Fungal Genetics and Biology 44 (2007) 455–465 www.elsevier.com/locate/yfgbi Technological Advancement Rapid genetic mapping in Neurospora crassa
Yuan Jin, Sabrina Allan, Lauren Baber, Eric K. Bhattarai, Teresa M. Lamb, Wayne K. Versaw ¤
Department of Biology, Texas A&M University, 3258 TAMU, College Station, TX 77843, USA
Received 28 July 2006; accepted 15 September 2006 Available online 23 October 2006
Abstract
Forward genetic analysis is the most broadly applicable approach to discern gene functions. However, for some organisms like the Wla- mentous ascomycete Neurospora crassa, genetic mapping frequently represents a limiting step in forward genetic approaches. We describe an eYcient method for genetic mapping in N. crassa that makes use of a modiWed bulked segregant analysis and PCR-based molecular markers. This method enables mapping with progeny from a single cross and requires only 90 PCR ampliWcations. Genetic distances between syntenic markers have been determined to ensure complete coverage of the genome and to allow interpolation of linkage data. As a result, most mutations should be mapped in less than one month to within 1–5 map units, a level of resolution suYcient to initiate map-based cloning eVorts. This system also will facilitate analyses of recombination at a genome-wide level and is applicable to other perfect fungi when suitable markers are available. © 2006 Elsevier Inc. All rights reserved.
Keywords: Neurospora crassa; Bulked segregant analysis; Map-based cloning; Genetic mapping; Molecular marker; Recombination
1. Introduction approach for a large majority of fungal researchers. However, forward genetics in N. crassa frequently is Neurospora crassa has a long, rich history as a model hampered by diYculties encountered in genetic mapping, organism due to its facile genetics, ease of culture and which is a necessary step toward the identiWcation of rapid growth rate (Davis and Perkins, 2002). In addition genes aVected by mutation. to these inherent attributes, many invaluable tools exist Mapping of mutations in N. crassa traditionally for genetic, molecular and biochemical analysis of N. involves co-segregation analysis using phenotypic mark- crassa—a large collection of mutants housed at the Fun- ers. In most cases multiply marked tester strains are used gal Genetics Stock Center (McCluskey, 2003), a dense, to improve eYciency (Perkins, 1990, 1991). However, new well-ordered genetic map (Perkins, 2000), an RFLP map mutations often fail to show linkage to any of the markers (Nelson and Perkins, 2000), eYcient transformation in these strains (Perkins, 2006). When this occurs one must (Margolin et al., 1997), a complete genome sequence conduct co-segregation analysis using a series of marked (Galagan et al., 2003), commercially available DNA strains that collectively test for linkage to regions within microarrays, and a rapidly growing number of targeted each arm of the seven linkage groups. In either case, even gene knock-out strains (Colot et al., 2006). While these when linkage is clearly established, additional crosses are tools are crucial for eVorts to elucidate gene function, required to obtain suYcient resolution to identify the they are complementary and supplementary to novel aVected gene by candidate gene prediction and/or comple- forward genetic analysis, the primary experimental mentation. As a result the entire process requires a consid- erable investment of time, usually on the order of 3–12 months. For mutations that give rise to a phenotype that * Corresponding author. Fax: +1 979 845 2891. can be detected only via a complex screen or that require a E-mail address: [email protected] (W.K. Versaw). deWned genetic background, e.g., suppressor mutations,
1087-1845/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2006.09.002 456 Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465 the time and eVort needed for mapping is increased dra- 2. Materials and methods matically. PCR-based molecular markers have been widely 2.1. Strains and culture conditions adopted for genetic mapping purposes (Elahi et al., 2004; Jenkins, 2003). The main advantages of molecular mark- Neurospora crassa strains used in this work included: ers are that they seldom aVect the Wtness of an organism wild-type Oak Ridge 74-ORS-6a (FGSC 4200), wild-type (selectively neutral) and are much more numerous than Mauriceville-1c (FGSC 2225), an albino (al-1) mutant phenotypic markers. As a result, high-resolution map- (FGSC 3623) and where indicated, progeny from crosses ping can be achieved using progeny from a single cross. between these parental strains. All strains were propagated On this basis, a mapping study in N. crassa could be com- in Vogel’s medium (Vogel, 1956) supplemented with 1% pleted in less than one month after a cross was initiated. sucrose. Sexual crosses were conducted on agar plates As a Wrst step toward this goal, Kotierk and Smith (2004) containing synthetic crossing medium (Westergaard and described a set of 18 PCR-based molecular markers that Mitchell, 1947) supplemented with 1% sucrose. exploit the abundant sequence polymorphisms that exist between the laboratory standard Oak Ridge wild-type 2.2. Genomic DNA isolation strain and the Mauriceville “exotic” wild-type strain (Kotierk and Smith, 2004; Metzenberg et al., 1984). In Mycelia were harvested by vacuum Wltration from 1 ml short, a mutant obtained in the Oak Ridge background is stationary cultures after 2 days growth at 30 °C. For DNA crossed to the Mauriceville strain and co-segregation isolation from single cultures, mycelial pads were rinsed analysis is conducted using the markers that distinguish with water and vacuum Wltered until just damp then trans- polymorphic diVerences between the two parental back- ferred to 1.5 ml microcentrifuge tubes, frozen in liquid grounds. nitrogen and ground to a Wne powder with plastic pestles. We have expanded upon the work of Kotierk and The freezing step could be omitted and mycelial pads Smith (2004), and describe here a set of genetically deWned instead lyophilized overnight. Equivalent yields and purity molecular markers that provide complete map coverage. of genomic DNA were