The Effect of Β-Cell Specific Znt8 Deficiency on Insulin Secretion

The Effect of β-Cell Specific ZnT8 Deficiency on Insulin Secretion

Anne Wu

A thesis submitted in conformity with the requirements for the degree of Masters of Physiology

Graduate Department of Medicine

University of Toronto

© Copyright by Anne Wu (2020) The Effect of β-Cell Specific ZnT8 Deficiency on Insulin Secretion Anne Wu Master of Science Department of Physiology University of Toronto 2020 Abstract Zinc plays a role in insulin processing, storage, and secretion. Zinc transport processes may be linked to defects in insulin secretion associated with type 2 diabetes (T2D). Indeed, ZnT8, a zinc influx transporter highly expressed in pancreatic β-cells, is associated with T2D risk. Presently, the role ZnT8 plays in diabetes progression and whether altered ZnT8 activity affects T2D risk/treatment is controversial. The effects of ZnT8 knockdown in mouse are modestly to severely deleterious, whereas in humans, ZnT8 loss- of-function haploinsufficiency appears to reduce diabetes risk. A β-cell specific ZnT8 knockout and haploinsufficiency model were developed and examined under normal and metabolically stressed conditions. Mice with reduced ZnT8 did not have significantly impaired glucose homeostasis or β-cell function compared to controls under normal and conditions of acute insulin resistance. Overall, pancreatic

β-cell ZnT8 deletion or knockdown did not impair β-cell function, nor was it protective of hyperglycaemia associated with insulin resistance.

Acknowledgements Thank you to the entire Wheeler lab for supporting me. Thanks to Dr. Alpana Bhatacharjee, Dr. Feihan Dai, Dana Al Rijjal, Jie Xu, Ashley Untereiner, Dr. Mi Lai, Dr. Saifur Khan for their advice and training. They provided great examples of how to conduct research. Importantly, thanks to Dr. Michael B. Wheeler for providing me this opportunity to grow as both a scientist and as a person. I truly appreciate the adaptations taken to accommodate my learning style.

I would be remiss not to thank the organizations who helped fund my schooling. Thanks to the Ontario Graduate Scholarship award (from the Estate of Gladys. A Fidlar), the Banting and Best Diabetes Centre Novo Nordisk Studentship, and the CIHR grant held by Dr. Michael B. Wheeler for providing me with the means to pursue diabetes research.

A huge thank you to Dr. Jonathan Rocheleau and Dr. Cynthia Luk, my committee members. They provided valuable insight and offered considerations we would have otherwise missed.

I’d like to thank my friends who kept me sane through this degree. They provided a great sounding board for me to talk through my confusion and gave me much needed reminders to take breaks to work more effectively.

And finally, I’d like to thank the mice whose sacrifices contributed to further diabetic research.

iii

Table of Contents Abstract ...... ii

Acknowledgements ...... iii

Awards and Publications ...... vii

List of Tables ...... viii

List of Figures ...... ix

Abbreviations ...... x

Chapter 1: Introduction ...... 1

1.1 Zinc Homeostasis ...... 1

1.1.1 Zinc in Diabetes ...... 1

1.2 Zinc Transporters ...... 4

1.3 Zinc Transporter 8 (ZnT8) and Diabetes ...... 5

1.3.1 GWAS studies of SLC30A8/ZnT8 ...... 6

1.3.2 ZnT8 in Mice ...... 8

1.3.3 ZnT8 Controversy ...... 10

1.3.4 Other functions of ZnT8 ...... 12

1.4 Rationale ...... 14

1.4.1 Hypothesis ...... 14

1.4.2 Objectives ...... 15

Chapter 2: Methods ...... 16

2.1 Model Generation ...... 16

2.1.1 PCR ...... 17

2.2 Islet Isolation ...... 18

2.3 Knockdown Detection ...... 19

2.3.1 qPCR ...... 19

2.3.2 Dithizone staining ...... 20

2.4 Validation of S961 ...... 20

2.4.1 Daily S961 injection ...... 20

2.4.2 Acute S961 Injection Challenge ...... 22

2.5 In vivo experiments ...... 22

2.5.1 Oral Glucose Tolerance Tests...... 22

2.5.2 Acute S961 Challenge ...... 22

2.6 Ex Vivo Experiments ...... 23

2.6.1 Glucose Stimulated Insulin Secretion ...... 23

2.6.2 Total Islet Insulin ...... 23

2.6.3 Insulin Concentration Measurements ...... 23

2.7 Statistical Analysis ...... 24

Chapter 3: Results ...... 25

3.1 Model Confirmation ...... 25

3.1.1 PCR ...... 25

3.1.2 qPCR ...... 25

3.2.3 Dithizone staining ...... 26

3.2 S961 Validation ...... 27

3.2.1 Daily S961 Injections ...... 27

3.2.2 Acute S961 Challenge Validation ...... 27

3.3 In vivo data ...... 30

3.3.1 OGTT ...... 31

3.3.2 S961 ...... 31

3.4 Ex vivo data ...... 32

Chapter 4: Discussion...... 34

4.1 Hepatic Insulin Clearance ...... 35

4.1.1 OGTT C-peptide ...... 35

4.2 ZnT8 Controversy ...... 35

4.2.1 ZnT8’s Relevance in β-cell function ...... 36

4.2.2 ZnT8 in Inflammation ...... 37

4.3 Altered Protein Expressions ...... 38

4.4 Study Limitations and Weaknesses ...... 38

4.4.1 Cre Expression ...... 38

4.4.2 S961 Challenge Timing ...... 39

4.4.3 Female Plasma Insulin...... 40

4.4.4 Sample Sizes ...... 40

4.5 Future Directions ...... 41

4.5.1 Increasing Confidence ...... 41

4.5.2 Other β-cell Functions of ZnT8 ...... 41

5.4.3 ZnT8 outside the β-cell ...... 42

5.4.4 Insulin Hexamerization ...... 42

4.6 Conclusion ...... 43

Awards and Publications Publications

Lai M, Liu Y, Ronnett GV, Wu A, Cox BJ, Dai FF, Röst HL, Gunderson EP, Wheeler MB. Amino acid and lipid metabolism in post-gestational diabetes and progression to type 2 diabetes: A metabolic profiling study. PLoS Med. 2020 May 20;17(5):e1003112. doi: 10.1371/journal.pmed.1003112. PMID: 32433647; PMCID: PMC7239388.

Submitted

Al Rijjal D, Liu Y, Lai M, Song Y, Danaei Z, Wu A, Mohan H, Wei L, Dai F, Schopfer F, Wheeler MB. Vascepa Protects Against High Fat Diet Induced Glucose Intolerance and Insulin Resistance. Submitted to JCI. Aug 2020;

Xu J, Wijesekara N, Bhattacharjee A, Wu A, Song Y, Regeenes R, Liu Y, Marzban L, Rocheleau J, Fraser P, Dai F, Hu C, Wheeler MB. Pancreatic beta cell specific zinc transporter 8 insufficiency accelerates diabetes associated with islet amyloidosis. Submitted to JCI Insight. Aug 2020;

Scholarships and Awards

Ontario Graduate Scholarship award (2018-2019) from the Estate of Gladys. A Fidlar

Ontario Graduate Scholarship award (2019-2020)

Banting and Best Diabetes Centre – Novo Nordisk Studentship (2019-2020)

vii

List of Tables Table 1. Tissue specific functions of ZnT8...... 13

Table 2. Primer sequences for both PCR and qPCR……………………….…………………….……………………….….17

Table 3. PCR protocols for Ins2-Cre and ZnT8 ……………………….……………………….……………………….…….....18

Table 4. Preliminary validation of S961 injection schedule ……………………….……………………….……………21

viii

List of Figures Figure 1. The role of zinc in insulin processing, storage, and secretion...... 2

Figure 2. Location of Zips and ZnTs, as they pertain to the pancreatic β-cell ...... 4

Figure 3. Transmission electron microscopy images of pancreatic β-cells with and without a ZnT8 knockout...... 6

Figure 4. Breeding scheme to generate experimental mice of the F3 generation...... 16

Figure 5. PCR and qPCR expression of Ins2-Cre and ZnT8...... 25

Figure 6. Dithizone staining of islets...... 26

Figure 7. Validation of S961 on WT C57BL/6N mice...... 28

Figure 8. Acute S961 injections on C57BL/6N background mice...... 29

Figure 9. Fasting body weight and blood glucose of male and female mice, starting from weaning...... 30

Figure 10. OGTT – 2g/kg body weight glucose via oral gavage after overnight fast...... 31

Figure 11. S961 acute injection – i.p. injection of 30nmol/kg body weight S961 after 4 hr fast...... 32

Figure 13. Ex-vivo islet experiments...... 33

Abbreviations Arg Arginine BKO β-cell ZnT8 knockout cDNA Copy DNA Ctrl Control DMSO Dimethyl sulfoxide dNTP Deoxyribose nucleoside triphosphate ELISA Enzyme-linked immunosorbent assay FRET Förster resonance energy transfer GWAS Genome wide association study Het Heterozygous β-cell ZnT8 knockdown HTRF Homogeneous time resolved fluorescence i.p Intraperitoneal ISV Insulin secretory vesicle ITT Insulin tolerance test KRB Krebs ringer buffer OGTT Oral glucose tolerance test PCR Polymerase chain reaction qPCR Quantitative PCR RT-PCR Reverse Transcriptase PCR SNP Single nucleotide polymorphism T2D Type 2 diabetes mellitus Trp Tryptophan Zip Zrt/Irt-like proteins ZnT Zinc transporter

Chapter 1: Introduction Type 2 diabetes mellitus (T2D) is a chronic disease characterized by increased insulin resistance and impaired pancreatic β-cell function. Diabetes Canada estimates that the incidence of T2D will increase by 31% between 2019 and 2029 [1]. Given the rising prevalence of T2D and the strain it puts on the healthcare system, increased prevention and management of the disease is necessary. One such avenue of management may lie in zinc management.

1.1 Zinc Homeostasis

Zinc is an essential trace element, critical in a plethora of pathways in physiology. Numerous proteins rely on the presence of zinc, such as zinc finger proteins, and contribute to metabolism, signaling transduction, cell growth, and differentiation [2]. Zinc plays a role as enzyme cofactors and DNA binding in transcription factors, rendering it an indispensable part of normal physiology. Furthering the importance of zinc, it is found in all organs and tissues [2]. Zinc deficiencies can result in disruptions in growth, immune function, cognition, fertility, and metabolism [3]. Zinc deficiency can also play a role in diabetes [4].

1.1.1 Zinc in Diabetes

Since as early as 1938, physicians have known that zinc plays a role in T2D [4]. Through the examination of cadavers, it was found that pancreases from diabetic individuals exhibited much lower zinc levels than that of non-diabetic individuals [4]. Further evidence of the effect of zinc in T2D can be found through zinc supplementation, which has been shown to improve glycemic control in diabetic patients [5]. The highest concentration of zinc can be found in pancreatic β-cells, suggesting a critical role of zinc in β-cell function [6].

Indeed, zinc is involved in pancreatic β-cell function. Other than basic cellular roles of growth and differentiation, it is thought to be associated with insulin processing, storage, and secretion [7].

Zinc is involved from the proinsulin stage (Figure 1), although the location of first interaction is not yet confirmed. In as early as the endoplasmic reticulum stage, further along the secretory pathway in the Golgi, or even as far as in immature insulin secretory vesicles (ISVs) proinsulin binds to zinc to form hexamers [8, 9]. Once in ISVs, C-peptide is cleaved off proinsulin, resulting in insulin.

Insulin, still in hexameric form, then crystalizes due to its lower solubility compared to proinsulin hexamers, forming the dense core granules of ISVs. X-ray crystallography has shown that at physiological

1 concentrations, these hexamers are likely comprised of 2 zinc molecules that bind to 6 insulin molecules [10, 11]. However, at supraphysiological concentrations of zinc, there exist an insulin hexamer variant that is composed of 4 zinc molecules instead [10]. The different numbers of zinc may result in differences in the kinetics of disassociation but is unlikely to be found in the physiological state [10].

Figure 1. The role of zinc in insulin processing, storage, and secretion.

Nonetheless, either forms of crystallization of insulin should allow for the increased the storage capacity of insulin in the β-cell in the presence of zinc [11]. Insulin secretion occurs via exocytosis, whereby

ISVs membranes fuse to the plasma membrane to release insulin into the bloodstream. The denser the concentration of insulin, the more insulin that can be released through one fusion event. The higher extracellular pH allows insulin hexamers to dissociate, freeing insulin monomers and zinc ions [7, 11, 12]. Zinc is thusly co-secreted with insulin (along with C-peptide) [7, 11, 12].

1.1.1.1 Zinc Co-Secretion Influences

The co-secretion of zinc causes pulsatile localized increases in zinc concentration [13]. The increased zinc is thought to have signalling effects. Most notably, zinc signalling has been implicated in acting on β- cells, α-cell, and hepatocytes [13-20].

Zinc may provide negative feedback on β-cells from which they were secreted [14, 15]. This is likely to occur through opening of the ATP-sensitive potassium (KATP) channels [14, 15]. Activation of KATP channels hyperpolarizes the cell and prevents voltage gated calcium channel activation, thereby inhibiting insulin secretion [14]. This effect is not seen in basal levels of insulin secretion but is observed during high glucose stimulation of pancreatic islets, presumably due to higher levels of localized zinc [15]. During high insulin secretion of the high glucose state, β-cells will secrete zinc to negatively feedback on itself and prevent further insulin secretion.

