0 0.0 0.0 x

( 0 2 4 6 0 2 4 6 0 2 4 6 r e -/- -/- b Trans EV Mix Trans Rbpj 1 Mix Trans Rbpj 2 Mix 2.5 2.5 2.5 m u

n 2.0 2.0 2.0 l l

e 1.5 1.5 1.5 C

1.0 1.0 1.0

0.5 0.5 0.5

0.0 0.0 0.0 0 2 4 6 0 2 4 6 0 2 4 6 Day