obtained regardless of which initial We also describe the use of these markers in an eYcient step was used, but most samples were frozen to expedite genetic mapping strategy that employs bulked segregant processing. To each ground sample 0.6 ml Extraction BuVer analysis (Michelmore et al., 1991). Bulked segregant anal- (100 mM Tris–HCl, pH 8.0, 50 mM EDTA, and 1% SDS) ysis is a widely used method to enhance the eYciency of and 3 l Proteinase K (20 mg/ml in 20 mM Tris–HCl, pH mapping monogenic traits. BrieXy, individual progeny 7.5, 50% glycerol) were added, mixed vigorously, and incu- from a single cross are pooled based on the segregating bated at 65 °C for 1 h. When processing multiple samples trait of interest. Within a bulk, all individuals have identi- the appropriate volumes of Extraction BuVer and Protein- cal genotypes at the region related to the trait of interest ase K solutions were combined immediately before use and (mutant or wild-type) but have random genotypes at all added as a single reagent. After the 1 h incubation, samples unlinked loci. Consequently, markers located near the were again mixed thoroughly and 0.2 ml of 7.5 M ammo- region of interest will be in linkage disequilibrium and nium acetate was added followed by vigorous mixing then markers located further away will have a level of disequi- incubation on ice for 5 min. Samples were centrifuged for librium proportional to their distance. At far distances 3 min at 16,000g, supernatants were transferred to fresh syntenic markers will display a maximum of 50% recom- tubes, 3 l RNase A (10 mg/ml in Tris–HCl, pH 8.0, 50% bination, indistinguishable from unlinked loci. The pri- glycerol) was added, and samples were incubated at 37 °C mary advantage of bulked segregant analysis is that it for 1 h. Each sample was extracted once with 0.5 ml chloro- greatly reduces the time and expense of mapping. For form, then genomic DNA was precipitated with 0.65 ml iso- example, a standard co-segregation analysis using just 40 propanol. DNA pellets were washed once with 70% ethanol individual progeny from a segregating population and 30 before dissolving in 0.1 ml TE, pH 8.0. For bulked samples, diVerent PCR-based molecular markers entails 1200 40 individual mycelial pads were combined, frozen with ampliWcations. Alternatively, use of the same marker set liquid nitrogen, ground with a mortar, and pestle. DNA but with bulked segregant analysis as described here was then isolated as described but reagent volumes were requires only 90 ampliWcations, which can be accom- increased 10-fold. plished in a single day using a 96-well plate. Our mapping approach is designed to minimize eVort 2.3. Primer design, PCR conditions and marker scoring and sample numbers, both as cost- and time-saving mea- sures. Despite this minimalist approach, most mutations To ensure uniform ampliWcation properties all PCR should be mapped in less than one month to within 1–5 primers were designed using Web Primer (http://seq.yeast- map units, a resolution suYcient to proceed with map- genome.org/cgi-bin/web-primer) with the default parame- based cloning eVorts without the need for additional ters, and the output “best primers” were chosen. Primers markers or analysis of large populations of individual were purchased from IDT, Inc. (Coralville, IA, USA). Cri- segregating progeny. teria for selection of a primer pair for marker use included Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465 457 equivalent ampliWcation eYciency and the same amplicon grounds that are widely used for RFLP mapping (Metzen- size when using genomic DNA isolated from either the Oak berg et al., 1984; Nelson and Perkins, 2000), and the use of a Ridge or the Mauriceville strains as PCR template. Ampli- CAPS marker is fundamentally the same as an RFLP cons were ideally 250–700 bp with a polymorphic restric- probe. The key advantage of CAPS markers is that analyses tion site located at the center. can be completed much more quickly and do not require an A single PCR ampliWcation scheme was used for all extensive series of hybridizations. primer pairs: 50 ng genomic DNA, 0.5 M each primer, CAPS markers used in this study are listed in Tables 1 0.25 mM dNTPs, 1 U Takara ExTaq polymerase (Fisher and 2. The approximate chromosomal locations of these ScientiWc, Houston, TX, USA), and 1£ ExTaq buVer were markers relative to multiple known mutations are illus- assembled in a 20 l total volume on ice. Thermal cyclers trated in Fig. 1. Markers were named based on the follow- were pre-heated to 95 °C before tubes or 96-well plates were ing convention: linkage group number—predicted genetic inserted. Samples were initially denatured for 3 min at 95 °C location in map units starting from the left telomere (Per- then treated with 26 cycles of 15 s at 95 °C, 15 s at 60 °C, kins, 2000; Radford and Parish, 1997)—restriction enzyme 1 min at 72 °C, followed by 5 min at 72 °C then stored at used to reveal a polymorphism. For example, the marker 4 °C. The same amount of template DNA was used for named 1-23-MspI denotes a marker located on Linkage analysis of individual strains and for bulked segregant anal- Group I with a predicted map position 23 map units from ysis. the left telomere, and the restriction enzyme MspI. For clar- To score the genotype pattern for a given marker, 3 l of ity, marker names are abbreviated hereafter with the desig- the PCR mix was digested with 10 U of the appropriate nated restriction enzyme omitted, e.g., 1–23. The values for restriction enzyme for 1.5 h in a Wnal volume of 20 l then the predicted genetic location serve solely as identiWers to the entire volume was electrophoresed in a 1.5% agarose gel orient the order of one marker relative to another on a at 70 V. In all cases, the amplicon of one parental type was chromosome; as discussed later they do not denote absolute cleaved and the other parental type was uncleaved. The map positions. polymorphic pattern for each marker is listed in Tables 1 Our approach to PCR primer design was simplistic and 2. Restriction endonucleases were purchased from New but eVective. In short, candidate genomic sequences were England Biolabs (Ipswich, MA, USA). selected