The Clock Gene Per2 Links the Circadian System to the Estrogen Receptor

Home , Clock, PER2, PER3

Oncogene (2007) 26, 7916–7920 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc SHORT COMMUNICATION The clock gene Per2 links the circadian system to the estrogen receptor

S Gery, RK Virk, K Chumakov, A Yu, HP Koefﬂer

Cedars-Sinai Medical Center, Division of Hematology/Oncology, UCLA School of Medicine, University of California, Los Angeles, CA, USA

Circadian rhythms regulate diverse physiological pro- 2007). Consequently in various tissues, circadian cesses including homeostatic functions of steroid hor- rhythms impinge upon many physiological processes mones and their receptors. Estrogen receptor-a (ERa)is and pathological conditions, including cancer (Fu et al., essential for normal mammary gland physiology and is a 2002; Matsuo et al., 2003; Lowrey and Takahashi, 2004; prognostic marker for the treatment of breast cancer. We Ko and Takahashi, 2006). Recent studies suggested that report that Per2, a core clock gene, links the circadian circadian disruption is associated with breast tumor- cycle to the ERa signaling network. Binding of enhances igenesis (Hansen, 2001; Chen et al., 2005). The steroid ERa degradation, while suppression of Per2 levels leads to hormone estrogen is essential for normal mammary ERa stabilization. In turn, Per2 itself is estrogen inducible gland physiology, and is also a potent mammary in these cells, suggesting a feedback mechanism to attenuate mitogen (Sternlicht, 2006; Yager and Davidson, 2006). stimulation by estrogen. In addition, overexpression of Per2 Although the circadian clock has been linked to several in breast cancer cells leads to significant growth inhibition, steroid hormone activities, the molecular mechanisms loss of clonogenic ability and apoptosis. Taken together, underlying the function of core clock genes in mammary these results further support a critical role for peripheral tissue are largely unknown. We hypothesized that circadian regulation in tissue homeostasis and suggest a circadian regulation may be implicated in hormone novel role for clock genes in estrogen receptor-positive homeostasis and hormone-related tumorigenesis in breast cancer. breast epithelia cells. Oncogene (2007) 26, 7916–7920; doi:10.1038/sj.onc.1210585; Estrogen stimulation is thought to be a major factor published online 18 June 2007 contributing to the development of breast cancer. Deregulation of the core clock factor, Per2, has been Keywords: circadian rhythms; ERa; breast cancer; reported in several human malignancies including breast Per2; transcriptional activation; estrogen cancer (Chen et al., 2005). We hypothesized that Per2 function in mammary epithelia cells could be linked to the ERa signaling pathway. ERa regulates transcription of target genes through an interaction with consensus Most physiological processes in mammals are influenced estrogen response elements (EREs). We performed by circadian rhythms. These rhythms are driven by a reporter assays with an ERE-luciferase reporter gene master clock within the hypothalamic suprachiasmatic to test the effect of Per2 on ERa transactivation nuclei (SCN) that synchronizes numerous subsidiary (Figure 1a). The ERa-positive breast cancer cell line, oscillators in peripheral tissues. The circadian clockwork MCF-7, was cotransfected with ERE-luciferase and in both the SCN and the peripheral cells is composed of either Per2 or empty vector. While 17-b estradiol (E2) transcription-translation feedback loops maintained by induced high luciferase activity in the control cells, Per2 a core set of clock genes (Shearman et al., 2000; Reppert expression substantially reduced this activity. Per2 also and Weaver, 2002; Schibler and Sassone-Corsi, 2002; inhibited E2-activated ERE transcription in two addi- Ishida, 2007). Two transcription factors, Clock and tional ERa-positive cancer cell lines, T47D (breast) and Bmal1, activate their targets, Period (Per1, 2 and 3) and Ishikawa (endometrial). In contrast, silencing of Per2 by cryptochrome (Cry1 and Cry2); subsequently, the Per small interfering RNA (siRNA) (as shown in Figure 1d) and Cry proteins interfere with Bmal1:Clock activity in those cells enhanced the ERE reporter activity thereby forming the major negative circadian feedback (Figure 1a). We also examined whether Per2 can loop. The central clock, through neural, hormonal and endogenously suppress ERa-responsive genes (Figures metabolic signals, synchronizes the peripheral oscilla- 1b and c). MCF-7 cells transfected with either Per2 or a tors, which in turn drive the expression of downstream control vector were treated with E2; and the mRNA clock-controlled genes in a tissue-specific manner levels of the known ERa targets, pS2, cyclin D1 and (Panda et al., 2002; Storch et al., 2002; Miller et al., CCN1 were measured by real-time PCR (Figure 1b). While expression of Per2 alone had little effect on Correspondence: S Gery, Cedars-Sinai Medical Center, Davis Building expression of those genes, it strongly inhibited E2-mediated 5066, 8700 Beverly Boulevard, Los Angeles, CA 90048, USA. E-mail: [email protected] induction of pS2, and further reduced the levels of Received 26March 2007; revised 8 May 2007; accepted 9 May 2007; cyclin D1 and CCN1 below basal level. Moreover, published online 18 June 2007 Per2 siRNA enhanced E2-activation of the ERa target Per2 links the circadian system to ER S Gery et al 7917 a b 300 c EV Per2 siCon siPer2 2 pS2 EV 200 Per2 Cyclin D1 1 100 0