Zinc can act locally on pancreatic α-cells [16]. With elevated zinc, rat pancreases [17] mouse islets [18, 19], and α-TC6 cells (a mouse α-cell cell line) [18], secreted less glucagon. Much like β-cells, α-cell can be inhibited via KATP channel activation resulting in cell hyperpolarization [14, 16]. Zinc may have also been transported into the cell for intracellular inhibition of glucagon secretion [18]. Locally increased zinc may increase the internalization of zinc due to non-specific calcium channels and zinc transporters to further activate KATP channels from the cytoplasmic side [20]. This is yet another mechanism by which zinc co- secretion may affect whole body glucose homeostasis.

Further from the β-cell, pulsatile increases of insulin and zinc co-secretion in the bloodstream are brought to the liver [13]. The liver is involved in insulin clearance. A study using HepG2, a human hepatic cell line, showed that increased zinc inhibited insulin uptake [13]. Especially since the liver has first pass of newly secreted insulin, the presence of co-secreted zinc that can inhibit hepatic insulin uptake can greatly affect circulating insulin levels and whole body glucose homeostasis [13].

Altogether, zinc clearly plays a role in diabetes. There are multiple avenues by which zinc may act, both internally, in standard β-cell, and externally once secreted, as a signaling molecule. Thus, looking into

the zinc transport and regulators, particularly in the β-cell, may provide insight onto T2D pathology and potential therapeutic targets.

Due to the importance for the proper distribution of zinc, it must be well regulated. This is achieved in large part via the transport of zinc through zinc transporters.

1.2 Zinc Transporters

Membrane bound proteins of two families of solute carriers – SLC39 family of Zrt/Irt-like proteins (ZIPs), and SLC30 family of zinc transporters (ZnTs) – are responsible for zinc influx and efflux to the cytoplasm respectively [2]. Balance between the activity of ZIPs and ZnTs is essential.

There are 14 ZIPs of the SLC39 family, numbered 1 through 14 [3]. These proteins transport zinc into the cytoplasm, whether it is from the extracellular space or intracellular organelles. Most (ZIPs 1-6, 8, 10, 14) are located on the plasma membrane [3]. Others localize to vesicles (ZIP1, ZIP13), lysosomes (ZIP3, ZIP8), Golgi apparatus (ZIP9, ZIP13) and the nucleus (ZIP7) [3]. These proteins generally have 8 transmembrane domains, with both N- and C- terminal domains on the extracellular side [3]. Other than zinc, these proteins generally transport iron, but may also transport other divalent metal ions, such as cadmium and may have the additional benefit of protecting cells from metal toxicity [3].

Figure 2. Location of Zips and ZnTs, as they pertain to the pancreatic β-cell

In mouse pancreatic islets, mRNAs of all known mammalian ZIPs have been detected [21]. More specifically, in murine and human primary pancreatic β-cells, the most commonly expressed ZIPs include

ZIP6 and ZIP7, located mostly on the plasma membrane and the ER (Figure 2) [21]. In the case of high glucose stimulation, pancreatic β-cells alter the expression pattern of expressed ZIPs. For example, ZIP6 and ZIP7 increase in mRNA expression [22]. Further, ZIP6 localizes more closely to cell membrane, suggesting increased translocation from the ER to the plasma membrane [23].

ZnTs, of the SLC30 family, are numbered from 1 to 10. These proteins are responsible for transporting zinc from the cytosol to the extracellular space, preventing zinc toxicity, or intracellular organelles, to store or for use in zinc-containing proteins [24]. Most have 6 transmembrane domains, with both terminal ends in the cytosol [24].

All 10 ZnTs have been detected in pancreatic islets [25]. Most commonly expressed in pancreatic β- cells are ZnT1 in the plasma membrane, ZnT5 in the Golgi apparatus and secretory vesicles, and ZnT7 on the Golgi apparatus [21, 26]. However, the most commonly expressed ZnT in the β-cell is ZnT8, expressed on the insulin secretory granule. ZnT8 is also most abundantly expressed in β-cells compared to other tissues, suggesting an important physiological role in β-cell function. Further, ZnT8 has been associated with diabetes risk making it an intriguing target for potential prevention or treatment strategies.

1.3 Zinc Transporter 8 (ZnT8) and Diabetes

ZnT8 is encoded by the gene SLC30A8 [27]. It has 6 transmembrane domains, with both the N- terminus and the C-terminus on the cytoplasmic domain [26]. Transport of zinc across the membrane is thought to be driven by zinc and proton antiport transport, as studied through homologous proteins [28].

Inside the β-cell, ZnT8 colocalizes to insulin and transports zinc into ISVs, increasing the likelihood of ZnT8 being critical in β-cell function [29]. With ZnT8 knockout, there is reduced β-cell zinc content [30- 33]. Some report that cytosolic zinc content is unaltered [30, 34], whereas others report reduced cytosolic zinc with reduced ZnT8 [31, 35]. Overall, ISVs, undoubtedly, have significantly lower granular zinc content in the absence of ZnT8 [33]. Conversely, overexpression of ZnT8 shows higher intracellular zinc as seen in INS-1E cells [29]. Knockout of ZnT8 shows greatly different morphology of ISVs in β-cells, observed most easily under electron microscopy [31, 32]. Transmission electron microscopy reveals that lack of ZnT8 reduces the frequency of dense core insulin granules in ISVs, as well increases the number of empty vesicles (Figure 3) [32]. These differences suggest that ZnT8 plays a role in providing zinc for the formation of dense core granules in ISVs. Since insulin crystallization with zinc is thought to improve insulin storage, assessments of insulin storage were done. There is both evidence that insulin storage is reduced in cells with shRNA-induced ZnT8 knockdown in INS-1 cells [36] as well as evidence that ZnT8 knockdown does

5 not affect islet insulin content [37]. Changes in ZnT8 activity nonetheless have potential to affect β-cell function or post-secretory effects through reduced ISV zinc levels.

Figure 3. Transmission electron microscopy images of pancreatic β-cells with and without a ZnT8 knockout. Scale bar 500nm, C57BL/6J mice, RIP-Cre and ZnT8loxP mice. ISVs in control mice are denser. There are more empty vesicles in ZnT8BKO vesicles, and more rod- shaped cores, for which an explanation has not yet been found. From Wijesekara (2010), used with permission [32].

On a larger, whole islet scale, dithizone staining can further reveal differences in islet zinc content due to ZnT8 knockouts. Dithizone is a zinc chelator, commonly used for quality control in islet transplantation. Dithizone staining, at low levels, has also been shown to have no effect on insulin secretion from live islets, suggesting preservation of islet health [38]. Upon binding to zinc in live islets, it will produce a deep red hue. Lack of dithizone staining can mean one of two things – cell death, or a decrease in intracellular zinc. The reduced staining and associated zinc levels are an indication of reduced ZnT8 activity in cells with ZnT8 knockout. Staining is reversible – upon removing islets from media with dithizone, islets will eventually lose their red hue [39]. Thus, dithizone entry into the cell is likely a continuous active transport. However, the mechanism of transport of dithizone is not well known.

1.3.1 GWAS studies of SLC30A8/ZnT8

Genome wide association studies (GWAS) have found polymorphisms in the SLC30A8 gene related to T2D risk. Several studies in different populations have independently found the same single nucleotide polymorphism (SNP), rs13266634, resulting in a p.Arp325Trp variation [40, 41, 42]. Carriers of the common Arg variant have a 1.12 to 1.18 fold higher risk of developing T2D compared to the lower risk Trp variant [40, 41, 42]. Individuals with two copies of the Arg variant have a further increased risk of T2D, up to 1.53 fold higher risk [40].

As of yet, it is unclear how the p.Arg325Trp polymorphism affects zinc transport. Several studies have investigated this effect with mixed results. The p.Arg325Trp polymorphism results in an alteration from

6 the more common arginine, a positively charged amino acid, into tryptophan, a non-polar amino acid, which can potentially affect zinc affinity [30]. Nicolson et. al found that, in both Ins-1 and Min6 mouse insulinoma cell lines, the arginine variant demonstrated reduced zinc transport [30]. Interestingly, it did not seem to affect glucose stimulated insulin secretion [30]. Further supporting this, Merriman and colleagues found that, when expressed in a human embryonic kidney cell line (HEK293), the arginine variant also had increased zinc transport activity [43]. However, contrary to this evidence, Kim et. al found that Ins-1E cells, when stressed with cyclosporin A, an insulin secretion suppressor, cells expressing the tryptophan variant secreted more insulin [44]. Yet another assessment done in oocytes, chosen for the easier manipulation of ion levels of the cells, demonstrated there was no evidence of altered zinc transport levels with either variant [45]. Further complicating the matter, there is a chance that ZnT8, like ZnT5, may be capable of bidirectional transport of zinc [46]. Thus, there is inconclusive evidence of the effect that the p.Arg325Trp variation has on zinc transport and, downstream from this, insulin secretion.

It is possible that the polymorphism has no effect on zinc transport. Through studying the E. coli ZnT8 homologue, Yiip, Fu et al. found that the residue 325 of the protein sits on the C-terminus cytoplasmic domain [47]. This residue is shielded from both conformational changes and substrate binding, and thus this group believes that the polymorphism should not affect zinc transport kinetics [48]. This may be the cause of all the contrasting results from different studies on the differences in zinc transport due to the polymorphisms.

Despite not knowing how transport mechanics are changed with the p.Arg325Trp polymorphism, the differences in overall glucose homeostasis has been examined. In a German population, the higher risk Arg variant is associated with reduced plasma insulin as assessed via an intravenous glucose tolerance test without any change in oral glucose tolerance test (OGTT) results [49]. Similarly, an Icelandic population and second German population demonstrated no changes in plasma insulin or blood glucose during OGTT [50]. Conflictingly, Dwivedi at al. found increased plasma insulin as studied in a Finnish population [34].

However, a study using a Japanese sample showed that the lack of change in plasma insulin may not be indicative of unchanged insulin secretion [13]. Although blood glucose and plasma insulin were similar between individuals with the Arg risk allele and without, C-peptide measurements revealed elevated levels in the carriers of the risk allele compared to those with the Trp variant without differences in insulin resistance [13]. This suggests that hepatic insulin clearance was affected by difference in ZnT8 activity. Aligned with this, during a test meal, Dwivedi and colleagues reported decreased plasma insulin levels in

7 carriers of p.Arg325, although plasma C-peptide, representing secretion, was unaffected [34]. From primary human islets, carriers of the low-risk Trp allele had increased KCl induced insulin secretion at high glucose (16.7mM) [34].

The risk allele may have additional effects on insulin processing. Kirchhoff et al. found that carriers of the risk allele had reduced proinsulin to insulin conversion, as assessed through OGTT [51]. Likewise, Dwivedi et al. found an increase in fasting proinsulin to insulin ratio in carriers of p.Arg325 [34]. Since zinc, possibly transported by ZnT8 into immature ISVs, is bound during the proinsulin stage, it is possible that the conversion of proinsulin to insulin has been affected.

Counterintuitively, though protective against T2D incidence, the lower risk Trp variant is associated with risk factors of T2D such as increased waist circumference and insulin resistance [49, 50]. There has been no conclusion as to why this is.

Overall, ZnT8 and its polymorphisms have been associated with diabetes risk. Thus, the role it plays in T2D progression can shed light onto preventative or treatment measures. Consequently, ZnT8 function has been further studied in animal models and in humans.

1.3.2 ZnT8 in Mice

In diabetic mouse models, there has been evidence of reduction in ZnT8 expression associated with worsened glucose tolerance [52]. Both db/db and Akita mouse models reflect this change [52]. To determine whether reduction in ZnT8 was part of the mechanism causing diabetic symptoms or the response to reduced glucose tolerance and better understand how ZnT8 and zinc affect glucose homeostasis and β-cell function, cell lines and mice models were created with altered ZnT8 activity. ZnT8 overexpression and knockout models were examined in vitro, using cell lines and islets; and in vivo, with global and tissue specific ZnT8 knockouts.

In cell lines, ZnT8 was overexpressed as well as knocked out. ZnT8 overexpression in rat insulinoma INS-1E cells increased high glucose stimulated insulin secretion and high intracellular zinc content [29]. These same ZnT8 overexpressing cells were also more resilient to cell death caused by zinc deficiency, as is often seen in T2D [29]. Also, in Ins1 cells, siRNA mediated ZnT8 knockout revealed increased intracellular insulin, but reduced secretion [53]. Other studies looking at the downregulation of ZnT8 via shRNA in the INS-1 cell line resulted in reduced cellular zinc uptake, decreased total insulin content, and reduced insulin secretion as a percentage of total insulin content [36]. In the mouse insulinoma Min6 cell line, siRNA ZnT8 knockdown also resulted in reduced intracellular zinc, although functional tests were unassessed [54].

In islets, siRNA mediated ZnT8 knockdown in islets from C57BL/6N male mice showed reduced glucose stimulated insulin secretion compared to baseline insulin secretion [54]. These islets, like the INS-1 cell line model, total intracellular insulin was unaffected [54]. Overall, it appears that in vitro tests of ZnT8 downregulation results in reduced β-cell glucose stimulated insulin secretion response, with mixed results on insulin storage.