from the complete genome sequence of the N. crassa Oak Ridge wild-type strain (Galagan et al., 3. Results and discussion 2003) (http://www.broad.mit.edu/annotation/genome/neuros- pora/Home.html). Suitable primers to amplify the candi- 3.1. Marker development date regions were identiWed using the freely available Web Primer program (http://seq.yeastgenome.org/cgi-bin/web- To facilitate single cross mapping, we initially intended primer) using the default parameters. All primer pairs were to simply supplement the Kotierk and Smith (2004) marker tested in separate PCR ampliWcations containing either collection as needed to achieve complete map coverage, and Oak Ridge- or Mauriceville-derived genomic DNA as tem- to use these markers for bulked segregant analysis to plate to ensure that amplicons were of the same size and enhance eYciency. However, ampliWcation conditions var- that ampliWcation eYciency (yield) was comparable. In sev- ied widely between the markers, which complicated high eral cases, we were unable to amplify Mauriceville DNA, or throughput, concurrent use. In addition, some markers only poorly so, presumably due to polymorphisms relative were not suitable for bulked segregant analysis because the to the Oak Ridge-based primer sequences. In most of these genetic contribution of only one parent was detected. To cases, ampliWcations were successful when new primers maximize eYciency we chose to utilize a single type of were designed to Xank the initial primer sites. molecular marker that was readily amenable to bulked seg- We used three diVerent approaches to identify restriction regant analysis. Similarly, we deWned parameters for PCR site polymorphisms suitable for CAPS markers. We Wrst primer design to enable use of a single ampliWcation scheme evaluated the marker set described by Kotierk and Smith for all markers. (2004). Our primary criterion for marker development was We chose to use cleaved ampliWed polymorphic that a restriction site polymorphism would be Xanked by at sequence (CAPS) markers for our studies. A CAPS marker least 125 bp without an identical site to allow detection of is a PCR-ampliWed sequence that corresponds to a deWned both the cleaved and uncleaved amplicons by standard aga- genomic region and includes a polymorphic restriction rose gel electrophoresis. We set a more Xexible upper limit endonuclease site, which allows one to distinguish the par- for the ideal amplicon size at 600 bp to ensure that all ent of origin. Because CAPS markers lack bias in the ampli- ampliWcations could be conducted with a single protocol Wcation step (both parental genotypes are ampliWed), these and resolved on a single gel. Although arbitrary, for eco- markers are readily amenable to bulked segregant analysis nomical reasons we limited our selection of polymorphisms (Elahi et al., 2004; Jenkins, 2003; Michelmore et al., 1991; to those that made use of readily available restriction endo- Vignal et al., 2002). For our purposes, CAPS markers dis- nucleases from a single vendor. Based on these criteria we tinguish between Oak Ridge- and Mauriceville-inherited adopted and/or developed Wve CAPS markers from the sequences. This is the same combination of genetic back- Kotierk and Smith data set (2–36, 4–120, 6–12, 6–95, and 458 Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465
Table 1 Primary CAPS marker panel for bulked segregant analysis Marker name Primers Amplicon (Contig #: bp coordinates) DNA fragment sizes (bp) Oak Ridge Mauriceville 1-23-MspI CACAAGTTCACGCCTTGTCC 7.39: 245326–245800 144/331 475 CTCGTTCATGGCGTAGAAGC 1-30-BamHI TTCTTTCTCCGCTACTTCCGT 7.59: 119186–119538 176/177 353 TCACAGAGTCCATGCCAGAAA 1-59-HaeIII CACCGTCCCTAAACTCCATAA 7.3: 817717–818262 246/300 546 TTGACTGTTCATCTGCCCACT 1-110-HaeIII CCGTTGATCATGATGTGACA 7.9: 362428–362948 228/293 521 ACAAAAAGAACGCTGCTCCC 1-185-TaqI CGAGGCACATATCCGCAGA 7.2: 274637–274940 148/156 304 AATAGCACCGCTCTTGCCA 1-226-DpnII AATATCAATGGTCTGGCCCT 7.7: 802187–802417 110/121 231 TCTCTACACTGTCAAGCACGG 2-36-PvuI CTCCGGATGAGGTTGCCG 7.8: 792196–793747 768/784 1552 GTGCGGGCTTAACCGCTG 2-60-DpnII TCCTTCTCTACACCTCTGGCT 7.33: 287493–287790 298 148/150 TGGGAGCAACGTAGAACTGA 2-88-TaqI CCGACAAGCATCTGGCTCT 7.5: 62054–62327 98/176 274 TTCTTCCTCGCACCCTCCTT 2-105-HhaI TGCAACGAGATCCCAGACTAT 7.71: 66401–66681 132/149 281 ACTGGTCCAAGGTCACCAAAT 3-17-AluI CTTTGGGCGGTCAACTCCA 7.42: 202777–203079 96/207 303 CAGGGCAACTTGTTTGGGC 3-52-EcoRI GGGCGATGAGCAACAAATAA 7.25: 33816–34195 189/191 380 ACAAAGTCTTACTGCCATGCG 3-102-Tsp509I GAGCCAGAACTTGGTTGTGAT 7.67: 55700–55988 152/137 289 ATTCTTCCATATTCCACCCCC 4-2-MspI CCATCCCCAAGCTTCTCAA 7.79: 61171–61527 357 175/182 TGTGTGGTATCGCTTTCAACT 4-35-AluI TGTCGATGGCACCCGTCT 7.18: 35189–35487 299 142/157 TGAGGAGTTCGCCGTCAA 4-70-BamHI TGGAGGGATTTGTGTCAAGGT 7.53: 90510–90919 410 201/209 CGTATAGCTTGCCTCGTCGA 4-120-BglII AATATCCTTCACCACCGTGGC 7.19: 771981–772470 242/248 490 AATCCTTAAGCACCCCTTGG 5-27-TaqI TCCTCTCCCTGTACTCGTCCA 7.64: 47023–47419 198/199 397 CCCCCTTGTCCGTCAAGTA 5-98-Tsp509I AAACCCATACCGAGGAGGA 7.11: 610139–610424 113/173 286 GCGTGGTCTGTGACATCTACA 5-135-HpaI ATCCCTCCATCTAAAAGCTCA 7.31: 259764–260117 170/184 354 CCCCTGATCATCGATCTCGT 5-175-DpnII CCGAGCCAGGATTGTCA 7.13: 40616–40913 298 88/210 ATCTGCATGTTGCCATCCGT 5-220-MspI TAAGCCCAACGGCACTGT 7.48: 153273–153700 181/247 428 AAAAAAGACCGTTGACGCCA 6-12-XhoI GGTCCGCAGGTCTTACTTTAA 7.16: 154977–155546 283/287 570 TCCGACAATGTTCAAACGCT 6-39-HaeIII CCCGCTCCAAGTTCTACTCTT 7.22: 187185–187397 213 92/121 GGTCTTCGGTCTGGACGTG 6-68-MspI ATGTCTTGGGTGTTTGGCAT 7.4: 334316–335039 724 216/508 TCCTCAAGATCGTCACTCAGC 6-95-KpnI GAAAATGTCAACTTTGTTGCG 7.4: 1131921–1132292 163/209 372 ATGAACGAATCAATGCCTCC 7-15-HaeIII TAGCCATACCTGGTTTGAGGG 7.66: 11810–12098 289 125/164 AACAGGTCCTTCCAGCGAGAT 7-40-DpnII AAAGCTTGCGAGACGTCGGAT 7.21: 577678–578059 155/227 382 TTAGAGCGCCAAGACACCAA 7-68-Tsp509I ATGTTGCCTTTAAGCCCCA 7.10: 232320–232919 600 295/305 GACCCATAGCCGCAAGGAT 7-94-HhaI ATTGTCTCCTTGCATCCCGTT 7.23: 348305–348726 68/354 422 CGAGGAGGAGGAGTCCAAGTA Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465 459
