Lactobacillus Maintains Healthy Gut Mucosa by Producing L-Ornithine

ARTICLE

https://doi.org/10.1038/s42003-019-0424-4 OPEN Lactobacillus maintains healthy gut mucosa by producing L-Ornithine

Houbao Qi1,2,3,6, Yuanyuan Li1,2,3,6, Huan Yun1,2,3,6, Tong Zhang4,5,6, Yugang Huang1,2,3,6, Jiang Zhou1,2,3, Hui Yan1,2,3, Jianmei Wei1,2,3, Yingquan Liu1,2,3, Zhiqian Zhang1,2,3, Yunhuan Gao1,2,3, Yongzhe Che2,3, Xiaomin Su1,2,3, Dashuai Zhu3, Yuan Zhang1,2,3, Jin Zhong4,5 & Rongcun Yang1,2,3 1234567890():,;

Gut mucosal layers are crucial in maintaining the gut barrier function. Gut microbiota regulate homeostasis of gut mucosal layer via gut immune cells such as RORγt(+) IL-22(+) ILC3 cells, which can inﬂuence the proliferation of mucosal cells and the production of mucin. However, it is unclear how gut microbiota execute this regulation. Here we show that lactobacilli promote gut mucosal formation by producing L-Ornithine from arginine. L-Ornithine increases the level of aryl hydrocarbon receptor ligand L-kynurenine produced from tryptophan metabolism in gut epithelial cells, which in turn increases RORγt(+)IL-22(+) ILC3 cells. Human REG3A transgenic mice show an increased proportion of L-Ornithine producing lactobacilli in the gut contents, suggesting that gut epithelial REG3A favors the expansion of L-Ornithine producing lactobacilli. Our study implicates the importance of a crosstalk between arginine metabolism in Lactobacilli and tryptophan metabolism in gut epithelial cells in maintaining gut barrier.

1 State Key Laboratory of Medicinal Chemical Biology, Nankai University, 300071 Tianjin, China. 2 Key Laboratory of Bioactive Materials Ministry of Education, Nankai University, 300071 Tianjin, China. 3 Department of Immunology, School of Medicine, Nankai University, 300071 Tianjin, China. 4 State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, 100101 Beijing, China. 5 School of Life Science, University of Chinese Academy of Sciences, 100039 Beijing, China. 6These authors contributed equally: Houbao Qi, Yuanyuan Li, Huan Yun, Tong Zhang, Yugang Huang. Correspondence and requests for materials should be addressed to R.Y. (email: [email protected])

COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio 1 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4

ut mucus layers play a crucial barrier role in both mice (Fig. 1f). Interestingly, mucus layers in the proximal colon Gseparating the host from the noxious external environ- tissues of REG3Atg mice were also markedly thicker, as compared ment and inhibiting the entrance of gut microbiota and/or with their control cohoused littermates (Fig. 1g). The thickened their metabolites into the bloodstream and tissues1. The small mucus layer in the colon tissues may be derived from the intestine has one layer of unattached mucus to directly form a expression of REG3A in colon Paneth cell-like cells17 and/or the soluble mucus gel2, which may act as a matrix to limit the contact secreted REG3A by intestinal Paneth cells. Higher levels of mucin of gut microbiota with gut cell surface3. The colonic mucus layer 2 were detected in proximal colon tissues of human REG3Atg forms a physical barrier against bacteria and their metabolites4. mice (Fig. 1h). Ki67 cells in the colon crypt also remarkably Although gut mucus layers are vitally important for individual increased in these REG3A tg mice (Fig. 1i). The Cdkn1a (p21) and health, the mechanism(s) underlying the maintenance of gut Cdkn2d (p19) were downregulated in the colonic epithelial cells mucosal homeostasis is not completely clear. (Fig. 1i). The REG3Atg mice also conferred a marked resistance to Gut mucus layer consists of high-molecular-weight glycopro- DSS-mediated colitis (Fig. 1i–n). Levels of serum LPS were lower teins called mucin, that are synthesized and secreted by goblet in DSS-treated human REG3Atg mice (Fig. 1o). The bacterium cells. Goblet cells originate by their own mitosis or by differ- numbers in the organs and tissues, such as the spleen of DSS- entiation of stem cells5, which may be regulated by gut immune treated REG3Atg mice, were much less than wt control littermates cells through the production of cytokines, such as IL-66 or direct (Fig. 1p). Furthermore, there had been much more goblet cells cell–cell contact by activated macrophages7. IL-22 produced by and Ki67 cells with upregulated Clca3, Retnlb, and Tff2 and innate lymphoid cells group 3 and other immune cells such as downregulated Cdkn1a and Cdkn2d in the colon crypt of DSS- Th17, Th22, natural killer cells, γδ T cells, and lymphoid tissue treated human REG3Atg mice (Supplementary Fig. 2a–d). Taken inducer, can also promote the production of gut epithelial stem together, these data indicate that REG3A is involved in the cells, which potentially increase mucus production through goblet maintenance of gut mucosal homeostasis through modulating gut cells8,9. These immune cell responses are dictated not only via epithelial regeneration and repair. “endogenous” host-derived but also “exogenous” signals, such as gut microbiota/their metabolites. Indeed, gut microbiota may not REG3A-mediated formation of gut mucus layers is dependent only regulate gut innate immune but also adaptive immune cells, on ILC3. Gut immune cells may influence mucosal cell pro- such as that L. reuteri has a role in IL-22 production10, and liferation through the direct cell–cell contact or the production of segmented filamentous bacteria may induce Th17 cells differ- cytokines, such as IL-229,18. We thus assessed IL-22-associated entiation11. The products of bacteria may also interrupt T-cell gut immune cell population and subpopulations according to the differentiation, such as that polysaccharide A from Bacteroides described gated strategy (Supplementary Fig. 3). IL-22(+) cells fragilis promotes Treg cell secretion12, and the lysates of include innate lymphocyte cell 3 (ILC3), CD4(+)Th17, and CD4 polysaccharide-producing bacteria induce differentiation of Treg (+)Th22 cells in gut tissues19. We found that the increased IL-22 cells and IL-10 production13. Thus, the altered gut microbiota has (+) cells in human REG3Atg mice mainly belonged to CD4(–) IL- direct or indirect effects on the gut immune cells. 22(+) cells but not CD4(+)IL17(+) (Fig. 2a), implying that these Interestingly, many secreted antimicrobial proteins in the cells may be ILC3 cells. ILC3 cells are RORγt-positive cells and gastrointestinal tract may potentially affect the composition of gut constitute at least two bona fide subsets NCR(+) ILC3 expressing microbiota via killing bacteria, such as REG314. Recent studies NKp46 and LTi-like ILC3, which includes CD4(+) and CD4(–) have shown that Reg3α contributes to resistance to DSS-mediated subsets20,21. The increased ILC3 cells in the ileum and colon of colitis with altered gut microbiota15. Thus, it is possible for gut human REG3Atg mice were CD45(+)lin(–)RORγt(+) IL-22(+) antimicrobial proteins to be involved in gut mucosal homeostasis NKp46(–) CD4(–) ILC3 cells (Fig. 2b, c), which may strongly through the altered microbiota. We here found that gut anti- produce IL-2222. Increased CD45(+)lin(–)RORγt(+) IL-22(+) microbial protein REG3A may affect the composition of gut NKp46(–) CD4(–) ILC3 cells were also found in Reg3α microbiota, typically increasing the proportion of Lactobacillus. adenovirus-injected mice (Fig. 2d and Supplementary Fig. 1b, d, We demonstrate that these increased Lactobacillus may promote f). Higher levels of IL-22 in the ileum and colon tissues were gut mucus-layer homeostasis through producing L-Orn. detected in REG3Atg mice and Reg3α/adenovirus- injected mice (Fig. 2e). All of these imply that CD45(+)lin(–)RORγt(+) IL-22 + – – Results ( )NKp46( ) CD4( ) ILC3 cells may be involved in REG3A/ Reg3α-mediated formation of gut mucus layers. To further con- REG3A promotes the formation of gut mucus layers.To firm the role of IL-22 in REG3A-mediated gut mucus layers, we investigate the effect(s) of gut microbiota on gut mucosal-layer treated REG3Atg mice by injecting IL-22-neutralizing antibodies. homeostasis, we generated human REG3Atg mice, which may Reduced mucus gel in the ileum tissues and thinned mucus layers affect the composition of gut microbiota. We found that mucus in the colon tissues of REG3Atg mice were observed after gel remarkably increased in the ileum of REG3Atg mice (Fig. 1a), administering IL-22-neutralizing antibodies (Fig. 2f, g), indicating in which human REG3A (Gene ID: 5068) was selectively that REG3A-mediated mucus layers were dependent on IL-22. In expressed in mouse intestinal Paneth cells under the control of addition, the proportion of CD11C(+)CD103(+)CD11B(+) the HD5 promoter16 (Supplementary Fig. 1a, c, e). Higher levels dendritic cells, CD11B(+)Ly6C(+) myeloid-derived monocytes, of mucin 2 were also detected in the ileum of REG3Atg mice and CD11B(+)F4/80(+) macrophages, which may be promoted (Fig. 1b). Intestinal histological structures of REG3Atg mice by GM-CSF from RORγt(+)IL-22(+) ILC3 cells, also increased exhibited increased goblet cells (Fig. 1c). The goblet cell markers (Supplementary Fig. 4). Taken together, gut REG3A (Reg3α in Clca3 (Gob5), Retnlb (RELMβ), and Tff2 (trefoil factor 2) were mouse) promotes the formation of gut mucus layers in the small upregulated in these REG3Atg mice (Fig. 1d). Ki67 cells in the intestine and colon through RORγt(+) IL-22(+) ILC3 cells. intestinal crypt also remarkably increased in REG3Atg mice (Fig. 1e). The cell-cycle checkpoint molecules Cdkn1a (p21) and Cdkn2d (p19) were downregulated in these epithelial cells Lactobacilli promote the accumulation of ILC3. We next (Fig. 1e). Meanwhile, increased crypt height, including the investigated whether the accumulation of CD45(+)lin(–)RORγt transit-amplifying compartment, which indicates high pro- (+) IL-22(+)NKp46(–) CD4(–) ILC3 cells in human REG3Atg liferative activity, was also observed in these human REG3Atg mice is dependent on the altered microbiota. We performed the

2 COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4 ARTICLE

a b WT REG3A 10 p = 0.0044

DAPI 8 6 16S rRNA / 4 probe-Cy3/ R. E.(MUC2)