In vivo results were a little more varied, but overall suggested deleterious effects of ZnT8 knockout on glucose homeostasis. Global ZnT8 knockout, via a CMV-Cre/LoxP system in C57BL/6J mice, displayed glucose intolerance on both normal and high-fat diet, with the latter more exacerbated [30]. Plasma insulin during glucose tolerance test was lower in ZnT8 knockout mice, despite a lack of changes in ex vivo islet glucose stimulated insulin secretion assays [30]. Another group, using the same model, found unchanged insulin secretion, glucose tolerance, and insulin secretion when mice were fed a chow diet [55]. When ZnT8 was knocked out with an SLC30A8 targeting vector in C57BL/6J mice crossed with 129SvEvBrd mice, on a normal diet, these mice had no evidence of glucose intolerance through intraperitoneal (i.p.) GTT [37]. Pancreatic islets isolated from these mice showed reduced insulin secretion, suggesting impaired islet function without significant impact on whole-body glucose homeostasis [37]. Improvements in insulin sensitivity or reduced glucagon secretion are potential sources of compensation [37].

In β-cell specific ZnT8 knockouts, Ins1-Cre/floxed ZnT8 C57BL/6N male mice displayed impaired glucose tolerance at the age of 10 weeks [31]. By the age of 14 weeks, no such differences were seen in glucose tolerance [31]. Further, no difference was seen in female mice [31]. Isolated islets from these mice showed no change in insulin secretion [31]. Using the Ins2-Cre/floxed ZnT8 C57BL/6N model, glucose tolerance was impaired in male mice compared to controls [32]. By looking at proinsulin to insulin ratios, this group surmised that insulin processing is likely impaired with reduced β-cell zinc [32]. Inducible β-cell ZnT8 knockout also resulted in the same changes in mice constant β-cell knockouts [33]. Compared to whole body knockouts, the β-cell specific ZnT8 knockout mice on high fat diet displayed a less severe phenotype, although trends of increased glucose intolerance, weight gain, and insulin resistance persisted [33].

Interestingly, isolated islets from these mice differed in trends; the global ZnT8 knockouts responded more vigorously to high glucose stimulation, whereas insulin secretion in islets from mice with β-cell specific ZnT8 knockouts was decreased compared to wildtypes [33].

In contrast, mice overexpression of ZnT8 resulted in improved glucose tolerance in female mice at 10 weeks and 14 weeks of age, though no changes were seen in males [31]. Plasma insulin was higher during glucose tolerance test [31]. Curiously, ex vivo islets from these mice displayed impaired insulin secretion response to glucose [31]. Since zinc co-secretion was elevated in these mice, Mitchell et. al suggested that blood glucose is affected by plasma zinc levels [31].

Loss of zinc co-secretion from the β-cell could also have downstream effects. Mice that were ZnT8 null had a higher C-peptide to insulin ratio than mice that had wildtype ZnT8 during a glucose tolerance test, suggesting increased liver clearance [13]. It was hypothesized that the loss of ZnT8 function resulted in reduced zinc co-secretion, leading to loss of hepatic insulin uptake inhibition [13]. In this way, loss of ZnT8 results in decreased circulating insulin, affecting whole body glucose homeostasis.

Pulsatile zinc co-secretion could locally affect both β-cells and α-cells through KATP channels. However, it is unlikely that the amount of zinc co-secreted with insulin is high enough to elicit a significant reduction in glucagon secretion [19].

Although the deleterious effects of ZnT8 knockout on glucose tolerance are not always consistent, depending on age, sex, genetic background, and diet, in murine models, there is no evidence thus far of ZnT8 knockout in mice being protective against T2D.

1.3.3 ZnT8 Controversy

Contrary to the generally deleterious or null effects of ZnT8 knockout in mice, ZnT8 loss of function in humans has been associated with reduced risk of T2D [56]. In a sample of about 150,000 individuals, mostly comprised of Finnish individuals, Flannick et al. found 345 individuals carrying 12 different rare loss-of-function truncation variants (as predicted through bioinformatics, two of which have been confirmed through lack of Western blot detection of ZnT8) collectively conferred a 65% reduced risk of T2D. This suggests that loss-of-function in the form of haploinsufficiency of ZnT8 is beneficial for glucose homeostasis in humans; in contrast, ZnT8 knockout in mice has been generally deleterious.

Further supporting the potentially beneficial effects of ZnT8 knockout in human models, a human pancreatic cell line, EndoC-βH1, with siRNA induced knockdown of ZnT8 demonstrated that reduced ZnT8 is associated with increased proinsulin processing (lower proinsulin to insulin ratio) and cell viability [34]. Further, cells with ZnT8 knockdown exhibited increased basal insulin secretion and high glucose insulin secretion compared to controls when challenged with diazoxide, a drug commonly used to treat low blood sugar and reduce insulin secretion [34].

One of the more common variants found by Flannick et al., p.Arg138X, has been further studied in the human population [34]. This group found that carriers of the truncated ZnT8 have greater proinsulin to insulin conversion during a test meal challenge, and higher insulin secretion in response to lower glucose during oral glucose tolerance tests [34]. Further comparisons of carriers of the p.Arg138X variant show that individuals have responses more similar to the p.Trp325 variants, which further suggests that the Trp variant results in a loss of function [34].

The inconsistent results between human and mice studies drove further studies in which mice were manipulated to express a truncated ZnT8 homologous to one of the truncation variations found by Flannick, p.Arg138X [56]. Mice ZnT8 was truncated at the same residue, resulting in a mouse p.Arg138X variation [57]. Mice were challenged with S961, an insulin receptor inhibitor, to determine functional differences in insulin secretion [57].

S961 is an insulin receptor antagonist [58]. It is a peptide, 43 amino acids long [58]. S961 is thought to inhibit insulin receptors by binding to insulin receptor dimers in two spots, holding it in the inactive conformation [59]. This rapid onset of insulin resistance has been used as a method to induce metabolic stress in animals in previous studies [34, 57]. S961 is generally administered through sub-cutaneous or intravenous injection [58]. Effects of injection are observed as early as 10 min post injection and up to 6 hrs post injection [58]. More consistent insulin resistance can be induced via mini-osmotic pumps, as seen in the mice with the p.Arg138X ZnT8.

With the p.Arg138X variation, truncated ZnT8 was not detectable via western blotting in experimental mice, although inhibition of proteasomes in HEK293 cells overexpressing the variant is evidence of a protein that can be expressed [57]. It then follows that the effects of the p.Arg138X variation should be similar to a knockout effect. However, this does not seem to be the case, as infusion of S961, an insulin receptor antagonist, in p.Arg138X expressing mice resulted in increased plasma insulin [57]. No changes were seen in plasma glucose compared to controls, which could be due to the dosage of S961 masking any effects of increased insulin [57].

The same p.Arg138X mouse model was used in more physiological states, whereby male mice on a high fat diet had increased insulin secretion and proinsulin processing compared to wildtype mice [34]. This study suggested that the p.Arg138X variation specifically may improve β-cell insulin secretion capacity. Curiously, increased insulin secretion during glucose tolerance test did not affect blood glucose, yet these p.Arg138X male mice had unchanged insulin tolerance compared to wildtype controls [34]. In

11 humans, carriers of this same truncation had improved insulin secretion during a test meal and OGTT [34]. In this regard, it seems that results from the mouse model has matched human models at last. However, it is unclear mechanistically how this model would be different from other whole-body knockout models of ZnT8. Expression of the p.Arg138X variant was not detectable without suppression of protein degradation [57]. Thus, this model should be extremely similar to other whole-body knockout models of ZnT8.

Looking further at the differences between murine and human models, rather than the specific truncation variations themselves, it is possible that the protective effect of ZnT8 loss-of-function is due to haploinsufficiency. To test this, CRISPR/Cas9 was used to knock out one allele of ZnT8 in the mouse insulinoma MIN6 β-cell line [60]. In these cells, mRNA expression of ZnT8 was reduced by 50%, suggesting haploinsufficiency [60]. Consequently, zinc content was reduced, without other metal concentrations changing [60]. ZnT8 haploinsufficiency resulted in reduced proliferation and Ins1 expression; no measurements of insulin secretion were taken [60]. Single allele knockout of ZnT8 was also assessed in vivo. During a GTT, whereas C57BL/6N mice that were ZnT8 null were significantly less glucose tolerant compared to wildtype ZnT8 control mice, mice that had a single ZnT8 allele did not have glucose tolerance that was significantly different from either controls or ZnT8 null mice [30]. Instead, these haploinsufficient mice had blood glucose that trended higher than controls but less than ZnT8 null mice [30]. This trend persisted in insulin secretion as well [30]. ZnT8 haploinsufficiency in this mice model does not seem to reflect the same protective effects of haploinsufficiency in ZnT8 that are seen in humans. Thus, the role of ZnT8 is still unknown and needs to be further examined.

1.3.4 Other functions of ZnT8

ZnT8 may have effects affecting zinc transport in tissues other than the pancreatic β-cell as well. Although initially thought to be a β-cell specific protein, ZnT8 expression has also been found in several other tissues. Those with the potential to affect glucose homeostasis include pancreatic α-cells [32], enteroendocrine cells [61], adipose tissues [62], and peripheral blood mononuclear cells [63].

In the α-cell, Wijesekara et. al found no differences in glucose tolerance with α-cell specific ZnT8 knockouts. Similarly, whole body ZnT8 knockout did not affect glucagon secretion [64]. However, this was studied in euglycemia or hyperglycemic conditions. Mice with α-cell specific ZnT8 overexpression impairs glucagon release and hypoglycemic response [65]. During hyperinsulinemic-hypoglycemic clamps, reduced glucose infusion as well as reduced glucagon release can be found in ZnT8 overexpressing mice,

12 suggesting a function for ZnT8 in regulating low blood glucose [65]. In vitro studies with islets show that low glucose glucagon secretion was reduced compared to control mice [65]. Thus, changes in ZnT8 activity may affect whole body glucose homeostasis via the glucagon regulation rather than insulin.

Table 1. Tissue specific functions of ZnT8

Tissue Function

Pancreatic β-cell Transport zinc into ISVs. Knockout in mice presumed to be deleterious for glucose homeostasis.

Pancreatic α-cell Overexpression impairs glucagon secretion during hypoglycemia. Knockout does not affect glucagon secretion.

Enteroendocrine Regulation of adiposity. Knockout of ZnT8 resulted in increased 5-HT secretion cell leading to increased adiposity.

Adipose cells Function and causal relation unclear, but higher levels of ZnT8 found in subcutaneous tissue compared to visceral tissue, and higher in leaner individuals.

Peripheral blood Affects inflammation. Carriers of the Arg325 variant were more susceptible to mononuclear inflammatory cytokine production in these cells compared to carriers of the Trp325 cells variant.

In the digestive tract, ZnT8 expression was found in enteroendocrine cells [61]. Whole body ZnT8 knockout shows that increased 5-HT levels lead to increased adiposity of the animals, without weight gain [61]. Increased adiposity likely arose from increased lipogenesis and lipid synthesis, as seen through increased expression of genes responsible for these activities [61]. Further, ZnT8 null mice were more susceptible to reduced glucose tolerance, as seen through OGTT, compared to controls [61]. IPGTT did not reveal the same differences, suggesting a role in the intestinal tract [61]. Increased adiposity itself has been shown to result in increased insulin resistance, but this was not seen in this mice model on a normal diet [61]. Through the altered 5-HT secretion, the digestive tract may affect whole body metabolism, leading to altered T2D risk.

ZnT8 expression has been detected in adipose tissue in humans, with variations depending on the location of adipocytes and the adiposity of the individual [62]. ZnT8 expression is higher in subcutaneous fat compared to visceral fat, and higher in lean individuals compared to obese individuals [62]. Although it is unclear whether loss of ZnT8 expression causes increased adiposity, mice with whole-body ZnT8

deficiency become more obese compared to mice with β-cell specific ZnT8 deficiency, also suggesting an association [30, 33]. Since obesity is a T2D risk factor, if changes in ZnT8 can affect adiposity, it may be another factor conflating the effect of ZnT8 knockout on T2D risk and progression.

In peripheral blood mononuclear cells, ZnT8 has been associated with inflammation [63]. The differences between the two ZnT8 polymorphisms previously found through GWAS studies (Arg325Trp) were studied in the context of inflammation [63]. The individuals carrying the Arg325 risk variant was found to have an increased intracellular zinc in their peripheral blood mononuclear cells and had increased inflammatory cytokine production compared to individuals with the Trp325 non-risk variant [63]. ZnT8 may act, in this case, to affect inflammation, thus resulting in increased risk in diabetes.

ZnT8, although largely expressed in pancreatic β-cells, is also expressed in other somatic tissues. Through comparison between β-cell specific ZnT8 knockout and whole-body ZnT8 knockouts, it is clear that ZnT8 in other tissues collectively does have an effect [33]. Thus, the role of ZnT8 in β-cells specifically needs to be further examined in order to better understand the physiological role of ZnT8.

1.4 Rationale

Since ZnT8 is expressed in several tissues other than pancreatic β-cells, a β-cell specific ZnT8 knockdown model will be able to better identify the role of ZnT8 on β-cell function and insulin secretion. Further, the differences in expression levels and activity of ZnT8 in the β-cell may have important physiological or pathophysiological consequences, as suggested in haploinsufficiency in humans [56] as well as ZnT8 overexpression and knockout in mice [31]. The mouse model used will also compare the differences between a β-cell specific homozygous knockout as compared to a heterozygous knockout model resulting in one functional allele of ZnT8.

