Colorado State University-Pueblo Isolation of cellulase enzymes from Penicillium spinulosum

Higgins, Nicole R. April 24, 2017 Senior Honors Thesis Abstract Cellulases are enzymes produced by select microorganisms and fungi that possess the ability to degrade cellulose, a particularly stable biopolymer found in plant cell walls. These enzymes are important to the organisms that produce them because they provide a carbon source that is inaccessible to most other organisms. They are also of particular interest in industry due to their potential to convert cellulose to biofuels that may serve as an alternative for non-renewable petroleum based fuels. Therefore, the isolation of cellulases with traits that make the production of biofuels on an industrial scale economically sustainable is of particular interest. This study aims to isolate cellulase genes from the fungus Penicillium spinulosum. Ultimately, the goal is to obtain the most efficient cocktail of enzymes for biofuel production whose gene sequences can be inserted into a genetically engineered bacterial vector for easy use in industrial applications. Therefore, this study also aims to determine the optimal conditions for the isolation of cellulases at all steps using techniques such as gradient PCR. In addition, a brief bioinformatics analysis of the primers developed for isolation of cellulases from P. spinulosum was conducted using NCBI BLAST to determine if any similarity with other cellulases or fungal organisms existed. BLAST search results indicated that the target cellulases are relatively novel.

Introduction The cell walls in plants are primarily composed of cellulose, a biopolymer containing β-1,4- glycosidic linkages1. Structurally, cellulose is a homo-polysaccharide that arranges into unbranched chains of glucose molecules called microfibrils1. These microfibrils are difficult to degrade due to the β- 1,4-glycosidic linkages between each glucose molecule as well as the presence of hydrogen bonding between the cellulose fibers2. As a result, enzymes specialized for hydrolyzing the β-1,4-glycosidic linkages in cellulose have developed in many bacterial and fungal species3. These enzymes, termed cellulases, are produced by select microorganisms and fungi and provide such organisms with a carbon source that is unattainable by the majority of organisms. The general term cellulase encapsulates three distinct groups of hydrolytic enzymes capable of degrading cellulose: endoglucanases, exoglucanases, and β-glucosidases (BGL)3. Cellulolytic enzymes are classified into one of these three groups based on the method by which they cleave β-1,4-linkages as well as their specificity for particular substrates3. The first class of cellulases, endoglucanases, acts randomly on the cellulose chain to produce smaller oligosaccharides3. Exoglucanases, on the other hand, act more specifically by cleaving off units of cellobiose from the ends of cellulose chains3. Cellobiose is the smallest cleavable unit of cellulose that can be converted to glucose3. BGL, also known as cellobiase, is then responsible for hydrolyzing cellobiose to glucose2,3. Ultimately, these three groups of enzymes work synergistically in order to hydrolyze cellulose to glucose for use in metabolic processes2,3. It is important to note that the final conversion of cellobiose to glucose monomers by BGL is frequently the limiting step of the process3. This is due to the fact that BGL exists in a smaller ratio compared to the other two classes of cellulases3. In addition, BGL is inhibited by both its end product, glucose, as well as its substrate cellobiose 3. Apart from their importance in the metabolic processes of many microorganisms, cellulases have a number of important industrial roles including their potential to convert cellulose and its derived sugars to renewable biofuels that may provide a viable substitute for non-renewable petroleum based fuels. Biofuels produced via this mechanism (shown in Figure 1) are commonly referred to as lignocellulosic ethanol, named after dry plant matter termed lignocellulose2. The use of lignocellulose in the production of biofuels is appealing for several reasons. First of all, a large portion of this raw plant material is inedible and therefore its use for biofuel production would not negatively impact food production4. In addition, biomass has a low economic cost and has been reported as one of the largest available energy resources in the world with India alone possessing an annual availability of about 500 million metric tons2,5. It has been suggested that in the United States alone, approximately 30% of the current petroleum usage could be offset by switching to biofuels2. Finally, the use of fuels derived from lignocellulose has the potential to substantially reduce many of the negative effects of climate change due to the fact that their combustion releases lower levels of greenhouse gases in comparison to fossil fuel combustion4.