(% of EV+E2) CCN1 200 Luciferase activity 0 Cyclin D1 −−+ − + ++−−+ − + E2 MCF-7 T47D Ishikawa 100 β-actin 4 siCon E2 −−++−−++ siPer2 0 Relative expression 200 d 2 CCN1 siCon siPer2 siCon siPer2 100

(% of siCon+E2) Per2 Luciferase activity 0 −−+ − + ++−−+ − + E2 0 β MCF-7 T47D Ishikawa E2 − + − + − + − + -actin

EV 293T MCF-7 Per2 siCon siPer2

Figure 1 Per2 suppresses ERa transcriptional activation. (a) MCF-7, T47D (breast) and Ishikawa (endometrial) cancer cell lines were cotransfected with ERE-luciferase construct and either empty vector (EV) or Per2 (Per2, upper panel) or with either a control siRNA (siCon) or Per2 siRNA (siPer2, bottom panel). Luciferase activity was measured either with or without treatment of cells with E2 (1 mM, 16h). Results represent the percentages of luciferase activity with either E2-treated EV-transfected cells (upper panel) or E2- treated siCon-transfected cells (bottom panel) set to 100%. Shown are the means7s.d. of triplicate samples. (b and c) MCF-7 cells transfected with either empty vector or Per2 were selected with G418 for 5 days. Surviving cells were treated with E2 (1 mM, 16h) and harvested for RNA and whole-cell protein. In addition, MCF-7 cells were transfected with either siCon or siPer2. Two days later, cells were treated with E2 (1 mM, 16h) and harvested for RNA and whole-cell protein. ( b) Real-time PCR analysis of the indicated genes. (c) Western blot analysis of the indicated proteins. (d) 293T and MCF-7 cells were transfected with either siCon or siPer2. Nuclear lysates were analysed for Per2 expression by immunoblotting. Cells culture, constructs, real-time PCR conditions and sources of antibodies and regents have been described in the Supplementary Information. genes (Figure 1b). Western blot analysis showed a prevent nuclear localization of ERa.Colocalizationof parallel effect of Per2 on the protein levels of cyclin D1 Per2 and ERa was noted in both cell lines. Notably, Per2- and CCN1 (Figure 1c). These results suggest that Per2 expressing MCF-7 cells exhibited changes in morphology could be involved in breast cancer prevention by inhibit- indicative of apoptosis, such as cell rounding and ing E2-induced proliferation. Recently, Per2 was also detachment, while the 293T cells had normal morphology. suggested to play a role in normal mammary cell differen- ERa is a short-lived protein and binding of E2 further tiation (Metz et al., 2006). accelerates its degradation (Reid et al., 2002). While In the absence of ligand, ERa is sequestered in the Per2 expression had no effect on ERa mRNA levels cytoplasm in an inhibitory protein complex. Upon (Figure 2d), it markedly downregulated ERa protein binding to E2, ERa undergoes conformational changes levels in MCF-7 cells (Figure 2e). PS-341, a speciﬁc facilitating cofactor binding and nuclear localization proteasome inhibitor, blocked Per2-stimulated down- (McDonnell and Norris, 2002). Immunoprecipitation regulation of ERa (Figure 2f) showing that Per2- experiments showed that Per2 associates with ERa in mediated ERa degradation is through the proteasome 293T and MCF-7 cells, and E2 stimulation enhances pathway. Moreover, suppression of endogenously the interaction (Figure 