Normal Patterns of Histone H3K27 Methylation Require the Histone Variant H2A.Z in Neurospora Crassa

| INVESTIGATION

Normal Patterns of Histone H3K27 Methylation Require the Histone Variant H2A.Z in Neurospora crassa

Abigail J. Courtney,* Masayuki Kamei,* Aileen R. Ferraro,* Kexin Gai,† Qun He,† Shinji Honda,‡ and Zachary A. Lewis*,1 *Department of Microbiology, University of Georgia, Athens, Georgia 30602, †State Key Laboratory of Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193, China, and ‡Division of Chromosome Biology, Faculty of Medical Sciences, University of Fukui, 910-1193, Japan ORCID IDs: 0000-0001-5319-2630 (A.J.C.); 0000-0003-0918-4486 (A.R.F.); 0000-0002-1735-8266 (Z.A.L.)

ABSTRACT Neurospora crassa contains a minimal Polycomb repression system, which provides rich opportunities to explore Polycomb- mediated repression across eukaryotes and enables genetic studies that can be difﬁcult in plant and animal systems. Polycomb Repressive Complex 2 is a multi-subunit complex that deposits mono-, di-, and trimethyl groups on lysine 27 of histone H3, and trimethyl H3K27 is a molecular marker of transcriptionally repressed facultative heterochromatin. In mouse embryonic stem cells and multiple plant species, H2A.Z has been found to be colocalized with H3K27 methylation. H2A.Z is required for normal H3K27 methylation in these experimental systems, though the regulatory mechanisms are not well understood. We report here that Neurospora crassa mutants lacking H2A.Z or SWR-1, the ATP-dependent histone variant exchanger, exhibit a striking reduction in levels of H3K27 methylation. RNA-sequencing revealed downregulation of eed, encoding a subunit of PRC2, in an hH2Az mutant compared to wild type, and overexpression of EED in a DhH2Az;Deed background restored most H3K27 methylation. Reduced eed expression leads to region-speciﬁc losses of H3K27 methylation, suggesting that differential dependence on EED concentration is critical for normal H3K27 methylation at certain regions in the genome.

KEYWORDS H2A.Z; EED; PRC2; H3K27 methylation

N eukaryotes, DNA-dependent processes in the nucleus are H3K27isamolecularmarkerof transcriptionally re- Iregulated by chromatin-based mechanisms (Luger 2003). pressed facultative heterochromatin (Cao et al. 2002; One heavily studied group of proteins that are particularly Czermin et al. 2002; Kuzmichev et al. 2002; Müller et al. important for maintaining stable gene repression are the 2002). PcG proteins are absent from the model yeasts, polycomb group (PcG) proteins. In plants and animal cells, PcG Saccharomyces cerevisiae and Schizosaccharomyces pombe, proteins assemble into polycomb repressive complexes 1 and but core PRC2 components have been identiﬁed and char- 2 (PRC1 and PRC2), which play key roles in repression of acterized in several fungi, including Neurospora crassa, developmental genes (as reviewed in Müller (1995), Hennig Fusarium graminearum, Cryptococcus neoformans, Epichloë and Derkacheva (2009), Simon and Kingston (2009), festucae,andFusarium fujikuroi (Veerappan et al. 2008; Schuettengruber et al. (2017), Kuroda et al. (2020)). PRC2 Aramayo and Selker 2013; Connolly et al. 2013; Jamieson is a multi-subunit complex that deposits mono-, di-, and tri- et al. 2013; Chujo and Scott 2014; Schotanus et al. 2015; methyl groups on lysine 27 of histone H3, and trimethyl Studt et al. 2016). In these fungi, PRC2 is required for re-

Copyright © 2020 by the Genetics Society of America pression of key fungal genes, suggesting that this enzyme doi: https://doi.org/10.1534/genetics.120.303442 complex is functionally conserved between fungi, plants, Manuscript received April 9, 2020; accepted for publication July 5, 2020; published Early Online July 10, 2020. and animals (Connolly et al. 2013; Jamieson et al. 2013; Supplemental material available at ﬁgshare: https://doi.org/10.25386/genetics. Dumesic et al. 2015). 12486482. 1Correspondingauthor:UniversityofGeorgia,DavisonLifeSciences,120EGreenSt., In N. crassa, the catalytic subunit of PRC2 is SET-7, a pro- B402, Athens, GA 30602. E-mail: [email protected] tein with homology to EZH1/EZH2 in humans and curly leaf

Genetics, Vol. 216, 51–66 September 2020 51 (CLF), medea (MEA), or swinger (SWN) in Arabidopsis (Wang et al. 2018). Colocalization of SUZ12, a subunit of (Jones and Gelbart 1993; Abel et al. 1996; Chen et al. PRC2, and H2A.Z has been found in mESCs at developmen- 1996; Goodrich et al. 1997; Grossniklaus et al. 1998; tally important genes, such as HOX clusters (Creyghton Czermin et al. 2002; Kuzmichev et al. 2002; Chanvivattana et al. 2008). In addition, H2A.Z is differentially modified et al. 2004; Schwartz and Pirrotta 2007). Neurospora EED is at its N- and C- terminal tails at bivalent domains that are essential for catalysis and is a homolog of mammalian en- “poised” for activation or repression upon differentiation hanced ectoderm development (EED), Drosophila extra sex (Ku et al. 2012; Surface et al. 2016). N-terminal acetylation combs (Esc) and Arabidopsis fertilization independent endo- (acH2A.Z) or C-terminal ubiquitylation (H2A.Zub) repress sperm (FIE) (Schumacher et al. 1998; Ng et al. 2000; or stimulate the action of PRC2 through interactions with Chanvivattana et al. 2004). SUZ-12 is the third essential com- the transcriptional activator BRD2 or the PcG protein component of PRC2 in Neurospora and is named SUZ12 in hu- plex PRC1 (Surface et al. 2016). It is important to note that mans, su(z)12 in Drosophila and embryonic flower 2 (EMF2), functional studies of H2A.Z are challenging because this vernalization 2 (VER2), or fertilization-independent seed 2 histone variant is essential for viability in most organisms, (FIS2) in Arabidopsis (Birve et al. 2001; Chanvivattana et al. including Drosophila, Tetrahymena,mouse,andXenopus 2004). N. crassa CAC-3/NPF is an accessory subunit homol- (van Daal and Elgin 1992; Iouzalen et al. 1996; Liu et al. ogous to mammalian retinoblastoma binding protein 46/48 1996; Clarkson et al. 1999; Faast et al. 2001; Ridgway et al. (RBAP46/68) in humans, and multicopy suppressor of 2004). IRA1-5 (MSI1-5) in Arabidopsis (Huang et al. 1991; Qian In Arabidopsis thaliana, a genetic interaction between et al. 1993; Derkacheva et al. 2013). In contrast to PRC2, PICKLE (PKL), a chromatin remodeler that promotes PRC1 components appear to be absent from the fungal king- H3K27me3, and PIE-1 (homolog to SWR-1), the remodeler dom (Jamieson et al. 2013; Lewis 2017). which deposits H2A.Z, was recently reported (Carter et al. The presence of a minimal polycomb repressive system in 2018). PKL has been found by ChIP-seq at loci enriched for well studied fungi such as N. crassa provides an opportunity H3K27me3, and is proposed to determine levels of H3K27me3 to explore the diversity of polycomb-mediated repression at repressed genes in Arabidopsis (Zhang et al. 2012). In rice across eukaryotes and enables genetic studies that can be callus and seedlings, H2A.Z is found at the 59 and 39 ends of difficult in plant and animal systems. Indeed, genetic studies genes that are highly expressed. In repressed genes, H2A.Z is have provided insights into PRC2 control in Neurospora.De- found along the gene body, and this pattern closely mimics letion of cac-3/npf causes region-specific losses of H3K27me3 the presence of H3K27me3 (Zhang et al. 2017). This is a at telomere-proximal domains, and telomere repeat sequences notable difference between plants and other eukaryotes. are sufficient to nucleate a new domain of H3K27me3-enriched We investigated the relationship between H2A.Z and PRC2 chromatin (Jamieson et al. 2013, 2018). In constitutive het- in the filamentous ascomycete Neurospora crassa, and report erochromatin domains, heterochromatin protein-1 (HP1) that H2A.Z is required for normal enrichment of H3K27me2/ prevents accumulation of H3K27me3 (Basenko et al. 2015; 3 across the genome. Our findings show that loss of H2A.Z Jamieson et al. 2016). Thus, regulation of H3K27 methyl- leads to region-specific losses of H3K27me2/3 in N. crassa. ation occurs at multiple levels. Despite recent advances, the Expression levels of eed, encoding a PRC2 subunit, are re- mechanisms that regulate PRC2 in fungal systems and eu- duced in the absence of H2A.Z and ectopic expression of karyotes in general is poorly understood. eed can restore H3K27me2/3 in an H2A.Z-deficient strain. In addition to the core histones (H2A, H2B, H3, and H4), Together, these data suggest that H2A.Z regulates facultative eukaryotes also encode nonallelic histone variants. One of the heterochromatin through transcriptional regulation of the most conserved and extensively studied histone variants is PRC2 component EED and points to differential requirements H2A.Z, which is enriched proximal to transcription start sites for EED at discrete PRC2-target domains. (TSS) and in vertebrate enhancers (Guillemette et al. 2005; Barski et al. 2007; Creyghton et al. 2008; Bargaje et al. 2012; Weber et al. 2014; Latorre et al. 2015; Dai et al. 2017; Gómez- Materials and Methods Zambrano et al. 2019). Functional studies of H2A.Z have Strains and growth media linked presence of this variant in nucleosomes to gene activation, gene repression, maintaining chromatin accessibility, Strains used in this study are listed in Supplemental Material, and a multitude of other functions (Adam et al. 2001; Table S1. Strains were grown at 32° in Vogel’s minimal me- Meneghini et al. 2003; Rangasamy et al. 2004; Bruce et al. dium (VMM) with 1.5% sucrose or glucose for DNA-based 2005; Guillemette et al. 2005; Dhillon et al. 2006; Xu et al. protocols and RNA-based protocols, respectively (Davis and 2012; Hu et al. 2013; Neves et al. 2017). Notably, H2A.Z has de Serres 1970). Liquid cultures were shaken at 180 rpm. been implicated in the direct regulation of H3K27 methyl- Crosses were performed on synthetic crossing (SC) medium ation in mouse embryonic stem cells (mESCs) and in plants in the dark at room temperature (Davis and de Serres 1970). (Surface et al. 2016; Zhang et al. 2017; Carter et al. 2018). In Ascospores were collected 14 days after fertilization. To iso- mESCs, there is a strong correlation between the activity of late cross progeny, spores were spread on solid VMM plates PRC2, enrichment of H3K27me3, and the presence of H2A.Z containing FGS (1X Vogel’s salts, 2% sorbose, 0.1% glucose,