Table 2 Supplementary CAPS markers Marker name Primers Amplicon (Contig #: bp coordinates) DNA fragment sizes (bp) Oak Ridge Mauriceville 1-85-HaeIII TATTGATCTTCCGCTCTTTGG 7.6: 213347–213745 399 67/332 AAGAAGGTCGAGTTCCTCGC 1-150-RsaI CACCGTCCCTAAACTCCATAA 7.2: 1385476–1386028 553 252/301 TTGACTGTTCATCTGCCCACT 1-184-HaeIII GGTTATGTAGGAAGGGGGAGA 7.2: 315838–316741 904 320/584 GGATGACACTGTCGTGGCTAA 3-76-AluI CAAAGCATGATTGCAAGCCA 7.1: 304660–304924 130/135 265 ACGGACATAGACAAGGGAAAA 5-55-MspI ATTCCTCCTTCTCGTCCTCCT 7.24: 31028–31473 446 189/257 TTGTCTGGTCGAACCATACCT 5-106-TaqI TACGTTGATGCCGGAAGC 7.14: 465795–466056 262 62/200 AGAAGGGAATCACCAACTCCA 5-127-Tsp509I AGCCGAACCAGAAATACAAGA 7.15: 145012–145283 272 122/150 TGCCGACTCCAAGATCAA 7-2-KpnI ACTTGATAGCAGCCAAGCTCT 7.78: 59602–60075 224/250 474 CGAGGAGGAGGAGTCCAAGTA 7-88-HindIII TGTTTTCCGTGTTCTGGGTT 7.52: 168261–168752 244/248 492 AGGAGCAAATCCAGGTTCTCA
fr mat ad-3B met-6 al-1 arg-13 LG I 1-231-30 1-591-85 1-110 1-1501-184 1-185 1-226
un-24gpd-1 trp-3 LG II 2-362-60 2-88 2-105
acr-2 leu-1 trp-1 ro-11 LG III 3-17 3-52 3-76 3-102
gln-2 pho-5 pyr-2 LG IV 4-2 4-35 4-70 4-120
Fsr-16 lys-2 inl ad-7 pyr-6 LG V 5-275-55 5-985-106 5-127 5-135 5-175 5-220
nit-6asd-1 pan-2 nuo21.3c LG VI 6-126-39 6-68 6-95
het-e lacc frq arg-10 LG VII 7-2 7-15 7-40 7-68 7-88 7-94
Fig. 1. Positions of CAPS markers on the N. crassa genetic map. The positions of 39 CAPS markers relative to known mutations are shown with the over- all scale based on Perkins (2000). Only the 30 markers listed in Table 1 are required for complete map coverage.
7–88; see Tables 1 and 2). Amplicons were not sequenced libraries were made and validated by Mi Shi, Randy and may contain additional polymorphisms, some of which Lambreghts and Jennifer Loros at Dartmouth Medical could be small insertions/deletions that were undetected by School and the clones were sequenced and analyzed at standard agarose gel electrophoresis. The existence of such the Broad Institute (Cambridge, MA, USA; http://www. polymorphisms would not aVect marker utility. Thus for broad.mit.edu/annotation/). These data were generated to simplicity, the sequence coordinates given for this marker detect SNPs and develop snip-SNP markers relative to the set in Tables 1 and 2 are based on the reference Oak Ridge Oak Ridge sequence that would be used for genetic map- sequence. ping as one component of the Neurospora Program Project Our second approach to identify restriction site poly- Grant P01 NIGMS 068087, Functional Analysis of a morphisms was to mine publicly available EST sequences Model Filamentous Fungus (http://www.dartmouth.edu/ derived from the Mauriceville strain. Mauriceville cDNA %7Eneurosporagenome). The sequence data were deposited 460 Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465
Table 3 Genetic distances between marker pairs Marker 1 Marker 2 Map unitsa Marker 1 Marker 2 Map unitsa 1-23-MspI 1-30-BamHI 10 5-27-TaqI 5-55-MspI 4 1-30-BamHI 1-59-HaeIII 18 5-55-MspI 5-98-Tsp509I 9 1-23-MspI 1-59-HaeIII 24 5-27-TaqI 5-98-Tsp509I 9 1-59-HaeIII 1-110-HaeIII 20 5-98-Tsp509I 5-135-HpaI 10 1-110-HaeIII 1-150-RsaI 15 5-135-HpaI 5-175-DpnII 9 1-150-RsaI 1-185-TaqI 5 5-175-DpnII 5-220-MspI 18 1-110-HaeIII 1-185-TaqI 17 1-185-TaqI 1-226-DpnII 25 6-12-XhoI 6-39-HaeIII 20 6-39-HaeIII 6-68-MspI 11 2-36-PvuI 2-60-DpnII 34 6-68-MspI 6-95-KpnI 32 2-60-DpnII 2-88-TaqI 8 2-88-TaqI 2-105-HhaI 26 7-15-HaeIII 7-40-DpnII 26 7-40-DpnII 7-68-Tsp509I 7 3-17-AluI 3-52-EcoRI 9 7-68-Tsp509I 7-88-HindIII 14 3-52-EcoRI 3-76-AluI 2 7-88-HindIII 7-94-HhaI 18 3-76-AluI 3-102-Tsp509I 13 7-68-Tsp509I 7-94-HhaI 32 3-52-EcoRI 3-102-Tsp509I 15
4-2-MspI 4-35-AluI 22 4-35-AluI 4-70-BamHI 24 4-70-BamHI 4-120-BglII 29 a A map unit is deWned as 1 percent recombination without correction for double crossovers. Map distances were determined as two-point data from the genotypes of 96 random progeny of a cross between the Oak Ridge mat a strain (FGSC 4200) and the Mauriceville mat A strain (FGSC 2225). at the Broad website prior to publication in the common enzymes with 4 bp recognition sequences (4-bp cutters). We interest and were obtained from Broad for the analyses chose to use the enzymes HaeIII, MspI, TaqI, and Tsp509I described here. A publication describing the Program Pro- primarily because these enzymes were robust and among ject eVort to identify several classes of SNPs and generate a the least expensive 4-bp cutters. The rationale for this high density SNP map is in preparation (Lambreghts, Shi screen was that single nucleotide polymorphisms would and Loros, personal communication). The sequence data exist in non-coding regions at a frequency of about 1% consisted of a set of 7566 Mauriceville EST sequences. (double our crude estimate from analysis of coding regions Assembly of these ESTs using the StackPACK clustering in ESTs). On average, four 4-bp cutters would sample system (Electric Genetics Corp., Reston, VA, USA; http:// 320 bp in the target 5 kb region so the probability of failure www.egenetics.com) yielded 649 singletons and 413 contigs to detect a polymorphism with four diVerent enzymes (1062 unigenes). Batch BlastN alignments (Altschul et al., would be (1–0.01)320, or 0.04. Thus one would have a better 1990) were prepared for the unigene set using the complete than 95% chance of successfully identifying at least one Oak Ridge-derived genome sequence as the reference (Gal- restriction site polymorphism in a speciWed 5 kb target agan et al., 2003). Unfortunately, automated search tech- region. We tested the de novo screen for a region near the al- niques were unable to reliably distinguish polymorphisms 2+ gene (albino-2) on Linkage Group I and found two poly- from random sequence errors. Therefore we manually morphisms, one of which was developed as marker 1–184 screened the alignments to focus on regions with near iden- (Table 2). Even though 1–184 was the only marker we tity. Due to this restriction it is likely that many useful poly- developed with this strategy, the successful outcome indi- morphisms were missed. Regardless, we identiWed 70 cated that it is a tenable approach to screen user-deWned potential restriction site polymorphisms, of which 33 were regions. conWrmed and subsequently developed as a CAPS marker (Tables 1 and 2). 