Figure 1: General schematic of the biofuel production process using cellulase enzymes. However, isolation and production of cellulase enzymes remains a costly process3–5. In addition, the enzymatic efficiency of many commercially available enzymes is still too slow to maintain biofuel production on an industrial scale3–5. Therefore, developing more efficient methods to isolate cellulases, as well as identifying cellulases with traits that eliminate economic constraints, have become widespread areas of research. Ultimately, a successful transition to the use of biofuels on a commercial level will depend on the development of a “cellulase cocktail” that completely and efficiently hydrolyzes the intended biomass substrate in a cost-effective manner2,3. As previously stated, cellulases are produced by a number of microorganisms including fungi and both aerobic and anaerobic bacteria, however fungi are the most studied of these microorganisms3. The reasons for this are twofold, the first being that they tend to have a higher enzyme yield2,3. Furthermore, fungi secrete cellulase enzymes extracellularly making them more accessible than the majority of their bacterial counterparts2,3. In particular filamentous fungi, including those from the genera Penicillium, tend to produce higher levels of cellulase enzymes3. More importantly, such fungi produce all three types of cellulases giving them the ability to completely hydrolyze cellulose polymers3. More specifically, the fungus P. spinulosum, is a fast growing, non-pathogenic fungal species, making it an attractive choice for the study of cellulolytic enzymes. Ultimately, this study aims to isolate the gene sequence for cellulase enzymes from the genome of P. spinulosum as well as determine the optimal conditions under which this isolation is most efficient. Optimal conditions for the isolation the enzymes will be carefully considered at all steps in order to obtain the most efficient cocktail of enzymes for biofuel production.

Methods Standard Growth Media Preparation

Two 500 mL batches of standard growth media were prepared, one with glucose and the other with sucrose as a carbon source. In both cases, the sugar solutions were prepared separately from the salt solutions. Sugar solutions were prepared by adding 28.84 g glucose and 28.82 g sucrose to their respective 500 mL flasks and dissolving in 250 mL of distilled, deionized water. Salt solutions were prepared together in a 1 L flask by combining the remaining macronutrients and micronutrients in a 500 mL of distilled, deionized water according to the concentrations listed in Table 1. All of the micronutrients, except iron sulfate, were in solution. Each micronutrient was pipetted into the solution of macronutrients and iron sulfate at a final volume of 250 μL/L. After preparation, the salt solution was divided into two 250 mL portions and placed in 1 L flasks. All of the salt and sugar solutions were autoclaved and allowed to cool. Upon cooling, the sugar solutions were each aseptically combined with a salt solution by adding the sugar solution to the salt solution in a biosafety cabinet (Fig. 2).

Table 1: Standard Growth Media Preparation Nutrients Constituents Concentrations Macronutrients mM g/L Carbon Glucose/Sucrose 320 57.6

Nitrogen NH4Cl 80 4.3 Phosphorus Na2HPO4 20 2.8 Sulfur Na2SO4 2 0.28 Buffer/Chelator Sodium Citrate 12.5 3.0 Citric Acid 12.5 2.2

Potassium K2CO3 3 0.42 Magnesium MgCO3 4 0.34 Sodium NaCl 20 1.2

Micronutrients Element, ppm Salt, mg/L . Iron FeSO4 7H2O 10 50 Zinc ZnCl2 5 10.4 . Manganese MnCl2 4H2O 5 18.0 . Molybdenum (NH4)6Mo7O24 4H2O 2 3.7 . Calcium CaCl2 5H2O 0.5 1.8 . Copper CuSO4 5H2O 0.4 1.6