Previous studies have looked at β-cell specific knockout model [32] or a global haploinsufficiency model [30], but not both. Our proposed model will combine these two effects, looking at β-cell specific homozygous or heterozygous ZnT8 knockdown to determine the role of ZnT8 in β-cell function.

1.4.1 Hypothesis

I hypothesize that, compared to Ins2-Cre positive controls, β-cell specific ZnT8 knockout will have reduced β-cell ZnT8 activity and impaired insulin secretion. Further, I hypothesize that heterozygous deletion of ZnT8 specifically in β-cells will lead to reduced ZnT8 activity and a milder form of β-cell dysfunction. Under conditions where β-cell function is acutely stressed by chemically-induced insulin

14 resistance, knockout or reduced ZnT8 expression specifically in β-cells (homozygous and heterozygous deletion respectively), will not be protective of impaired glucose homeostasis.

1.4.2 Objectives

The aim of this study is to determine whether β-cell specific ZnT8 knockdown or knockout associated with reduced or absent ZnT8 activity in β-cells affects glucose homeostasis under normal conditions and those associated with acute insulin resistance known to cause defects in glucose homeostasis (hyperglycemia).

Chapter 2: Methods 2.1 Model Generation

The Cre-lox recombination system was used to generate β-cell specific heterozygous ZnT8 knockdown and homozygous ZnT8 knockout mice. Cre was expressed with the Ins2 promoter (Ins2-Cre), and ZnT8 was floxed, excising exon 1, thereby removing the start codon. Ins2-Cre positive mice were used as controls (Ctrl), Ins2-Cre ZnT8fl/WT mice were the heterozygous β-cell knockdowns (Het), and Ins2-Cre ZnT8fl/fl mice were homozygous β-cell knockouts (BKO).

Figure 4. Breeding scheme to generate experimental mice of the F3 generation. Experimental mice are highlighted in the red box. Control mice (Ctrl) are Ins2-Cre positive with wildtype ZnT8. Mice heterozygous for β-cell ZnT8 (Het) have Ins2-Cre and one allele each of floxed and wildtype ZnT8. β-cell knockout mice (BKO) have Ins2-Cre and two floxed ZnT8 alleles.

To generate the necessary mice, Ins2-Cre positive mice were bred with ZnT8 floxed mice, all on a C57BL/6N background. The breeding scheme can be found in figure 4. Only BKO mice (Ins2-Cre ZnT8fl/fl) were previously present in the lab. Thus, to have proper Ins2-Cre positive mice as controls, these mice

were back-crossed to wildtype C57BL/6N mice to form the F1 generation of mice. These mice were all of

fl/WT the Het genotype (Ins2-Cre ZnT8 ). Mice from the F1 generation were crossed together, which resulted in mice that were either Ins2-Cre positive or negative, and had either ZnT8WT/WT, ZnT8fl/WT, ZnT8fl/fl for the

F2 generation. Since the PCR detection of Ins2-Cre is not sensitive to whether the mice had Ins2-Cre on

16 one allele or two alleles, one more generation had to be produced to ensure that Ins2-Cre was only present on one allele – a precaution to mitigate the effects of potential disruptions in other genes due to Cre insertion – despite the presence of all the desired genotypes. An Ins2-Cre ZnT8fl/WT mouse was crossed

flWT with a ZnT8 mouse to produce the F3 generation that was used for all experiments, guaranteeing Ins2- Cre hemizygosity.

2.1.1 PCR

Tail samples were obtained from mice prior to weaning. To extract DNA, tail clippings were first submerged in 100uL of extraction solution (Sigma – E7526) and 25uL of tissue preparation solution (Sigma – T3073). The samples were incubated at room temperature for 10 minutes, after which they were transferred to a heat block at 93°C for 3 minutes. 100uL of neutralization solution B (Sigma – N3819) was added to the mixture and mixed well.

Table 2. Primer sequences for both PCR and qPCR.

PCR primers

Gene Forward primer (5’-) Reverse primer (5’-)

Ins-2 GGCAGTAAAAACTATCCAGCAA GTTATAAGCAATCCCCAGAAATG Cre

ZnT8 AGTTATTGACTGAACACACCTATCTTATGTCCTGC GCTATATACTCTTCCACTCAGCTACATCGCTACC qPCR primers

Gene Forward primer (5’-) Reverse primer (5’-)

Ins-2 GGCAGTAAAAACTATCCAGCAA GTTATAAGCAATCCCCAGAAATG Cre

ZnT8 AGTTATTGACTGAACACACCTATCTTATGTCCTGC GCTATATACTCTTCCACTCAGCTACATCGCTACC

β-actin CTGAATGGCCCAGGTCTGA CCCTGGCTGCCTCAACAC

Extracted DNA samples underwent conventional polymerase chain reaction (PCR) to determine the presence of Ins2-Cre and floxed ZnT8. PCR reactions were completed with REDTaq® ReadyMix™ (Sigma – R2523). A master mix was created, with 5 parts REDTaq ReadyMix, 2.5 parts ultra pure water, and 0.8

parts each of forward and reverse primers. Primer sequences for Ins2-Cre and ZnT8 are listed in Table 2. 9uL of the master mix was added to each reaction tube. 1uL of sample was added to the reaction tubes. Reaction tubes were loaded onto an Alpha Unit Block Assembly on which DNA amplification programs suitable for the genes in question were run. The protocol is listed in Table 3.

Table 3. PCR protocols for Ins2-Cre and ZnT8

Ins2-Cre PCR protocol ZnT8 PCR protocol

95°C for 5 min 94°C for 2 min

35 cycles of: 95°C for 30 sec 30 cycles of: 94°C for 30 sec 59°C for 30 sec 62°C for 30 sec 72°C for 2 min 15 sec 68°C for 4 min

72°C for 10 min 68°C for 7 min

Once PCR reactions were complete, samples were loaded onto 1.2% agarose gel with RedSafe (FroggaBio – 21141) with a DNA ladder (Thermofisher – SM1333) and run at 100V. Samples were run until the red dye from RedTaq was past the halfway point of the gel. Gels were imaged on a Kodak Image Station (4000MM PRO). Images were exposed with multi-wavelength light for 60 seconds.

2.2 Islet Isolation

Intact, functional islets are necessary for several experiments. For model validation, islets are necessary for both dithizone staining and qPCR. Further, live, healthy islets are necessary for GSIS.

To achieve this, the pancreas was perfused in situ via the common bile duct with collagenase (0.5mg/mL). First, the common bile duct is sutured shut just before the ampulla of vater to prevent flow through the common bile duct into the small intestine. Then, a 30G needle is inserted into the common bile duct in the direction from the liver to the small intestine. 3mL of collagenase is then injected slowly into the pancreas until it is fully perfused. The pancreas is extracted from the body and submerged in 5mL collagenase in a 50mL falcon tube. Pancreases are incubated in a hot water bath at 37°C for 9-14 minutes, depending on the quality of the perfusion. The pancreases are shaken and visually inspected to confirm digestion. Digestion is stopped with 45mL of RPMI media (Sigma – R8758) with 10% new-born calf serum.

Islets are isolated from pancreatic digests under a dissection scope. Islets, identifiable by their rounded and brighter appearance under the dissection scope, are hand picked with a pipette and

transferred into fresh media three times to wash them of debris. Islets are allowed to rest and recover overnight in RPMI media with 10% FBS and 100 units/mL P/S (Penicillin and streptomycin) in an incubator

set to 37°C, 5% CO2.

2.3 Knockdown Detection

2.3.1 qPCR

Real-time, or quantitative PCR (qPCR) was performed to determine the expression levels of Ins2-Cre and ZnT8. Both the hypothalamus and the islets will be used. Since there has been evidence of Ins2-Cre in the hypothalamus [66], we wanted to determine whether the expression levels of Ins2-Cre in the hypothalamus is comparable to that of islets, and whether ZnT8 expression is affected in the hypothalamus. Islet isolation was described in section 2.2.

RNA extraction was performed with the RNeasy Plus Mini Kit (Qiagen – 74134), as per manufacturer’s instructions. RNA concentration was measured on the Nanodrop machine.

RNA then underwent reverse transcription PCR (RT-PCR) to obtain cDNA. First, a 1:1 mix of oligo(dT) and dNTP was created by added equal parts oligo(dT) (Invitrogen – 18418012) and dNTPs. 2uL of this mix is added to each reaction tube. Up to 5ug of RNA is added to their respective reaction tubes, for a total of 8uL of reaction. The reaction tubes are spun down and placed on a PCR machine for 10min at 70°C. While waiting for the 10min, a reverse transcriptase mix is made with 1:2:7 ratio of reverse transcriptase, reverse

transcriptase buffer, and UP H2O.

After 10 minutes, the reaction tubes were put on ice for 1min. 10uL of the reverse transcriptase mix is added to each reaction tube and centrifuged. Tubes were placed back in the PCR machine and the protocol is allowed continue. Resultant cDNA is stored at -20°C until use for qPCR.

To perform qPCR with a standard curve, cDNA prepared with universal mouse RNA with the protocol

stated above. A 1:4 serial dilution was performed by adding UP H2O. Each sample was diluted to a

maximum of 7.5 ug/uL of cDNA by adding UP H2O. (cDNA concentration is generally regarded as mass of RNA added/20uL.) A SYBR green primer mix was made by adding UP H2O, SYBR green (Applied Biosystems – 4367659), and forward and reverse primers (Table 2) such that the final volume in each well is 3.3uL H2O, 2.5uL SYBR, and 0.2uL forward and reverse primers.

Each serial dilution of the standard curve and sample were run in triplicate for each set of primers. 4uL of the serial dilutions and diluted samples were added to their respective wells. Each set of primers

received one row of the reaction plate. 6uL of SYBR green primer mix was added to their respective rows. The plate was covered and centrifuged for 2min at 1000 RPM. The plate was inserted into the qPCR machine and the standard SYBR green protocol with a relative standard curve was run with the Quantstudio Flex7 program. Resultant data was normalized to β-actin as a loading control. Fold-change, as compared to Ins2-Cre negative samples and Control samples for Cre and ZnT8 mRNA expression

respectively, was calculated by using Δ∆Ct.

2.3.2 Dithizone staining

To prepare dithizone, 40mg of dithizone is dissolved in 20mL dimethyl sulfoxide (DMSO). The mixture is vortexed for 3 to 4 minutes. Immediately, 5mL of the solution is diluted into 45mL of calcium and magnesium free PBS (Gibco – 14190-144). This mixture is filtered through a 0.4um nylon filter and is used as the working solution. The working solution undergoes a further 1:10 dilution to stain islets live islets, as obtained through islet isolation (Section 2.2).

Islets were transferred into 12 well plates with dithizone and incubated for 3 min at room temperature, and immediately imaged using a Leica microscope.

Bright-field images taken with the microscope were then analysed through HALO (Indica Labs). A spherical mask was applied to select islet area. Islet area is then analyzed for total area that is stained – strong, moderate, and weak – as well as unstained. Classification of stain intensity was determined via thresholding of OD.

2.4 Validation of S961

While waiting for mice to breed, initial tests of acute S961 function were performed to assess effectivity. S961 insulin receptor inhibitor was received as a lyophilized powder. It was dissolved using calcium and magnesium free PBS to a concentration of 2mM for storage. This solution was further dissolved to 7.5nM for injection.

2.4.1 Daily S961 injection

First, only wild type C57BL/6N mice were used. These mice were injected daily and monitored for blood glucose and insulin changes. The schedule of injections and other tests are listed in Table 4. I.p. injections of 30nmol/kg body weight were in administered once a day at the end of the day unless otherwise indicated. Fasted and non-fasted blood glucose and insulin before injection were compared between S961 and PBS control injected mice. Additionally, blood glucose was tracked for up to 6 hr after

20 a morning injection rather than an afternoon injection on day 9, and an i.p. insulin tolerance test (ITT) was administered on day 15. Blood glucose for this, and all other experiments, were measured with a glucometer (Contour – 7391).

Table 4. Preliminary validation of S961 injection schedule

Day Procedures

0 4hr fast for fasting blood glucose and fasting insulin

End fast at the same time as daily injections

1 Injections start

Collect blood glucose at times 0, 10min, 30min, 60min post injection

7 Collect blood for random plasma insulin before injection

Collect blood glucose at times 0, 10min, 30min, 60min post injection

8 No injections – allow to start day 9 without S961 interference from previous day

9 Injected in the morning – to allow for completion of blood collection during the light cycle. Collect blood glucose at times 0, 1hr, 2hr, 4hr, 6hr post injection

14 Collect blood for random plasma insulin before injection

15 Insulin Tolerance Test (Start at 12am)

26 Random blood glucose before injection

27 Sacrifice after 4 hour fast

Fasting blood glucose, fasting insulin

No injection

Insulin tolerance tests started with a 4 hr fast for the mice. Then, baseline measurements of blood glucose were taken. An i.p. injection of insulin (1IU/kg) was administered. Blood glucose was monitored from the tail vein every 15 minutes for 2 hours.

2.4.2 Acute S961 Injection Challenge

Acute effects of single S961 injections of 30nmol/kg body weight were assessed in mice of the F1 or F2 generation. These mice were compared to wildtype C57BL/6N for the time being, prior to true Ins2- Cre ZnT8WT/WT control mice being available.