52 A. J. Courtney et al. 0.1% fructose, and 1.5% agar) and incubated at 65° for 1 hr electroporated into the mutant strain. Specifically, the bar as previously described (Davis and de Serres 1970), after (confers Basta resistance) was amplified with primers LL which spores were picked using a sterile inoculating needle #148 CCGTCGACAGAAGATGATATTGAAGGAGC and LL #149 and transferred to agar slants with appropriate medium (typ- AATTAACCCTCACTAAAGGGAACAAAAGC (Avalos et al. 1989), ically VMM). To test for sensitivity to DNA damaging agents, and the wild-type hH2Az gene fragment including its native 5 ml of a conidial suspension was spotted on VMM contain- promoter (genomic coordinate 1390154–1393398 of GCA_ ing FGS plates containing concentrations of methyl methane- 000182925.2 assembly accession) was amplified with sulfonate (cat. # 129925-5g; Sigma–Aldrich) between 0.010% primers AC #27 CCCAATCCTAGAATCCCGTCG and AC #21 and 0.030% (w/v). TAAAAGAGCTGCTGTCGCACG, and fragments were co-integrated To construct the N-terminal FLAG-tagged eed allele, we into the DhH2Az::hph strain, followed by selection of trans- amplified the eed region with primers, MK #51: GGCGGA formants on Basta-containing plates (VMM with 2% sorbose, GGCGGCGCGATGCAAATTTGTCGGGACCG and MK #52: 0.1% glucose, 0.1% fructose, 1.5% agar, and 200 mg/mL TTAATTAATGGCGCGTTACTTCCCCCACCGCTGAA (Table S5), Basta). Transformants were transferred to agar slants and from wild-type genomic DNA (FGSC 4200). The amplified then screened by PCR, and Southern blots with the North2- fragment was cloned into the AscI site of pBM61::CCGp-N- South Biotin Random Prime Labeling and Detection Kit (cat. 3xFLAG (Honda and Selker 2009) by InFusion cloning (cat. #17175; ThermoFisher) and the wild-type hH2Az gene # 639648; Takara). The new plasmid was then digested fragment generated from primers AC#27: CCCAATCC with DraI and transformed into a his-3;mus-52::bar strain. TAGAATCCCGTCG and AC#21: TAAAAGAGCTGCTGTCG Primary transformants were selected on VMM plates, and CACG was used as a probe. Genomic DNA was extracted then back-crossed to wild type to isolate homokaryons (his- from wild type, DhH2Az, and the two complemented strains 3::Pccg-1-3xflag-eed). We next crossed the homokaryon (ACt9-3, ACt12-1). A 500 ng aliquot of DNA from all strains (his-3::Pccg-1-3xflag-eed) to Deed::hph (FGSC 14852) to ob- was subjected to double restriction digests with EcoRI-HF tain Deed;his-3::Pccg-1-3xflag-eed. 3xFLAG-EED expression (cat # R3101S; NEB) and EcoRV-HF (cat # R3195S; NEB) in and deletion of eed deletion were confirmed by western CutSmart Buffer. Digests were incubated at 37° overnight blots probed with anti-FLAG antibody (cat. # F1804; Sigma and then subjected to heat inactivation for 20 min at 65°. Aldrich) and genotyped by PCR with primers, LL #155: TCG Digests were run on a 0.7% agarose gel and transferred CCTCGCTCCAGTCAATGACC and LL #466: TGTGGGCGA overnight to a nylon membrane which was then UV cross- TTTGAGCGTGC, respectively. The Deed;his-3::Pccg-1-3xflag- linked. Hybridization and detection followed the manufac- eed strain was then crossed to the DhH2Az::hph (FGSC turer’s instructions. 12088) strain to obtain DhH2Az;Deed;his-3::Pccg-1-3xflag- Race tube assay eed. 3xFLAG-EED expression and deletion of eed were confirmed by western blots with anti-FLAG antibody (cat. # Race tubes were prepared with 15 ml of VMM plus 1.5% F1804; Sigma Aldrich) and genotyping with eed deletion pri- sucrose and 1.5% agar. Strains were grown on VMM plates mers (see above). Deletion of hH2Az was confirmed by PCR with 1.5% sucrose and 1.5% agar for 16 hr before using a with primers AC #24: GAACAAGCCGATTGCTGTCC and AC 6 mm cork borer to extract mycelial agar plugs from the edge #23: TGTATAGAACGCTGCCAAGGA. of growing hyphae. This plug was used for inoculating each For the H2AZ-GFP gene replacement construct, a 1-kb tube at one end. Strains were inoculated in triplicate. Mea- segment including the end of the hH2Az coding region was surements were taken at 9, 23, 47, and 60 hr to determine amplified by PCR with primers #1577: CGGAAAGGGCAA linear growth rates. GTCGTCTG and #1578: CCTCCGCCTCCGCCTCCGCCGCCT Protein extraction and western blotting CCGCCAGCCTCCTGAGCCTTGGCCT and a 500-bp segment of the 39 flanking region was amplified with primers #1579: Strains were grown at 32° shaken in 18 3 150 mm glass test TGCTATACGAAGTTATGGATCCGAGCTCGCTGCACCGAAAAA tubes at 180 rpm in 5 ml VMM with 1.5% sucrose. After CTCGACG and #1580: GTGACGAGGGGAGATTGCTC. The 16 hr, tissue was harvested using filtration, washed once in cassettes containing the GFP segment and the hph gene were phosphate buffered saline (PBS), and suspended in 1 ml of amplified using M13 forward and reverse primers from ice-cold protein extraction buffer [50 mM HEPES pH 7.5, pGFP::hph::loxP (Honda and Selker 2009). The three frag- 150 mM NaCl, 0.02% NP-40, 1 mM EDTA, 1 mM phenyl- ments were mixed and then assembled by overlapping PCR methylsulfonyl fluoride (PMSF; P7626; Sigma), one tablet with primers #1577 and #1580 above. The cassette was Roche cOmplete mini EDTA-free Protease Inhibitor Cocktail transformed into the Dmus-52 strain (FGSC 15968) by (cat. # 11836170001; Roche)]. Tissue was subjected to son- electroporation. ication by Diagenode Bioruptor UCD-200 to deliver 22.5 30 sec pulses at 4°. After two rounds of centrifugation at Transformation and complementation assays 13,200 rpm for 10 min, supernatant was mixed with 23 Transformations were performed as previously described Laemmli buffer and boiled for 5 min. Samples for FLAG (Margolin et al. 1997). To carry out ectopic complementation and H2A.Z western blots were separated by SDS-polyacryl- of the DhH2Az::hph strain, two linear gene fragments were amide gel electrophoresis (SDS-PAGE) and transferred to

H2A.Z Regulates H3K27me2/3 via EED 53 polyvinylidene diﬂuoride (PVDF) membranes in Tris-glycine 50 mM LiCl, and ﬁnally with TE (10 mM Tris-HCl, 1 mM transfer buffer (25 mM Tris, 200 mM glycine) or CAPS EDTA). Bound chromatin was eluted in TES (50 mM Tris transfer buffer (10 mM, pH 11) containing 20% methanol pH 8.0, 10 mM EDTA, 10% SDS) at 65° for 10 min. Chro- at constant 100 V for 1 hr at 4°, respectively. Membranes matin was de-crosslinked overnight at 65°. The DNA was were blocked with Tris-buffered saline (TBS; 10 mM Tris, treated with RNase A for 2 hr at 50°, then with proteinase K pH 7.5, 150 mM NaCl) including 3% milk powder or phos- for 2 hr at 50°, and extracted using phenol-chloroform-iso- phate-buffered saline including Tween 20 (PBS-T; 137 mM amyl alcohol (25:24:1) followed by chloroform extraction.

NaCl, 2.7 mM KCl, 10 mM Na2HPO4,KH2PO4, 0.01% After final chloroform extraction, DNA was precipitated using Tween-20) including 30% milk powder for 1 hr, and incu- ethanol precipitation with 2 vol of ethanol, 1/10 vol 3 M bated overnight with anti-FLAG antibody (cat. # F1804; NaOAc, pH 5.2, and 0.025 mg/mL glycogen overnight Sigma Aldrich) in TBS plus 3% milk or H2A.Z antibody in at 220°. DNA pellets were washed with 70% ethanol and PBS-T plus 3% milk. Detection was performed with horserad- resuspended in TE buffer. Samples were then prepared for ish peroxidase-conjugated secondary antibodies and Super- Illumina sequencing. Signal West Femto chemiluminescent substrate (cat. # RNA extraction 34094; ThermoFisher). Conidia were inoculated into 100 3 15 mm plates contain- Chromatin immunoprecipitation ing 25 ml of VMM + 1.5% glucose and grown for 36–48 hr To carry out chromatin immunoprecipitation (ChIP), conidia to generate mycelial mats. Using a 9 mm cork borer, five to were inoculated in 5 ml of liquid VMM plus 1.5% sucrose and seven disks were cut out of the mycelial mat and transferred grown for 18 hr for wild type and other strains with typical to 125 ml flasks with 50 ml of VMM + 1.5% glucose and growth rates. Slow growing DhH2Az::hph strains were grown allowed to grow for 12 hr at 29° in constant light while for 24 hr to isolate cultures at a similar developmental stage. agitating at 90–100 rpm. Disks were harvested using fil- ChIP was performed as described previously (Sasaki et al. tration and flash-frozen with liquid nitrogen. Frozen tissue 2014; Seymour et al. 2016; Ferraro and Lewis 2018). In brief, was transferred to 1.5 ml RNase-free tubes with 100 ml mycelia were harvested using filtration and were washed sterile RNase-free glass beads andvortexedtolysetissue once in PBS prior to cross-linking for 10 min in PBS contain- in phenol:chloroform (5:1) pH 4.5. Three sequential acid ing 1% formaldehyde on a rotating platform at room temper- phenol:chloroform extractions were performed followed by ature. After 10 min, the reaction was quenched using ethanol precipitation using two volumes of ethanol and 1/10 125 mM glycine and placed back on the rotating platform vol of 3 M NaOAc pH 5.2, incubated overnight at 220°. for 5 min. Mycelia were harvested again using filtration, Samples were centrifuged at 13,200 rpm in 4° for 30 min washed once with PBS, then resuspended in 600 ml of ChIP and pellets were then washed in RNase-free 70% ethanol, lysis buffer [50 mM HEPES, pH 7.5, 140 mM NaCl, 1 mM andresuspendedinRNase-freewater.Sampleswere EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, one tab- quantified using the Invitrogen Qubit 2.0 fluorometer let Roche cOmplete mini EDTA-free Protease Inhibitor Cock- (cat. # Q32866) and RNA quality was checked on a denatur- tail (cat. # 11836170001; Roche)] in 15 ml conical tubes. ing agarose gel. After quality was verified 10 mg of RNA for Chromatin was sheared by sonication after lysing cell walls each sample was subjected to Turbo DNase treatment (cat. # with the QSONICA Misonix S-4000 ultrasonic processor (am- AM2238; Invitrogen) at 37° for 30 min and then another acid plitude 10, 30 sec processing, 1 sec on, 1 sec off), using the phenol:chloroform extraction was performed to inactivate en- Diagenode Bioruptor UCD-200 (Intensity level: Medium, zyme and purify the RNA. Samplesweresubjectedtoanother three rounds of 15 min (30 sec on, 30 sec off) to deliver ethanol precipitation as described above, this time with the 22.5 30 sec pulses at 4°. Water temperature was kept at a addition of 1 ml of RNase-free glycogen (5 mg/ml). Samples constant 4° by using a Bio-Rad cooling module (cat. # 170- were centrifuged at 13,200 rpm in 4° for 30 min and the pellets 3654) with variable speed pump to circulate 4° water while were washed with RNase-free 70% ethanol, then resuspended processing samples. Lysates were centrifuged at 13,000 rpm in RNase-free water. Quality and quantity were again checked in an Eppendorf 5415D microcentrifuge for 5 min at 4°. For with denaturing gel and with the Invitrogen Qubit 2.0 fluorom- ChIP reactions with antibodies against N. crassa H2A.Z, 1, eter. Samples were then prepared for Illumina sequencing. 2.5, or 5 ml of antibody was used [antibody supplied by Qun ChIP library preparation He, China Agricultural University (Liu et al. 2017; Dong et al. 2018)]. For detection of H3K27 di- and trimethylation Libraries were constructed as described (Sasaki et al. 2014; (H3K27me2me3; Active Motif 39535), and GFP-tagged Seymour et al. 2016; Ferraro and Lewis 2018). In brief, the H2A.Z (GFP; Rockland 600-301-215), 1 ml of the relevant NEBNext Ultra II End Repair/dA-tailing Module (cat. # antibody was used. Protein A/G beads (20 ml) (cat. # E7546S), NEBNext Ultra II Ligation Module (cat. # E7546) sc-2003; Santa Cruz) were added to each sample. Following were used to clean and A-tail DNA after which Illumina overnight incubation, beads were washed twice with 1 ml adapters were ligated. The ligation products were amplified lysis buffer without protease inhibitors, once with lysis buffer to generate dual-indexed libraries using NEBNext Ultra II Q5 containing 500 mM NaCl, once with lysis buffer containing Hot Start HiFi PCR Master Mix (cat. # M0543S). Size selection