Mucin 2 0 WT REG3A c WT d 10 p = 0.0267 p = 0.0108 6 p = 0.0043 p < 0.0001 30 ) 8 4 ) 4

6 Tff2

20 Clca3 4 2 2 10 2 R. E. (

REG3A R. E. ( R. E. (REtnlb) Goblet cells 0 0 0

Goblet cells/VCU 0 WT WT WT WT REG3A REG3A REG3A REG3A e f WT REG3A WT REG3A TA DAPI TA Crypt Ki67/ Lysozyme Lysozyme Crypt

P < 0.0001 1.1 1.1 P= 0.0001 P < 0.0001 P = 0.0174 ) P = 0.0392 ) 150 100

25 m) μ 1.0 1.0 m) 80 20 μ 0.9 0.9 100 15 60 Cdknla 0.8 Cdkn2d 0.8 10 50 40 5 0.7 0.7 20 R. E. ( R. E. ( 0.6 ( height TA Ki67 cells / VCU 0.6 0 Crypt height ( 0 0 WT WT WT WT WT REG3A REG3A REG3A REG3A REG3A g h WT REG3A 100 p < 0.0001 p = 0.0054 5 M)

μ 80 DAPI 4 μ 26 μm 60 m 60 3 16S rRNA

/ 2 Mucus 40 1 20 R. E. (MUC2) thickness (

probe-Cy3/ 0 Mucin WT WT REG3A REG3A i WT REG3A p = 0.0211 p = 0.0096 ) 30 p < 0.0001 ) 1.5 1.5

20 1.0 1.0 /DAPI Cdknla Cdkn2d 0.5 0.5 Ki67 10 R. E. ( 0.0 R. E. ( 0.0 Ki67 cells / VCU 0 WT WT WT REG3A REG3A REG3A j k 100 100 4 80 3 60 50 2 40 WT p = 0.0002 WT REG3A 20 p = 0.0162 DAI score 1 WT REG3A p < 0.0001 Survival rate (%) Body weight (%) REG3A 0 0 0 036912 036912 0 36912 Days Days Days

l m 1.5 p = 0.0210 1.5 1.5 p = 0.0209 ) p = 0.0602 p = 0.002 ) β 7 α WT 1.0 1.0 1.0 6 0.5 0.5 0.5 R. E. (IL-6) REG3A 5 R. E. (IL-1 R. E. (TNF 0.0 0.0 0.0 Colon length (cm) length Colon WT WT WT WT REG3A REG3A REG3A REG3A

n p <0.0001 o p WT REG3A 8 8 p = 0.0004 80 p = 0.0002 6 6 60 4 4 40 2 2 20 Bacterium LPS (ng/ml) colons / spleen Histology score 0 0 0 WT WT WT REG3A REG3A REG3A transplantation experiment of REG3A-shaped microbiota in pan- (Supplementary Fig. 5). We next analyzed the composition of gut antibiotic-treated WT mice. More RORγt(+)IL-22(+) cells microbiota and found that the proportion of lactobacilli was high increased mucus gel in the ileum, thickened mucus layers in the in the ileum and colon of human REG3Atg mice, as compared colon tissues, and increased goblet cells and Ki67 cells in the gut with their control cohoused littermates (Fig. 3a–e). Although tissues were observed in REG3Atg feces- transplanted mice mouse Reg3 may kill some Gram-positive bacteria, Gram-positive

COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio 3 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4

Fig. 1 Gut human REG3A promotes the formation of gut mucus layers. a Fluorescence in situ hybridization of 16S rRNA and immunostaining of mucin in the ileum of human REG3Atg mice (REG3A) and control cohoused littermate wt mice (ten slides/mouse; n = 6). b qRT-PCR of mucin 2 (MUC2) in the ileum of human REG3Atg and control cohoused littermate wt mice (n = 6). c Staining of goblet cells in the ileum of control cohoused littermate wt and human REG3Atg mice. Ten slides/mouse, n = 6; VCU, villus-crypt units. d QRT-PCR of Clca3, REtnlb, and Tff2 (n = 6). e Staining of Ki67 cells (ten slides/mouse, n = 6) and qRT-PCR of Cdknla and Cdkn2d (n = 6). f Crypt and transit-amplifying (TA) heights in the ileum of wt and human REG3Atg mice. Eighty wt (WT) versus 86 human REG3A tg (REG3A) transit-amplifying compartments; ten slides/mouse, n = 6. g Fluorescence in situ hybridization of 16S rRNA and immunostaining of mucin in the proximal colon of human REG3Atg mice (REG3A) and control cohoused littermate wt mice (ten slides/mouse; n = 6). h QRT-PCR of mucin 2 (MUC2) in the colon tissues (n = 6). i Staining of Ki67 cells in the colon (ten slides/mouse, n = 6) and qRT-PCR of Cdknla and Cdkn2d (n = 6). j, k Survival rate (j), body weight, and the disease activity index (DAI) (k) after DSS (n = 18). l Length of colon tissue. m QRT-PCR of TNFα, IL1®, and IL-6 in the colon tissues after DSS (n = 6). n Hematoxylin/eosin staining and histological scores of distal colon samples after DSS. Scale bars = 40 µm. o LPS in the peripheral sera of REG3Atg and control cohoused littermate wt mice after DSS (n = 6). p Bacterium clones in the spleen after DSS (n = 6). Student’s t test, mean ± SD in b, d, and e (RE), h, i (RE), and l, m, o, and p, mean ± SEM in e (ki67 cell), f, g, and i the Mann–Whitney U test in c and n; Wilcoxon’s test in j; analysis of variance test in k; NS no significance; RE relative expression. Data are representative of three independent experiments. Also see Supplementary Figs. 1 and 2 lactobacilli are not sensitive to Reg314,23. We further analyzed the epithelial cells in L. NK2-infused mice (Fig. 4d). Since Trp composition of lactobacilli via in vitro culture and sequencing metabolites by IDO1 are primarily L-Kyn, more L-Kyn was analyses, and found that increased lactobacillus in human detected in the gut epithelial cells of L. NK2-infused GF mice than REG3Atg mice was close to L. murinus isolates, which was named control lactobacillus (Fig. 4e). L-Kyn in the gut epithelial cells of as L. NK2 (Fig. 3c, d and Supplementary Fig. 6a, b). We next REG3Atg mice was higher (Fig. 4f). Trp metabolism-associated employed germ-free (GF) mice to examine the effects of L. NK2 components such as IDO1 and p-Src29 were also higher in strain on RORγt(+) IL-22(+) ILC3 cells and formation of gut REG3Atg mice (Fig. 4g–i and Supplementary Fig. 11). In vivo- mucus layers (Supplementary Fig. 6c). Infusion of L. NK2 caused administered L-Kyn caused the accumulation of ROR©t(+)IL-22 increased mucus and accumulation of RORγt(+) IL-22(+) ILC3 (+) cells in both the ileum and colon tissues (Fig. 4j, k). Thus, the cells (Fig. 3f, g). Non-transplanted control GF mice housed under AhR ligand L-Kyn produced by gut epithelial cells is responsible separated but similar conditions had less RORγt(+)IL-22(+) cells for lactobacillus-mediated ROR γt(+)IL-22(+) cells. (Fig. 3f, g), consistent with previous data in GF mice24,25. Moreover, the effect of lactobacillus is bacteria-species specific. L. NK2 strain than L. NK1 strain, which is homologous with L. Lactobacillus-derived L-Orn is a critical factor for ILC3.We taiwaness isolate23, caused more remarkable accumulation of next sought to address how lactobacillus regulates the expression RORγt(+)IL-22(+) cells in GF mice (Fig. 3f, g). Increased mucus of IDO1 in gut epithelial cells. In addition to cytokine-mediated gel in the ileum, thickened mucus layers in the colon tissues, and activation, IDO1 signaling can also be triggered by metabolites increased goblet cells and Ki67 cells in the gut tissues were also such as L-Orn29; thus, we hypothesized that REG3A-associated observed in L. NK2 strain- transplanted GF mice (Fig. 3h, i and lactobacillus might produce some metabolites to regulate the Supplementary Fig. 6d–f). The increased RORγt(+) IL-22(+) expression and activity of IDO1. Indeed, there was increased L- cells, thickened gut mucus, and increased Ki67 cells were also not Orn in the gut contents of GF mice with L. NK2 colonization found in germ-free REG3A tg mice (Fig. 3j–m). Thus, we (Supplementary Fig. 8a). Increased L-Orn was further confirmed demonstrate that lactobacillus L. NK2 alone promotes the accu- by ELISA in the ileum but also in the colon contents (Supple- mulation of RORγt(+) IL-22(+) in gut tissues. mentary Fig. 8b). Higher levels of L-Orn were also detected in the contents of the ileum and colon of REG3Atg mice (Supplementary Increased ILC3 is related to lactobacillus-induced L-Kyn.We Fig. 8c). L-Orn may upregulate IDO1 in macrophages and den- next determined how REG3A-associated lactobacillus was formed dritic cells30. When gut ileum and colon epithelial cells were to cause the accumulation of CD45(+)Lin(–)ROR□t(+)IL-22(+) exposed to different concentrations of L-Orn in vitro, L-Orn also cells. Previous studies showed that AhR ligand indole-3-aldehyde upregulated the expression of IDO1 in these tissues (Supple- (IAld) from lactobacillus may contribute to AhR-dependent IL-22 mentary Fig. 8d, e). Importantly, L-Orn-infused mice had a high transcription10. However, this was not the case for REG3A- level of IDO1 in their gut epithelial cells; whereas L-Orn inhibitor associated lactobacillus (Supplementary Fig. 7). Studies have also DFMO, which may inhibit L-Orn to putrescine29, suppressed the shown that diverse host-derived signals can regulate and cause expression of IDO1 (Supplementary Fig. 8f, g and Fig. 5a). the accumulation of ROR©t(+)IL-22(+) cells, such as AhR Notably, spermidine, a metabolite of L-Orn also induced the ligands derived/generated from host cells26,27, chemotaxis, and expression of IDO-1 (Supplementary Fig. 8h), implying that L- + 28 IL-23 by CX3CR1( ) mononuclear phagocytes . To investigate Orn-mediated IDO-1 expression may be through its metabolites. the factor(s) which is responsible for an increase in CD45(+)Lin L-Kyn increased in the epithelial cells in L-Orn-infused mice, but (–)ROR©t(+)IL-22(+) cells, we employed a microarray to com- DFMO caused reduced L-Kyn in REG3Atg mice (Fig. 5b). Thus, pare the gene expression of gut ileum epithelial cells and gut lactobacillus-derived L-Orn promotes the production of the AhR immune tissues (Payer’s patch node). We did not find ROR©t(+) ligand L-Kyn in gut epithelial cells. Increased RORγt(+) IL-22 IL-22(+) cells associated with chemokines and/or IL-23 (+) ILC3 cell populations and higher levels of IL-22 were also (GSE111111). Interestingly, L. NK2 colonization in GF mice detected in the ileum and colon of L-Orn-infused mice (Fig. 5c, induced at least a twofold change in the expression of multiple d). Conversely, L-Orn inhibitor (DFMO) decreased accumulation other genes in gut epithelial cells, typically indoleamine 2,3- of RORγt(+) IL-22(+) cells in the gut tissues (Fig. 5c, d). dioxygenase 1 (IDO1) (Fig. 4a and GSE111111), which is a critical Unsimilar to wt mice, IDO-1 KO mice did not exhibit the same enzyme for tryptophan (Trp) metabolism to produce AhR ligends responses to L-Orn (Fig. 5e). Administration of L-Orn also pro- such as L-Kyn (Fig. 4b)26,27. QRT-PCR and immunoblotting also moted mucin secretion, goblet cell production, and cell pro- exhibited the higher expression of IDO1 in the gut epithelial liferation in wt mice. Conversely, L-Orn inhibitor-infused tissues of lactobacillus-infused mice (Fig. 4c and Supplementary REG3Atg mice had reduced mucin secretion, goblet cell produc- Fig. 11). Importantly, IDO1 was mainly expressed in gut tion, and cell proliferation (Fig. 5f–h). Thus, lactobacillus-derived