After a 4 hour fast, mice were given i.p. injections of 30nmol/kg body weight of S961. Blood glucose was measured every hour via tail vein until blood glucose returned to those injected with PBS (5 hours for males, 4 hours for females). Blood samples for plasma insulin was collected in an EDTA coated microcuvette (Sarstedtstr – 16.444.100) at baseline, peak, and end times. For some of the batches, blood glucose was sampled at 1.5h in to determine whether there was a higher peak between the 1hr and 2hr times.

2.5 In vivo experiments

From weaning, every two weeks, mice body weight and blood glucose measurements were taken. Mice were fasted for 4 hours, after which body weight was taken by placing mice in a box on top of a scale. Blood from the tail vein was taken for blood glucose.

2.5.1 Oral Glucose Tolerance Tests

OGTTs were conducted in mice 8 weeks after weaning (at the age of 12-14 weeks). Mice were fasted overnight (12-17 hours) and gavaged with 2g/kg body weight of glucose. Blood glucose was measured at 0 min, 10 min, 30 min, 60 min, 90 min, and 120 min after gavage.

Blood was collected at 0 min, 10 min, 30 min in an EDTA coated microcuvette for plasma insulin measurements. Blood was spun down at 10 000rpm for 10 minutes to separate plasma. Plasma was stored at -80°C until analysis using an enzyme-linked immunosorbent assay (ELISA).

ELISA was performed according to the Mouse Ultrasensitive Insulin ELISA kit (80-INSMSU-E01) from ALPCO, using 10uL of sample rather than the suggested 5uL. The absorbance of the final plate was read on a Pherastar machine (BMG Labtech) at 450 nm.

2.5.2 Acute S961 Challenge

An acute S961 challenge, as outlined before (section 2.4.2), was administered to both male and female experimental mice (Ctrl, Het, BKO). To maintain consistency, all mice were monitored hourly for 5 hours post injection for blood glucose. Blood was collected at 0 hr, 2 hr, and 5 hr for plasma insulin and plasma

C-peptide levels. Blood collection and insulin ELISA was completed the same way as for OGTTs (section 2.3.1). 2 hr and 5hr plasma had to be diluted with the 0 Standard 10-fold and 5-fold respectively. C-peptide was analyzed via C-peptide ELISA (ALPCO – 80-CPTMS-E01) according to manufacturer’s instructions, again using 10uL of sample rather than 5uL. The 2 hr and 5 hr plasma samples were diluted 5-fold with the 0 Standard.

2.6 Ex Vivo Experiments

Ex vivo islet experiments required the harvesting of intact mouse pancreatic islets as outlined in section 2.2.

2.6.1 Glucose Stimulated Insulin Secretion

Islets were transferred from RPMI+FBS media into 2.8mM glucose Krebs Ringer Buffer (KRB) and incubated for 1 hr to equilibrate. The media was replaced with fresh 2.8mM KRB buffer, and islets were incubated for 20 min. This buffer was saved and analyzed later for low glucose insulin secretion. High glucose (16.7mM glucose KRB) stimulated insulin secretion and KCL induced insulin (16.7mM glucose, 30mM KCl) secretion were sequentially assessed the same way.

2.6.2 Total Islet Insulin

Finally, total islet insulin was extracted via acid-ethanol cell lyses. Islets were lysed overnight in acid- ethanol. Lysed cells were dried via speed vac. Ultra pure water was added to each sample, vortexed, then heated at 65°C for 10 min to ensure that insulin was properly dissolved. Samples were spun down for 10 min at 10 000 rpm to pellet cell debris at the bottom and the supernatant was collected to analyze total insulin content as well as DNA content (via Nanospec).

2.6.3 Insulin Concentration Measurements

Insulin concentration in each GSIS and total insulin sample was assessed via homogenous time resolved fluorescence microscopy (HTRF) (Cisbio, 62IN2PEG), a technique based on Forester Resonance Energy Transfer (FRET). Insulin samples are loaded into a 384-well plate (Greiner Bio – 784075) along with a serial dilution standard curve. Dilutions (10-fold, 20-fold, 40-fold, and 4000-fold respectively for low glucose, high glucose, KCl induced, and total insulin respectively) with KRB are necessary for the sample insulin concentrations to fall on the standard curve. Cryptate – the antibody donor, and XL655 – the antibody acceptor are loaded into each well and incubated for 3-24 hr. These antibodies sandwich insulin,

and when in proximity afforded by the binding of insulin, the donor excites the acceptor for a time delayed fluorescence signal that is read by a Pherastar machine (BMG – Labtech).

2.7 Statistical Analysis

Two-way ANOVA was used to analyze all dithizone, blood glucose, and insulin data. Results from qPCR

data was calculated as ∆ΔCt. Values are displayed as means + SEM.

Chapter 3: Results 3.1 Model Confirmation

3.1.1 PCR

PCR amplification of Ins2-Cre provides a band at 250 BP, which can be found in figure 5A. In the absence of Ins2-Cre, no band will be found. Amplification of ZnT8 results in the possibility of two bands. The first, at 354 BP, is the amplification of wildtype ZnT8. The presence of a single band at this weight indicates a mouse that has only wildtype ZnT8. The second, higher band, at 484 BP, is the amplification of floxed ZnT8. The presence of a single band at this weight indicates a mouse that has only floxed ZnT8. The presence of two bands suggests a heterozygous mouse with one wildtype and one floxed ZnT8.

3.1.2 qPCR

Ins2-Cre expression can be found in the hypothalamus (Figure 5B). However, expression levels in the hypothalamus are significantly lower than that in the islets. Furthermore, expression levels of ZnT8 in FigureFigure 55. .PCR PCR and andqPCR expression qPCR expression of Ins2- Cre of and Ins2 ZnT8.-Cre and s (A) Conventional PCR. Left: Ins2-Cre is 250bp. The lack of a band the hypothalamus are not significantly indicates that the mouse is Ins2-Cre negative. Right: ZnT8 can be found in the wildtype form at 354bp. The floxed allele is 484bp long, and is the different between the genotypes. Thus, higher band on the gel. A mouse that is heterozygous (het) has two bands: one floxed and one wildtype allele. (E) qPCR of Ins2-Cre in islets there is very little effect of Ins2-Cre and the hypothalamus (n=2) **Will be repeating these (F) qPCR of ZnT8 in islets and the hypothalamus(n=2) **Will also be repeating these expression in affecting expression of ZnT8 *P<0.05 Hypothalamus Cre vs Islet Cre, ***P<0.001 Hypothalamus in the hypothalamus. ZnT8 vs Islet ZnT8, §P<0.05 vs Ctrl

Ins2-Cre expression in islets is not significantly different between the genotypes. Ins2-Cre detection was several thousand-fold higher in all the Ins2-Cre positive islets, and in comparison, barely present in the hypothalamus (Figure 5B).

ZnT8 expression has no significant difference either but needs to be reassessed. However, the reduction in ZnT8 activity may be seen more clearly through dithizone staining.

3.2.3 Dithizone staining

Visual inspection of brightfield images of dithizone stained live islets revealed slightly reduced stain intensity in ZnT8 heterozygous (Het) islets and further reduced staining in β-cell knockout (BKO) islets compared to Ins2-Cre positive controls (Ctrl) (Figure 6A). Images of unstained islets can be found in figure 6B. Halo analysis – through which subjectivity is removed by quantifying stain intensity via optical density

Figure 6. Dithizone6. stainingDithizone of islets. staining of islets. thresholding – reflects this reduction (A) staining of Ins2-Cre controls (Ctrl), ZnT8 heterozygous (Het), and β-cell knockout (BKO) islets respectively. (B) Unstained Ctrl, Het, and through significantly reduced area that has BKO islets (C) Stain intensity areas of dithizone stained islets (Ctrl - n=4, Het - n=7, BKO - n=5) § P<0.05 vs Ctrl been stained strongly dark red compared to Ctrl mice (Figure 6C). This reflects a reduction in zinc inside the islet. There are no significant other differences in the proportional area of strong, moderate, or weak stains between Ctrl and Het islets; however, there is still a trend of reduced staining. This trend may reflect a decrease in zinc in the islets, resulting from reduced ZnT8 activity. There is significantly reduced staining in strongly stained area between Ctrl and BKO islets, indicating a definitive reduction in intracellular zinc. Since ZnT8 is only reduced and knocked out of the β-cells specifically, some

ZnT8 activity will prevail in other cells, such as α-cells, rendering these islets unevenly but persistently stained.

3.2 S961 Validation

3.2.1 Daily S961 Injections

Pilot studies to better understand the effects of S961 using wildtype C57BL/6N mice showed that i.p. injections of 30nmol/kg body weight S961 resulted in increased blood glucose compared to PBS injected controls. Blood glucose rises were evident as early as 30 min after injection (Figure 7A). This rise was similar between the first day and the 7th day of injection. Monitoring blood glucose for longer (Figure 7B) shows that blood glucose reaches its peak approximately 2 hours post injection, after which blood glucose drops, likely resulting from the clearance of S961. In the unfasted state, mice return to normal glycemia around 6 hours post injection.

Measurement of blood glucose prior to injections each day, ~24 hours after the last injection, show that S961 injected mice and PBS injected mice have similar blood glucose. This is consistent both in the fasted and non-fasted state (Figure 7C,D). Insulin in both the fasted and unfasted states were also not significantly different between PBS and S961 injected groups as measured on different days prior to injection as well (Figure 7E,F).

An i.p.ITT was performed on these wildtype mice to determine whether insulin sensitivity is consistently altered. Over 24 hours after S961 injection, insulin sensitivity was not different between control and S961 injected mice (Figure 7G).

3.2.2 Acute S961 Challenge Validation

In order to have a better idea of the time points that would be appropriate to measure the maximal effects of a S961 injection, preliminary studies of acute S961 challenges were conducted using mice of the

F2 generation (as this was done during the time it took to breed the F3 generation experimental mice). For this section as well, before Ins2-Cre positive control mice were available, true wild-type mice were used as an approximation of controls.

After a 4 hour fast, i.p. injection of S961 resulted in significant hyperglycemia regardless of mouse genotype (Figure 8A,C). Mice returned to normoglycemia after 5 hours and 3 hours for male and female mice respectively (Figure 8A,C). Plasma insulin was measured at baseline, blood glucose peak, and at the

FigureFigure 7.. ValidationValidation of of S961 S961 on onWT WT C57BL/6N C57BL/6N mice. mice . (A) Blood glucose monitored over 1 hr post injection on two days. (B) Blood glucose monitored over 6 hours post injection. (C) Pre-injection blood glucose in the fasted state. (D) Pre-injection blood glucose unfasted. (E) Pre-injection plasma insulin, in the fasted state. (F) Pre-injection plasma insulin, in the non-fasted (G) i.p. ITT after S961 had 24 hours to clear from the system.

Figure 8. Acute S961 injections on C57BL/6N background mice. WT included are true wildtypes and do not serve as true controls but a rough point of reference to see whether we can expect similar responses in control mice. HET refers to mice that are Ins2-Cre positive and ZnT8fl/WT BKO mice are Ins2-Cre positive and ZnT8fl/fl. After a 4 hour fast, male and female mice were subjected to 30nmol/kg body weight dose of S961. Blood glucose and insulin were monitored for up to 5 hours. Female mice were monitored for 4 hours after injection, at which point blood glucose has returned to levels comparable to vehicle control mice. (A) Male mice blood glucose (B) Male mice plasma insulin (C) Female mice blood (D) Female mice plasma insulin. §P<0.05 S961 Het and BKO vs PBS control of the respective genotype, §§§P<0.001 S961 vs PBS control of the respective genotype, *P<0.05 vs BKO - S961, **P<0.01 vs BKO - S961, ****P<0.0001 vs BKO - S961, $$$$P<0.0001 vs WT - S961 end of the observation period. Plasma insulin was significantly increased 2 hours post-injection with S961 injection compared to PBS control (Figure 8B,D). Additionally, in males, there was a significant difference between WT and F2 generation BKO mice injected with S961. In females, all three genotypes were significantly different from one another in plasma insulin at the 2 hr mark. These method validation studies with close approximations of the desired genotypes for the rest of the study show that S961 produces effects of similar timing between the different groups, regardless of genotype. Further, this data shows that the 1.5 hr and 2 hr blood glucose values are not significantly different. As such, it would be preferred to stress the mice out fewer times and collect all samples at the same time, rather than increase the sampling frequency for female mice alone. Thus, it is a viable acute challenge that will induce metabolic stress and reveal potential differences in glucose homeostasis.

Figure 9. Fasting body weight and blood glucose of male and female mice, starting from weaning.10 (A) Male 4hr fasted body weight (Ctrl: n=8, Het: n=13, BKO: n=4) (B) Female 4hr fasted body weight (Ctrl: n=4, Het: n=11, BKO: n=5) (C) Male 4hr fasted blood glucose (Ctrl: n=8, Het: n=13, BKO: n=4) (D) Female 4hr fasted blood glucose (Ctrl: n=4, Het: n=11, BKO: n=5) (E) Male fasting plasma insulin at 8-10 weeks after weaning (Ctrl: n=7, Het: n=8, BKO: n=4) (F) Male 4hr fasting C- peptide at 8-10 weeks after weaning (Ctrl: n=4, Het: n=4, BKO: n=4) *P<0.05 vs BKO, **P<0.01 vs BKO 3.3 In vivo data

For a broad view of how ZnT8 may affect development, body weight and blood glucose was measured every two weeks. There was no difference in body weight of the Het or BKO mice compared to controls

30 when fed a normal rodent chow diet (Figure 9A,B). In male mice, blood glucose was not different between groups (Figure 9C). In female mice, blood glucose varied slightly at 2 weeks and 6 weeks after weaning in BKO mice compared to Het and Ctrl mice (Figure 9D). Fasting plasma insulin and C-peptide were not significantly different as measured in male mice (Figure 9E,F).