2a). Moreover, glutathione expressed Per2 by siRNA led to stabilization of ERa S-transferase (GST) pull-down assays, with an in vitro- (Figure 2g), suggesting that Per2 is necessary for translated Per2 and a GST-ERa fusion protein, efﬁcient proteasome-induced degradation of ERa.A demonstrated direct binding of these proteins (Figure 2b). recent study showed that several nuclear receptors are As Per2 shuttles between the nucleus and the cytoplasm clock-controlled genes (Yang et al., 2006). Although (Yagita et al., 2002), it could change the subcellular ERa does not exhibit a circadian expression pattern in distribution of ERa. To test this possibility, 293T cells normal cells, it is downregulated in Clock mutant mice cotransfected with ERa and V5-tagged mPer2, and (Miller et al., 2007), suggesting that core circadian MCF-7 cells transfected with V5-tagged mPer2 were components have an important role in regulating ERa treated with E2 and analysed by confocal microscopy. expression. Protein degradation plays a role in the Strong nuclear staining of ERa was detected in the 293T circadian transcription-translation feedback loops, and cells (Figure 2c). Also, ERa localized mainly to the core clock factors modulate protein stability through the nucleus in both nonexpressing and Per2-expressing proteasome pathway in other systems as well (Yagita MCF-7 cells. These results indicate that Per2 does not et al., 2002; Gallego and Virshup, 2007). Together, these

Oncogene Per2 links the circadian system to ER S Gery et al 7918 a 293T MCF-7 b c 293T MCF-7 E2 − + − +

Per2 Per2

IgG GST ST-ER G IP ERα IgG ERα IgG α e EV Per2

d ER 200 ERα

relative 100

α β-actin expression ER 0 E2 − + − + EV Per2 DNA

f Per2 g siCon siPer2 EV

ERα

β-actin merge E2 − − − + − + − + PS-341 − − + +

Figure 2 Per2 interacts with and induces degradation of ERa protein. (a) 293T and MCF-7 cells were transfected with Per2 and ERa and treated with E2 (1 mM, 1 h). Protein lysates were immunoprecipitated (IP) either with ERa antibody or immunoglobulin G (IgG), and analysed by western blot with Per2 antibody. (b) In vitro-translated Per2 was incubated with either GST-ERa fusion protein or GST protein alone. GST-protein complexes were analysed by western blot with Per2 antibody. (c) 293T cells cotransfected with ERa and V5-tagged Per2 and MCF-7 cells transfected with V5-tagged Per2 were treated with E2 (1 mM, 1 h) and triple-stained for ERa (ERa antibody, red), Per2 (V5 antibody, green) and DNA (TO-PRO-3, blue). The merged images show colocalization of ERa and Per2 (yellow). (d and e) MCF-7 cells transfected with either empty vector (EV) or Per2 were selected with G418 for 5 days, treated with E2 (1 mM, 1 h) and harvested for RNA and proteins. (d) Real-time PCR analysis of ERa expression. (e) Western blot analysis of ERa expression. (f) EV- and Per2-transfected MCF-7 cells were treated with the proteasome inhibitor PS-341 (100 nM, 16h) either in the presence or absence of E2 (1 mM, 1 h) and analysed for ERa expression by immunoblotting. (g) MCF-7 cells transfected with either control siRNA (siCon) or Per2 siRNA (siPer2) were treated with E2 (1 mM, 1 h) and ERa expression was analysed by western blot.