3.2. Map coverage Our Wnal strategy to identify restriction site polymor- phisms was to amplify and screen deWned target sequences Although we had developed markers with an eye toward from the Oak Ridge and Mauriceville genomes directly, a uniform map distribution (Fig. 1) we could not be certain process we refer to as a de novo screen. For this strategy, a of the minimum number of markers or their placement on target sequence was selected on the assumption that the the map to achieve complete map coverage. This uncer- chromosomal location would serve as a useful genetic tainty was due to the fact that recombination frequencies in marker. Primers were designed to amplify a 5 kb region in diVerent genetic backgrounds can be highly variable (Per- three to Wve segments. Intergenic regions were preferred kins and Barry, 1977). An underestimate of the genetic dis- since non-coding sequence is likely to have greater numbers tance between two markers could result in a gap whereby of random polymorphisms than coding sequence. The we would fail to detect linkage to a mutation located in the screen was conducted with four diVerent restriction interstitial region. To identify potential gaps in map cover- Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465 461 age and to assess genetic distances between markers we Regardless, if we assumed that double crossovers occur genotyped 96 randomly chosen progeny from a cross within this region at high frequency, similar to that of the between the Oak Ridge and Mauriceville wild-type strains region between markers 5–27 to 5–98 (see above), we with 34 of the CAPS markers. In essence, this was a 34- would estimate the corrected map distance at close to 50 point cross with the ability to add markers as needed with- map units. Given this conservative value, a mutation out repeating the entire process. The genetic distances were located midway between marker 2–36 and 2–60 would be calculated as two-point data, e.g., from the percent recom- roughly 25 map units from either marker, and this would bination between two markers among the population of 96 represent the greatest distance any mutation would be individuals (Table 3). We made no correction for double found from a marker in our collection. Even at this dis- crossover events in our estimates of map distances. How- tance, linkage would be conWrmed from co-segregation ever, we did assess the occurrence of these events for Wve analysis using only a modest number (40) of random diVerent loci (Table 3) and found that for three of the loci, progeny (95% conWdence level, Chi square). Conse- double crossovers reduced the apparent recombination fre- quently, the set of 30 markers listed in Table 1 are more quency as might be expected (15% in the regions between than suYcient to provide complete map coverage. Fur- markers 1–23 to 1–59, and 1–110 to 1–185, and 30% for the thermore, most mutations will be linked to more than one region between markers 5–27 to 5–98). In contrast, no dou- marker when using this set of 30, adding precision to the ble crossovers were detected for the distal right arms of estimate of genomic location. The supplementary markers Linkage groups III and VII, which was especially surprising listed in Table 2 may be useful to further reWne some map for Linkage Group VII since the map length for this region positions although it is important to note that when (32 map units) was signiWcantly greater than those regions markers are located very close to each other, the popula- where double crossovers were detected in Linkage Groups I tion size needed to detect an informative recombinant and V (24, 17, and 9 map units). must be increased. The N. crassa total map length is unknown, but estimates based on cytological chiasma counts and regional recombi- 3.3. Bulked segregant analysis: sensitivity and limit of nation frequencies suggest a value of about 1000 map units detection (Perkins and Barry, 1977; Radford and Parish, 1997). The sum of the regional map lengths determined from our 34- Map distance data indicated that our 30-marker set point cross (Table 3), however, suggest that the total map (Table 1) would provide complete map coverage if co-seg- length for this combination of genetic backgrounds is likely regation analysis were performed using individual prog- to be less than 500 map units. Although the genetic length of eny. The limiting factor was the ability to establish each linkage group was less than anticipated from previous linkage at a maximum distance of 25 map units. To deter- map data (Perkins, 2000; Radford and Parish, 1997), the mine if this level of sensitivity could be achieved using reduction was not uniform. Map lengths of Linkage Groups bulked segregant analysis we tested three unlinked CAPS III and V were each about 25% of the expected values, and markers in a mock analysis. Genomic DNA from the Oak Linkage Group I was about 45% of the expected value. In Ridge strain was mixed in diVerent proportions with contrast, the genetic lengths of the left arm of Linkage group genomic DNA from the Mauriceville strain to mimic II and distal segments of the right arms of Linkage Groups recombination and the related genetic distances. As II, VI, and VII were all greater than the expected values. The shown in Fig. 2, each marker yielded band patterns that presence of recombination hotspots and the non-random correlate with the “parental” DNA proportion, and we distribution of recombination events in general have been could easily distinguish mixes indicative of 25 map unit well documented in N. crassa (Bowring and Catcheside, distances (25% and 75% of each parental DNA) from a 1999b; Catcheside, 1981; Catcheside, 1975), and attributed mix representing an unlinked sample (50% each parent). to modulators of recombination that include rec genes, cog, The mock bulk segregant analyses shown in Fig. 2 and spo11 (Angel et al., 1970; Bowring et al., 2006; Catche- also established a working limit of detection for the side, 1981; Yeadon et al., 2004). Allelic diVerences in these presence of the rarer allele when linkage is tight. About genes may also contribute to the distribution of recombina- 5% of the bulk must be composed