3.3.1 OGTT

OGTT revealed no differences in blood glucose between all three groups of both sexes, although there is a trend for higher blood glucose in females (Figure 10A,B). Plasma insulin of male mice also revealed no significant differences between all three groups (Figure 10C).

Figure 11. OGTT – 2g/kg body weight glucose via oral gavage after overnight fast. (A) Blood glucose of males (Ctrl: n=7, Het: n=12, BKO: n=6) (B) Blood glucose of females (Ctrl: n=4, Het: n=6, BKO: n=6) (C) Plasma insulin of males (Ctrl: n=7, Het: n=10, BKO: n=5)

3.3.2 S961

S961 revealed no difference in blood glucose or plasma insulin in male mice (Figure 11A,C). C-peptide measurement also revealed no significant differences, indicating no differences in insulin secretion (Figure 11D). Blood glucose of female mice showed only a difference 1 hr post-injection, in which the Het mice had higher blood glucose than that of controls (Figure 11B). However, this difference was not sustained throughout.

Figure 12. S961 acute injection – i.p. injection of 30nmol/kg body weight S961 after 4 hr fast. (A) Blood glucose of males (Ctrl: n=9, Het: n=13, BKO: n=6) (B) Blood glucose of females (Ctrl: n=4, Het: n=10, BKO: n=7) (C) Plasma insulin of males (Ctrl: n=7, Het: n=8, BKO: n=4) (D) Plasma C-peptide of males (Ctrl: n=4, Het: n=4, BKO: n=4) *P<0.05 vs Ctrl 3.4 Ex vivo data

GSIS results show that there is no difference in ex vivo islet function in male mice with ZnT8 manipulation. Neither low glucose (2.8mM glucose) or high glucose (16.7mM glucose) stimulated insulin secretion are different between groups (Figure 12A). Further, KCl induced insulin secretion is also not significantly affected (Figure 12B). Total islet insulin is also consistent between groups (Figure 12C).

Figure 13. Ex-vivo islet experiments. (A) Glucose stimulated insulin secretion. Low glucose and high glucose (2.8mmol and 16.7nmmol respectively) (B) KCl induced insulin secretion (C) Total islet insulin

Ctrl: n=4, Het: n=7, BKO: n=2

Chapter 4: Discussion Through backcrossing Ins2-Cre positive ZnT8fl/fl mice with wildtype C57BL/6N mice, we were able to obtain reduced islet zinc content in BKO mice compared the Ctrl mice, as seen through dithizone staining – both evident visually through brightfield microscopy and semi-quantitatively through Halo analysis. Dithizone staining of Het islets is not exactly halfway between that of Ctrl and BKO mice, as the genotype might suggest, possibly due to regulatory compensation of the one allele. Through qPCR analysis, there was no differences in ZnT8 islet mRNA between the genotypes. However, indirectly, dithizone staining revealed decreased islet zinc suggesting lowered zinc transport activity assumed to be due to reduced ZnT8 activity. Due to α-cell expression of ZnT8, our model with β-cell specific ZnT8 knockdown will always result in some ZnT8 expression in whole islets. Consequently, dithizone staining of BKO islets will result in some staining, in contrast to the unstained islets due to global ZnT8 inactivity [57]. qPCR reduction of ZnT8 in whole islets is also limited in this way. To better look at changes of ZnT8 expression, Western blots to assess protein expression directly would be preferable. However, there are currently no good antibodies for ZnT8.

Preliminary data shows that S961 i.p. injections increased blood glucose, with insulin rising in compensation. Blood glucose rises for up to 2 hr, after which it normalizes within 4 or 5 hr. In contrast, PBS vehicle injected mice did not display any changes in blood glucose or plasma insulin from baseline to the time S961 injected mice had normalized. These preliminary results provided a timeline suitable for all mice, wild-type mice to BKO, both male and female.

In general, under unstressed baseline physiological conditions, there is no discernable difference in body weight or fasting blood glucose between the different genotypes. Further in vivo acute tests of glucose regulation, namely OGTT and S961 acute challenges also revealed no significant differences in blood glucose between male Ctrl, Het, and BKO mice. Only mild differences were seen in female blood glucose. Circulating plasma insulin in male mice showed no differences. C-peptide analysis in male mice also showed a lack of differences in insulin secretion. Because of the lack of insulin and C-peptide data for female mice, there was no way to determine underlying causes for the changes in female blood glucose. Altogether, this suggests that there are no significant differences in glucose regulation between Ctrl, Het, and BKO mice.

Additionally, ex vivo GSIS showed no differences in insulin secretion of islets harvested from Ctrl, Het, and BKO islets. Maximal islet secretory capacity, assessed via KCl induced insulin secretion, and total insulin content were also unchanged in these islets.

4.1 Hepatic Insulin Clearance

Tamaki et al. suggest that ZnT8 knockout affects insulin secretion via the lack of zinc co-secretion, thereby failing to suppress hepatic insulin clearance [13]. With plasma insulin and C-peptide values, it appears that our model does not reflect this difference in hepatic insulin clearance. However, it is possible that S961 is affecting this pathway. Hepatic insulin clearance is mediated by insulin receptors, through which hepatocytes endocytose insulin. Given that S961 is an insulin receptor inhibitor, it is plausible that S961 will affect the binding of insulin on hepatocytes, which will prevent the inhibition of insulin clearance.

However, combined with the GSIS results in which there are no differences in insulin secretion, it is unlikely that the lack of difference in plasma insulin between groups is due to inhibition of insulin clearance.

4.1.1 OGTT C-peptide

Although it is unlikely that S961 impaired hepatic insulin clearance, given the GSIS and circulating plasma results, ideally, this hypothesis would be further tested by assessing C-peptide during an OGTT – in which there is no S961 to influence insulin clearance. Because the amount of plasma necessary to run insulin ELISA is higher for OGTT samples (due to the lower concentration of insulin in OGTT samples), there was not enough plasma left over to analyze C-peptide. More plasma could have been collected to circumvent this problem. Comparing C-peptide to circulating insulin levels would allow comparison of insulin clearance free of S961.

4.2 ZnT8 Controversy

Other studies in mice models have shown that reduced ZnT8 results in glucose intolerance, often with diet induced metabolic stress. Without extra stressors, the influence of ZnT8 is less apparent. In this study, ZnT8 knockout and knockdown seem to have no effect on glucose tolerance or insulin secretion both in vivo and in vitro. This contrasts with pervious studies in which male mice with a β-cell specific ZnT8 knockout resulted in impaired glucose tolerance, even in the absence of extra metabolic stress [32]. Islets from these same mice were underwent glucose perifusion; BKO islets demonstrated reduced first phase insulin secretion, which may not be as apparent through static GSIS assessments [32]. It is possible that

35 additional, perhaps sustained metabolic stress, either in the form of a high fat diet or a constant infusion of S961 insulin receptor inhibitor could reveal a susceptibility in one group over the other as seen in a study by Hardy et. al [33]. Female mice were not assessed in either of the previous studies.

Further, some studies have found that there are age related effects in the presentation of glucose intolerance in ZnT8 knockout mice. Mice assessed at 4 week intervals showed relative glucose intolerance at the age of 10 weeks, but not at the age of 6 weeks or 14 weeks [31]. It is possible that if assessed at a different age, the current mice model may have different responses to glucose tolerance.

Based on the results of the current study, although there are no notable negative effects of β-cell specific ZnT8 knockout and knockdown, this study contributes to the numerous studies that show ZnT8 knockout in mice models is not beneficial to improved glucose homeostasis. The potential exceptions are two studies, both using the p.Arg138X manipulated ZnT8 mice model in which plasma insulin is increased without appreciable effects in blood glucose [34, 57]. This mouse model is the only one that has potentially displayed protective effects of ZnT8, although it is unclear why the specific truncation would affect glucose homeostasis differently when there are no appreciable levels of protein expression with the truncation [57]. It is possible that low levels of truncated ZnT8 or the expression of truncated ZnT8 mRNA itself plays a factor. Further insight into alternative roles of ZnT8 in the pancreatic β-cell may be necessary.

4.2.1 ZnT8’s Relevance in β-cell function

The extent to which ZnT8 affects insulin processing may be up for debate. It has been suggested that zinc binds in as early as the pro-insulin stage, in the endoplasmic reticulum to the Golgi apparatus [8, 9]. ZnT8, which is largely colocalized to ISVs membranes, is involved later in the pathway [27]. In this case, the process of insulin may not be affected by ZnT8. The morphology of β-cells is clearly affected by ZnT8 loss as seen through transmission electron microscopy, with the lack of dense core granules of crystalized insulin. However, the extent to which this negatively impacts β-cell function is unclear; based on current data, no changes are seen in insulin storage or secretion. How important, then, is insulin crystallization to β-cell function?

Insulin crystallization via zinc binding is a process that is preserved in almost all mammalian species. ZnT8, as well, is well preserved in mammals, with 98% homology in rats, mice, chimpanzees, and dogs [67]. Evolutionarily speaking, there is likely a high selection pressure involved for ZnT8 and insulin crystallization. It is possible that the role of ZnT8 in β-cell function can be examined in the reverse, with the one mammalian species that does not crystalize insulin – the guinea pig.

Guinea pig insulin has lost the B10 histidine residue that allows for zinc binding and the formation of insulin hexamers [68]. Guinea pig β-cells have also been found to be much lower in zinc content compared to other species [68]. Correspondingly, Guinea pig SLC30A8, which encodes ZnT8, is a pseudogene, and is likely the cause of low islet zinc content [69]. There are only theories as to why guinea pig insulin has lost the ability to bind zinc. A common early theory is the selectionist theory, which suggests that loss of freely available zinc resulted in guinea pig insulin no longer binding zinc [70]. This is backed by the more recent finding that other mammalian species, including sheep, cows, chinchillas, and naked mole rats, have inactivated SLC30A8 genes, thus no longer expressing ZnT8, that have the zinc binding B10 histidine residue in insulin [71]. Regardless, given that guinea pigs do not develop T2D easily – a suitable T2D model has only been achieved using both STZ and DIO – the lack of zinc binding does not seem to make them particularly susceptible to glucose intolerance [72]. Thus, guinea pigs may be an example of why ZnT8 and insulin crystallization may not be critical to β-cell function.

Since ZnT8 is expressed in tissues other than the β-cell and whole body knockouts of ZnT8 seem to result in a more severe phenotype than β-cell specific ZnT8 knockout, ZnT8 may exert as much, or more of an influence on whole body metabolism as it does on β-cell insulin secretion [33]. Further, zinc (and ZnT8) can play other roles in β-cell health.

4.2.2 ZnT8 in Inflammation

Some studies have reported that ZnT8 knockout in mice, rather than affecting the insulin secretory pathway through insulin processing, storage, and secretion directly, may affect β-cell health via inflammation.

In EndoC-βH1 cells, inflammatory cytokines (but not high glucose or free fatty acids) reduced ZnT8 expression levels via cytokine mediated down-regulation [73]. ZnT8 knockdown resulted in protection against cytokine cytotoxicity, showing that reduction in ZnT8 is a β-cell response to inflammation [73]. In INS-1 cells, cytokines (including IL1B, interferon-y, tumor necrosis factor-a) treatment resulted in downregulation of ZnT8 [74]. This remained true in mouse islets as well [74]. Overexpression of ZnT8 resulted in reduced survival of INS-1 cells [74]. No measures of GSIS during ZnT8 overexpression was assessed.

In our study, perhaps applying increased metabolic stress in the long-term, in the form of a high fat diet (as previously seen in our lab [32]) or cytokines could have revealed differences in the protective effects of ZnT8. If ZnT8 downregulation is a protective response to inflammation without necessarily any

changes in GSIS, a longer experiment could have revealed differences in β-cell survival, and thus affecting glucose homeostasis.

4.3 Altered Protein Expressions

In several studies, ZnT8 knockout resulted in changes in protein expression in other genes. Many were other proteins responsible for zinc transport, whereas others were genes associated with T2D incidence.

Based on dithizone staining, it is clear that islet zinc content is altered with loss of ZnT8. Given that ZnT8 increases zinc content in ISVs, without compensation from other zinc transporters, the lack of ZnT8 would result in a dramatic increase in cytoplasmic zinc. Although there are conflicting reports over whether cytoplasmic zinc levels are altered [30, 31, 34, 35], manipulating ZnT8 expression seems to have effects on the expression levels of other ZnTs, as well as ZIPs. ZnT5 expression was found to be increased [32]. Responsible for transporting zinc into the Golgi apparatus and vesicles, increased ZnT5 could help lower cytoplasmic zinc levels. ZIP8 and ZIP14 mRNA expression is reduced, as seen in Min6 cell lines [60]. As these are on the cell membrane, reduction may normalize cytoplasmic zinc levels [60].

Other genes associated with T2D that may potentially be affected by ZnT8 deficiency include increased transcription of Hnf4a, Pax4, and deceased Foxa1 [60]. Hnf4α knockout has been shown to inhibit GSIS [75]; increased Hnf4α expression in response to ZnT8 knockout could potentially be regulating insulin secretion, if ZnT8 deficiency is negatively affecting it. Pax4 is known as a β-cell differentiation gene during development [76]. Further, Pax4 has been shown to stimulate β-cell proliferation in adults and prevents β-cell apoptosis [76]. Foxa1 deficiency has been shown to impair insulin secretion [77]. It is possible that the downstream alterations in protein expression of these genes also associated with T2D are the reasons for altered glucose homeostasis, rather than altered ZnT8 activity directly.