Vanadium NH4VO3 0.2 0.46

Boron H3BO3 0.1 0.57 . Chromium Cr2(SO4)3 12H2O 0.1 0.93 . Nickel NiCl2 6H2O 0.1 0.40 . Cobalt CoCl2 6H2O 0.1 0.40 Sucrose (28.82 g) in Glucose (28.84 g) in 250 mL H O in 500 mL 250 mL H2O in 500 mL 2 flask (calc. for 500 flask (calc. for 500 mL) mL) 500 mL Sucrose Std. 500 mL Glucose Std. Growth Growth Salts in 250 mL H O in Salts in 250 mL H2O in 2 1 L flask (calc. for 1 L) 1 L flask (calc. for 1 L)

Figure 2: Schematic Diagram of Standard Growth Media for P. spinulosum cultures. Spore Suspension

A spore suspension to be used for current and future inoculations was prepared by adding sterile water to three Penicillium spinulosum cultures in petri dishes and scraping them with a sterile glass spreader. The spores were resuspended in an aqueous 0.12% (w/v) Tween 20 solution with 0.9% (w/v) NaCl to increase the density of the solution and suspend the spores. The Tween 20 is hydrophobic and therefore coats the spores to prevent them from germinating.

Media Inoculation

Each liquid media preparation was inoculated with 0.20 mL of the Penicillium spinulosum from the spore suspension using a sterile micropipette. The inoculated media flasks were then placed in the shaker and allowed to grow for approximately 1 week.

Fungal DNA Extraction

In order to extract DNA from the prepared cultures, the MasterPure Yeast DNA Purification kit was used6. First, mycelia were harvested by pouring cultures onto a Buchner funnel and using suction filtration to remove the medium and dry the mycelia. A total mass of 61.2 g of the harvested mycelia grown in the glucose medium was obtained before transferring approximately 1 g of the mycelia to a prechilled mortar and pestle. The mycelia were ground into a fine powder in the presence of liquid nitrogen and then divided into two microcentrifuge tubes. This procedure was carried out for both the glucose and sucrose cultures in order to obtain four total microcentrifuge tubes. The cells were then lysed by adding 300 µL of well-mixed of Yeast Cell Lysis Solution and 1µL of 5 µg/µL RNAse to each of the microcentrifuge tube, vortexing to suspend the cells, and incubating at 65 oC (~ room temperature) for 15 minutes. After incubating for 15 minutes, the samples were placed on ice for 5 minutes before adding 150 µL MPC Protein Precipitation Reagent. Each of the tubes was vortexed for 10 seconds after addition of the MPC Protein Precipitation Reagent. Cell debris were then pelleted by centrifuging each tube for 10 minutes at 10,000 rpm. The supernatant of each tube was then trasferred to a clean microcentrifuge tube and 500 µL of isopropanol was added and mixed by inversion to help precipitate the DNA. The DNA was pelleted by centrifuging for 10 minutes at 10,000 rpm once again. The supernatant was removed and the pelleted DNA was washed with 0.5 mL of 70% ethanol. The ethanol was carefully removed and each tube was briefly centrifuged to remove any residual ethanol. The isolated DNA was then suspended in 35 µL of TE buffer and stored at 4 oC.

DNA Quantitation

In order to quantify the DNA, each sample was resuspended in 1.0 mL of molecular grade deionized water and the 260:280 ratio was determined for each sample using a plate reader. The concentration of the template DNA was determined from this ratio which, for pure DNA should be about 1.87. Alternatively, a number of other methods can be used to quantify DNA, including fluorimetry, rt- PCR methods, and UV spectroscopy8. The protocol for the MasterPure kit used to isolate the DNA instructs the user to quantify DNA by fluorimetry using Hoechst dye 332586.

Primer Design

Peptide sequences elucidated from cellulase enzymes previously isolated from Penicillium spinulosum coupled with the use of Primer3Plus, an online bioinformatics tool were used in order to design primers for the isolation of cellulase genes via polymerase chain reaction (PCR)9,10. Carefully designed primers are highly important for successful PCR because they dictate which section of the template DNA or RNA will be amplified. If the primers are not specific enough for the target genes, then the desired region of DNA may not be amplified.