54 A. J. Courtney et al. with magnetic beads was performed after the adapter liga- fastqc command (version 0.11.3). Trimmed Illumina single- tion and PCR steps with Sera-Mag SpeedBeads (cat. # end reads were mapped to the current N. crassa NC12 ge- 65152105050250) suspended in a solution of 20 mM PEG nome assembly using the Hierarchical Indexing for Spliced 8000, 1 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA (Rohland Alignment of Transcripts 2 (HISAT2: version 2.1.0) (Kim and Reich 2012). et al. 2019) with parameters –RNA-strandness R then sorted and indexed using SAMtools (version 1.9) (Li et al. 2009). RNA library preparation FeatureCounts from Subread (version 1.6.2) (Liao et al. Libraries were prepared according to the Illumina TruSeq 2013) was used to generate gene level counts for all RNA mRNA stranded Library Kit (cat. # RS-122-2101). In brief, bam files. Raw counts were imported into R and differential mRNA selection via polyA tails was performed using RNA gene expression analysis was conducted using Bioconductor: purification beads and washed with bead washing buffer. DeSeq2 (Love et al. 2014). Volcano plot and box plots were Fragmentation and cleanup were performed enzymatically generated in R using DeSeq2 and ggplot2 (Wickham 2009). using the Fragment, Prime, Finish Mix and incubated at 94° for 8 min. First-strand synthesis using the SuperScript II RT Data deposition enzyme and First Strand Synthesis Act D Mix was incubated The authors state that all data necessary for confirming the as described, and second-strand synthesis used the Second conclusions presented in the article are represented fully Strand Marking Mix with resuspension buffer was incubated within the article. Raw sequence data associated with this for 1 hr to generate cDNA. The final steps in the library paper are available through the NCBI GEO database (acces- preparation are the same as the above ChIP-seq library prep- sion # GSE146611). Supplemental data have been uploaded aration with exception of two extra bead cleanup steps: one to figshare. Supplemental material available at figshare: prior to A-tailing and adapter ligation, two after adapter https://doi.org/10.25386/genetics.12486482. ligation. Libraries were pooled and sequenced on a NextSeq500 instrument at the Georgia Genomics and Bioinformatics Core Results to generate single or paired-end reads. Normal patterns of H3K27me2/3 enrichment require the Data analysis presence of H2A.Z or SWR-1 For ChIP-seq data, short reads (,20 bp) and adaptor se- Normal H3K27me2/3 patterns in plants and in mESCs depend quences were removed using TrimGalore (version 0.4.4), on the histone variant H2A.Z (Creyghton et al. 2008; Carter cutadapt version 1.14 (Martin 2011), and Python 2.7.8, with et al. 2018), but the underlying mechanism is ill-understood. fastqc command (version 0.11.3). Trimmed Illumina reads To determine if H2A.Z also plays a role in polycomb group were aligned to the current N. crassa NC12 genome assembly repression in N. crassa, we performed ChIP-seq to exam- available from NCBI (accession # GCA_000182925.2) using ine H3K27me2/3 enrichment in an H2A.Z deletion strain the BWA (version 0.7.15) (Li and Durbin 2009), mem algo- (DhH2Az::hph, hereafter DhH2Az) and compared this to wild rithm, which randomly assign multi-mapped reads to a single type and Dset-7. Inspection of the data in the Integrative location. Files were sorted and indexed using SAMtools (ver- Genomics Viewer (IGV) genome browser (Thorvaldsdottir sion 1.9) (Li et al. 2009). To plot the relative distribution of et al. 2013) revealed that the DhH2Az mutant displayed a mapped reads, read counts were determined for each 50 bp significant reduction in H3K27me2/3 (Figure 1A). This re- window across the genome using DeepTools to generate duction was apparent on all chromosomes (Figure S1) but bigwigs (version 3.3.1) (Ramirez et al. 2016) with the pa- H3K27me2/3 was not completely abolished, as observed in rameters –normalizeUsing CPM (counts per million), and the Dset-7 strain, which lacks the catalytic subunit of PRC2 data were displayed using the Integrated Genome Viewer (Figure 1A). To quantify the change in H3K27me2/3 pat- (Thorvaldsdottir et al. 2013). The Hypergeometric Optimiza- terns, we called peaks of H3K27me2/3 enrichment using tion of Motif EnRichment (HOMER) software package (ver- HOMER (version 4.8; Heinz et al. 2010). We identified sion 4.8) (Heinz et al. 2010) was used to identify H3K27me3 325 peaks of H3K27me2/3 in wild type, hereafter referred peaks in wild type and DhH2Az against input using “find- to as PRC2-target domains (Table S2). Consistent with pre- Peaks.pl” with the following parameters: -style histone. Bed- vious studies, these peaks comprised 6% of the N. crassa tools (version 2.27.1) “intersect” (version 2.26.0) was used genome (Jamieson et al. 2013; Basenko et al. 2015). These to determine the number of peaks that intersect with other regions are typically larger than single genes, ranging in size peak or gff files, for determining PRC2-target genes the pa- from 500 bp to 108 kb, with an average size of 7.7 kb. We rameter of -f 0.70 was used. Heatmaps, Spearman correlation next plotted H3K27me2/3 levels across the 59 end of all matrix (Figure S7) and line plots were constructed with 325 domains for wild type and DhH2Az (Figure 1B). Inspec- DeepTools (version 3.3.1) (Ramirez et al. 2016). tion of heatmaps and the genome browser revealed that For RNA-seq data, short reads (,20 bp) and adaptor se- H3K27me2/3 levels were reduced in many, but not all, quences were removed using TrimGalore (version 0.4.4), PRC2-target domains in DhH2Az. Using HOMER software cutadapt version 1.14 (Martin 2011), and Python 2.7.8, with to identify PRC2-target domains in DhH2Az revealed