4.4 Study Limitations and Weaknesses

There are 3 main things that, given the chance, I would have liked to change about this study. These are the use of Ins2-Cre, sampling timepoints during the acute S961 challenge experiments, and the measuring of female plasma insulin.

4.4.1 Cre Expression

The results from qPCR have indicated that the hypothalamus expresses Ins2-Cre mRNA, which may have unintended effects on mice phenotypes. These results are consistent to previous studies in which the Ins2-Cre expression was found in the hypothalamus [66]. Despite low expression levels, Ins2-Cre

38 expression may account for other effects. Ins2-Cre mice have been shown to have impaired glucose tolerance compared to control mice [78]. Insulin responses were slower in the Ins2-Cre mice [78].

However, this problem is circumvented by using Ins2-Cre positive mice as controls. With these controls, the only difference between mice is the presence or lack of ZnT8. The manipulation of ZnT8 is also not in the hypothalamus, since wildtype expression of ZnT8 is already extremely low, and no differences in hypothalamic ZnT8 mRNA was found. Further, mRNA levels for Ins2-Cre are roughly 300- fold lower in the hypothalamus compared to islets, suggesting that the effects of Cre will be much higher in pancreatic islets.

Ins2-Cre is still preferable to Pdx1-Cre, since Pdx1 is expressed in pancreatic development and would be in other pancreatic cells, such as acinar cells. Additionally, Pdx1-Cre expression has also been found in the hypothalamus [79]. More recently, there have been Ins1-Cre, which reportedly has fewer side-effects. Given more time and resources, a study using Ins1-Cre instead of Ins2-Cre may produce results less affected by Cre expression differences.

Unlike the Ins2 promoter, Ins1 has not been reported to be expressed in the brain [80]. Ins1-Cre was also the only β-cell targeting promoter that has also not been reported in the brain [79]. Both male and female mice expressing Ins1-Cre had equal body weight, blood glucose, and glucose tolerance test response compared to respective controls [81]. In contrast, the wild-type improper “controls “used in preliminary studies showed that fasting blood glucose was higher compared to any of the mice with Ins2- Cre expression (Figure 8A time 0); Ins2-Cre positive controls had fasting blood glucose that was the same as the mice that were Het and BKO (Figure 11A time 0), which were also the same as the mice with Ins2- Cre expression from preliminary studies. Although using Ins2-Cre controls can allow us to isolate for the effects of ZnT8, Ins2-Cre expression may have other unforeseen interactions affecting glucose homeostasis. Using Ins1-Cre instead of Ins2-Cre would be the superior option.

4.4.2 S961 Challenge Timing

At the end of the observation period of 5 hours, plasma insulin in the mice had not yet returned to normal. Insulin remains elevated, over 5x the amount of basal insulin levels despite blood glucose levels dropping to or lower than baseline levels (Figure 11). Perhaps this is the transition period in which high levels of insulin, intended to compensate for the insulin resistance caused by S961, have yet to be cleared after S961 has been cleared. Continuing to monitor blood glucose and insulin levels after this time point may result in a better understanding of insulin clearance mechanics or regulation of low glucose in mice.

Although the focus of this study was to assess differences in β-cell function and insulin secretion, which has not been altered with differences in ZnT8 expression, continued insulin monitoring may have resulted in a better understanding of the role of ZnT8.

4.4.3 Female Plasma Insulin

Although, generally, female mice typically display less of a phenotypic difference and less susceptibility to glucose intolerance, it would have provided a more complete assessment of the impact of ZnT8 knockout or knockdown in female mice to have measured female plasma insulins as well as males. Experiments examining different effects in female mice are becoming increasingly important as we realise differences between the sexes may be important for disease progression and treatment strategies.

Historically, female mice were avoided because the estrus cycle is thought to introduce increased variability in results. However, this difference was shown to be less significant that commonly thought [82]. Variability in female mice for factors such as hormones was not significantly higher than male mice, despite concerns about the estrous cycle [82].

Given that the same number of female mice as male mice can be used to conduct studies, and that female and male mice may have different responses, it is important to use both male and female samples. The traces for female blood glucose during acute S961 challenges (Figure 11) are more varied than that of male mice. Further, Figure 9 shows that fasting blood glucose in female mice are also more varied. Although insignificant, OGTT (Figure 10) shows trends of higher blood glucose in BKO mice, which may be worth pursuing. Examining female plasma insulin and C-peptide may reveal underlying causes of these differences.

4.4.4 Sample Sizes

Although results from this current project have revealed no significant differences between the Ins2- Cre positive control, β-cell specific heterozygous, and β-cell specific knockout mice, due to the low number of samples, more data should be acquired before definitively ruling out effects of ZnT8 in β-cell function. Increases in sample size in all experiments, particularly ex vivo islet glucose stimulated insulin secretion would provide more confidence in the reliability of results. Other promising data include female mice OGTT which had a trend in higher blood glucose. A larger sample size may help discern whether a true difference may be seen.

4.5 Future Directions

Current research is still insufficient in elucidating the causes of differences between mouse models with ZnT8 deficiency and human haploinsufficiency. Several avenues of future research may be beneficial in determining How, or whether ZnT8 is a suitable target for T2D treatment or prevention. These include increasing confidence in current results, examining other functions of ZnT8, both in the β-cell as well as elsewhere in the body, and examining the necessity of insulin hexamerization and crystallization in insulin storage and secretion.

4.5.1 Increasing Confidence

As mentioned in section 4.4.4, sample sizes for most data sets, particularly for GSIS, are low. Rectifying this limitation is simple; confidence in the data can easily be increased by breeding more mice and increasing sample sizes.

4.5.2 Other β-cell Functions of ZnT8

Glucose perifusion tests of insulin secretion can allow further insight onto whether insulin storage or secretion is affected through examination of first phase insulin secretion. Although previously examined in ZnT8 knockout mice models [32], no studies have examined this using the heterozygous haploinsufficient model. Since ZnT8 knockout may affect insulin secretion due to the loss of insulin crystallization, it is possible that first phase insulin secretion would be the most affected, as previously seen in the BKO model [32].

S961 mini pumps, to induce constant insulin resistance, may allow for better monitoring of islet response to rapid and sustained high insulin demand. Longer term use of S961 may reveal more differences in insulin secretion, as seen in previous studies in which use of the S961 mini pump in R138X ZnT8 truncation mice resulted in differences in plasma insulin [57]. This can allow for a better comparison as to whether the effects of ZnT8 manipulation are variant-dependent, or solely dependent on the presence or absence of ZnT8.

Future studies looking into how, mechanistically, if at all, ZnT8 affects insulin processing, storage, and secretion can be achieved through cell line work. Using Min6 K8 cells and either human islets or the EndoC- βH1 human cell line, siRNA mediated ZnT8 knockout can reveal cellular changes. Previously, siRNA mediated ZnT8 knockdown in Ins1-cell lines were examined in which intracellular insulin was unchanged, but insulin secretion was reduced [53]. Additionally, Min6 cells have been studied with an siRNA mediated

41 knockdown, resulting in reduced intracellular zinc, no functional tests of insulin were assessed [54]. Thus, we plan to use Min6 K8, a clonal line of mouse insulinoma cells that respond more physiologically to glucose and are particularly stable and easy to propagate, can help reveal differences in β-cell specific changes with ZnT8 knockdown. Using the human β-cell line would allow for a comparison of differences between the species, specifically in the β-cell, in response to ZnT8 knockdown. Differences in insulin storage, processing, or secretion can be seen without potential confounding factors due to neurological enervation or endocrine signalling affecting secretion.

Further, ZnT8 has been shown to affect β-cell survival [29]. Inflammatory cytokines, such as IL1B, interferon-y, tumor necrosis factor-a, can help stress the cell and determine whether loss of ZnT8 affects cell survivability [74]. If ZnT8 downregulation in response to cytokines is protective to β-cell survivability, as previously suspected, then siRNA mediated ZnT8 downregulation should also be protective. In vitro, there would be no conflating aspects such as insulin secretion increasing β-cell proliferation to affect results. This can again be done in both Min6 K8 and EndoC-βH1 cell lines.

5.4.3 ZnT8 outside the β-cell

Alternatively, it is possible that a look into the effects of ZnT8 outside the β-cell is warranted. Although ZnT8 is most prominently expressed in the pancreatic β-cell, the differences between tissue specific and global ZnT8 knockouts suggest functions in other tissues that should be examined. These can be tissue specific, most promisingly in the adipose, enteroendocrine, or peripheral blood mononuclear cells, or using a global knockout of ZnT8 with only expression of ZnT8 in the β-cell. These manipulations of ZnT8 could provide further insight into whether ZnT8’s association with diabetes truly lies in the β-cell.

5.4.4 Insulin Hexamerization

Finally, looking into animals that don’t have insulin hexamerization, such as the guinea pig, may provide more insight onto the role of insulin hexamerization in glucose homeostasis. There are other animals, such as sheep, cows, chinchillas, and naked mole rats, who don’t express ZnT8 who may be of interest as well [71]. Further examination of their islet zinc content, insulin hexamerization, and insulin secretion patterns may illuminate other consequences due to the lack of ZnT8. The importance of insulin hexamerization and crystallization may be further elucidated in studies using these animals.

4.6 Conclusion

The data from this study suggests that β-cell specific ZnT8 knockout and knockdown do not affect β- cell function as seen through insulin expression or insulin secretion, whole body glucose homeostasis in male and female mice on normal rodent chow under the conditions studied. It is possible that ZnT8 has effects that affect β-cell health or glucose homeostasis through other tissues. More studies are necessary to reconcile the differences in response to ZnT8 knockdown in mouse models and human models.

References

[1] Diabetes Canada, "Diabetes in Canada," January 2019. [Online]. Available: https://www.diabetes.ca/DiabetesCanadaWebsite/media/About- Diabetes/Diabetes%20Charter/2019-Backgrounder-Canada.pdf. [Accessed Janurary 2020].

[2] N. F. Krebs and K. M. Hambidgepp, "Zinc metabolism and homeostasis: the application of tracer techniques to human zinc physiology," Zinc Biochemistry, Physiology, and Homeostasis, pp. 211-266, 2001.

[3] J. Jeeyon and D. J. Eide, "The SLC39 family of zinc transporters," Molecular aspects of medicine, vol. 34, no. 2-3, pp. 612-619, 2013.

[4] D. A. Scott and A. M. Fisher, "The insulin and the zinc content of normal and diabetic pancreas.," The Journal of clinical investigation, vol. 17, no. 6, pp. 725-728, 1938.

[5] R. Jayawardena, P. Ranasinghe, P. Galappatthy, R. Malkanthi, G. Constantine and P. Katulanda, "Effects of zinc supplementation on diabetes mellitus: a systematic review and meta- analysis," Diabetology & metabolic syndrome, vol. 4, no. 1, p. 13, 2012.

[6] P. D. Zalewski, S. H. Millard, I. J. K. O. L. Forbes, A. N. Slavotinek, W. H. Betts, A. D. Ward, S. F. Lincoln and I. N. Mahadevan, "Video image analysis of labile zinc in viable pancreatic islet cells using a specific fluorescent probe for zinc.," Journal of Histochemistry & Cytochemistry, vol. 42, no. 7, pp. 877-884, 1994.

[7] S. O. Emdin, G. G. Dodson, J. M. Cutfield and S. M. Cutfield, "Role of zinc in insulin biosynthesis," Diabetologia, vol. 19, no. 3, pp. 174-182, 1980.

[8] M. F. Dunn, "Zinc-ligand interactions modulate assembly and stability of the insulin hexamer - a review.," Biometals, vol. 18, no. 4, pp. 295-303, 2005.

[9] X. F. Huang and P. Arvan, "Intracellular Transport of Proinsulin in Pancreatic β-Cells," Journal of Biological Chemistry, vol. 270, no. 35, pp. 20417-20423, 1995.

[10] E. N. Baker, T. L. Blundell, J. F. Cutfield, E. J. Dodson, G. G. Dodson, D. M. Hodgkin, R. E. Hubbard, N. W. Isacs, C. D. Reynolds, K. Sakabe and N. Sakabe, "The structure of 2Zn pig insulin crystals at 1.5 Å resolution," Philosophical Transactions of the Royal Society B, vol. 319, no. 1195, pp. 369-456, 1988.

[11] G. Dodson and D. Steiner, "The role of assembly in insulin's biosynthesis," Current opinion in sturctural biology, vol. 8, no. 2, pp. 189-194, 1998.

[12] W. J. Qian, C. A. Aspinwall, M. A. Battiste and R. T. Kennedy, "Detection of secretion from single pancreatic β-cells using extracellular fluorogenic reactions and confocal fluorescence microscopy," Analytical chemistry, vol. 72, no. 4, pp. 711-717, 2000.

[13] M. Tamaki, Y. Fujitani, A. Hara, T. Uchida, Y. Tamura, K. Takeno, M. Kawaguchi, T. Watanabe, T. Ogihara and A. S. T. Fukunaka, "The diabetes-susceptible gene SLC30A8/ZnT8 regulates hepatic insulin clearance," Journal of clinical investigation, vol. 123, no. 10, pp. 4513-4524, 2013.