Primer BLAST Searches

BLAST searches using the NCBI database were performed in order to investigate the similarity of the designed primer sequences (Table 2). These searches were performed using the nucleotide blast program (BLASTN) which searches for nucleotide matches using an entered nucleotide query. For each primer sequence, the resulting sequences with the highest similarity as well as sequences that were related to fungal cellulases or other fungal proteins were recorded.

Table 2: Penicillium spinulosum Cellulase Primers9 Primer Name Primer Sequence GRev60-559-F AACATGCTACCCCCTTCCTC GRev60-559-R GGGTCAGGAAATCACTCGAA FRevFirst123-F GAGCTCGGATCCACTAGTAACG FRevFirst123-R TATCCTCAATTCGCCCTTG ERev62-560-F GACCCGCTTAAACAACATGC ERev62-560-R GGGTCAGGAAATCACTCGAA DRev60-244-F GTCTACCGGACACTTTCACGA DRev60-244-R CGGATTTGTCGCAGATTCAG CRev60-388-F ACCCATGGCCAGACAGATAC CRev60-388-R AATTGTCGCGACTTGTCATC Brev-56-231-F TAGCGCGTTTACCGTAGCTA Brev-56-231-R CGGGTTTGTCATGTGCTG ARev64-450-F AGGTCTTCCTGATCGAAGCA ARev64-450-R CGGCTCACTATCGTGTTTCA

Gradient PCR

Gradient PCR is primarily used in order to determine the optimal annealing temperature DNA during the PCR reaction. Using optimal PCR conditions increases the likelihood of achieving accurate experimental results. If the annealing temperature used during the PCR reaction is too low, the primers will anneal non-specifically. On the other hand, using too high of an annealing temperature leads to poor interactions between the primers and template DNA which results in a low PCR yield. In this case, gradient PCR was used to determine the optimal annealing temperature of six different primer pairs (GRev, ERev, DRev, CRev, BRev, and ARev) specific to cellulase genes in Penicillium spinulosum. Each set of primers was tested at a total of eight temperatures bracketing the reported melting temperature of the primer pairs. These temperatures ranged from 42.5 oC - 55.8 oC with an approximate increase of 2 oC between each reaction. Volumes used in the gradient PCR reaction mixture are given in Table 3. The reagents listed below were added to EasyStart PCR tubes directly onto the wax layer in the tube. This wax layer contains the other necessary reagents for the PCR reaction including the dNTPs for elongation and MgCl2 for the catalysis of the reaction. Specific reaction conditions for the gradient PCR are given in Table 4.

Table 3: Gradient PCR reaction mixture. Reagent Volume Taq polymerase 0.125 µL Taq buffer 2.50 µL Forward primer 1.00 µL Reverse primer 1.00 µL Template DNA 4.00 µL DI molecular grade water 16.375 µL

Table 4: Gradient PCR reaction conditions for the first reaction cycle. Steps two through four of the listed conditions were repeated for 40 cycles in order to amplify the target DNA. Reaction step Temperature Time Initial denaturation 94 oC 60 sec Denaturation 94 oC 30 sec Annealing 42.5-55.8 oC 45 sec Elongation 72 oC 60 sec

Gel Electrophoresis

Gel electrophoresis was used in order to analyze the PCR results. All PCR products were run on 2% agarose gels with an ethidium bromide concentration of 20 µL/ 100 mL of gel. A standard 1x TBE buffer solution was used both to dissolve agarose and as a running buffer. A 10 µL aliquot of a 100bp DNA ladder was loaded into the first lane of the gel as a control DNA size standard and subsequent lanes were loaded with 10 µL samples of the gradient PCR products mixed with a 6x loading dye. All gels were run at 100 V for 45 min and then gel bands were visualized using a Gel Doc system to record gel images.