H2A.Z Regulates H3K27me2/3 via EED 55 239 peaks (Table S3). These were slightly smaller, with an (i.e., nonsubtelomeric regions .200 kb from the telomere average size of 5.5 kb, and comprised only 3% of the repeats) chromosome sites, but not at telomere-proximal N. crassa genome. To determine if the peaks observed in sites (i.e., ,200 kb from the telomere repeats) (Figure the DhH2Az strain are in wild-type locations, we compared 2A). To quantify this, we inspected ChIP-seq results for peaks only from assembled contigs. Using bedtools intersect, H3K27me2/3 for both classes and found retention of we found that all peaks in DhH2Az overlap with wild-type H3K27 methylation in telomere-proximal regions with pro- peaks, indicating that DhH2Az exhibits significant loss of gressive loss in domains farther from chromosome ends. Pre- H3K27me2/3 from normal domains, but does not gain viously published work showed that a cac-3/npf deficient H3K27me2/3 in new locations (Table S4). strain has H3K27me2/3 loss, which was observed primarily Since H2A.Z is required for maintaining genome stability in in the telomere-proximal regions (Jamieson et al. 2013); cac- yeast and animals, our findings raised the possibility that a 3/npf encodes an accessory subunit of PRC2 in N. crassa second site mutation could be responsible for the observed homologous to the conserved PRC2 components Msl1-5, phenotype (Krogan et al. 2004; Rangasamy et al. 2004; NURF55, Rpbp46/48, found in plants, Drosophila, and hu- Dhillon et al. 2006; Greaves et al. 2007). To confirm that loss mans, respectively. of H3K27me2/3 was due to the absence of H2A.Z, we first To better visualize which regions of the genome in the backcrossed the original deletion strain (FGSC 12088) to Dcac-3/npf or DhH2Az strains lose enrichment of H3K27me2/ wild type (Colot et al. 2006). Four independent DhH2Az 3, we again divided all 325 H3K27me2/3 peaks in the wild- progeny all displayed similar reduction in H3K27me2/3 lev- type strain into telomere-proximal sites (123 peaks, average els (Figure S2). In addition, the backcrossed DhH2Az strain size 8261 bp) (Figure 2B, top) and internal sites (186 peaks, displayed slow and variable growth (Figure S3) and was hy- average size 7509 bp) (Figure 2B, bottom). The loss was persensitive to the DNA-damaging agent methyl methanesul- again most dramatic at the internal regions in the hH2Az fonate (MMS). This is consistent with previous studies that deletion strain, where most PRC2-target domains showed have demonstrated poor growth of DhH2Az in S. cerevisiae significant reduction of H3K27me2/3 levels. Specifically, and in N. crassa (Jackson and Gorovsky 2000; Liu et al. 2017). we found that telomere-proximal regions show normal levels We next introduced a wild-type copy of the hH2Az gene of H3K27me2/3. with its native promoter into DhH2Az (Figure S4, A and B). Previous work demonstrated that the placement of repet- This complemented defects in growth and MMS-sensitivity, itive telomere repeat sequences (59-TTAGGG-39) in a euchro- and fully restored H3K27 methylation, suggesting that loss of matic locus can induce de novo H3K27 methylation across H2A.Z was responsible for all observed phenotypes in the large regions (Jamieson et al. 2018). Together, these data deletion mutant (Figure 1, C and D and Figure S3). Using demonstrate that the absence of H2A.Z is more detrimental HOMER software to identify PRC2-target domains in the for the establishment and/or maintenance of internal do- complemented strains (n = 2) revealed an average of mains of H3K27me2/3 in N. crassa. 449 peaks with an average size of 6.6 kb, comprising 7% Neurospora H2A.Z localizes to promoter regions but not of the N. crassa genome. To determine if the peaks observed to PRC2-target domains in the complemented strains are in wild-type locations, we compared peaks only from assembled contigs. Using bedtools We next asked if H2A.Z colocalizes with H3K27 methylation, intersect, we found that most peaks in overlap with wild-type as has been reported for plants and mESCs (Creyghton et al. peaks. The six peaks that were reported as not intersecting 2008; Zhang et al. 2017; Carter et al. 2018). We used a strain were viewable in the genome browser in the same location as expressing a C-terminal H2A.Z-GFP fusion protein to perform wild type, but of a slightly different amplitude, which affects ChIP-seq with antibodies against H3K27me2/3 and GFP. We peak calling and is likely due to ChIP efficiency from multiple confirmed the H2A.Z-GFP was functional by testing the different experiments. Because a specific chromatin remod- growth rate with race tubes, as disruption of H2A.Z function eling complex, SWR1, exchanges H2A.Z for H2A in plants, leads to significantly impaired growth in Neurospora (Figure yeast, and animals (Kobor et al. 2004; Mizuguchi et al. 2004; S3 and Figure S5).Visual inspection of the enrichment pro- Deal et al. 2007; Wong et al. 2007; Luk et al. 2010), we next files in a genome browser revealed a mostly mutually exclu- examined H3K27me2/3 in a deletion strain lacking the sive localization pattern (Figure 3A). There are some small N. crassa homolog of the SWR1 ATPase (Dswr-1 also known H2A.Z peaks in PRC2-target domains, such as in Figure 3A; as Dcrf1-1; Borkovich et al. 2004). The swr-1 mutant dis- however, these were rare (Figure 3B). The genomic locations played a similar reduction in H3K27me2/3 (Figure 1, C and with the highest enrichment for H2A.Z-GFP are the regions D). Together, these data demonstrate that H2A.Z is required immediately before and after the TSS of most genes, with low for normal H3K27me2/3 in N. crassa. enrichment in gene bodies and 39 ends (Figure 3C). On average, we find little enrichment of H2A.Z-GFP in the pro- Deletion of hH2Az results in region-specific loss moters and gene bodies of H3K27me2/3 enriched genes of H3K27me2/3 or at the center of H3K27me2/3 peaks, confirming that Visual inspection of the ChIP-seq data revealed losses of H3K27me2/3 and H2A.Z are largely mutually exclusive (Fig- H3K27me2/3 from PRC2-target domains located at internal ure 3, D and E).

56 A. J. Courtney et al. Figure 1 H2A.Z is required for normal patterns of H3K27 methylation. (A) Genome browser images illustrate H3K27me2/3 enrichment on N. crassa linkage group (“chromosome”) III for wild type, DhH2Az, and Dset-7. A segment of chromosome III is displayed at higher resolution to illustrate depletion of internal H3K27me2/3 domains. (B) H3K27me2/3 in the DhH2Az strain exhibits striking depletion of most H3K27me2/3 domains, with overall lower enrichment of this modiﬁcation. Heatmaps display 325 PRC2-target domains (rows) ordered by wild type enrichment for wild type, DhH2Az, and Dset-7 strains centered on the 59 end of each domain + or –1000 bp for a total window size of 2000 bp. (C) Genome browser images illustrate H3K27me2/3 enrichment on chromosome III for two ectopic complemented strains of DhH2Az+hH2Azwt and the Dswr-1 strain. The segment of chromosome III is displayed at higher resolution to illustrate rescue by complementation and depletion of H3K27me2/3 in Dswr-1 background. (D) Heatmaps of H3K27me2/3 rescue in complemented strains [DhH2Az+hH2Azwt (ACt9-3 and ACt12-1)] and depletion in the Dswr-1 strain. The heatmaps are ordered as in (B) and depict the domain boundary + or –1000 bp for a total window size of 2000 bp.

To validate H2A.Z enrichment, we also performed ChIP- and identiﬁed a 15 kDa band in the chromatin fraction only seq on wild type using an antibody raised against the native in wild type, conﬁrming our ability to use this antibody to N. crassa H2A.Z protein (Liu et al. 2017). We performed a recognize H2A.Z (Figure S6C). These H2A.Z ChIP-seq exper- western blot using the H2A.Z antibody on both the chromatin iments show the same localization as the H2A.Z-GFP ChIP- and soluble fractions of wild type, H2A.Z-GFP, and DhH2Az seq experiments (Figure S6, A and B). Using HOMER, we

H2A.Z Regulates H3K27me2/3 via EED 57 Figure 2 Deletion of hH2Az results in region-speciﬁc loss of H3K27me2/3. (A) Genome browser images illustrate H3K27me2/3 enrichment on linkage group (“chromosome”) III for wild type, DhH2Az, Dcac-3/npf, and Dset-7. The two segments of chromosome III are displayed at higher resolution to visualize region-speciﬁc loss. Left panel displays the end of the chromosome to 300 kb (left panel) and from 400 to 600 kb (right panel). The telomere-proximal H3K27me2/3 regions are only moderately affected by the deletion of hH2Az, whereas internal domains show a more dramatic loss of H3K27me2/3. (B) Heatmaps of H3K27me2/3 enrichment for wild type, DhH2Az, Dcac-3/npf, and Dset-7 across PRC2-target domains organized by their proximity to the telomere. The top section is restricted to domains that are ,200 kb away from the chromosome ends (“telomere-proximal domains”), plotted from largest to smallest (123 domains). The bottom of the heatmaps contain the domains that are .200 kb away from chromosome ends (“internal domains”), also plotted from largest to smallest (186 domains). Heatmaps are centered on the 59 edge of PRC2-target domains + or 21000 bp for a total window size of 2000 bp. The DhH2Az strain retains most telomere-proximal H3K27me2/3, as opposed to the Dcac-3/npf strain where almost all H3K27me2/3 enrichment is lost from telomere-proximal regions.

58 A. J. Courtney et al. Figure 3 H3K27me2/3 and H2A.Z are not colocalized in N. crassa mycelium. (A) Genome browser images of ChIP-seq for H2A.Z-GFP (green) and H3K27me2/3 (blue) enrichment across Linkage Group (“chromosome”) VII. A segment of chromosome VII is displayed at higher resolution to visualize the distinct patterns of each modification. Distinct peaks are located at the start of many genes in the genome yet few H2A.Z peaks are present within transcriptionally silent PRC2-target domains. (B) Heatmaps of H3K27me2/3 (blue) and H2A.Z-GFP (green) enrichment ordered by H3K27me2/3 enrichment. Heatmaps are centered on the transcription start site (TSS) for all 10,397 genes, + or –1000 bp for a full window size of 2000 bp. (C) Gene profile of H2A.Z-GFP (green line) and H3K27me2/3 (blue line) enrichment for all 10,397 genes (fit to 1000 bp for gene body length) in the genome –1000 bp upstream of TSS, and +1000 bp downstream of TES. (D) Gene profile of H2A.Z-GFP (green line) and H3K27me2/3 (blue line) enrichment for only H3K27me2/3 genes (589 genes) enriched in the genome –1000 bp upstream of TSS and + 1000 bp downstream of TES. (E) Line plot centered on 325 PRC2-target domains displays very low enrichment for H2A.Z-GFP (green line) and high enrichment for H3K27me2/3 (blue line). called peaks and found that there were far fewer peaks iden- genes exhibit differential expression in the absence of H2A.Z. tified, which is likely due to the higher signal-to-noise ratio Deletion of histone variant H2A.Z causes both positive and when using the H2A.Z antibody. Overall, 695 peaks were negative misregulation of a large number of genes (Figure identified, as compared to 3104 in the H2A.Z-GFP strain; 4A). After Benjamini–Hochberg correction (Yoav Benjamini however, when viewed in the genome browser, the peaks and Hochberg 1995), there are 1066 genes with differential clearly overlap (Figure S6A), and, when we intersected the transcription (adjusted P value , 0.05 and fold change peaks to determine if they were in the same location, we find $ 1.5). Of these 1066 genes, there are similar numbers that 80% of the peaks were in common with the GFP peaks of genes up- and downregulated in the absence of H2A.Z (Figure S6D). The localization of H2A.Z-GFP at the TSS of (559 genes upregulated and 507 downregulated) (Figure 5704 genes (over half of all genes) is similar to findings in 4A and Table S6). multiple other organisms (Guillemette et al. 2005; Barski H2A.Z distribution flanks the TSS throughout much of the et al. 2007; Creyghton et al. 2008; Bargaje et al. 2012; genome, and we wanted to know if this distribution was Weber et al. 2014; Latorre et al. 2015; Dai et al. 2017; different for the transcripts that were misregulated in the Gómez-Zambrano et al. 2019). DhH2Az strain. There is higher enrichment at the TSS for transcripts that are downregulated in the absence of H2A.Z H2A.Z is crucial for proper regulation of 11% of the than there is for transcripts that are upregulated in the ab- genes in N. crassa, including eed sence of H2A.Z (Figure 4C). These data suggest that, in Previous studies have implicated H2A.Z in multiple roles Neurospora, H2A.Z may be more important for activation of related to transcription including gene activation and repres- genes than for repression. sion (Dhillon et al. 2006; Creyghton et al. 2008; Valdes-Mora We looked more closely at the PRC2-target genes and their et al. 2012; Hu et al. 2013; Kim et al. 2013; Surface et al. differential expression status. Using the previously generated 2016). We therefore asked if H2A.Z regulates H3K27me2/3 domains of internal and telomere-proximal H3K27me2/3 by regulating expression of one or more PRC2 components. domains, we found 506 internal and 262 telomere-proximal We performed RNA sequencing of wild type, DhH2Az, Dset-7, genes. Out of these, 78 PRC2-target genes are misregulated and the double mutant DhH2Az;Dset-7 to determine which (FDR corrected P value , 0.05 and fold change $ 1.5) in