studies suggest that control of protein turnover is an assays with MCF-7 cells detected the presence of ERa important feature of circadian regulation. on the upstream regulatory region of Per2 following E2 Recent studies in rats showed Per2 is differentially treatment (Figure 3d), demonstrating that endogenous regulated by E2 in specific tissues (Nakamura et al., ERa binds to the Per2 promoter. Several additional 2005; Perrin et al., 2006). We found that Per2 mRNA half-ERE sites were found within the Per2 promoter, levels were induced by E2 in ERa-positive breast cancer which may also contribute to the E2-induction of cell lines (Figure 3a), showing that the human Per2 gene Per2. Hormone-mediated gene expression is attenuated is E2-inducible in mammary epithelial cells. Analysing rapidly; inducible expression of corepressors might the Per2 promoter, we identified a potential ERE serve as a mechanism to control the magnitude of ERa binding site at À365 bp. The ERE and the surrounding transcriptional activation. Indeed, other ERa corepres- nucleotides are conserved between mouse and human sors including BRCA1 and SHARP are also E2 Per2 promoters, suggesting functional significance inducible (Romagnolo et al., 1998; Shi et al., 2001). In (Figure 3b). Electrophoretic mobility shift analyses this regard, regulation of circadian genes by E2 may demonstrated protein-DNA binding between the ERE help maintain hormonal homeostasis. element from the Per2 promoter and E2-treated MCF-7 Per2 mutant mice show increased susceptibility to nuclear extracts (Figure 3c). The protein binding was tumor development, suggesting that Per2 is a tumor specific as it could be competed with excess cold probe; suppressor gene (Fu et al., 2002). Expression of Per2 and the addition of ERa antibody resulted in a dramatically reduced the growth of MCF-7 cells on supershift of the protein-DNA complex. No specific plastic and the ability of the cells to form colonies on complexes were detected using nuclear extracts from soft agar (Figures 4a and b). Per2-induced growth control cells, nor in parallel experiments with a mutated inhibition was associated with a significant increase in probe. Furthermore, chromatin immunoprecipitation apoptotic death, measured by Annexin-V staining and

Oncogene Per2 links the circadian system to ER S Gery et al 7919

a 15 b Human-365 a c d Per2 EV Per2 GCGCGCGCGGTCACGTTTTCCACTATGTG EV 10 ||||||||||||||||||||||||||||| GCGCGCGCGGTCACGTTTTCCACTATGTG Per2 5 Mouse-34 EV Consensus ERE GGTCAnnnTGACC 3% Fold induction 0 Per2 promoter GGTCAnnnTTTCC PI PARP T47D

MCF-7 Per2 MB-231 80 β-actin c wtDNA mDNA b 63% α Anti-ER + + d Input ERα IgG Annexin Competitor + + E2− + − + − + E2 +++ +++ 40 e Clock ERα ERα Bmal1 E2 circadian No. of colonies 0 Per2 EV Per2 response cycle