Results and Discussion Preparation and inoculation of standard growth media with P. spinulosum using either glucose or sucrose as a carbon source yielded 61.2 g and 29.9 g of mycelia respectively upon harvesting. The difference in the amount of mycelia contained may stem from two sources. First, it was more difficult to dry out the mycelia from the glucose media on suction filtration due to the health of the culture. More likely, however, is that P. spinulosum more preferentially utilizes glucose for growth and metabolism. DNA isolation of the mycelia harvested from the culture flasks produced two micro-centrifuge tubes of DNA isolated from the glucose culture and two from the sucrose culture. The pelleted DNA was stored at 4 oC in order to maintain structural integrity. Upon quantitation, the DNA from glucose P. spinulosum cultures was determined to have a 260:280 ratio of 1.742, which indicated relatively pure DNA and a concentration of 189.80 µg/mL. In order to isolate cellulase genes from the template DNA, specific primers were designed using amino acid sequences of cellulase enzymes previously isolated from P. spinulosum. These primers, with the exception of the FRev primer pair which was not ordered, were then used in order to amplify cellulase to genes with gradient PCR. Gradient PCR was used in order to determine the optimal annealing temperature of the DNA. This is of particular importance because too high of an annealing temperature will result in a low PCR product yield due to inadequate interactions between the primers and template DNA11. Furthermore, too low of an annealing temperature may allow primers to bind non- specifically resulting in PCR products that differ from the targeted DNA sequence11. However, with the exception of one gel run for the GRev primer pair which showed an optimal annealing temperature of 48.6 oC, electrophoresis gels of the PCR products showed only primer dimer bands at the bottom of the gel indicating that no amplification occurred during the reaction (Figure 3). The most likely cause of a failed PCR reaction is low activity of the Taq polymerase enzyme. However, after running a number of PCR reactions with new samples of the enzyme it was determined that the failed PCR reactions were due to some other cause. In an attempt to address this, new P. spinulosum cultures were grown up and DNA was isolated from the harvested mycelia as before. Upon replacing both the Taq polymerase and the template DNA, still no amplification products were obtained. It is also suggested that diluting the template DNA may improve the outcome of the PCR in cases where no amplification product is obtained12. Although the template DNA used in these reactions was diluted up to 1.0 mL using molecular grade water during in order to quantitate the DNA on the plate reader, it may be helpful to further dilute the template DNA before the reaction. It is unlikely that reagents included in the EasyStart PCR tubes affected the efficacy of the reaction; therefore the remaining reagents in the prepared portion of the reaction mixture should be evaluated next. The first is the addition of extra MgCl2 into the reaction mixture in order to promote catalysis of the reaction. Another option is to run the reaction with different primers in order to determine if an amplification product is obtained. The primer sequences used in these reactions were specifically designed for the amplification of P. spinulosum cellulase genes, therefore if a problem exists with the primers; it is most likely degradation or damage of the primers themselves. Finally, increasing the number of cycles of the PCR reaction may also improve the yield of PCR products12. Ultimately, each of these approaches should be explored in order to obtain an amplification product from the PCR reaction as well as to ensure that the amplification product is obtained under optimal conditions, thus allowing for the most efficient isolation of cellulase genes in future steps. Obtaining an amplification product for the GRev primer pair was encouraging as it indicates that the primer sequences may still be specific enough to amplify the target DNA under the appropriate PCR conditions. GRev ERev DRev