H2A.Z Regulates H3K27me2/3 via EED 59 Figure 4 H2A.Z is important for the proper regulation of a large number of genes in N. crassa, including eed. (A) Volcano plot of differentially expressed genes in DhH2Az. Deletion of hH2Az misregulates a large number of genes in both directions; however, there are slightly more genes that are upregulated upon deletion of hH2Az. It is likely that H2A.Z is necessary for the proper expression of a large percentage of genes in N. crassa. EED is labeled and highlighted in green on the plot. Genes enriched for H3K27me2/3 are in gray (FDR corrected P-value . 0.05) or pink (FDR corrected P- value , 0.05) corresponding to their significance values. The eed gene is significantly downregulated in the deletion strain. (B) Genome browser images of each gene and its corresponding H2A.Z enrichment, for all PRC2 components, there is enrichment of H2A.Z near the TSS. Boxplots of normalized counts for all subunits of PRC2 [eed (light blue), set-7 (purple), suz-12 (pink) cac-3/npf (dark blue)] in wild type, DhH2Az, Dset-7, and DhH2Az;Dset-7 backgrounds. Downregulation of eed is dependent on hH2Az deletion. (C) Heatmap showing the difference of H2A.Z-GFP enrichment for all transcripts that are misregulated in the DhH2Az strain. Heatmap is ordered by enrichment,: top panel transcripts that are upregulated in DhH2Az (559), bottom panel: transcripts that are downregulated in DhH2Az (507). (D) Volcano plot of 548 differentially expressed PRC2-target genes divided by their proximity to the end of the chromosome. Genes that are not significant are in black, significant telomere-proximal genes are in orange, significant internal genes are in purple, and other genes are in gray (other are genes that do not overlap 70% or more with H3K27me2/3 domains). More internal genes show upregulation (27) than downregulation, and the telomere-proximal genes show a similar number of up and downregulated genes.

60 A. J. Courtney et al. the DhH2Az strain. Of these, 31 are located in internal do- eed, which lack any H3K27me2/3, exhibit a wild-type-like mains and 41 are located in telomere-proximal domains. Due growth rate (Basenko et al. 2015; Jamieson et al. 2016). to the stringency of the intersections between domains and Therefore, we conclude that the defective growth of DhH2Az genes, there are six that are denoted as “other” (six genes are strains is likely due other functions of H2A.Z and not the loss not covered by 70% or more H3K27me2/3). There are ap- of H3K27me2/3. There are some qualitative differences in proximately even numbers of genes that are up (46) and peak shape and not all peaks are fully restored (Figure 5B), downregulated (32); however, we find a large number of which could indicate that H2A.Z contributes to normal the internal genes are upregulated (27) in comparison to H3K27me2/3 via additional mechanisms. To quantify the the telomere-proximal genes, which are almost evenly up restoration of peaks in the overexpression strain, we called and downregulated (Figure 4D). peaks of H3K27me2/3 using HOMER. We identified a total of We next examined expression levels of genes encoding 445 peaks, which comprised 6% of the genome, analogous individual PRC2 components (Figure 4B). We found that ex- to wild type. The restored domains tended to be smaller than pression of eed is significantly reduced in DhH2Az by more wild type, ranging from 500 bp to 59 kb, with an average than ninefold (FDR-corrected P value = 8.96 3 10207), size of 6.1 kb. To determine if the peaks observed in this whereas cac-3/npf, suz-12, and set-7 were expressed at sim- strain are in wild-type locations, we again compared peaks ilar levels in both wild type and DhH2Az (Figure 4, A and B). only from assembled contigs. Using bedtools intersect, we The eed gene showed the most dramatic change in expres- found 301 peaks in common (out of 308 wild-type peaks sion compared to wild type in either DhH2Az or DhH2Az; on assembled contigs) indicating that the peaks in the over- Dset-7, but is expressed normally in the single mutant Dset-7. expression strain were smaller but located in the same re- This indicated that deletion of H2A.Z is likely responsible for gions as in wild type. Nevertheless, the significant restoration its downregulation. As an essential component of PRC2, EED of H3K27me2/3 suggests that reduced eed expression is the is required for catalytic activity. EED is also important for major contributor to the loss of H3K27me2/3 in the DhH2Az recognition of the H3K27me2/3 mark and has been impli- strain. cated in maintenance and/or spreading of H3K27me3 from nucleation sites (Hansen et al. 2008; Xu et al. 2010). Since Discussion H2A.Z is localized proximal to the promoters of a little over half the genes (5704) in the N. crassa genome, we examined H2A.Z is a highly conserved histone variant that has been the H2A.Z localization at the eed gene. There is a large peak linked to gene activation and repression, and control of H3K27 of H2A.Z enrichment at the promoter of eed (Figure 4B), methylation. We report here that N. crassa H2A.Z is required which appears to be crucial for normal eed expression. Pro- for normal methylation of H3K27 in facultative heterochro- moters of other PRC2 components are also enriched for matin domains. In contrast to the situation in plants and H2A.Z, but apparently are not dependent on H2A.Z for their animals, we find that N. crassa H2A.Z does not colocalize expression. Together, these data suggest that H2A.Z is re- with H3K27me2/3. In undifferentiated mammalian cells quired for the proper expression of eed. and in plant cells, H2A.Z colocalized with PRC2 components, H3K27me3, SUZ12, or both (Creyghton et al. 2008; Ku et al. Overexpression of EED rescues H3K27 methylation 2012; Surface et al. 2016; Zhang et al. 2017; Carter et al. levels in the absence of H2A.Z 2018; Wang et al. 2018). In mESCs, H2A.Z is found at de- To determine if downregulation of eed is responsible for the velopmentally important loci where SUZ12 is also enriched depletion of H3K27me2/3 observed in DhH2Az, we con- (Creyghton et al. 2008; Ku et al. 2012). In addition, this structed a strain that lacks both eed and hH2Az, and we in- histone variant is proposed to regulate lineage commitment troduced N-terminal tagged 3xflag-eed into the his-3 locus by functioning as a “molecular rheostat” to drive either acti- driven by the strong constitutive clock controlled gene-1/glucose- vation or repression of genes (Subramanian et al. 2015; repressible gene-1 (ccg-1/grg-1)promoter(his-3::Pccg1- Surface et al. 2016; Zhang et al. 2017). This colocalization 3xflag-eed). We calculated expected expression levels of this of PRC2 and H2A.Z is not seen in differentiated murine cells, construct using native ccg-1 levels observed in our RNA-seq and ubiquitylated residues on the C-terminal tail of H2A.Z experiment, and we expect eed to be expressed at 100 times have been hypothesized as integral for cells to maintain un- the native level. To confirm this construct was being differentiated status (Ku et al. 2012; Surface et al. 2016). In expressed at the same level in both the Deed and Deed; plants, H2A.Z displays significant colocalization with DhH2Az backgrounds, we performed an anti-FLAG western H3K27me3 in the gene bodies of PcG-repressed genes even blot (Figure S4C). Our results confirm that the deletion of in differentiated tissues (Zhang et al. 2017; Carter et al. H2A.Z does not alter 3xFLAG-EED expression driven by the 2018). Our work highlights an important structural differ- ccg-1 promoter. After performing H3K27me2/3 ChIP-seq in ence between facultative heterochromatin in plants and fila- this strain, we find that the majority of H3K27me2/3 peaks mentous fungi. In both plants and animals, PRC1 and PRC2 are recovered in the genome (Figure 5A), but the growth work together to maintain stable gene repression in a number phenotype of the Deed;DhH2Az strain is only partially res- of ways including, the classic hierarchical model (L. Wang cued (Figure S4D). Strains with deletions of either set-7 or et al. 2004), ubiquitylation of H2A proteins (H. Wang et al.

H2A.Z Regulates H3K27me2/3 via EED 61 Figure 5 Overexpression of eed rescues H3K27 methylation levels in the absence of H2A.Z. (A) Partial restoration of H3K27 methylation throughout the genome in a DhH2Az;Deed strain containing his-3::Pccg-1-3xFlag-eed and overexpressing eed at 1003 the native level. Most H3K27 methylation is restored, though there are some qualitative differences in the peak patterns between the overexpression strain and wild type. (B) Heatmaps of H3K27me3 enrichment across PRC2-target domains sorted by first by telomere-proximal (123 domains) or internal domains (186 domains) and then by enrichment, centered on each domain + or –1000 bp for a full window size of 2000 bp for wild type, DhH2Az, Deed;his-3::Pccg-1-3xflag-eed, and Deed;DhH2Az;his-3::Pccg-1-3xflag-eed. Not all domains are fully rescued to wild-type levels.