Figure 4 Per2 expression inhibits growth of MCF-7 cells. (a) MCF-7 cells were transfected with either Per2 expression vector (Per2) or empty vector (EV) and selected with G418. Shown are the results of a representative experiment. (b and d) MCF-7 cells transfected with either Per2 or empty vector were selected with G418 for 5 days and used in subsequent assays. (b) Clonogenic Figure 3 Per2 expression is estrogen inducible. (a) Breast cancer assays. (c) Apoptosis was analysed by Annexin-V/propidium iodide cell lines were either untreated or treated with E2 (1 mM, 16h) and staining. Late and early apoptotic populations are in the upper Per2 expression was analysed by real-time PCR. Data are presented right quadrant and lower right quadrant, respectively. (d) Western as fold increase in treated cells compared to untreated cells. (b) blot analysis for Per2 and poly-(ADP-ribose)polymerase cleavage Sequence alignment of the conserved region between the mouse expression. (e) A model showing that Per2 couples the circadian and human Per2 promoter. The potential ERE is underlined. The cycle to the estrogen response; dysregulation in either pathway may nonconserved nucleotides between the Per2-ERE and consensuses contribute to development of hormone-dependent breast cancer. ERE are shown in bold. (c) Electrophoretic mobility shift analyses (EMSA) was performed with nuclear extracts from MCF-7 cells transfected with ERa and either untreated or treated with E2 (1 mM, 1 h). Extracts were incubated with oligonucleotides containing corepressor, suggesting a feedback mechanism coupling either wild-type (wtDNA) or mutant (mDNA) ERE site from the the circadian clock to the estrogen pathway. Our results Per2 promoter. EMSA conditions have been described in the Supplementary Information. Protein complexes and supershifted further support a model wherein, while circadian protein complexes are indicated with arrow and an arrowhead, regulation helps maintain estrogen homeostasis in respectively. (d) Chromatin immunoprecipitation analysis was normal mammary cells, disruption of this regulation performed using MCF-7 cells cultured either without or with E2 could play a role in the development of hormone-related (1 mM, 1 h) with ERa antibody. Samples were analysed by PCR with Per2 promoter-specific primers. Input chromatin was included breast cancer (Figure 4e). Further, elucidating the as a positive control; immunoprecipitations with IgG antibody connections between clock genes and the ER network were the negative control. could benefit the development of new therapeutic strategies for breast cancers, as well as, provide insights into chronotherapy, as a way to optimize current poly-(ADP-ribose)polymerase cleavage (Figures 4c and therapies. d). A recent study also found that Per2 induced apoptosis in murine lung and breast cancer cell lines (Hua et al., 2006). These results show that Per2 has Acknowledgements antiproliferative effects in breast cancer cells and suggest that dysregulation of this gene could play a role in This work was supported by NIH grants, UCLA Cancer Gene Medicine Training grant and also in part by the Parker Hughes mammary tumorigenesis. Trust, the Inger Foundation and the Mary Barry Foundation. The circadian transcriptional network allows the H Phillip Koeffler is a member of the UCLA Jonsson orchestration of physiology and behavior for optimal Comprehensive Cancer Center and holds the endowed Mark adaptation of the organism to its environment. We Goodson Chair of Oncology Research at Cedars-Sinai identified Per2 as a novel estrogen-inducible ERa Medical Center/UCLA School of Medicine.

References

Chen ST, Choo KB, Hou MF, Yeh KT, Kuo SJ, Chang JG. suppression and DNA damage response in vivo. Cell (2005). Deregulated expression of the PER1, PER2 and 111: 41–50. PER3 genes in breast cancers. Carcinogenesis 26: 1241–1246. Gallego M, Virshup DM. (2007). Post-translational modiﬁca- Fu L, Pelicano H, Liu J, Huang P, Lee C. (2002). The tions regulate the ticking of the circadian clock. Nat Rev circadian gene Period2 plays an important role in tumor Mol Cell Biol 8: 139–148.