4 COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4 ARTICLE

a Gated CD45+ Gated CD45+ Gated CD45+ 10.9 2.09 2.37 1.77 3.96 1.44 p < 0.0001 p = 0.0016 24 4 4 p = 0.1680

18 3 3 WT 12 10.4 2 2 6 1 1 18.1 2.79 2.46 2.1 6.71 2.38 CD4+IL22+cell (%) CD4-IL22+cells (%) 0 0 0 WT REG3A WT REG3ACCD4+IL17+cells (%) WT REG3A REG3A

IL-22 18.1 IL-17 IL-17 CD4 CD4 IL-22

Gated CD45+Lin– Gated CD45+Lin– p < 0.0001 b 24

1.31 10.7 26.8 18 75.9 t+IL22+ 12 γ WT cells (%) 6 ROR 22.5 14.7 0 WT REG3A

10.6 p < 0.0001 2.55 18.2 15

72 10

t+IL22+NKp46 5 REG3A γ

35.3 20.3 –CD4–cells (%) SSC SSC ROR

IL-22 0 Untreated Stimulated NKp46 CD4 WT REG3A RORγ t

p = 0.0001 c Gated CD45+Lin– Gated CD45+Lin– 10

3.12 t+IL22+ 5

0.11 36.9 γ 71.4 cells (%) ROR WT 0 6.87 3.59 WT REG3A

p < 0.0001 7.56 24.2 1.5 0.47 56.6

REG3A 1.0

0.5 t+IL22+NKp46– IL-22 12.7 6.74 SSC SSC γ CD4-cells (%) Untreated Stimulated NKp46 CD4 0.0 ROR RORγt WT REG3A

d p = 0.0230 e p = 0.0121 p = 0.0121 20 15 15 15 10 10

t+IL22+ 10 Gated CD45+Lin– Gated CD45+Lin– γ cells (%) 5 5 5 ROR 9.1 15.4 R. E (IL-22 .) R. E (IL-22 .) 0 0 0 NC/ad Reg3a/ad WT REG3A WT REG3A

p =0.0015 p = 0.0166 p = 0.0198 15 10 10 IL-22 22.4 28.5 10 NC/ad Reg3a/ad 5 5 5 γ R. E (IL-22 .)

ROR t t+IL22+NKp46– R. E (IL-22 .) γ CD4-cells (%) 0 0 0

ROR NC/ad Reg3a/ad NC/ad NC/ad Reg3a/ad Reg3a/ad

f WT/Iso WT/IL22 Ab g WT/Iso WT/IL22Ab p = 0.0001 30 M) μ 20

10 Mucin Mucin2

Mucin thickness ( 0

REG3A/Iso REG3A/IL22Ab WT/Iso REG3A/Iso REG3A/IL22 Ab WT/IL22Ab

p < 0.0001 80 M) μ Mucin Mucin2 40

Mucin thickness ( 0

REG3A/Iso REG3A/IL22Ab

Fig. 2 REG3A-mediated gut mucus layers depend on RORγt(+)IL-22 (+) ILC3 cells. a Flow cytometry of CD4(+)IL22(+), CD4(–)IL-22(+), CD4(+)Th17 (+), and Th22(+)IL17(–) cells in the ileum lamina propria (LP) of human REG3Atg (REG3A) and control cohoused littermate wt mice (n = 6). b, c, Flow cytometry of ROR©t(+)IL22(+) cells and their subsets in the ileum (b) and colon (c) LP of wt and human REG3Atg mice (n = 6). d Flow cytometry of ROR©t(+)IL22(+) cells in the ileum LP of mice with (Reg3〈/ad) or without (NC/ad) Reg3〈/adenovirus injection (n = 3). e QRT-PCR of IL-22 in the ileum and colon of human REG3Atg and control littermate wt mice (upper) and in the ileum (left) and colon (right) of mice with (Reg3〈/ad) or without (NC/ad) Reg3a/adenovirus injection (lower). f, g Staining of ileum mucin (f) and colon tissues (g) in human REG3Atg or control littermate wt mice using IL-22-neutralizing antibody or control isotype antibody (Iso) (ten slides/mouse in g); scale bars = 40 µm. Student’s t test, mean ± SD in a–e, mean ± SEM in g, n = 6; NS no signiﬁcance; RErelative expression; data are representative of three independent experiments. Also see Supplementary Figs. 3, 4

COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio 5 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4

a c 100 Lactobacillus S24-7_norank p < 0.0001 Allobaculum p < 0.0001 p = 0.1331 p = 0.2262 Lactococcus Candidatus Arthromitus 5 20 2 80 Parasuttereπa Candidate_division _TM7_norank 4 2 Enterorhadbus Streptococcus Bifidobacterium 3 60 Bacillus 10 1 Lachnospiraceae_uncultured 2 . NK2 1 Reuteri Johnsoni Pseudomonas L

Coriobacteriaceae_unclassified L.

Lactobacilli 1 L. fold changes

Desulfovibrio fold changes fold changes 40 Arthrobacter fold changes Akkermansia 0 0 0 0 Lysinibacillus Escherichia-Shigella WT Solibacillus WT WT WT

Relative abundance (%) abundance Relative 20 Chloroplast_norank REG3A Coriobacteriaceae_uncultured REG3A REG3A REG3A Facklamia Actinobacillus Others d p = 0.0410 0 p < 0.0001 p = 0.2066 p = 0.8664 WT 8 8 8 8 REG3A

4 4 4 4 16S rRNA Reuteri 16S rRNA 16S rRNA . NK2 16S rRNA 10

b L 10 . Johnsoni 100 S24-7_norank 10 L. 10 Lactobacilli

Lachnospiraceae_uncultured L

Prevotellaceae_uncultured copies/g feces copies/g feces 0 copies/g feces 0 Log copies/g feces 0 Log 0 Lactococcus Log Prevotella Log 80 Bacteroides WT WT WT WT Lachnospiraceae_unclassified Alistipes REG3A REG3A Allobaculum REG3A REG3A Ruminococcaceae_uncultured 60 Ruminococcaceae_incertae_sedis Odoribacter e Desulfovibrio Parasutterella p < 0.0001 p < 0.0001 Akkermansia 40 40 Ruminococcaceae_unclassified 40 Helicobacter Candidate_division_TM7_norank 30 Mucispirillum 30 Lachnospiraceae_incertae_sedis

Relative abundance (%) abundance Relative Parabacteroides 20 20 Rikenella 20 Escherichia-Shigella Oscillibacter 10 Others 10

0 L. NK2 positive 0 0 in colon tissues (%) clones in feces (%)

WT L. NK2 positive clones WT WT REG3A REG3A REG3A

f Gated CD45+Lin– p < 0.0001 p < 0.0001 4.21 15 8 2.25 7.31 p = 0.0014 p = 0.0001 6 10 t+IL22+

γ 4 IL-22 cells (%) 5 2

12.4 7.08 t+IL22+NKp46– ROR 5.09 γ 0 CD4-cells (%) 0 RORγt GF GF SPF ROR SPF GF GF/NK2 GF/NK1 g Gated CD45+Lin– GF/L.NK.2GF/L.NK.1 GF/L.NK.2GF/L.NK.1 p < 0.0001 0.32 p = 0.0003 0.98 0.57 1.0 4 p < 0.0001 p = 0.0006 0.5 t+IL22+

IL-22 2 γ

4.54 t+IL22+NKp46– cells (%) 3.32 5.01 γ

CD4-cells (%) 0.0 RORγt ROR 0 GF

ROR SPF GF GF/NK2 GF/NK1 GF SPF GF/L.NK.2GF/L.NK.1 GF/L.NK.2GF/L.NK.1

h p < 0.0001 GF/NC GF/L. NK.2 GF/L. NK.1 8 p > 0.9999

4 Lac 16S Lac.Probe / tissues 10 0 Log copies/g ilieum GF SPF Mucin GF/L.NK.2GF/L.NK.1 GF/L.NK2 p < 0.0001 i GF GF/L.NK1 100 p < 0.0001

M) 50 μ ( Mucin

Mucus thickness 0

GF SPF

GF/L.NK.2GF/L.NK.1 j l WT REG3A p > 0.9999 0.06 3.91 1.2 WT 0.8 11.2 8.86 0.4 Mucin

0.05 4.14 R. E.(MUC2) 0.0

REG3A WT REG3A 12.7 9.15 IL-22 WT REG3A p = 0.6815 30

Untreated Stimulated M) μ p = 0.3153 20 Mucin 10

4 Mucus 0 t+IL22+ thickness ( γ 2 WT cells (%) REG3A

ROR 0 WT REG3A

k m WT REG3A 8 p = 0.2879 WT 0.22 1.28 4 Ki67 Ki67 cells

/VCU in ileum 0 6.31 5.91 WT REG3A 0.12 1.24 WT REG3A p = 0.6213 REG3A 8

Ki67 4 6.69 5.05 IL-22

Untreated Stimulated Ki67 cells

/VCU in colon 0 p = 0.7741 WT 2 REG3A

t+IL22+ 1 γ cells (%)