62 A. J. Courtney et al. 2004), and inhibition of machinery involved in transcription PRC2 is being recruited to the telomeric region and the down- (King et al. 2002). PRC1 monoubiquitylates H2A.Z in these regulation of eed causes a defect in the propagation of the organisms, which is important for Polycomb binding and re- H3K27me2/3 modification into topologically associated, pression (Surface et al. 2016; Gómez-Zambrano et al. 2019). nearby regions, and we will address this possibility in future H2A.Z may not be required for H3K27me2/3 in fungi due to Hi-C studies. Another possibility is that the internal domains the absence of PRC1. Although we did not observe colocali- have a special requirement for EED in spreading, or for the zation of H2A.Z and H3K27me2/3 in N. crassa, it remains maintenance of H3K27 methylation following DNA replica- possible that these two chromatin features overlap in specific tion. Alternatively,EED may interact directly with transcription developmental cell types (e.g., during sexual development or factors that control assembly of facultative heterochromatin at meiosis). Future work is needed to test this possibility. certain internal domains, while other PRC2-associated pro- In N. crassa, we generally find histone H2A.Z at the proteins may be more important for targeting PRC2 to telomeres. moters of a large number of genes in the genome. When Future studies are needed to distinguish between these possi- viewing the localization using a metaplot, which averages ble working models. the enrichment of all H2A.Z marked nucleosomes, it appears that H2A.Z flanks the TSS. Genome-wide localization of Acknowledgments H2A.Z has been performed in a variety of organisms including Arabidopsis, Caenorhabditis elegans, S. cerevisiae, mouse, We thank the undergraduate students who contributed to and Drosophila. H2A.Z is generally found in the promoters of this work JongIn Hwang, Vlad Sirbu, Jacqueline Nutter, and active and inactive genes, as well as in vertebrate enhancers Preston Trevor Neal. We are grateful to Robert J. Schmitz (Guillemette et al. 2005; Barski et al. 2007; Creyghton et al. and Christina Ethridge for RNA-seq library support and the 2008; Bargaje et al. 2012; Weber et al. 2014; Latorre et al. Georgia Genomic and Bioinformatics Core for sequencing. We 2015; Gómez-Zambrano et al. 2019). The +1 nucleosome— thank Michael Freitag and Kristina Smith for constructive the first nucleosome after the TSS, containing H2A.Z—has comments on this manuscript. This work was supported by been postulated as a lower energy barrier to transcription grants from the American Cancer Society (RSG-14-184-01-DMC) elongation in Drosophila and Arabidopsis (Weber et al. and the National Institutes of Health (NIH) (R01GM132644) to 2014; Dai et al. 2017). Our data are consistent with an im- Z.A.L. and the National Science Foundation Graduate Research portant promoter-specific role for N. crassa H2A.Z. Fellowship Program Grant (DGE-1443117) to A.J.C. Indeed, in N. crassa we find that the eed gene contains a large peak of H2A.Z in the +1 nucleosome, and we find that Literature Cited H2A.Z is required for the proper expression of eed. To our knowledge, this is the first report of H2A.Z specifically regu- Abel, K. J., L. C. Brody, J. M. Valdes, M. R. Erdos, D. R. McKinley lating the eed gene. Previous studies in mESCs demonstrate et al., 1996 Characterization of EZH1, a human homolog of – that appropriate binding of multiple factors to the eed pro- Drosophila Enhancer of zeste near BRCA1. Genomics 37: 161 171. https://doi.org/10.1006/geno.1996.0537 moter are required for the normal expression of eed (Ura et al. Adam, M., F. Robert, M. Larochelle, and L. Gaudreau, 2001 H2A.Z is 2008, 2011). It is also possible that there are transcription required for global chromatin integrity and for recruitment of RNA factors that can bind to the sequence associated with the polymerase II under specific conditions. Mol. Cell. Biol. 21: 6270– H2A.Z-containing nucleosome. Nucleosomes that contain 6279. https://doi.org/10.1128/MCB.21.18.6270-6279.2001 H2A.Z protect 120 bp of DNA from MNase digestion as Aramayo, R., and E. U. Selker, 2013 Neurospora crassa, a model system for epigenetics research. Cold Spring Harb. Perspect. Biol. opposed to nucleosomes with canonical H2A that protect 5: a017921. https://doi.org/10.1101/cshperspect.a017921 147 bp (Tolstorukov et al. 2009). This may leave more se- Avalos, J., R. F. Geever, and M. E. Case, 1989 Bialaphos resistance quence available for transcription factor binding between as a dominant selectable marker in Neurospora crassa. Curr. H2A.Z-containing nucleosomes. Genet. 16: 369–372. https://doi.org/10.1007/BF00340716 We observed that reduced eed expression levels leads to Bargaje, R., M. P. Alam, A. Patowary, M. Sarkar, T. Ali et al., fi 2012 Proximity of H2A.Z containing nucleosome to the tran- region-speci c losses of H3K27me2/3, rather than a more scription start site influences gene expression levels in the mam- general, or global, reduction. In contrast to our work, reduced malian liver and brain. Nucleic Acids Res. 40: 8965–8978. Eed is reported to cause a global decrease in H3K27me3 in https://doi.org/10.1093/nar/gks665 mESCs. In these cells, reduced expression of Eed was ob- Barski, A., S. Cuddapah, K. Cui, T. Y. Roh, D. E. Schones et al., 2007 High- fi served following downregulation of Oct3/4, which, in turn, resolution pro ling of histone methylationsinthehumangenome. Cell 129: 823–837. https://doi.org/10.1016/j.cell.2007.05.009 led to a global reduction of H3K27me3 (Ura et al. 2008, Basenko,E.Y.,T.Sasaki,L.X.Ji,C.J.Prybol,R.M.Burckhardtet al., 2011). In N. crassa, repetitive sequences (e.g., the canonical 2015 Genome-wide redistribution of H3K27me3 is linked to gen- telomere repeats) are sufficient to induce an artificial otoxic stress and defective growth. Proc. Natl. Acad. Sci. USA 112: H3K27me3 domain when inserted into a locus normally de- E6339–E6348. https://doi.org/10.1073/pnas.1511377112 void of H3K27me3 (Jamieson et al. 2018). It is interesting Benjamini, Y., and Y. Hochberg, 1995 Controlling the false dis- covery rate: a practical and powerful approach to multiple test- that, even though we also observe the loss of H3K27 meth- ing. J. R. Stat. Soc. B 57: 289–300. ylation throughout much of the genome, regions proximal to Birve, A., A. K. Sengupta, D. Beuchle, J. Larsson, J. A. Kennison the telomeres retained H3K27me2/3. This suggests that et al., 2001 Su(z)12, a novel Drosophila Polycomb group gene

H2A.Z Regulates H3K27me2/3 via EED 63 that is conserved in vertebrates and plants. Development 128: EMBO J. 32: 2073–2085. https://doi.org/10.1038/emboj.2013. 3371–3379. 145 Borkovich, K. A., L. A. Alex, O. Yarden, M. Freitag, G. E. Turner Dhillon,N.,M.Oki,S.J.Szyjka,O.M.Aparicio,andR.T.Kamakaka, et al., 2004 Lessons from the genome sequence of Neurospora 2006 H2A.Z functions to regulate progression through the cell crassa: tracing the path from genomic blueprint to multicellular cycle. Mol. Cell. Biol. 26: 489–501. https://doi.org/10.1128/ organism. Microbiol. Mol. Biol. Rev. 68: 1–108. https://doi.org/ MCB.26.2.489-501.2006 10.1128/MMBR.68.1.1-108.2004 Dong, Q., Y. Wang, S. Qi, K. Gai, Q. He et al., 2018 Histone variant Bruce, K., F. A. Myers, E. Mantouvalou, P. Lefevre, I. Greaves et al., H2A.Z antagonizes the positive effect of the transcriptional acti- 2005 The replacement histone H2A.Z in a hyperacetylated vator CPC1 to regulate catalase-3 expression under normal and form is a feature of active genes in the chicken. Nucleic Acids oxidative stress conditions. Free Radic. Biol. Med. 121: 136–148. Res. 33: 5633–5639. https://doi.org/10.1093/nar/gki874 https://doi.org/10.1016/j.freeradbiomed.2018.05.003 Cao, R., L. Wang, H. Wang, L. Xia, H. Erdjument-Bromage et al., Dumesic, P. A., C. M. Homer, J. J. Moresco, L. R. Pack, E. K. Shanle 2002 Role of histone H3 lysine 27 methylation in Polycomb- et al., 2015 Product binding enforces the genomic specificity of group silencing. Science 298: 1039–1043. https://doi.org/10.1126/ a yeast polycomb repressive complex. Cell 160: 204–218. science.1076997 https://doi.org/10.1016/j.cell.2014.11.039 Carter, B., B. Bishop, K. K. Ho, R. Huang, W. Jia et al., 2018 The Faast, R., V. Thonglairoam, T. C. Schulz, J. Beall, J. R. Wells et al., chromatin remodelers PKL and PIE1 Act in an epigenetic pathway 2001 Histone variant H2A.Z is required for early mammalian that determines H3K27me3 homeostasis in Arabidopsis. Plant development. Curr. Biol. 11: 1183–1187. https://doi.org/10.1016/ Cell 30: 1337–1352. https://doi.org/10.1105/tpc.17.00867 S0960-9822(01)00329-3 Chanvivattana, Y., A. Bishopp, D. Schubert, C. Stock, Y. H. Moon Ferraro, A. R., and Z. A. Lewis, 2018 ChIP-seq analysis in Neuros- et al., 2004 Interaction of Polycomb-group proteins controlling pora crassa. Methods Mol. Biol. 1775: 241–250. https://doi.org/ flowering in Arabidopsis. Development 131: 5263–5276. 10.1007/978-1-4939-7804-5_19 https://doi.org/10.1242/dev.01400 Gómez-Zambrano, A., W. Merini, and M. Calonje, 2019 The re- Chen, H., C. Rossier, and S. E. Antonarakis, 1996 Cloning of a pressive role of Arabidopsis H2A.Z in transcriptional regulation human homolog of the Drosophila enhancer of zeste gene depends on AtBMI1 activity. Nat. Commun. 10: 2828. https:// (EZH2) that maps to chromosome 21q22.2. Genomics 38: 30– doi.org/10.1038/s41467-019-10773-1 37. https://doi.org/10.1006/geno.1996.0588 Goodrich, J., P. Puangsomlee, M. Martin, D. Long, E. M. Meyerowitz Chujo, T., and B. Scott, 2014 Histone H3K9 and H3K27 methyl- et al., 1997 A Polycomb-group gene regulates homeotic gene ation regulates fungal alkaloid biosynthesis in a fungal endo- expression in Arabidopsis. Nature 386: 44–51. https://doi.org/ phyte-plant symbiosis. Mol. Microbiol. 92: 413–434. https:// 10.1038/386044a0 doi.org/10.1111/mmi.12567 Greaves, I. K., D. Rangasamy, P. Ridgway, and D. J. Tremethick, Clarkson, M. J., J. R. Wells, F. Gibson, R. Saint, and D. J. Tremethick, 2007 H2A.Z contributes to the unique 3D structure of the cen- 1999 Regions of variant histone His2AvD required for Drosoph- tromere. Proc. Natl. Acad. Sci. USA 104: 525–530. https:// ila development. Nature 399: 694–697. https://doi.org/10.1038/ doi.org/10.1073/pnas.0607870104 21436 Grossniklaus, U., J. P. Vielle-Calzada, M. A. Hoeppner, and W. B. Colot,H.V.,G.Park,G.E.Turner,C.Ringelberg,C.M.Crewet al., Gagliano, 1998 Maternal control of embryogenesis by MEDEA, 2006 A high-throughput gene knockout procedure for Neuros- a polycomb group gene in Arabidopsis. Science 280: 446–450. pora reveals functions for multiple transcription factors. Proc. Natl. https://doi.org/10.1126/science.280.5362.446 Acad. Sci. USA 103: 10352–10357 (erratum: Proc. Natl. Acad. Sci. Guillemette, B., A. R. Bataille, N. Gevry, M. Adam, M. Blanchette USA 103: 16614). https://doi.org/10.1073/pnas.0601456103 et al., 2005 Variant histone H2A.Z is globally localized to the Connolly, L. R., K. M. Smith, and M. Freitag, 2013 The Fusarium promoters of inactive yeast genes and regulates nucleosome graminearum histone H3 K27 methyltransferase KMT6 regu- positioning. PLoS Biol. 3: e384. https://doi.org/10.1371/journal. lates development and expression of secondary metabolite gene pbio.0030384 clusters. PLoS Genet. 9: e1003916. https://doi.org/10.1371/ Hansen, K. H., A. P. Bracken, D. Pasini, N. Dietrich, S. S. Gehani journal.pgen.1003916 et al., 2008 A model for transmission of the H3K27me3 epige- Creyghton, M. P., S. Markoulaki, S. S. Levine, J. Hanna, M. A. Lodato netic mark. Nat. Cell Biol. 10: 1291–1300 (erratum: Nat. Cell et al., 2008 H2AZ is enriched at polycomb complex target genes Biol. 10: 1484). https://doi.org/10.1038/ncb1787 in ES cells and is necessary for lineage commitment. Cell 135: Heinz, S., C. Benner, N. Spann, E. Bertolino, Y. C. Lin et al., 649–661. https://doi.org/10.1016/j.cell.2008.09.056 2010 Simple combinations of lineage-determining transcrip- Czermin, B., R. Melfi, D. McCabe, V. Seitz, A. Imhof et al., tion factors prime cis-regulatory elements required for macro- 2002 Drosophila enhancer of Zeste/ESC complexes have a phage and B cell identities. Mol. Cell 38: 576–589. https:// histone H3 methyltransferase activity that marks chromosomal doi.org/10.1016/j.molcel.2010.05.004 polycomb sites. Cell 111: 185–196. https://doi.org/10.1016/ Hennig, L., and M. Derkacheva, 2009 Diversity of Polycomb S0092-8674(02)00975-3 group complexes in plants: same rules, different players? Trends Dai, X., Y. Bai, L. Zhao, X. Dou, Y. Liu et al., 2017 H2A.Z represses Genet. 25: 414–423. https://doi.org/10.1016/j.tig.2009.07.002 gene expression by modulating promoter nucleosome structure Honda, S., and E. U. Selker, 2009 Tools for fungal proteomics: and enhancer histone modifications in Arabidopsis. Mol. Plant multifunctional neurospora vectors for gene replacement, pro- 10: 1274–1292. https://doi.org/10.1016/j.molp.2017.09.007 tein expression and protein purification. Genetics 182: 11–23. Davis, R., and F. de Serres, 1970 Genetic and microbiological re- https://doi.org/10.1534/genetics.108.098707 search techniques for Neurospora crassa. Methods Enzymol. 17: Hu, G., K. Cui, D. Northrup, C. Liu, C. Wang et al., 2013 H2A.Z 79–143. https://doi.org/10.1016/0076-6879(71)17168-6 facilitates access of active and repressive complexes to chromatin Deal, R. B., C. N. Topp, E. C. McKinney, and R. B. Meagher, in embryonic stem cell self-renewal and differentiation. Cell Stem 2007 Repression of flowering in Arabidopsis requires activation Cell 12: 180–192. https://doi.org/10.1016/j.stem.2012.11.003 of FLOWERING LOCUS C expression by the histone variant H2A. Huang, S., W. H. Lee, and E. Y. Lee, 1991 A cellular protein that Z. Plant Cell 19: 74–83. https://doi.org/10.1105/tpc.106.048447 competes with SV40 T antigen for binding to the retinoblastoma Derkacheva, M., Y. Steinbach, T. Wildhaber, I. Mozgova, W. Mahrez gene product. Nature 350: 160–162. https://doi.org/10.1038/ et al., 2013 Arabidopsis MSI1 connects LHP1 to PRC2 complexes. 350160a0