Oncogene Per2 links the circadian system to ER S Gery et al 7920 Hansen J. (2001). Light at night, shiftwork, and breast cancer limbic forebrain is modulated by the estrous cycle. Proc Natl risk. J Natl Cancer Inst 93: 1513–1515. Acad Sci USA 103: 5591–5596. Hua H, Wang Y, Wan C, Liu Y, Zhu B, Yang C et al. (2006). Reid G, Denger S, Kos M, Gannon F. (2002). Human Circadian gene mPer2 overexpression induces cancer cell estrogen receptor-alpha: regulation by synthesis, modiﬁca- apoptosis. Cancer Sci 97: 589–596. tion and degradation. Cell Mol Life Sci 59: 821–831. Ishida N. (2007). Circadian clock, cancer and lipid metabo- Reppert SM, Weaver DR. (2002). Coordination of circadian lism. Neurosci Res 57: 483–490. timing in mammals. Nature 418: 935–941. Ko CH, Takahashi JS. (2006). Molecular components Romagnolo D, Annab LA, Thompson TE, Risinger JI, Terry LA, of the mammalian circadian clock. Hum Mol Genet 20062: Barrett JC et al. (1998). Estrogen upregulation of BRCA1 R271–R277. expression with no effect on localization. Mol Carcinog 22: Lowrey PL, Takahashi JS. (2004). Mammalian circadian 102–109. biology: elucidating genome-wide levels of temporal orga- Schibler U, Sassone-Corsi P. (2002). A web of circadian nization. Annu Rev Genomics Hum Genet 5: 407–441. pacemakers. Cell 111: 919–922. Matsuo T, Yamaguchi S, Mitsui S, Emi A, Shimoda F, Shearman LP, Sriram S, Weaver DR, Maywood ES, Chaves I, Okamura H. (2003). Control mechanism of the circadian Zheng B et al. (2000). Interacting molecular loops in the clock for timing of cell division in vivo. Science 302: 255–259. mammalian circadian clock. Science 288: 1013–1019. McDonnell DP, Norris JD. (2002). Connections and regulation Shi Y, Downes M, Xie W, Kao HY, Ordentlich P, Tsai CC of the human estrogen receptor. Science 296: 1642–1644. et al. (2001). Sharp, an inducible cofactor that integrates Metz RP, Qu X, Lafﬁn B, Earnest D, Porter WW. (2006). nuclear receptor repression and activation. Genes Dev 15: Circadian clock and cell cycle gene expression in mouse 1140–1151. mammary epithelial cells and in the developing mouse Sternlicht MD. (2006). Key stages in mammary gland mammary gland. Dev Dyn 235: 263–271. development: the cues that regulate ductal branching Miller BH, McDearmon EL, Panda S, Hayes KR, Zhang J, morphogenesis. Breast Cancer Res 8: 201. Andrews JL et al. (2007). Circadian and CLOCK-controlled Storch KF, Lipan O, Leykin I, Viswanathan N, Davis FC, regulation of the mouse transcriptome and cell proliferation. Wong WH. (2002). Extensive and divergent circadian gene Proc Natl Acad Sci USA 104: 3342–3347. expression in liver and heart. Nature 417: 78–83. Nakamura TJ, Moriya T, Inoue S, Shimazoe T, Watanabe S, Yager JD, Davidson NE. (2006). Estrogen carcinogenesis in Ebihara S et al. (2005). Estrogen differentially regulates breast cancer. N Engl J Med 354: 270–282. expression of Per1 and Per2 genes between central and Yagita K, Tamanini F, Yasuda M, Hoeijmakers JH, peripheral clocks and between reproductive and nonrepro- van der Horst GT, Okamura H. (2002). Nucleocyto- ductive tissues in female rats. J Neurosci Res 82: 622–630. plasmic shuttling and mCRY-dependent inhibition of Panda S, Antoch MP, Miller BH, Su AI, Schook AB, Straume ubiquitylation of the mPER2 clock protein. EMBO J 21: M et al. (2002). Coordinated transcription of key pathways 1301–1314. in the mouse by the circadian clock. Cell 109: 307–320. Yang X, Downes M, Yu RT, Bookout AL, He W, Straume M Perrin JS, Segall LA, Harbour VL, Woodside B, Amir S. et al. (2006). Nuclear receptor expression links the circadian (2006). The expression of the clock protein PER2 in the clock to metabolism. Cell 126: 801–810.

Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc).

Oncogene