ROR 0 WT REG3A

L-Orn is a critical factor for lactobacillus-mediated ROR©t(+)IL- in lactobacillus (Supplementary Fig. 9a)31. Indeed, L. NK2 pro- 22(+) cells and gut mucus formation. duced L-Orn through Arg metabolism, but L. NK2 and L. reuteri more effectively used Arg to produce L-Orn than L. NK1 (Sup- L-OCT deﬁciency impedes the effect of lactobacillus. L-Orn plementary Fig. 9b). The ADI pathway comprises three reactions may be derived from Arg metabolism through the ADI pathway catalyzed by Arg deminase (ADI; EC3.5.3.6), ornithine

6 COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4 ARTICLE

Fig. 3 REG3A-associated lactobacillus is critical in increased RORγt(+)IL-22 (+) ILC3 cells in gut tissues. a, b 16S rRNA analyses of gut microbiota in the ileum contents (a) and colon contents (b) of wt and human REG3Atg mice (REG3A) under normal chow (N. Chow) (n = 6). c Proportion of lactobacillus genus and species in the ileum of wt and huREG3 〈tg mice (n = 6). d QPCR of lactobacillus genus, lactobacillus NK2 (L.NK2), lactobacillus Reuteri (L. Reuteri), and lactobacillus Johnsoni (L. Johnsoni) in the feces.ePercentage of lactobacillus NK2 (L.NK2) in the total lactobacilli of feces (left) and colon tissues (right) of wt and human REG3Atg mice (n = 6). Lactobacilli in feces and colon tissues were cultured and sequenced using 16S rDNA. f, g, Flow cytometry of IL-22(+)RORγt (+) and IL-22(+)RORγt(+) NK46(–)CD4(–) cells in the ileum (f) and colon (g) LP of GF mice with or without L. NK1 (NK1) or L.NK2 (NK2) colonization (n = 6). h Staining of mucus layers in the ileum from GF mice with or without L. NK2 or L. NK1 colonization. Tissue sections were stained with anti-mucin 2 antibody (green) and hybridized to a probe that recognized 16S rRNA of lactobacillus (red) and a nonspecific scrambled probe and counterstained with DAPI to visualize the nuclei (blue). Ten slides/mouse were analyzed (n = 5). i Staining of mucus layers in the colon from GF mice with or without L. NK2 or L. NK1 colonization. Ten slides/mouse were analyzed (n = 5). GF mice were colonized with L. NK2 or L. NK1 (1⋅109/mouse). j, k, Flow cytometry of ROR©t(+)IL22 (+) cells and QRT-PCR of IL-22 in the ileum (j) and colon (k) LP of wt and REG3Atg germ-free mice (n = 3). l Staining and qRT-PCR of ileum mucin and colon tissues in REG3Atg and wt germ-free mice. m ki67 cells in the ileum and colon epithelial cells of REG3Atg and control wt germ-free mice. SPF, wt mice raised in specific pathogen-free (SPF) environment. Student’s t test, mean ± SD in c, e, l, and m; ANOVA plus post-Bonferroni analysis in f–i; NS no significance; R.E relative expression. Data in c–m are representative of at least three independent experiments. Also see Supplementary Fig. 5 and Fig. 6 carbamoyl-transferase (OCT: EC2.1.3.3), and carbamate kinase We demonstrate that the proportion of L-Orn-producing lacto- (CK: EC 2.7.2.2), leading to the conversion of Arg into ornithine bacilli in the gut contents may be regulated by gut epithelial (Supplementary Fig. 9a)31. We prepared L. reuteriΔOCT but REG3A. Thus, there exists a gut epithelial REG3A—lactobacillus- failed to generate L. NK2ΔOCT. The generated L. reuteriΔOCT derived L-Orn—L-Kyn in gut epithelial cells—RORγt(+) IL-22 did not produce L-Orn in vitro in the presence of Arg (Supple- (+) ILC3 immune cell axis to maintain gut mucosal homeostasis. mentary Fig. 9b). OCT deficiency affected the concentration of L- Our data improve understanding of the mechanism of gut Kyn not only in the ileum but also in the colon epithelial tissues mucosal homeostasis. Since the gut mucosal homeostasis plays a (Supplementary Fig. 9c). The levels of both IDO1 and p-Src in the critical role in human diseases such as colitis and metabolism- gut epithelial cells of OCT-deficient lactobacillus-colonized mice associated diseases, our findings also offer insight for prevention were lower (Supplementary Fig. 9d–f). The proportion of CD45 and treatment of these diseases. (+) RORγt(+)IL-22(+)lin(–)NKp46(–)CD4(–) ILC3 cells, We demonstrate that lactobacillus-derived L-Orn may upregulate decreased mucus gel, thinner mucus layers, and reduced mucin 2 IDO1 in gut epithelial cells to produce AhR ligand L-Kyn. AhR were also observed in these OCT-deficient lactobacillus-colonized ligands that drive the differentiation of ILC3 immune cells may be mice (Supplementary Fig. 9g–i). L. reuteri also produced the AhR entirely derived from the endogenous ligands, such as the Trp ligand indole-3-aldehyde10. But no differences were detected in L- metabolites L-Kyn24,27. Several cell types, including specificsubsets Kyn in the gut content between wild-type L. reuteri and OCT- of dendritic cells (DCs), macrophages, and immature monocytes, deficient L. reuteri. Higher levels of L-Orn could be detected in L. express increased levels of IDO1, which may promote the AhR reuteri and L.NK2-infused mice (Supplementary Fig. 9j). Both L. ligand production in response to inflammatory cues, such as reuteri and OCT- deficient L. reuteri had a similar proliferative interferon γ (IFNγ) or signal transducer and activator of tran- ability (Supplementary Fig. 9k). scription 3 (STAT3)-activity stimuli32,andCpGoligodeox- Since L.NK2 promotes the homeostasis of not only the small ynucleotides (ODNs)32. However, our data exhibit that gut epithelial intestine but also the colon, we employed DSS- mediated colitic cells also produce AhR ligand L-Kyn by L-Orn through upregu- model to assess the physiological function of lactobacillus-derived lating IDO1. Previous studies show that IDO1-positive staining may L-Orn in resisting DSS- mediated colitis. L-Orn administration be primarily detected within the interstitial space of the villi or promoted resistance of wt mice to DSS-induced colitis; whereas mucosal layer33. IDO1 expression at mucosal sites may be modu- L-Orn inhibitor decreased the resistance of human REG3Atg to DSS- lated during immune activation33. Recent studies also reveal that mediated colitis (Fig. 6a–g and Supplementary Fig. 10a, b, e, f). The L-Orn may upregulate IDO1 in the macrophages and DCs29. levels of serum LPS were lower and the numbers of bacterium Lactobacillus may produce L-Orn through arginine (Arg) clones in the spleen were less in L-Orn-administered mice metabolisms. Others also reported that lactobacillus could pro- (Supplementary Fig. 10c, d); whereas there were higher levels of duce L-Orn30,34. Interestingly, Arg has been found to preserve serum LPS and the more bacterium clones in L-Orn inhibitor intestinal barrier integrity in animals after intestinal obstruction35 administered human REG3Atg mice after giving DSS (Supplemen- and dextran sodium sulfate (DSS) colitis. It has also been estab- tary Fig. 10g, h). OCT-deficient lactobacillus, which did not produce lished that Arg may improve the migration of epithelial cells, L-Orn, reduced the resistance of mice to DSS-mediated colitis increase villus height and crypt depth, and decrease cell apoptosis (Fig. 6i–k and Supplementary Fig. 10i, j). Similar effectiveness was in methotrexate (MTX)-induced mucositis and DSS colitis35. also observed in L. NK2-transplanted mice, which were adminis- Long-term increased polyamine (L-Orn metabolites) intake ele- tered using L-Orn inhibitor DFMO (Fig. 6l–n and Supplementary vated blood spermine levels and inhibited aging-associated Fig. 10m, n). They also had higher levels of serum LPS and the more pathologies in mice and humans36. Since L-Orn from lactoba- bacteria in the spleen of OCT-deficient lactobacillus-infused mice cillus through Arg metabolism may promote gut mucus home- and also in L. NK2 transplantation with L-Orn inhibitor- treated ostasis, our results expand understanding of the mechanism by mice after giving DSS (Supplementary Fig. 10k, l, o, p). These results which Arg contributes to this homeostasis. Others also found that demonstrate that lactobacillus- derived L-Orn plays a critical role in some lactobacilli, such as L. reuteri, have an effect on IL-22 maintaining gut mucosal homeostasis. production by producing indole-3-aldehyde10. Thus, multiple lactobacillus strains or multiple effects of one lactobacillus strain are involved in the regulation of RORγt(+)IL-22(+) ILC3 cells Discussion through different mechanisms. However, previous reports We found that lactobacillus may promote the homeostasis of gut showed that REG3α could produce cytotoxity to Gram + bacteria. mucus layer through producing L-Orn. L-Orn stimulates Trp This may be that Lactobacillus is different from other Gram+ metabolism to produce AhR ligands in gut epithelial cells, which bacteria. It is possible that the cytotoxity of REG3 to other induce accumulation of RORγt(+) IL-22(+) ILC3 in gut tissues. Gram+ bacteria may affect proliferation and growth of

COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio 7 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4

a b Tryptophan TpH 5-Hydroxy-L-tryptophan O2 O2

GF/L.NK2 GF PLP PLP IDO,Indoleamine 2,3-dioxygenase IDO AADC AADC TDO, Tryptophan dioxygenase TDO TpH, Tryptophan hydroxylase IDO1 AFMID,Kynurenine formamidase CO2 AADC, Aromatic L-amino acid Tryotamine decarboxylase TpH1 Serotonin KMO, Kynurenine 3-monooxygenase O2 N-Formykynurenine PLP, Pyridoxal phosphate TDO2 KMO ALDH, Aldehyde dehydrogenase H O 2 mitochondrial