of recombinants to tion events that we detected. Regardless of mechanism, vari- distinguish the pattern from either of the parental, ation in the relationship between physical and genetic monomorphic patterns. For some markers detection at distances throughout the genome strongly supports the need this 5-map unit level required examination of the equiva- for an empirical approach when investigating genetic map lent, reciprocal mix, presumably due to subtle diVerences distances and meiotic recombination. in the ampliWcation eYciencies for speciWc target The greatest map distance between any two adjacent sequences. Quantitative analysis of band patterns using markers was 34 map units (markers 2–36 and 2–60). It densitometry conWrmed the congruence between recip- should be noted that based on the physical map, marker rocal mixes and furthermore, indicated that the mock 2–36 is located much closer to the left telomere than was analyses yield remarkably consistent standard curves estimated from previous genetic map data (Radford et al., that could be used to estimate map distance to an 2006). unknown mutation. 462 Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465
0 5 10 20 25 30 40 50 60 70 75 80 90 95 100 % Oak Ridge 100 95 90 80 75 70 60 50 40 30 25 20 10 5 0 % Mauriceville
2-105
3-52
7-15
100 2-105 3-52 7-15
10
1 Relative band intensity (Oak Ridge/Mauriceville) 0.1 0 2550751000 25 50 75 100 0 255075100 Percent Oak Ridge DNA Percent Oak Ridge DNA Percent Oak Ridge DNA
Fig. 2. Quantitative assessment of sensitivity and detection limits for bulked segregant analysis. Mock bulks were prepared from proportions of Oak Ridge and Mauriceville-1c genomic DNA to mimic recombination and related genetic distances. (A) Representative band patterns from analysis with three CAPS markers. Note that for 2–105 and 3–52 it is the Oak Ridge “allele” that is cleaved but for 7–15 the Mauriceville allele is cleaved. (B) Band intensities for the parental alleles were determined by densitometry, and for each marker the ratio of Oak Ridge to Mauriceville allele is plotted vs. the percent Oak Ridge DNA in the bulk.
Cross mutant in Oak Ridge with selected CAPS markers. In short, the al-1 mutant (Oak x background to Mauriceville Ridge background) was crossed to the Mauriceville strain and random progeny were isolated. Progeny that carried the Pool 40 mutant progeny al-1 mutation were readily distinguished from wild-type Pool 40 wild-type progeny progeny by their lack of the usual orange pigment. We pooled mycelia from 40 individuals of each phenotypic class Extract DNA, prepare to form two bulks, and isolated genomic DNA from both 1:1 mix control (gray) bulks. We chose 40 individuals as an ideal bulk size because, as discussed in section 3.2, this is the minimum number Analyze with CAPS markers required to establish linkage if 25% recombination is observed (95% conWdence level, Chi square). Although we No linkage Linkage could have analyzed only the albino class, which would be the norm for bulked segregant analysis in diploid organisms Estimate genomic location by interpolation (Martinez-Morales et al., 2004; Michelmore et al., 1991; or Rawls et al., 2003; Rymarquis et al., 2005), we also included Repeat with new markers as needed the wild-type class for conWrmation, and a 1:1 mix of the two pooled DNA samples as a control. In retrospect, the value of Complementation these extra samples in terms of increased conWdence in the Fig. 3. Flow chart for map-based cloning in N. crassa using bulked segre- scoring far outweighs the modest increase in workload. The + gant analysis. al-1 gene is located on the right arm of Linkage group I (Fig. 1). As shown in Fig. 4, markers located on diVerent chromosomes (4–120 and 7–88) displayed equivalent band 3.4. EYcacy of bulked segregant analysis for genetic patterns in all three bulks, indicative of unlinked loci. In con- mapping trast, markers located near the al-1+ gene (1–150 and 1–185) displayed reciprocal band patterns in the albino and wild- To test the overall utility of our mapping approach (out- type bulks that clearly deviate from those in the 1:1 non-link- lined in Fig. 3), bulks were prepared from a population segre- age control bulk, indicating that these markers are indeed gating a known mutation, al-1 (albino-1), and were analyzed linked to the al-1+ gene. Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465 463
+ Phenotypic class lation of these map distance data, we estimate that the al-1 albino mix WT gene is located within 1 map unit of marker 1–185. To ver- ify this estimate we compared the physical and genetic dis- tances between each of the markers and the al-1+ gene. 1-185 Markers 1–150 and 1–185 are physically separated by about 1110 kb and genetically by 5 map units. Thus for this region there is an average of 220 kb per map unit. Marker 1–185 is physically separated from the al-1+ gene by 75 kb, well within our estimated 1 map unit genetic distance at 220 kb per map unit. At this level of resolution we could easily have undertaken complementation studies to conWrm 1-150 the gene aVected by mutation. As a further validation of this technique, we mapped a trait for which the causative mutation was not known. The Oak Ridge-derived strain bd, COP1-2 (Vitalini et al., 2004), has altered expression of the circadian clock-controlled genes ccg-1 and ccg-2, and conidia from the mutant strain 4-120 are dark in color and wet-looking. When COP1-2 was backcrossed, the conidial phenotype segregated 1:1 in ran- dom progeny, and cosegregated with altered ccg-1 expres- sion levels, indicating that a single gene was responsible for the COP1-2 mutant phenotypes. We crossed the bd, COP1- 2 strain with the Mauriceville-1c strain, and assembled 7-88 pools of wild-type and mutant segregants as described above. Using the CAPS markers, we located the mutation on the right arm of Linkage group IV, with linkage to markers 4–70 and 4–120. Recombination values derived Fig. 4. Bulked segregant analysis conWrms the map location of the al-1 from genotyping individual progeny (data not shown) sug- mutation at 1–185. The al-1 strain was crossed to Mauriceville-1c and gested that the mutation was