CRev BRev ARev

Figure 3: Electrophoretic gels of gradient PCR products using each set of designed primer pairs. Temperatures from left to right beginning in the lane after the standard are 42.5, 44.3, 46.4, 48.6, 50.8, 52.8, 54.5, and 55.8 oC. Only the gel for the GRev primer pair shows a PCR product. The relative brightness of the bands in this gel can be used to determine the optimal annealing temperature, which in this case appears to be 48.6 oC (lane 5). All of other gels show primer dimers, indicating that the PCR reaction failed. BLAST searches in the NCBI database produced some interesting results that indicate that the cellulases being studied are relatively novel. The results illustrate that many of the primer sequences searched produced strong matches with organisms unrelated to P. spinulosum as well as many other fungal species (Table 5). In addition, many of the sequence matches were found to code for a variety of proteins other than cellulases, such as scaffolding proteins, mitochondrial proteins, kinases, and sulfite reductases (Table 5). Ultimately, proteins included in the following table were selected based on their E- value and their similarity to cellulase and P. spinulosum. The E-value is a measure of how many matches that can be expected by chance during a search13. Therefore, the lower the E-value, the more significant a database match is. In the results for the primers searched in this experiment, the best E values (0.018) are returned for the FRevFirst123-F primer for HIV-1 envelope glycoproteins, a partial 16s rRNA from γ- proteobacterium, and a phosphoglycerate kinase from the common potato. These results alone indicate the high amount of variability in the matches for each of the primers investigated. Upon considering search results for organisms similar to P. spinulosum, it was found that Aspergillus nomius and P. marneffei occur most commonly. Interestingly, both of these fungi are pathogenic to humans. Aspergillus nomius is a known aflatoxin producing fungus that causes carcinogenic effects in the liver of rodents and seemingly in humans as well14,15. As discussed earlier, P. marneffei was recently renamed Talaromyces marneffei, and has also been found to cause systemic infection in immunocompromised individuals16. Ultimately, the BLAST searches performed suggest that the cellulases that the searched primers have been developed for are novel sequences. However, it will also be pertinent to perform additional BLAST searches with more specific parameters in order to conclude this. Nucleotide BLAST searches that narrow the search to only fungal species as well as protein queries for the designated primers may yield useful and interesting information about the target cellulases.

Table 5: Best matched sequences to each primer sequence and matches similar to P. spinulosum. Primer Name Organism Matched Protein Type E-value Query Cover O. canadensis (Bighorn Sheep) 43U chromosome 19 sequence 3.0 100% GRev60-559-F 43U chromosome 6 sequence 12.0 100% T. canis (Helminth parasite) Scaffold protein 3.0 90% Pig X chromosome sequence 3.0 90% GRev60-559-R O. Canadensis 43U chromosome 4 sequence 12.0 100% E. caproni (Trematode parasite) Scaffold proteins 12.0 85% HIV-1 isolate Envelope glycoprotein 0.018 100% FRevFirst123-F γ-proteobacterium Partial 16s rRNA gene 0.018 100% S. tuberosum (Potato) Phosphoglycerate kinase 0.018 100% A. nomius (Filamentous fungus) Sulfite reductase (partial β- 46.0 84% subunit) FRevFirst123-R P. marneffei (Fungi) Mitochondrial carrier protein 46.0 84% A. oryzae Sulfite reductase 47.0 84% B. gladioli (Gram-neg. bacteria) Chromosome 2 (complete seq.) 3.0 94% D. dendriticum (Parasitic fluke) Scaffold protein 12.0 85% ERev62-560-F B. neritina (sessile marine) Mitochondrial cytochrome 47.0 80% T. nigra (marine worm) oxidase 47.0 80% E. caproni Scaffold protein 4.5 81% ERev62-560-R B. simplex Partial coding sequence 18.0 77% DRev60-244-F X. bovienii (Gram-neg. bacteria) Megaplasmid 0.19 95% R. aquatilis Hx2 (Gram-neg. Complete genome 0.19 100% DRev60-244-R bacteria) E. coli Plasmids 47.0 80% M. musculus (Mouse) Lac-Z mutant allele 3.0 90% CRev60-388-F H. sapiens Calcium/calmodulin kinase 3.0 90% Chromosome 8 complete seq. 12.0 85% T. adhaerens (Placozoa) Hypothetical mRNA protein 3.0 90% CRev60-388-R S. mattheei (parasitic flatworm) Scaffold protein 46.0 80% A. nomis (Fungi) Hypothetical protein 183.0 75% S. erinaceieuropaei (Tapeworm) Scaffold protein 0.75 95% Brev56-231-F T. peptoniphilus 06-1 Complete genome 12.0 85% A. australis mantelli (Brown Scaffold protein 12.0 94% Brev56-231-R kiwi) C. necator Chromosome 2, complete 3.0 95% ARev64-450-F sequence O. Canadensis 43U chromosome 13 sequence 3.0 100% H. sapiens HLA Class I survey sequence 0.75 95% ARev64-450-R E. caproni Scaffold proteins 3.0 90% A. nomius Aquaporin mRNA 183.0 75% Conclusion Ultimately, the primer sequences developed for the target cellulases show a high degree of variability in BLAST searches which suggests they may be novel. Isolation of novel cellulases may be a substantial contribution to the biofuel synthesis field. In addition, due to the indication that there may be some similarity to pathogenic fungi such as Aspergillus nomius and Talaromyces marneffei, the isolation of these cellulase genes may also have some interesting medical applications. Work to optimize the PCR reaction conditions in order to obtain amplification products is a critical step in developing the most efficient isolation method. Future steps in this project will include the purification and sequencing of PCR products in order to clone the target gene sequences into a bacterial vector for easy study and eventual commercial use in the biofuel industry.