64 A. J. Courtney et al. Iouzalen, N., J. Moreau, and M. Mechali, 1996 H2A.ZI, a new Lewis, Z. A., 2017 Polycomb group systems in fungi: new models variant histone expressed during Xenopus early development for understanding polycomb repressive complex 2. Trends exhibits several distinct features from the core histone H2A. Genet. 33: 220–231. https://doi.org/10.1016/j.tig.2017.01.006 Nucleic Acids Res. 24: 3947–3952. https://doi.org/10.1093/ Li, H., and R. Durbin, 2009 Fast and accurate short read align- nar/24.20.3947 ment with Burrows-Wheeler transform. Bioinformatics 25: Jackson, J. D., and M. A. Gorovsky, 2000 Histone H2A.Z has a 1754–1760. https://doi.org/10.1093/bioinformatics/btp324 conserved function that is distinct from that of the major H2A Li,H.,B.Handsaker,A.Wysoker,T.Fennell,J.Ruanet al., 2009 The sequence variants. Nucleic Acids Res. 28: 3811–3816. https:// sequence alignment/map format and SAMtools. Bioinformatics doi.org/10.1093/nar/28.19.3811 25: 2078–2079. https://doi.org/10.1093/bioinformatics/btp352 Jamieson, K., M. R. Rountree, Z. A. Lewis, J. E. Stajich, and E. U. Liao, Y., G. K. Smyth, and W. Shi, 2013 The Subread aligner: fast, Selker, 2013 Regional control of histone H3 lysine 27 methyl- accurate and scalable read mapping by seed-and-vote. Nucleic ation in Neurospora. Proc. Natl. Acad. Sci. USA 110: 6027– Acids Res. 41: e108. https://doi.org/10.1093/nar/gkt214 6032. https://doi.org/10.1073/pnas.1303750110 Liu, X., B. Li, and M. A. Gorovsky, 1996 Essential and nonessential Jamieson, K., E. T. Wiles, K. J. McNaught, S. Sidoli, N. Leggett et al., histone H2A variants in Tetrahymena thermophila. Mol. Cell. 2016 Loss of HP1 causes depletion of H3K27me3 from facul- Biol. 16: 4305–4311. https://doi.org/10.1128/MCB.16.8.4305 tative heterochromatin and gain of H3K27me2 at constitutive Liu, X., Y. Dang, T. Matsu-ura, Y. He, Q. He et al., 2017 DNA heterochromatin. Genome Res. 26: 97–107. https://doi.org/ replication is required for circadian clock function by regulating 10.1101/gr.194555.115 rhythmic nucleosome composition. Mol. Cell 67: 203–213.e4. Jamieson, K., K. J. McNaught, T. Ormsby, N. A. Leggett, S. Honda https://doi.org/10.1016/j.molcel.2017.05.029 et al., 2018 Telomere repeats induce domains of H3K27 meth- Love, M. I., W. Huber, and S. Anders, 2014 Moderated estimation ylation in Neurospora. eLife 7: e31216. https://doi.org/10.7554/ of fold change and dispersion for RNA-seq data with DESeq2. eLife.31216 Genome Biol. 15: 550. https://doi.org/10.1186/s13059-014- Jones, R. S., and W. M. Gelbart, 1993 The Drosophila Polycomb- 0550-8 group gene Enhancer of zeste contains a region with sequence Luger, K., 2003 Structure and dynamic behavior of nucleosomes. similarity to trithorax. Mol. Cell. Biol. 13: 6357–6366. https:// Current Opinion in Genetics &. Development 13: 127–135. doi.org/10.1128/MCB.13.10.6357 Luk, E., A. Ranjan, P. C. Fitzgerald, G. Mizuguchi, Y. Huang et al., Kim, D., J. M. Paggi, C. Park, C. Bennett, and S. L. Salzberg, 2010 Stepwise histone replacement by SWR1 requires dual 2019 Graph-based genome alignment and genotyping with activation with histone H2A.Z and canonical nucleosome. Cell HISAT2 and HISAT-genotype. Nat. Biotechnol. 37: 907–915. 143: 725–736. https://doi.org/10.1016/j.cell.2010.10.019 https://doi.org/10.1038/s41587-019-0201-4 Margolin, B. S., M. Freitag, and E. U. Selker, 1997 Improved plas- Kim,K.,V.Punj,J.Choi,K.Heo,J.M.Kimet al., 2013 Gene dysre- mids for gene targeting at the his-3 locus of Neurospora crassa gulation by histone variant H2A.Z in bladder cancer. Epigenetics by electroporation. Fungal Genet. Newsl. 44: 2. Chromatin 6: 34. https://doi.org/10.1186/1756-8935-6-34 Martin, M., 2011 Cutadapt removes adapter sequences from high- King, I. F., N. J. Francis, and R. E. Kingston, 2002 Native and throughput sequencing reads. EMBnet 17: 2. recombinant polycomb group complexes establish a selective Meneghini, M. D., M. Wu, and H. D. Madhani, 2003 Conserved block to template accessibility to repress transcription in vitro. histone variant H2A.Z protects euchromatin from the ectopic Mol. Cell. Biol. 22: 7919–7928. https://doi.org/10.1128/MCB.22.22. spread of silent heterochromatin. Cell 112: 725–736. https:// 7919-7928.2002 doi.org/10.1016/S0092-8674(03)00123-5 Kobor, M. S., S. Venkatasubrahmanyam, M. D. Meneghini, J. W. Mizuguchi, G., X. Shen, J. Landry, W. H. Wu, S. Sen et al., Gin, J. L. Jennings et al., 2004 A protein complex containing 2004 ATP-driven exchange of histone H2AZ variant catalyzed the conserved Swi2/Snf2-related ATPase Swr1p deposits his- by SWR1 chromatin remodeling complex. Science 303: 343– tone variant H2A.Z into euchromatin. PLoS Biol. 2: E131. 348. https://doi.org/10.1126/science.1090701 https://doi.org/10.1371/journal.pbio.0020131 Müller, J., 1995 Transcriptional silencing by the Polycomb protein Krogan, N. J., K. Baetz, M. C. Keogh, N. Datta, C. Sawa et al., in Drosophila embryos. EMBO J. 14: 1209–1220. https:// 2004 Regulation of chromosome stability by the histone H2A doi.org/10.1002/j.1460-2075.1995.tb07104.x variant Htz1, the Swr1 chromatin remodeling complex, and the Müller, J., C. M. Hart, N. J. Francis, M. L. Vargas, A. Sengupta et al., histone acetyltransferase NuA4. Proc. Natl. Acad. Sci. USA 101: 2002 Histone methyltransferase activity of a Drosophila Poly- 13513–13518 [corrigenda: Proc. Natl. Acad. Sci. USA 103: comb group repressor complex. Cell 111: 197–208. https:// 6410 (2006)]. https://doi.org/10.1073/pnas.0405753101 doi.org/10.1016/S0092-8674(02)00976-5 Ku, M., J. D. Jaffe, R. P. Koche, E. Rheinbay, M. Endoh et al., Neves, L. T., S. Douglass, R. Spreafico, S. Venkataramanan, T. L. 2012 H2A.Z landscapes and dual modifications in pluripotent Kress et al., 2017 The histone variant H2A.Z promotes efficient and multipotent stem cells underlie complex genome regulatory cotranscriptional splicing in S. cerevisiae. Genes &. Devel- functions. Genome Biol. 13: R85. https://doi.org/10.1186/gb- opment 31: 702–717. 2012-13-10-r85 Ng, J., C. M. Hart, K. Morgan, and J. A. Simon, 2000 A Drosophila Kuroda, M. I., H. Kang, S. De, and J. A. Kassis, 2020 Dynamic ESC-E(Z) protein complex is distinct from other polycomb group competition of polycomb and trithorax in transcriptional pro- complexes and contains covalently modified ESC. Mol. Cell. Biol. 20: gramming. Annu. Rev. Biochem. 89: 235–253. https://doi.org/ 3069–3078. https://doi.org/10.1128/MCB.20.9.3069-3078.2000 10.1146/annurev-biochem-120219-103641 Qian, Y. W., Y. C. Wang, R. E. Hollingsworth, Jr., D. Jones, N. Ling Kuzmichev, A., K. Nishioka, H. Erdjument-Bromage, P. Tempst, and et al., 1993 A retinoblastoma-binding protein related to a neg- D. Reinberg, 2002 Histone methyltransferase activity associ- ative regulator of Ras in yeast. Nature 364: 648–652. https:// ated with a human multiprotein complex containing the En- doi.org/10.1038/364648a0 hancer of Zeste protein. Genes Dev. 16: 2893–2905. https:// Ramirez, F., D. P. Ryan, B. Gruning, V. Bhardwaj, F. Kilpert et al., doi.org/10.1101/gad.1035902 2016 deepTools2: a next generation web server for deep- Latorre, I., M. A. Chesney, J. M. Garrigues, P. Stempor, A. Appert sequencing data analysis. Nucleic Acids Res. 44: W160–W165. et al., 2015 The DREAM complex promotes gene body H2A.Z https://doi.org/10.1093/nar/gkw257 for target repression. Genes Dev. 29: 495–500. https://doi.org/ Rangasamy, D., I. Greaves, and D. J. Tremethick, 2004 RNA in- 10.1101/gad.255810.114 terference demonstrates a novel role for H2A.Z in chromosome