located within a 1 map unit genomic DNA bulks were prepared from progeny based on phenotype. region. Based on this genetic map location, a single candi- Each DNA bulk as well as a 1:1 mixture of the two phenotypic bulks was W analyzed with the indicated CAPS markers. Reciprocal patterns in the two date gene was identi ed and sequenced from the COP1-2 phenotypic bulks that diVer from those of the mix are indicative of link- strain. While the identity of the gene and its characteriza- age. The albino bulk contains only the Oak Ridge polymorphism at 1–185 tion with respect to circadian rhythmicity will be published while the wild-type bulk contains only the Mauriceville polymorphism, elsewhere, the sequence analysis identiWed a mutation in an W indicating strong linkage of the al-1 mutation to this locus. Signi cant open reading frame that would result in early termination, linkage to the nearby marker 1–150 is also apparent. Unlinked markers W 4–120 and 7–88 show equal parental polymorphisms. and con rmed the map data.
The patterns detected for marker 1–185 (Fig. 4) from the 3.5. Method summary segregated bulks are monomorphic suggesting that this marker is tightly linked to the al-1+ gene. Because our limit Based on our investigations of map coverage by a set of of detection is about 5% recombinants, we would estimate deWned molecular markers and the sensitivity and detection that the al-1+ gene is located at a position less than 5 map limits of bulked segregant analysis, we have devised an units from marker 1–185. However, this marker would give eYcient method for rapid genetic mapping of mutations in the same pattern regardless of whether it was located to the N. crassa. The overall scheme for this procedure is illus- left or right of al-1+ so the gene must lie within a 10-map trated in Fig. 3. In summary, a mutant isolated in the Oak unit region. For some purposes this level of resolution may Ridge background, i.e., FGSC 4200 (mat a) is crossed to the be suYcient but it is unlikely to be suitable for map-based polymorphism-rich wild-type Mauriceville-1c (mat A) cloning. To improve resolution we made use of the fact that strain (FGSC 2225) to obtain a segregating population. It is marker 1–150 did undergo recombination with the al-1+ important to note that the Mauriceville-1d strain (FGSC gene (Fig. 4). From a standard curve prepared the same as 2226), which is mat a, cannot be substituted in this method those shown in Fig. 2 (data not shown), we estimated that as a crossing partner with an Oak Ridge strain of opposite marker 1–150 contains 5% recombinants, and therefore is mating type. This is because the Mauriceville-1d strain is an located approximately 5 map units from the al-1+ gene. independent isolate (D.D. Perkins, personal communica- Genotyping of individual progeny conWrmed this estimate tion) that possesses mostly Oak Ridge-type polymorphisms (4 recombinants out of 80 total progeny). Furthermore, our (data not shown). Use of the Mauriceville-1c strain as the map distance data (Table 3) indicated that marker 1–150 is sole crossing partner is not a signiWcant limitation because located 5 map units from marker 1–185. Through interpo- the routine backcrosses required for analysis of any new 464 Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465 mutant would yield both mating types unless the mutation marker in the initial screen, which might occur for muta- is tightly linked to the mat locus. tions located near the telomeres. However, it is important, Genomic DNA bulks are assembled from wild-type and but perhaps counterintuitive, that closely spaced markers mutant progeny. The two bulk DNA samples, as well as a may not yield useful information unless very large numbers sample prepared from an equal mixture of the two bulks of individual progeny are analyzed. This simply relates to (non-linkage control) are analyzed with the 30 CAPS mark- the fact that the probability for a crossover occurring ers listed in Table 1. The analysis consists of PCR ampliW- within a small region is low. In contrast, with moderately cation, restriction digestion and gel electrophoresis. spaced markers, the level of recombination is meaningful Although we describe additional markers (Table 2), there and the interpolation of genetic distances provides high are two important considerations for our decision to limit map resolution. Ultimately, the method described here the number of markers included in an initial screen. First, allows one to map any new mutation using progeny from a the distribution of the 30 markers listed in Table 1 provides single cross, and the molecular analyses can be completed complete map coverage so the location of any new muta- in parallel using a 96-well plate. tion can quickly be deWned to a relatively small region within a linkage group. Second, by limiting the number of 3.6. Applications markers to 32 or less, the PCR ampliWcations required for our strategy (two bulks plus a 1:1 control analyzed with Although our motivation for this work was to facilitate each marker) can be accomplished in parallel using a single map-based cloning, this is not the sole potential application 96-well plate. Inclusion of the wild-type bulk provides for our genetic mapping method. One intriguing example is immediate conWrmation of map position determined in the the analysis of genome-wide recombination. Since the mutant bulk; the mutation should be linked to the Oak genetic backgrounds are deWned in our method, only the Ridge polymorphism and the wild-type allele should be nature of the mutation one investigates would be expected linked to the Mauriceville polymorphism at the same locus. to alter recombination. Thus, it will be possible to investi- When linkage is detected to one or more markers, the gate the eVect of speciWc mutations on recombination and/ genetic distance between a marker and the mutation can be or its control and to test whether the eVects are global or estimated from a standard curve prepared from parental localized to distinct chromosomal regions. Interesting can- DNA, similar to those in Fig. 2, or can be calculated from didates would include those genes previously identiWed two-point