References (1) Kuhad, R. C.; Deswal, D.; Sharma, S.; Bhattacharya, A.; Jain, K. K.; Kaur, A.; Pletschke, B. I.; Singh, A.; Karp, M. Renew. Sustain. Energy Rev. 2016, 55, 249.

(2) Payne, C. M.; Knott, B. C.; Mayes, H. B.; Hansson, H.; Himmel, M. E.; Sandgren, M.; Ståhlberg, J.; Beckham, G. T. Chem. Rev. 2015, 115 (3), 1308.

(3) Singhania, R. R.; Adsul, M.; Pandey, A.; Patel, A. K. In Current Developments in Biotechnology and Bioengineering; 2017; pp 73–101.

(4) Agostinho, F.; Bertaglia, A. B. B.; Almeida, C. M. V. B.; Giannetti, B. F. Ecol. Modell. 2015, 315, 46.

(5) Gaurav, N.; Sivasankari, S.; Kiran, G.; Ninawe, A.; Selvin, J. Renew. Sustain. Energy Rev. 2017, 73, 205.

(6) MasterPure- Yeast DNA Purification Kit http://www.epibio.com/applications/nucleic-acid- purification-extraction-kits/dna-purification-genomic/masterpure-yeast-dna-purification- kit?protocols (accessed Apr 21, 2017).

(7) Thermo Fisher Scientific. 260/280 and 260/230 Ratios. http://www.nanodrop.com/Library/T009- NanoDrop%201000-&-NanoDrop%208000-Nucleic-Acid-Purity-Ratios.pdf.

(8) Nielsen, K.; Mogensen, H. S.; Eriksen, B.; Hedman, J.; Parson, W.; Morling, N. Int. Congr. Ser. 2006, 1288, 759.

(9) Parthasarathy, S. Unpublished data.

(10) Wheeler, T. Cellulase work.

(11) Primer Design Guide for PCR :: Learn Designing Primers for PCR http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html (accessed Apr 22, 2017).

(12) Palumbi, S.; Romano, S.; Mcmillan, W. O.; Grabowski, G. October 1991, 96822 (808), 1.

(13) NCBI: National Center for Biotechnology Information. BLAST Frequently Asked questions https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=FAQ (accessed Apr 22, 2017). (14) Environment, Health, and S. O. Information about Health & Aflatoxins in foods such as peanut butter http://www.ehso.com/ehshome/aflatoxin.php (accessed Apr 22, 2017).

(15) Moore, G.; Mack, B.; Beltz, S. BMC Genomics 2015, 16 (551), 1.

(16) Chan, J. F. W.; Chan, T. S. Y.; Gill, H.; Lam, F. Y. F.; Trendell-Smith, N. J.; Sridhar, S.; Tse, H.; Lau, S. K. P.; Hung, I. F. N.; Yuen, K.-Y.; Woo, P. C. Y. Emerg. Infect. Dis. 2015, 21 (7), 1101.