TpH2 H2O IAAId, Indole-3-Aldehyde AFMID IAAId 0.00 0.28 0.56 0.84 –0.84 –0.56 –0.28 Kynurenine*

c p = 0.0003 d GF GF/L.NK2 8 p = 0.0125 6 4 p = 0.0023

2 IDO-1 R.E (IDO1) p < 0.0001 p = 0.1331 200 0

GF 150 SPF GF/L.NK1 SPF 100 GF/L.L.NK1GF/L.L.NK2 50 42 kDa IDO1 Ido1 expression 0 Actin IDO-1 43 kDa (fluorescence intensity) GF SPF GFGF/ GF/ SPF L.NK1 L.NK2 GF/L.NK.2GF/L.NK.1

e Ileum Colon f Ileum Colon p < 0.0001 p < 0.0001 p < 0.0001 p < 0.0001 2 1.5 p = 0.0295 2 p = 0.0400 2 p < 0.0001 1.0 p < 0.0001 1 g/g protein) g/g protein)

g/g protein) 1 μ g/g protein) μ

μ 1 μ 0.5 L-Kyn (

0 L-Kyn ( L-Kyn ( 0 0.0 L-Kyn ( 0 GF SPF GF WT WT SPF REG3A REG3A GF/L.NK.2GF/L.NK.1 GF/L.NK.2GF/L.NK.1

g Ileum Colon h i p = 0.0006 Ileum 8 4 p = 0.0013 Ileum 60kd p-Src 6 3 42kd IDO1 Src 4 2 43kd Actin 55kd 2 1 WT REG3A Actin

R. E. (IDO1) 43kd 0 0 WT REG3A WT WT REG3A REG3A

jkGated CD45+Lin– p = 0.0024 Gated CD45+Lin– 30 4 p = 0.0021 20 2 t+IL-22+

14.2 t+IL-22+ 2.69 γ

γ 10 cells (%) cells(%)

0 ROR 0 ROR WT/Vehicle WT/Vehicle WT WT WT/Kyn WT/Kyn 6.75 24.4 p = 0.0002 20 p = 0.001 1.5 WT/Kyn WT/Kyn t+IL-22+

10 γ t+IL-22+ γ IL-22

IL-22 0.5

RORγt RORγt ROR

ROR 0 NKp46-CD4-cells (%)

NKp46-CD4-cells(% WT WT WT/Kyn WT/Kyn

Fig. 4 REG3A-associated lactobacillus promotes production of L-Kyn in gut epithelial cells. a Microarray of the ileum epithelial cells in REG3A-associated lactobacillus-colonized GF mice (GF/L.NK2) and control uncolonized GF mice (n = 6). b Metabolism map of tryptophan in mouse gut epithelial cells. c QRT- PCR and immunoblotting of IDO1 in the ileum tissues of L. NK2 or L. NK1-colonized GF mice and control uncolonized GF mice. SPF, wt mice raised in SPF environment. d Immunostaining of IDO1 in the ileum tissues of REG3A-associated lactobacillus-colonized GF mice and control GF mice (representative image, n = 6). e L-Kyn ELISA of the ileum (left) and colon (right) epithelial cells of REG3A-associated lactobacillus-colonized GF mice and control GF mice (n = 6). f L-Kyn ELISA of the ileum (left) and colon (right) epithelial cells of human REG3A tg mice and their control littermates (n = 6). g, h QRT-PCR (g) and immunoblotting (h) of IDO1 in the ileum or colon epithelial cells of human REG3Atg mice and their control littermates. i Immunostaining of p-Src in the ileum epithelial cells of human REG3Atg mice and their control littermates. j, k Flow cytometry of CD45(+)RORγt(+)IL-22(+) and their subsets in the ileum (j) and colon (k) LP of mice with or without L-Kyn infusion. Scale bars = 40 µm; Student’s t test was used in f, g, j, and k. ANOVA plus post- Bonferroni analysis in c, d, and e; NS no signiﬁcance; RE relative expression. In h and i, different individuals were indicated

8 COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4 ARTICLE

a p = 0.0029 WT WT/L-Orn REG3A REG3A/DFMO p < 0.0001 200

IDO1 150 intensity) (fluorescence Ido1expression 100

WT REG3A b WT/L-Orn 100 WT WT/L-Orn REG3A REG3A/DFMO REG3A/DFMO p = 0.0016 p = 0.0011 75 4

50 3 2 25 Intensity (%) (L-Kyn) 1 g/g gut tissue μ 0123123012300 123 0

RT (min) WT REG3A WT/L-Orn

c Gated CD45+Lin– Gated CD45+Lin– e REG3A/DFMO p < 0.0001 25 30 p = 0.0017 p = 0.4183 12.1 23.5 20 20 15 t+IL22+

WT REG3A γ 10 10 t+IL22+cells γ cells (%)

29.7 in Ileum (%) 5

15.6 ROR 0 ROR 0 WT IL-22 REG3A WT/L-Orn WT/L-Orn REG3A/DFMO IDO1–/– RORγt REG3A/DFMO IDO1–/–/L-Orn d Gated CD45+Lin– Gated CD45+Lin– p < 0.0001 p < 0.0001 2.12 5.43 6 4 p = 0.6681 4 WT REG3A t+IL22+

γ 2 t+IL22+cells

cells(%) 2 4.64 2.67 γ ROR in colon (%) 0 ROR 0 IL-22 WT/L-Orn REG3A/DFMO WT γ REG3A IDO1–/– ROR t WT/L-Orn IDO1–/–/L-Orn REG3A/DFMO

f 8 p = 0.0121 p = 0.0460 WT WT/L-Orn REG3A REG3A/DFMO 6 4

Mucin 2 R.E (IL-22) 0

WT g REG3A WT/L-Orn WT/Veh WT/L-Orn REG3A REG3A/DFMO REG3A/DFMO p < 0.0001 25 p = 0.0031

Ki67 20 15 10 5

Ki67 cells/VCU 0

WT h REG3A WTWT/L-Orn REG3A REG3A/DFMO WT/L-Orn REG3A/DFMO 80 p < 0.0001 p < 0.0001 60 Mucin M) 40 μ ( 20 0 Mucus thickness

WT REG3A WT/L-Orn

REG3A/DFMO

Fig. 5 Lactobacillus-derived L-Orn promotes the production of AhR ligand L-Kyn in gut epithelial cells. a Immunostaining of IDO1 in the ileum after L-Orn administration in wt mice or L-Orn inhibitor DFMO administration in human REG3Atg mice. b HPLC/MASS of L-Kyn in the ileum epithelial cells after administrating L-Orn or L-Orn inhibitor DFMO (n = 6). c, d Flow cytometry of RORγt(+) IL-22(+) cells in the ileum (c) and colon (d) of mice after administering L-Orn or L-Orn inhibitor DFMO. e Flow cytometry of RORγt(+) IL-22(+) cells in the ileum and colon of IDO-1 KO with or withour L-Orn. f Immunostaining and qRT-PCR of mucin in the ileum of mice after administering L-Orn or L-Orn inhibitor DFMO (ten slides/mouse, n = 6). g Staining of Ki67 cells in the ileum of mice after administering L-Orn or L-Orn inhibitor DFMO (ten slides/mouse, n = 6). h Immunostaining of mucin in the colon of mice after administering L-Orn or L-Orn inhibitor DFMO (ten slides/mouse, n = 6). WT, wild-type mice; WT/Orn, L-Orn-fed mice; REG3A, human REG3Atg mice; REG3A/DFMO, L-Orn inhibitor DFMO-fed mice. IDO-1 KO/L-Orn, L-Orn-fed IDO-1 KO mice. Scale bars = 40 µm; Student’s t test, mean ± SD in e; ANOVA plus post-Bonferroni analysis in a, b, c, d, f, g, and h; NS no signiﬁcance; RE, relative expression. Data are representative of at least three independent experiments. Also see Supplementary Fig. 7

COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio 9 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4

a L-Orn/DFMO 2.5% DSS (–) d Vehicle D-7 D0 D7 D14 2.5% DSS (+) L-Orn

b c 100 4 p = 0.0005 100 Vehicle p < 0.0001 80 L-Orn 8 3 60 80 (cm) 6 40 2 Vehicle 60 Vehicle Colon length 20 p = 0.0207 DAI score 1 4 L-Orn p = 0.0228 L-Orn Survival rate (%)

0 Body weight (%) 40 0 L-Orn 036912 036912 0 369 12 Vehicle DaysDays Days g REG3A

REG3A e f /DFMO 100 5 100 REG3A/DFMO p < 0.0001 80 4 REG3A p = 0.0008 60 80 3 8 40 2 60 REG3A/DFMO DAI score 6 20 REG3A/DFMO p = 0.0033 1 (cm) p = 0.0158 REG3A Survival rate (%) REG3A Body weight (%)

40 Colon length 0 0 4 036912 0 369 12 0 369 12 Days Days Days REG3A

REG3A/DFMO k h Lac/Lac+DFMO 2.2% DSS (–) L. reuteri

D-14 D-7 D0D7 D14 Pan-antibiotics 2.2% DSS (+) L. reuteri DOCT

i p = 0.0335 j 100 p < 0.0001 5 L. reuteri DOCT p < 0.0001 8 L. reuteri 80 100 4 60 7 80 3 40 2 6 L. reuteri DOCT 60 DAI score 20 L. reuteriDOCT 1 Survival rate (%) L. reuteri * p = 0.0417 5 L. reuteri Colon length (cm) 0 Body weight (%) 40 0 0 369 12 036912 036912 DOCT L. reuteri Days Days L. reuteri l m n 100 L.NK2

L.NK2/DFMO 80 100 5 p < 0.0001 L.NK2 L.NK2 60 4 /DFMO 80 3 40 2 L.NK2/DFMO 60 9 p = 0.0016

20 p = 0.0297 L.NK2/DFMO DAI score Survival rate (%) L.NK2 p = 0.0465 1 L.NK2 8 0 Body weight (%) 40 0 036912 036912 036912 7 Days Days Days 6 5 Colon length (cm)

L.NK2

L.NK2/DFMO lactobacilli. There also exist increased Gram-positive lactobacilli experimental litters were bred and maintained under speciﬁc pathogen-free con- in other Regtg mice14,23. ditions in the Animal Center of Nankai University. Experiments were carried out using age- and gender-matched mice. All procedures were conducted according to the Institutional Animal Care and Use Committee of the Model Animal Research Methods Center. Animal experiments were approved by the Institute’s Animal Ethics Mice. Four- to six-week-old male or female C57BL/6 mice were obtained from Committee of Nankai University. All experimental variables such as husbandry, Nanjing Animal Center. IDO-1–/– mice were from Nanjing Animal Center. All parental genotypes, and environmental inﬂuences were carefully controlled.