data in which recombination is scored from indi- through classical and related molecular approaches to vidual genotypes. Although the latter approach is more modulate recombination (Angel et al., 1970; Bowring et al., labor intensive, scoring individual progeny with two or 2006; Catcheside, 1981; Kato et al., 2004; Suzuki et al., three markers is likely to yield more consistent data. When 2005; Yeadon et al., 2004). Similarly, one could quantita- the mutation lies between two markers, one can interpolate tively assess chiasma interference at a genome-wide level the position of the mutation to within 1–5 map units. If the (Bowring and Catcheside, 1999a; Foss et al., 1993). linked markers are within 10 map units of the mutation one The same mapping methodology described here also can, in most cases, safely assume that the map distances are could be applied to other fungi both for the purpose of not skewed by double crossover events. Thus the position map-based cloning and for investigations of meiotic recom- of the mutation can be estimated to within a single map bination. Key requirements would be that the fungus has a unit. sexual cycle, a complete or nearly so genome sequence, and The level of resolution deemed suYcient to proceed with the availability of a polymorphism-rich out-crossing part- gene identiWcation via complementation tests will undoubt- ner strain. There are currently 65 fungal species listed at the edly depend on the nature of the mutant phenotype and NCBI that have completed or initiated genome-sequencing whether complementation can be detected via a selection or projects. However, identifying a suitable polymorphic out- requires a screen. For example, if a mutation that could be crossing strain may require screening of wild isolates. Once complemented by direct selection was mapped within 5 a suitable polymorphic out-crossing strain is identiWed, the map units and this genetic distance corresponded to de novo screen method to identify restriction site polymor- 1000 kb, one could immediately proceed with a relatively phisms could be applied. Alternatively, adaptation of the straightforward complementation strategy. That is, one method would be nearly trivial if genomic sequence also is could either test 25–50 cosmids from an ordered collection available from the polymorphic strain. individually, or assemble binary pools (e.g., left half, right half, odd, even, etc.) of the same cosmids to reduce the Acknowledgments number of candidate clones to just a few individuals. This approach also could be applied for a complementation We thank Tom McKnight, Deb Bell-Pedersen, and screen. However, if the screen is arduous it may be more Kathy Ryan for critical discussions and for comments on expedient to Wrst reWne the map resolution. To reWne the the manuscript. We also are grateful to Dan Ebbole for map location of a mutation one could of course repeat the assistance with bioinformatic analyses. This work was sup- analysis with additional, more closely spaced markers. This ported by start-up funds from Texas A&M University and would be warranted if linkage were detected for only one in part by the National Institutes of Health (GM58529). Y. Jin et al. / Fungal Genetics and Biology 44 (2007) 455–465 465
References Margolin, B.S., Freitag, M., Selker, E.U., 1997. Improved plasmids for gene targeting at the his-3 locus of Neurospora crassa by electroporation. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic Fungal Genet. Newsl. 44, 34–36. local alignment search tool. J. Mol. Biol. 215, 403–410. Martinez-Morales, J.R., Naruse, K., Mitani, H., Shima, A., Wittbrodt, J., Angel, T., Austin, B., Catcheside, D.G., 1970. Regulation of recombination 2004. Rapid chromosomal assignment of medaka mutants by bulked at the his-3 locus in Neurospora crassa. Aust. J. Biol. Sci. 23, 1229–1240. segregant analysis. Gene 329, 159–165. Bowring, F.J., Catcheside, D.E.A., 1999a. Evidence for negative interfer- McCluskey, K., 2003. The fungal genetics stock center: from molds to mol- ence: clustering of crossovers close to the am locus in Neurospora ecules. Adv. Appl. Microbiol. 52, 245–262. crassa among am recombinants. Genetics 152, 965–969. Metzenberg, R.L., Stevens, J.N., Selker, E.U., Morzycka-Wroblewska, E., W Bowring, F.J., Catcheside, D.E.A., 1999b. Recombinational landscape 1984. A method for nding the genetic map position of cloned DNA across a 650-kb contig on the right arm of linkage group V in Neuros- fragments. Fungal Genet. Newsl. 31, 35–40. W pora crassa. Curr. Genet. 36, 270–274. Michelmore, R.W., Paran, I., Kesseli, R.V., 1991. Identi cation of markers Bowring, F.J., Yeadon, P.J., Stainer, R.G., Catcheside, D.E.A., 2006. Chro- linked to disease-resistance genes by bulked segregant analysis: a rapid W mosome pairing and meiotic recombination in Neurospora crassa method to detect markers in speci c genomic regions by using segre- spo11 mutants. Curr. Genet. 50, 115–123. gating populations. Proc. Natl. Acad. Sci. USA 88, 9828–9832. Catcheside, D.E.A., 1981. Genes in Neurospora that suppress recombina- Nelson, M.A., Perkins, D.D., 2000. Restriction polymorphism maps of tion when they are heterozygous. Genetics 98, 55–76. Neurospora crassa: 2000 update. Fungal Genet. Newsl. 47, 25–39. Catcheside, D.G., 1975. Regulation of recombination in Neurospora Perkins, D.D., 1990. New multicent linkage testers for centromere-linked genes crassa. In: Peacock, W.J., Brock, R.D. (Eds.), The Eukaryotic Chromo- and rearrangements in Neurospora. Fungal Genet. Newsl. 37, 31–32. some. Australian National University Press, Canberra, pp. 301–312. Perkins, D.D., 1991. Neurospora alcoy linkage tester stocks with group VII Colot, H.V., Park, G., Turner, G.E., Ringelberg, C., Crew, C.M., Litvink- marked, and their use for mapping translocations. Fungal Genet. ova, L., Weiss, R.L., Borkovich, K.A., Dunlap, J.C., 2006. A high- Newsl. 38, 83. throughput gene knockout procedure for Neurospora reveals func- Perkins, D.D., 2000. Neurospora crassa genetic maps and mapped loci. tions for multiple transcription factors. Proc. Natl. Acad. Sci. USA 103, Fungal Genet. Newsl. 47, 40–58. 10352–10357. Perkins, D.D., 2006. How to use alcoy.