H2A.Z Regulates H3K27me2/3 via EED 65 segregation. Nat. Struct. Mol. Biol. 11: 650–655. https://doi.org/ Ura, H., K. Murakami, T. Akagi, K. Kinoshita, S. Yamaguchi et al., 10.1038/nsmb786 2011 Eed/Sox2 regulatory loop controls ES cell self-renewal Ridgway, P., K. D. Brown, D. Rangasamy, U. Svensson, and D. J. through histone methylation and acetylation. EMBO J. 30: Tremethick, 2004 Unique residues on the H2A.Z containing nucleo- 2190–2204. https://doi.org/10.1038/emboj.2011.126 some surface are important for Xenopus laevis development. J. Biol. Valdes-Mora, F., J. Z. Song, A. L. Statham, D. Strbenac, M. D. Chem. 279: 43815–43820. https://doi.org/10.1074/jbc.M408409200 Robinson et al., 2012 Acetylation of H2A.Z is a key epigenetic Rohland, N., and D. Reich, 2012 Cost-effective, high-throughput modification associated with gene deregulation and epigenetic DNA sequencing libraries for multiplexed target capture. Genome remodeling in cancer. Genome Res. 22: 307–321. https:// Res. 22: 939–946. https://doi.org/10.1101/gr.128124.111 doi.org/10.1101/gr.118919.110 Sasaki, T., K. L. Lynch, C. V. Mueller, S. Friedman, M. Freitag et al., van Daal, A., and S. C. Elgin, 1992 A histone variant, H2AvD, is 2014 Heterochromatin controls gammaH2A localization in essential in Drosophila melanogaster. Mol. Biol. Cell 3: 593– Neurospora crassa. Eukaryot. Cell 13: 990–1000. https:// 602. https://doi.org/10.1091/mbc.3.6.593 doi.org/10.1128/EC.00117-14 Veerappan, C. S., Z. Avramova, and E. N. Moriyama, 2008 Evolution of Schotanus, K., J. L. Soyer, L. R. Connolly, J. Grandaubert, P. Happel SET-domain protein families in the unicellular and multicellu- et al., 2015 Histone modifications rather than the novel re- lar Ascomycota fungi. BMC Evol. Biol. 8: 190. https://doi.org/ gional centromeres of Zymoseptoria tritici distinguish core and 10.1186/1471-2148-8-190 accessory chromosomes. Epigenetics Chromatin 8: 41. https:// Wang, H., L. Wang, H. Erdjument-Bromage, M. Vidal, P. Tempst doi.org/10.1186/s13072-015-0033-5 et al., 2004 Role of histone H2A ubiquitination in Polycomb Schuettengruber,B.,H.M.Bourbon,L.DiCroce,andG.Cavalli, silencing. Nature 431: 873–878. https://doi.org/10.1038/ 2017 Genome regulation by polycomb and trithorax: 70 Years and nature02985 counting. Cell 171: 34–57. https://doi.org/10.1016/j.cell.2017.08.002 Wang, L., J. L. Brown, R. Cao, Y. Zhang, J. A. Kassis et al., Schumacher, A., O. Lichtarge, S. Schwartz, and T. Magnuson, 2004 Hierarchical recruitment of polycomb group silencing 1998 The murine Polycomb-group gene eed and its human or- complexes. Mol. Cell 14: 637–646. https://doi.org/10.1016/ thologue: functional implications of evolutionary conservation. j.molcel.2004.05.009 Genomics 54: 79–88. https://doi.org/10.1006/geno.1998.5509 Wang, Y., H. Long, J. Yu, L. Dong, M. Wassef et al., 2018 Histone Schwartz, Y. B., and V. Pirrotta, 2007 Polycomb silencing mech- variants H2A.Z and H3.3 coordinately regulate PRC2-dependent anisms and the management of genomic programmes. Nat. Rev. H3K27me3 deposition and gene expression regulation in mES Genet. 8: 9–22. https://doi.org/10.1038/nrg1981 cells. BMC Biol. 16: 107. https://doi.org/10.1186/s12915-018- Seymour,M.,L.Ji,A.M.Santos,M.Kamei,T.Sasakiet al., 2016 Histone 0568-6 H1 limits DNA methylation in neurospora crassa. G3 (Bethesda) 6: Weber, C. M., S. Ramachandran, and S. Henikoff, 2014 Nucleosomes 1879–1889. https://doi.org/10.1534/g3.116.028324 are context-specific, H2A.Z-modulated barriers to RNA poly- Simon, J. A., and R. E. Kingston, 2009 Mechanisms of polycomb merase.Mol.Cell53:819–830. https://doi.org/10.1016/j.molcel. gene silencing: knowns and unknowns. Nat. Rev. Mol. Cell Biol. 2014.02.014 10: 697–708. https://doi.org/10.1038/nrm2763 Wickham, H., 2009 Ggplot2: elegant graphics for data analysis, Studt, L., S. M. Rosler, I. Burkhardt, B. Arndt, M. Freitag et al., Springer, New York. https://doi.org/10.1007/978-0-387-98141-3 2016 Knock-down of the methyltransferase Kmt6 relieves Wong, M. M., L. K. Cox, and J. C. Chrivia, 2007 The chromatin H3K27me3 and results in induction of cryptic and otherwise remodeling protein, SRCAP, is critical for deposition of the his- silent secondary metabolite gene clusters in Fusarium fujikuroi. tone variant H2A.Z at promoters. J. Biol. Chem. 282: 26132– Environ. Microbiol. 18: 4037–4054. https://doi.org/10.1111/ 26139. https://doi.org/10.1074/jbc.M703418200 1462-2920.13427 Xu, C., C. Bian, W. Yang, M. Galka, H. Ouyang et al., Subramanian, V., P. A. Fields and L. A. Boyer, 2015 H2A.Z: a 2010 Binding of different histone marks differentially regu- molecular rheostat for transcriptional control. F1000Prime lates the activity and specificity of polycomb repressive complex Rep. 7: 01. https://doi.org/10.12703/P7-01 2 (PRC2). Proc. Natl. Acad. Sci. USA 107: 19266–19271. Surface, L. E., P. A. Fields, V. Subramanian, R. Behmer, N. Udeshi https://doi.org/10.1073/pnas.1008937107 et al., 2016 H2A.Z.1 monoubiquitylation antagonizes BRD2 to Xu, Y., M. K. Ayrapetov, C. Xu, O. Gursoy-Yuzugullu, Y. Hu et al., maintain poised chromatin in ESCs. Cell Rep. 14: 1142–1155. 2012 Histone H2A.Z controls a critical chromatin remod- https://doi.org/10.1016/j.celrep.2015.12.100 eling step required for DNA double-strand break repair. Mol. Thorvaldsdottir, H., J. T. Robinson, and J. P. Mesirov, 2013 Integrative Cell 48: 723–733. https://doi.org/10.1016/j.molcel.2012. Genomics Viewer (IGV): high-performance genomics data visu- 09.026 alization and exploration. Brief. Bioinform. 14: 178–192. https:// Zhang, H., B. Bishop, W. Ringenberg, W. M. Muir, and J. Ogas, doi.org/10.1093/bib/bbs017 2012 The CHD3 remodeler PICKLE associates with genes en- Tolstorukov, M. Y., P. V. Kharchenko, J. A. Goldman, R. E. Kingston, riched for trimethylation of histone H3 lysine 27. Plant Physiol. and P. J. Park, 2009 Comparative analysis of H2A.Z nucleo- 159: 418–432. https://doi.org/10.1104/pp.112.194878 some organization in the human and yeast genomes. Genome Zhang, K., W. Xu, C. Wang, X. Yi, W. Zhang et al., 2017 Differential Res. 19: 967–977. https://doi.org/10.1101/gr.084830.108 deposition of H2A.Z in combination with histone modifications Ura, H., M. Usuda, K. Kinoshita, C. Sun, K. Mori et al., within related genes in Oryza sativa callus and seedling. Plant J. 2008 STAT3 and Oct-3/4 control histone modification through 89: 264–277. https://doi.org/10.1111/tpj.13381 induction of Eed in embryonic stem cells. J. Biol. Chem. 283: 9713–9723. https://doi.org/10.1074/jbc.M707275200 Communicating editor: O. Rando

66 A. J. Courtney et al.