10 COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4 ARTICLE

Fig. 6 Lactobacillus-derived L-Orn promotes resistance to DSS-mediated colitis. a Experimental design for B–G. b, c, Survival rate (b) and body weight and the disease activity score (c) were monitored after the start of DSS. Wild-type (WT) mice with (L-Orn) or without (Vehicle) administration of L-Orn (n = 18, male). d Length of colon tissue in wild-type mice with or without administration of L-Orn. Mice were killed on day 7 after the start of DSS and colon length was measured. e, f, Survival rate (e) and body weight and the disease activity index (f) were monitored after the start of DSS. Human REG3Atg mice with (REG3a/DFMO) or without (REG3A/Vehicle) administration of DFMO (n = 18, male) mice. g Length of colon tissue in human REG3Atg mice with or without administration of DFMO mice. Mice were killed on day 7 after the start of DSS and colon length was measured. h Experimental design for i–n. i, j, Survival rate (i) and body weight and the disease activity score (j) were monitored after the start of DSS. Mice were infused with L. reuteri or L. reuteri/ ΔOCT (n = 18, male). k Length of colon tissue in mice after infusing L. reuteri or L. reuteri/ΔOCT. Mice were killed on day 7 after the start of DSS and colon length was measured. l, m, Survival rate (l) and body weight and the disease activity score (m) were monitored after the start of DSS. Mice were infused with or L. NK2 with DFMO (n = 18, male) mice. n Length of colon tissue in mice after infusing L. NK2 or L. NK2 with DFMO. Mice were killed on day 7 after the start of DSS and colon length was measured. Wilcoxon’s test in b, e, i, and l; analysis of variance test in c, f, j, and m; Student’s t test in d, g, k, and n;NS no signiﬁcance; RE relative expression. Data are representative of three independent experiments. Also see Supplementary Fig. 9

C57BL/6 germ-free (GF) mice were generated by Shanghai SLAC Laboratory Gut microbiota analysis. Gut microbiota was analyzed according to our pre- Animal Co. LID. All experiments in GF mice were performed in Shanghai SLAC viously reported method23. Briefly, gut microbiota were analyzed by Majorbio Laboratory Animal Co. LID. Human REG3A transgenic mice (human REG3Atg) Biotechnology Company (Shanghai, China) using primers that target to the V3–V4 mice were prepared by Nanjing Animal Center. HD5 promoter, which may spe- regions of 16S rRNA. Operational Taxonomic Unit (OTU) analysis was performed cifically promote the REG3A expression in gut Paneth cells, was conjugated into as follows: sequences were processed (trimmed) using the Mothur software and Pinsulator–pHD5-promoter–CDS–polyplasmid. The fragments of REG3A–CDS subsequently clustered at 97% sequence identity using cd-hit to generate OTUs. and polyA were cloned into HD5 promoter–Pinsulator. This conjugation was The OTU memberships of the sequences were used to construct a sample–OTU demonstrated using primers (M13F: GCCAGGGTTTTCCCAGTCACGA and count matrix. The samples were clustered at genus and OTU levels using the HD5-REG3A-tR: GTAGGGTATGATGTGACGTTTG) and sequencing using the sample–genus and sample–OTU count matrices, respectively. For each clustering, primers (HD5-tR:CAGCATGGTGGTACATGCCT and CDS-tF: GGCAACATAT Morisita–Horn dissimilarity was used to compute a sample distance matrix from GCCCATATGC). Human REG3Atg mice were identified using the following pri- the initial count matrix, and the distance matrix was subsequently used to generate mers (REG3A-tF3: GAGCCCAATGGAGAAGGTTGG and REG3A -tR3:GTCCT a hierarchical clustering using Ward’s minimum variance method. For the absolute TCCGAGTGAGAGACAC, which produced a 323-bp band in tg mice and no band numbers of gut lactobacilli, 16Ss rRNAs were extracted, and then amplified using in wt mice). According to this method, mice were identified as human REG3A- strain-specific primers. The concentration of each product was detected and then positive mice (human REG3Atg) and human REG3A-negative mice (wt). Human exchanged into copy numbers. Standard curves were prepared from serial dilution REG3Atg mice or wt siblings were from a cross between wt mice and human of Lactobacillus genomic 16S rRNAs. Primers used were listed in Supplementary REG3Atg mice (heterozygous mice). The mice were from different mothers. Table 1. For preparation of mouse Reg3α/adenovirus-injected mice, mouse Reg3α adenoviruses (Reg3α/Ad) were first prepared by ABM, Canada and expanded by JIKAI, China, and then ip injected into mice according to the indicated time (1 × Lactobacillus isolation and culture. Lactobacillus isolation and culture were 109 viral particles/mouse). Control empty adenoviruses (NC/Ad, 1 × 109 control performed according to previous method23. In brief, 100 mg of fresh fecal samples viral particles) were from ABM, Canada. were collected and diluted in 2 ml of BPS solution, and cultured on Rogosa SL selective medium (Sigma-Aldrich) for lactobacillus enumeration, and then colonies were identified and purified using 16S rRNA sequence analyses. Lactobacilli were Mouse models. For DSS-induced colitis, dextran sodium sulfate (DSS)-induced cultured in deMan, Rogosa, Sharpe (MRS; 3 M Health Care, St. Paul, MN) media colitis was performed according to the previous method37. Briefly, mice received and also grown on MRS agar containing 10% sucrose. Anaerobic conditions were 2.5% (wt/vol) DSS (40,000 kDa; ICN Biochemicals) or indicated doses in their generated with the sachets of AnaeroPack-Anaero (Mitsubishi Gas Chemical, drinking water for 7 days, and then switched to regular drinking water. The Japan) in an airtight jar. After 24 h of cultivation in liquid media, lactobacilli could amount of DSS water drank per animal was recorded and no differences in intake reach 1 × 109 CFU/ml. between strains were observed. For survival studies, mice were followed for 14 days For L-Orn production by lactobacillus in vitro, lactobacilli were propagated post start of DSS treatment. Mice were weighed every other day for the determi- routinely for 24 h at 37 °C in MRS broth medium. Before using to assay arginine nation of percent weight change. This was calculated as % weight change = (weight catabolism, cells were first subcultured (37 °C for 24 h) on MRS agar. Monoclonal at day X–day 0/weight at day 0) × 100. Diarrhea was scored daily as follows: 0, lactobacillus was newly propagated in MRS broth with or without 6 mM arginine, normal; 2, loose stools; 4, watery diarrhea. Blood in stool was scored as follows: 0, which was then used to induce arginine catabolism. The supernatants were normal; 2, slight bleeding; 4, gross bleeding. Weight loss was scored as follows: 0, collected at the indicated time and L-ornithine was analyzed using ELISA. none; 1, 1–5%; 2, 5–10%; 3, 10–15%; 4, >15%. Disease activity index was the average of these scores: (combined score of stool consistency, bleeding, and weight loss)/338. Mice were killed at the indicated days for histological study. Repre- Construction of OCT-deficient lactobacillus. Ornithine carbamoyltransferase sentative colon tissues were embedded in paraffin for hematoxylin/eosin (H&E) (OCT) nucleotide sequences of L. reuteri DSM 20016 (NCBI GI 148530277, staining or embedded in OCT compound (Tissue-Tek, Sakura, Torrance, CA) and Lreu_0044) and JCM 1112 (NCBI GI 183223999, LAR_0041) were used for frozen over liquid nitrogen for immunostaining. For histological evaluation, identifying a homologous gene in the genome of L. reuteri ATCC PTA 4659. The colonic epithelial damage was scored blindly as follows: 0, normal; 1, hyperproli- locus of the gene encoding the OCT and flanking nucleotide sequences in L. reuteri feration, irregular crypts, and goblet cell loss; 2, mild-to-moderate crypt loss ATCC PTA 4659 were analyzed with the BLAST program against the NCBI (10–50%); 3, severe crypt loss (50–90%); 4, complete crypt loss, surface epithelium databases (http://blast.ncbi.nlm.nih.gov/Blast. cgi). The gene coding for OCT in L. intact; 5, small-to-medium-sized ulcer (<10 crypt widths); 6, large ulcer (>10 crypt reuteri ATCC PTA 4659 was truncated according to the following method. To widths)39. construct a ΔOCT (ornithine carbamoyltransferase) deletion mutant inserted with For microbiota transplantation, germ-free mice were orally administered chloramphenicol acetyltransferase (cat, Cm), the upstream chromosomal DNA 200 □loflactobacillus (1 × 109 bacteria, once/week). In wt mice, mice were first fragment (896 bp) and the downstream chromosomal DNA fragment (949 bp) and treated with ampicillin (A, 1 g/L, Sigma), vancomycin (V, 0.5 g/L), neomycin the cat gene were amplified with the Left-F/Left-R, Right-F/Right-R, and Cat-F/ sulfate (N, 1 g/L), and metronidazole (M, 1 g/L) via the drinking water for 2 weeks. Cat-R primers. The vector pMG36e fragment was amplified by 36e-F/36e-R pri- To confirm the elimination of bacteria, stools were collected from antibiotic-treated mers. Then the four PCR products were gel purified, ligated by the one-step and untreated mice and cultured in anaerobic and aerobic conditions. Mice were cloning kit, and transformed into E. coli DH5α. The recombinant plasmid orally administered 200 □l of fecal suspension or 1 × 109 bacteria (once/week). pMG36e-left-cat-right was electroporated into L. reuteri with selection on MRS For L-kynurenine (L-Kyn) administration, mice were randomly assigned to two medium of 3 μg/ml erythromycin (Em) and 3 μg/ml Cm. The recombinant L. different treatment groups (n = 6/group). L-kynurenine sulfate (300 mg/kg, i.p.) or reuteri-containing plasmid pMG36e-left-cat-right was propagated in MRS medium vehicle (0.1 M PBS buffer) of the same volume (0.2 ml) was administered with 5 μg/ml Em at 37 ℃ for 30 generations without Em at 37 ℃ for 20 generations intraperitoneally40. for the loss of plasmid subsequently. Then the cultures of the 20th generation were For L-Orn or eflornithine (DFMO) infusion, mice were randomly assigned to serially diluted from 10 to 107 in sterilized PBS and plated onto MRS medium two different treatment groups (n = 6/group), and then mice were administered in without any antibiotics. After culturing for 48 h, the clones were spotted on the drinking distilled H2O for 14 days. The mean L-Orn consumption of mice was MRS medium with Em and Cm. After incubation at 37 °C for 48 h, the clones ∼3.3 g/kg/d41.Eflornithine (DFMO) (MedChem Express) was administered as a which were growing only on the MRS medium with Cm, were thought to be 42 fi 1% solution in drinking distilled H2O to mice for 14 days . The mean DFMO desired mutants. The sequences around the OCT gene were ampli ed and ∼ fi consumption of mice was 1.5 g/kg/d. Mice fed with H2O without L-Orn or sequenced to con rm the mutants. PCR primers used in this study were listed in DFMO were used as control. Supplementary Table 1.

COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio 11 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4

Microarray. Expression of coding mRNA was analyzed by Beijing Capitalbio HPLC/MASS analyses of gut contents. For HPLC/MASS analyses of the gut Technology Co., Ltd, according to our previously reported method43. Total RNA contents, 50 mg of sample were applied to the extraction procedure, and extracted was extracted using Trizol (Life Technologies). Contaminating DNAs were with 800 μL of methanol46. In total, 10 μL of internal standard (2.9 mg/mL, DL-o- removed using RNeasy spin columns (Qiagen). The quality of isolated RNA chlorophenylalanine) was then added. All samples were grinded to fine powder samples was evaluated with an Agilent Bioanalyzer 2100 (Agilent Technologies) using a grinding mill at 65 Hz for 90 s. The samples after grinding were vortexed and the purified RNA was quantified using a NanoDrop ND-2000 spectro- for 30 s, and centrifuged at 12,000 rpm and 4 °C for 15 min. In total, 200 μLof photometer (Thermo Fisher). The Agilent Gene Expression oligo microarrays and supernatant was transferred to a vial for HPLC–MS analysis. miRNA microarrays were analyzed using Agilent Gene Expression oligo microarrays Version 6.5, May 2010 and Agilent miRNA microarrays Version 2.3. The R Ex vivo ileum and colon stimulation. For ex vivo ileum and colon stimulation, the software (v.2.13.0) platform was applied to analyze the microarray data, and the fragmented fresh ileum and colon from untreated mice were immediately added in LIMMA (linear regression model) package was used to statistically analyze dif- − 2 ml of RPMI-1640 medium containing 10% heat-inactivated FBS (Gibco, Invi- ferentially expressed genes. Genes having a fold change >2 or < 2 and an adjusted trogen), 100 U penicillin, 100 g/ml streptomycin, and 10 mm HEPES (Gibco, p < 0.05 were considered as differentially expressed. Invitrogen), and then L-ornithine was added into culture at the indicated concentration and time. For IDO1 analyses, the ileum or colon epithelial cells were Flow-cytometry analyses. Single-cell suspensions of Peyer’s patches (PP) and separated from ileum or colon tissues using 0.1% EDTA, and expression of IDO1 spleen of mice were prepared by mashing in a cell strainer (70 mm), stained, and was analyzed using qRT-PCR and immunoblotting. analyzed by flow cytometry according to previous method44. In brief, colon or small intestine were isolated and cleaned by shaking in ice-cold PBS four times ELISA. For ELISA of L-kynurenine and L-ornithine, the preparation of tissue before tissue was cut into 1 -cm pieces. The epithelial cells were removed by homogenates was performed as previously described47,48. L-kynurenine and L- ℃ incubating the tissue in HBSS with 2 mM EDTA for 30 min at 37 with shaking. ornithine concentration in tissue homogenates or cell culture supernatants was The LP cells were isolated by incubating the tissues in digestion buffer (DMEM, 5% measured using the L-kynurenine or L-Ornithine ELISA kit (ImmuSmol). fetal bovine serum, and 1 mg/ml Collagenase IV and DNase I) for 40 min. The digested tissues were then filtered through a 40-mm filter. Cells were resuspended in 10 ml of the 40% fraction of a 40:80 Percoll gradient and overlaid on 5 ml of the Western blotting. Cell lysates were denatured and subjected to SDS-PAGE, and 80% fraction in a 15-ml Falcon tube. LP cells were collected at the interphase of the then were transferred to PVDF membranes according to our previous 41,46 fl Percoll gradient, washed, and resuspended in a medium, and then stained and methods . Brie y, hybridizations with primary Abs were performed for 1 h at – analyzed by flow cytometry. Dead cells were eliminated through 7-AAD staining. room temperature in blocking buffer. The protein Ab complexes were checked For intracellular staining, the cells were cultured and stimulated for 6 h with using peroxidase-conjugated secondary Abs (Boehringer Mannheim) and ECL 50 ng/ml phorbol 12-myristate 13-acetate and 1 μg/ml ionomycin (Sigma) in the (Amersham Biosciences). The primary and secondary antibodies were listed in presence of GolgiStop. After incubation for 6 h, cells were washed in PBS, and then Supplementary Table 1. fixed in Cytofix/Cytoperm, permeabilized with Perm/Wash buffer, and stained with FITC-, PE-, APC- APC/cy7-, PerCP/Cy5.5-, or PE/cy7-conjugated antibodies. RT-PCR and qRT-PCR. RT-PCR and qRT-PCR were performed according to Meanwhile, dead cells were eliminated through 7-AAD staining. our previous methods41,46. Briefly, total RNA was extracted from cells by using For intracellular IL-22 staining, cells were stimulated directly ex vivo by TRIzol reagent (Life Technologies, Carlsbad, CA) and was transcribed to incubating for 6 h with 20 ng/ml rIL-23 in the presence of GolgiStop for the final cDNA using HiFiScript cDNA Synthesis Kit (CWBIO, Beijing, China) according to 3 h of culture. Cells were fixed and permeabilized by using perm buffer set, as the manufacturer’s instructions, and then RT-PCR was done. qRT-PCR was per- described by the manufacturers, and stained with IL-22 and RORγt antibodies. formed by using HieffTMqPCR SYBR-Green Master Mix (YEASEN, Shanghai, China) in a Bio-Rad iQ5 multicolor RT-PCR system. The levels of each −ΔΔ Histological and immunostaining. For hematoxylin/eosin (H&E) staining, pre- gene were calculated using the 2 CT method. GAPDH was used as the viously reported methods were used in this experiment37. Immunostaining was endogenous control. The primers used for qRT-PCR were shown in Supplementary performed according to our previous method37,45. For RORγt(+)IL-22(+) cell Table 1. staining, slides were treated with 0.1% Triton X-100, blocked with 3% H2O2. Then sections were blocked with 5% rabbit serum. Add 1:200 RORγt and IL-22 anti- Statistical analyses. Student’s t test, one-way analysis of variance (ANOVA), bodies in Perm buffer for incubation overnight. Sections were then incubated with ANOVA plus post-Bonferroni analysis, Mann–Whitney U test, and Wilcoxon’s test biotin-labeled goat anti-rat secondary antibody. Tyramide signal amplification was were used to determine significance. A 95% confidence interval was considered performed to RORγt staining. Fluorescence intensity was analyzed using ImageJ significant and was defined as p < 0.05. software. Alcian blue-periodic acid Schiff staining was used for mucin or goblet cells. Reagents. The source of the reagents and primer sequences was listed in Sup- plementary Table 1. Immunostaining of mucus layers and localization of bacteria by fluorescent fl in situ hybridization. Mucus immune staining was paired with uorescent in situ Reporting summary. Further information on research design is available in hybridization (FISH) in order to analyze bacteria localization at the surface of the the Nature Research Reporting Summary linked to this article. intestinal mucosa according to a reported method23. In brief, 5-μm sections were cut and dewaxed by preheating at 60 °C for 10 min, followed by bathing in xylene at 60 °C for 10 min, xylene at room temperature for 10 min, and 99.5% ethanol for Data availability 10 min. The hybridization step was performed at 50 °C overnight with a probe Raw 16S rRNA gene sequence data for the feces microbiota were deposited in the NCBI (EUB338 probe (5ʹ-GCTGCCTCCCGTAGGAGT-3ʹ with a 5ʹ Cy3 label for all Short Read Archive under BioProject Accession Number PRJNA326574. Microarray data bacteria, Huada, China and PNA probe (Lac663) FAM-O-ACATGGAGTTCCACT Accession number GSE111111. The source data underlying plots presented in figures are for lactobacillus, which were synthesized by PNA BIO INC) diluted to a final shown in Supplementary Data 1. The data used for the L-kynurenine HPLC–MS/ concentration of 0.01 μg/mL in hybridization buffer (20 mM Tris-HCl, pH 7.4, HPLC–MS/MS analyses and HPLC/MASS analyses of the gut contents are presented in 0.9 M NaCl, 0.1% SDS, and 20% formamide). After washing for 10 min in wash Supplementary Data 2. The full blots are shown in Supplementary Fig. 11. buffer (20 mM Tris-HCl, pH 7.4, 0.9 M NaCl) and 10 min in PBS, block solution (5% FBS in PBS) was added for 30 min at 50 °C. Mucin 2 primary antibody was diluted to 1:200 in block solution and applied overnight at 4 °C. After washing in Received: 12 September 2018 Accepted: 11 April 2019 PBS, block solution containing anti-rabbit secondary antibody diluted to 1:200 was applied to the section for 2 h. Nuclei were stained using Hoechst33342. Observa- tions were performed with a Zeiss LSM 700 confocal microscope with software Zen 2011 version 7.1. This software was used to determine the distance between bacteria and the epithelial cell monolayer, as well as the mucus thickness.

L-kynurenine HPLC–MS and HPLC–MS/MS analyses. HPLC–MS and References HPLC–MS/MS analyses of L-kynurenine were performed by ProfLeader Bio- 1. Shan, M. et al. Mucus enhances gut homeostasis and oral tolerance by technology Company (Shanghai, China). Brieﬂy, the UPLC–MS/MS analysis was delivering immunoregulatory signals. Science 342, 447–453 (2013). performed on a Waters Acquity UPLC system coupled with a Waters Xevo-TQXS 2. Atuma, C., Strugala, V., Allen, A. & Holm, L. The adherent gastrointestinal system. The mobile phase consisted of 20 mM ammonium acetate in water (A) and mucus gel layer: thickness and physical state in vivo. Am. J. Physiol. acetonitrile (B). The chromatographic separation was conducted by a gradient Gastrointest. liver Physiol. 280, G922–G929 (2001). elution program as follows: 0 min, 5% B; 1 min, 5% B; 2 min, 25% B; 4 min, 60% B; 3. Ermund, A., Schutte, A., Johansson, M. E., Gustafsson, J. K. & Hansson, G. C. 4.5 min, 95% B; 6 min, 95% B; 6.5 min, 5% B; 10 min, 5% B. The ﬂow rate was Studies of mucus in mouse stomach, small intestine, and colon. I. 0.4 ml/min. Column temperature was 50 °C. Gastrointestinal mucus layers have different properties depending on location

12 COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4 ARTICLE

as well as over the Peyer’s patches. Am. J. Physiol. Gastrointest. liver Physiol. 31. Fernandez, M. & Zuniga, M. Amino acid catabolic pathways of lactic acid 305, G341–G347 (2013). bacteria. Crit. Rev. Microbiol 32, 155–183 (2006). 4. Johansson, M. E., Larsson, J. M. & Hansson, G. C. The two mucus layers of 32. Krupnick, A. S. et al. Central memory CD8+T lymphocytes mediate lung colon are organized by the MUC2 mucin, whereas the outer layer is a allograft acceptance. J. Clin. Investig. 124, 1130–1143 (2014). legislator of host-microbial interactions. Proc. Natl Acad. Sci. USA 108, 33. Dai, X. & Zhu, B. T. Indoleamine 2,3-dioxygenase tissue distribution and 4659–4665 (2011). Suppl 1. cellular localization in mice: implications for its biological functions. 5. Karam, S. M. Lineage commitment and maturation of epithelial cells in the J. Histochem. Cytochem. 58,17–28 (2010). gut. Front. Biosci. 4, D286–D298 (1999). 34. D’Incecco, P. et al. Lysozyme affects the microbial catabolism of free arginine 6. Kuhn, K. A., Manieri, N. A., Liu, T. C. & Stappenbeck, T. S. IL-6 stimulates in raw-milk hard cheeses. Food Microbiol. 57,16–22 (2016). intestinal epithelial proliferation and repair after injury. PloS ONE 9, e114195 35. Quirino, I. E. et al. The role of L-arginine and inducible nitric oxide synthase (2014). in intestinal permeability and bacterial translocation. JPEN J. Parent. Enter. 7. Pull, S. L., Doherty, J. M., Mills, J. C., Gordon, J. I. & Stappenbeck, T. S. Nutr. 37, 392–400 (2013). Activated macrophages are an adaptive element of the colonic epithelial 36. Soda, K. Polyamine metabolism and gene methylation in conjunction with progenitor niche necessary for regenerative responses to injury. Proc. Natl one-carbon metabolism. Int. J. Mol. Sci. 19,1–35 (2018). Acad. Sci. USA 102,99–104 (2005). 37. Cao, S. et al. The gut epithelial receptor LRRC19 promotes the 8. Spits, H. et al. Innate lymphoid cells—a proposal for uniform nomenclature. recruitment of immune cells and gut inflammation. Cell Rep. 14, 695–707 Nat. Rev. Immunol. 13, 145–149 (2013). (2016). 9. Lindemans, C. A. et al. Interleukin-22 promotes intestinal-stem-cell-mediated 38. Tang, C. et al. Inhibition of dectin-1 signaling ameliorates colitis by inducing epithelial regeneration. Nature 528, 560–564 (2015). Lactobacillus-mediated regulatory T cell expansion in the intestine. Cell host 10. Zelante, T. et al. Tryptophan catabolites from microbiota engage aryl microbe 18, 183–197 (2015). hydrocarbon receptor and balance mucosal reactivity via interleukin-22. 39. Lee, J. et al. Maintenance of colonic homeostasis by distinctive apical Immunity 39, 372–385 (2013). TLR9 signalling in intestinal epithelial cells. Nat. cell Biol. 8, 1327–1336 11. Ivanov, I. I. et al. Induction of intestinal Th17 cells by segmented filamentous (2006). bacteria. Cell 139, 485–498 (2009). 40. Varga, D. P. et al. Systemic administration of l-kynurenine sulfate induces 12. Telesford, K. M. et al. A commensal symbiotic factor derived from Bacteroides cerebral hypoperfusion transients in adult C57Bl/6 mice. Microvasc. Res. 114, fragilis promotes human CD39(+)Foxp3(+) T cells and Treg function. Gut 19–25 (2017). microbes 6, 234–242 (2015). 41. Kurata, K. et al. Orally administered L-ornithine reduces restraint stress- 13. Neff, C. P. et al. Diverse intestinal bacteria contain putative zwitterionic induced activation of the hypothalamic-pituitary-adrenal axis in mice. capsular polysaccharides with anti-inflammatory properties. Cell host microbe Neurosci. Lett. 506, 287–291 (2012). 20, 535–547 (2016). 42. Ye, C. et al. Targeting ornithine decarboxylase by alpha- 14. Wang, L. et al. Intestinal REG3 lectins protect against alcoholic steatohepatitis difluoromethylornithine inhibits tumor growth by impairing myeloid-derived by reducing mucosa-associated microbiota and preventing bacterial suppressor cells. J. Immunol. 196, 915–923 (2016). translocation. Cell host microbe 19, 227–239 (2016). 43. Gao, Y. et al. Lnc-C/EBPbeta negatively regulates the suppressive function 15. Darnaud, M. et al. Enteric delivery of regenerating family member 3 alpha of myeloid-derived suppressor cells. Cancer Immunol. Res. 6, 1352–1363 alters the intestinal microbiota and controls inflammation in mice with colitis. (2018). Gastroenterology 154, 1009–1023 e1014 (2018). 44. Shi, G. et al. mTOR inhibitor INK128 attenuates dextran sodium sulfate- 16. Salzman, N. H., Ghosh, D., Huttner, K. M., Paterson, Y. & Bevins, C. L. induced colitis by promotion of MDSCs on Treg cell expansion. J. Cell. Protection against enteric salmonellosis in transgenic mice expressing a Physiol. 234, 1618–1629 (2019). human intestinal defensin. Nature 422, 522–526 (2003). 45. Su, X. et al. LRRC19 expressed in the kidney induces TRAF2/6-mediated 17. Su, X. et al. Expression of FABP4, adipsin and adiponectin in Paneth cells is signals to prevent infection by uropathogenic bacteria. Nat. Commun. 5, 4434 modulated by gut Lactobacillus. Sci. Rep. 5, 18588 (2015). (2014). 18. Turner, J. E., Stockinger, B. & Helmby, H. IL-22 mediates goblet cell 46. He, Z., Wang, M., Li, H. & Wen, C. GC-MS-based fecal metabolomics reveals hyperplasia and worm expulsion in intestinal helminth infection. PLoS gender-attributed fecal signatures in ankylosing spondylitis. Sci. Rep. 9, 3872 Pathog. 9, e1003698 (2013). (2019). 19. Dudakov, J. A., Hanash, A. M. & van den Brink, M. R. Interleukin-22: 47. Hayashi, T. et al. Inhibition of experimental asthma by indoleamine 2,3- immunobiology and pathology. Annu. Rev. Immunol. 33, 747–785 (2015). dioxygenase. J. Clin. Investig. 114, 270–279 (2004). 20. Sonnenberg, G. F., Fouser, L. A. & Artis, D. Border patrol: regulation of 48. Lee, S. M. et al. Inhibition of acute lethal pulmonary inflammation immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22. by the IDO-AhR pathway. Proc. Natl Acad. Sci. USA 114, E5881–E5890 Nat. Immunol. 12, 383–390 (2011). (2017). 21. Sawa, S. et al. Lineage relationship analysis of RORgammat+innate lymphoid cells. Science 330, 665–669 (2010). 22. Lee, Y. et al. Intestinal Lin- c-Kit+NKp46- CD4- population strongly Acknowledgements produces IL-22 upon IL-1beta stimulation. J. Immunol. 190, 5296–5305 This research was supported by NSFC grants 91842302, 31470876, and 91629102, ISF- (2013). NSFC program 31461143010, Tianjin Science and Technology Commission 23. Huang, Y. et al. Gut REG3gamma-associated Lactobacillus induces anti- (18JCZDJC35300), a Ministry of Science and Technology grant (2016YFC1303604), and inflammatory macrophages to maintain adipose tissue homeostasis. Front. the State Key Laboratory of Medicinal Chemical Biology. Immunol. 8, 1063 (2017). 24. Lee, J. S. et al. AHR drives the development of gut ILC22 cells and postnatal Author contributions lymphoid tissues via pathways dependent on and independent of Notch. Nat. R.Y. designed the research and wrote the paper; H.Q., Y.L., H.Y., Y.H. and H.Y. con- Immunol. 13, 144–151 (2011). ducted in vivo experiments and immunoassay, participated in study design, and per- 25. Sawa, S. et al. RORgammat+innate lymphoid cells regulate intestinal formed the statistical analysis; Z.Z., Y.L. and Y.G. performed in vitro assay; T.Z. and J.Z. homeostasis by integrating negative signals from the symbiotic microbiota. prepared mutant lactobacillus; J.Z., J.W., Y.C., D.Z., X.S. and Y.Z. offered assistance for Nat. Immunol. 12, 320–326 (2011). the animal experiments. All authors read and approved the final manuscript. 26. Bessede, A. et al. Aryl hydrocarbon receptor control of a disease tolerance defence pathway. Nature 511, 184–190 (2014). 27. Opitz, C. A. et al. An endogenous tumour-promoting ligand of the human aryl Additional information hydrocarbon receptor. Nature 478, 197–203 (2011). Supplementary information accompanies this paper at https://doi.org/10.1038/s42003- 28. Longman, R. S. et al. CX(3)CR1(+) mononuclear phagocytes support colitis- 019-0424-4. associated innate lymphoid cell production of IL-22. J. Exp. .211, 1571–1583 (2014). Competing interests: The authors declare no competing interests. 29. Mondanelli, G. et al. A relay pathway between arginine and tryptophan metabolism confers immunosuppressive properties on dendritic cells. Reprints and permission information is available online at http://npg.nature.com/ Immunity 46, 233–244 (2017). reprintsandpermissions/ 30. Araque, I., Bordons, A. & Reguant, C. Effect of ethanol and low pH on citrulline and ornithine excretion and arc gene expression by strains of Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in Lactobacillus brevis and Pediococcus pentosaceus. Food Microbiol. 33, published maps and institutional affiliations. 107–113 (2013).

COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio 13 ARTICLE COMMUNICATIONS BIOLOGY | https://doi.org/10.1038/s42003-019-0424-4

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/ licenses/by/4.0/.

14 COMMUNICATIONS BIOLOGY | (2019) 2:171 | https://doi.org/10.1038/s42003-019-0424-4 | www.nature.com/commsbio