[14] A. Bloc, T. Cens, H. Cruz and Y. Dunant, "Zinc‐induced changes in ionic currents of clonal rat pancreatic β‐cells: activation of ATP‐sensitive K+ channels," The Journal of Physiology, vol. 529, no. 3, pp. 723-734, 2000.

[15] K. Slepchenko, N. Daniels, A. Guo and Y. Li, "Autocrine effect of Zn 2+ on the glucose- stimulated insulin secretion," Endocrine, vol. 50, no. 1, pp. 110-122, 2015.

[16] I. Franklin, J. Gromada, A. Gjinovci, S. Theander and C. Wollheim, "β-cell secretory products activate α-cell ATP-dependent potassium channels to inhibit glucagon release," Diabetes, vol. 54, no. 6, pp. 1808-1815, 2005.

[17] H. Ishihara, P. Maechler, A. Gjinovci, P. Herrera and C. Wollheim, "Islet β-cell secretion determines glucagon release from neighbouring α-cells," Nature cell biology, vol. 5, no. 4, p. 330, 2003.

[18] A. Gyulkhandanyan, H. Lu, S. Lee, A. Bhattacharjee, N. Wijesekara, J. Fox, P. MacDonald, F. Chimienti, F. Dai and M. Wheeler, "Investigation of transport mechanisms and regulation of intracellular Zn2+ in pancreatic α-cells," Journal of Biological Chemistry, vol. 283, no. 15, pp. 10184-10197, 2008.

[19] A. B. Hardy, A. S. Serino, N. Wijesekara, F. Chimienti and M. B. & Wheeler, "Regulation of glucagon secretion by zinc: lessons from the β cell‐specific Znt8 knockout mouse model," Diabetes, Obesity and Metabolism, vol. 13, pp. 112-117, 2011.

[20] A. L. Prost, A. Bloc, N. Hussy, R. Derand and M. Vivaudou, "Zinc is both an intracellular and extracellular regulator of KATP channel function," The Journal of physiology, vol. 559, no. 1, pp. 157-167, 2004.

[21] P. Chabosseau and G. A. Rutter, "Zinc and Diabetes," Archives of Biochemistry and Biophysics, vol. 611, pp. 79-85, 2016.

[22] E. A. Bellomo, G. Meur and G. A. Rutter, "Glucose regulates free cytosolic Zn2+ concentration, Slc39 (ZiP), and metallothionein gene expression in primary pancreatic islet β- cells," Journal of Biological Chemistry, vol. 286, no. 29, pp. 25778-25789, 2011.

[23] Y. Liu, B. Batchuluun, L. Ho, D. Zhu, K. Prentice, A. Bhattacharjee, M. Zhang, F. Pourasgari, A. Hardy, K. Taylor and H. Gaisano, "Characterization of Zinc Influx Transporters (ZIPs) in Pancreatic β Cells Roles in Regulating Cytosolic Zinc Homeostasis and Insulin Secretion," Journal of Biological Chemistry, vol. 290, no. 30, pp. 18757-18769, 2015.

[24] L. Huang and S. Tepaamorndech, "The SLC30 family of zinc transporters - a review of current understanding of their biological and pathophysiological roles," Mol Aspects Med, vol. 34, no. 2- 3, pp. 548-560., 2013.

[25] K. Lemaire, F. Chimienti and F. Schuit, "Zinc transporters and their role in the pancreatic β- cell," Journal of Diabetes Investigation , vol. 3, no. 3, pp. 202-211, 2012.

[26] H. W. Davidson, J. M. Wenzlau and R. M. O'Brien, "Zinc transporter 8 (ZnT8) and β cell function," Trends in Endocrinology & Metabolism, vol. 25, no. 8, pp. 415-424, 2014.

[27] F. Chimienti, S. Devergnas, A. Favier and M. Seve, "Identification and cloning of a B-cell- specific zinc transporter, ZnT-8, localized into insulin secratory granules," Diabetes, vol. 53, no. 9, pp. 2330-2337, 2004.

[28] M. Lu and D. Fu, "Structure of the zinc transporter YiiP," Science, vol. 317, no. 5845, pp. 1746- 1748, 2007.

[29] F. Chimienti, S. Devergnas, F. Pattou, F. Schuit, R. Garcia-Cuenca, B. Vandewalle, J. Kerr- Conte, L. Van Lommel, D. Grunwald, A. Favier and M. Seve, "In vivo expression and functional characterization of the zinc transporter ZnT8 in glucose-induced insulin secretion," Journal of cell science, vol. 119, no. 20, pp. 4199-4206, 2006.

[30] T. J. Nicolson, E. A. Bellomo, N. Wijesekara, M. K. Loder, J. M. Baldwin, A. V. Gyulkhandanyan, V. Koshkin, A. I. Tarasov, R. Carzaniga, K. Kronenberger and T. K. Taneja, "Insulin storage and glucose homeostasis in mice null for the granule zinc transporter ZnT8 and studies of the type 2 diabetes–associated variants," Diabetes, vol. 58, no. 9, pp. 2070-2083, 2009.

[31] R. Mitchell, M. Hu, P. Chabosseau, M. Cane, G. Meur, E. C. R. Bellomo, L. Collinson, W. Li, D. Hodson and G. Rutter, "Molecular genetic regulation of Slc30a8/ZnT8 reveals a positive association with glucose tolerance," Molecular endocrinology, vol. 30, no. 1, pp. 77-91, 2016.

[32] N. Wijesekara, F. F. Dai, A. B. Hardy, P. R. Giglou, A. Bhattacharjee, V. Koshkin, F. Chimienti, H. Y. Gaisano, G. A. Rutter and M. B. Wheeler, "Beta cell-specific Znt8 deletion in mice causes marked defects in insulin processing, crystallisation and secretion," Diabetologia, vol. 53, no. 8, pp. 1656-1668, 2010.

[33] A. B. Hardy, N. Wijesekara, I. Genkin, K. J. Prentice, A. K. D. Bhattacharjee, F. Chimienti and M. B. Wheeler, "Effects of high-fat diet feeding on Znt8-null mice: differences between β-cell and global knockout of Znt8," American Journal of Physiology-Endocrinology and Metabolism, vol. 302, no. 9, p. E1084, 2012.

[34] O. P. Dwivedi, M. Lehtovirta, B. Hastoy, V. Chandra, N. A. Krentz, S. Kleiner, D. Jain, A. Richard, F. Abaitua, N. L. Beer, A. Grotz, R. B. Prasad, D. Gomez, A. Baras, B. Champon, A. J. Payne, P. Chabosseau and L. & Groop, "Loss of ZnT8 function protects against diabetes by enhanced insulin secretion," Nature genetics, pp. 1-11, 2019.

[35] P. Gerber, E. Bellomo, D. Hodson, G. Meur, A. Solomou, R. Mitchell, M. Hollinshead, F. Chimienti, D. Bosco, S. Hughes, P. Johnson and G. Rutter, "Hypoxia lowers SLC30A8/ZnT8 expression and free cytosolic Zn2+ in pancreatic beta cells," Diabetologia, vol. 57, no. 8, pp. 2634-1644, 2014.

[36] Y. Fu, W. Tian, E. B. Pratt, L. B. Dirling, S. L. Shyng, C. K. Meshul and D. M. & Cohen, "Down- regulation of ZnT8 expression in INS-1 rat pancreatic beta cells reduces insulin content and glucose-inducible insulin secretion," PloS one, vol. 4, no. 5, p. e5679, 2009.

[37] L. D. Pound, S. A. Sarkar, R. K. Benninger, Y. Wang, A. Suwanichkul, M. K. Shadoan, R. L. Printz, J. K. Oeser, C. E. Lee, D. W. Piston and O. P. McGuinness, "Deletion of the mouse Slc30a8 gene encoding zinc transporter-8 results in impaired insulin secretion," Biochemical Journal, vol. 421, no. 3, pp. 371-376, 2009.

[38] Z. A. Latif, J. Noel and R. Alejandro, "A simple method of staining fresh and cultured islets," Transplantation, vol. 45, no. 4, pp. 827-830, 1988.

[39] W. A. Hansen, M. R. Christie, R. Kahn, A. Norgaard, I. Abel, A. M. Petersen, D. W. Jorgensen, S. Baekkeskov, J. H. Nielsen and A. Lernmark, "Supravital dithizone staining in the isolation of human and rat pancreatic islets.," Diabetes research, vol. 10, no. 2, p. 53, 1989.

[40] R. Sladek, G. Rocheleau, J. Rung, C. Dina, L. Shen, D. Serre, P. Boutin, D. Vincent, A. Belisle, S. Hadjadj and B. Balkau, "A genome-wide association study identifies novel risk loci for type 2 diabetes," Nature, vol. 445, no. 7130, p. 881, 2007.

[41] L. J. Scott, K. L. Mohlke, L. L. Bonnycastle, C. J. Willer, Y. Li, W. L. Duren, M. R. Erdos, H. M. Stringham, P. S. Chines, A. U. Jackson and L. Prokunina-Olsson, "A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants," science, 2007.

[42] R. Saxena, B. F. Voight, V. Lyssenko, N. P. Burtt, P. I. de Bakker, H. Chen, J. J. Roix, S. Kathiresan, J. N. Hirschhorn, M. J. Daly and T. E. Hughes, "Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels," Science, vol. 316, no. 5829, pp. 1331- 1336, 2007.

[43] C. Merriman, Q. Huang, G. Rutter and D. Fu, "Lipid-tuned zinc transport activity of human ZnT8 correlates with risk for type-2 diabetes," Journal of Biological Chemistry, pp. jbc-M116, 2016.

[44] I. Kim, E. Kang, Y. Yim, S. Ko, S. Jeong, J. Rim, Y. Kim, C. Ahn, B. Cha and H. K. C. Lee, "A low- risk ZnT-8 allele (W325) for post-transplantation diabetes mellitus is protective against cyclosporin A-induced impairment of insulin secretion," The pharmacogenomics journal, vol. 11, no. 3, p. 191, 2011.

[45] S. Carvalho, J. Molina-López, D. Parsons, C. Corpe, W. Maret and C. Hogstrand, "Differential cytolocation and functional assays of the two major human SLC30A8 (ZnT8) isoforms," Journal of Trace Elements in Medicine and Biology, vol. 44, pp. 116-124, 2017.

[46] J. K. Thornton, K. M. F. D. Taylor and R. A. Valentine, "Differential subcellular localization of the splice variants of the zinc transporter ZnT5 is dictated by the different C-terminal regions," PloS one, vol. 6, no. 8, p. e23878, 2011.

[47] D. Fu, "Zinc Transporter YiiP from Escherichia coli," Encyclopedia of Inorganic and Bioinorganic Chemistry, 2011.

[48] R. N. Weijers, "Three-dimensional structure of β-cell-specific zinc transporter, ZnT-8, predicted from the type 2 diabetes-associated gene variant SLC30A8 R325W," Diabetology & metabolic syndrome, vol. 2, no. 1, p. 33, 2010.

[49] H. Staiger, F. Machicao, N. Stefan, O. Tschritter, C. Thamer, K. Kantartzis, S. A. Schäfer, K. Kirchhoff, A. Fritsche and H. U. Häring, "Polymorphisms within novel risk loci for type 2 diabetes determine β-cell function," PloS one, vol. 2, no. 9, p. e832, 2007.

[50] V. Steinthorsdottir, G. Thorleifsson, I. Reynisdottir, R. Benediktsson, T. Jonsdottir, G. B. Walters, U. Styrkarsdottir, S. Gretarsdottir, V. Emilsson, S. Ghosh and A. Baker, "A variant in CDKAL1 influences insulin response and risk of type 2 diabetes," Nature genetics, vol. 39, no. 6, p. 770, 2007.

[51] K. Kirchhoff, F. Machicao, A. Haupt, S. Schäfer, O. Tschritter, H. Staiger, N. Stefan, H. Häring and A. Fritsche, "Polymorphisms in the TCF7L2, CDKAL1 and SLC30A8 genes are associated with impaired proinsulin conversion," Diabetologia, vol. 51, no. 4, pp. 597-601, 2008.

[52] M. Tamaki, Y. Fujitani, T. Uchida, T. Hirose, R. Kawamori and H. Watada, "Downregulation of ZnT8 expression in pancreatic β-cells of diabetic mice," Islets, vol. 1, no. 2, pp. 124-128, 2009.

[53] A. B. Petersen, K. Smidt, N. E. Magnusson, F. Moore, L. Egefjord and J. Rungby, "siRNA‐ mediated knock‐down of ZnT3 and ZnT8 affects production and secretion of insulin and apoptosis in INS‐1E cells," Apmis, vol. 119, no. 2, pp. 93-102, 2011.

[54] M. El Muayed, L. K. Billings, M. R. Raja, X. Zhang, P. J. Park, M. V. Newman, D. B. Kaufman, T. V. O'Halloran and W. L. Lowe, "Acute cytokine-mediated downregulation of the zinc transporter ZnT8 alters pancreatic β-cell function," Journal of Endocrinology, vol. 206, no. 2, pp. 159-169, 2010.

[55] K. Lemaire, M. A. Ravier, A. Schraenen, J. W. Creemers, R. Van de Plas, M. Granvik, L. Van Lommel, E. Waelkens, F. Chimienti, G. A. Rutter and P. Gilon, "Insulin crystalization depends on

zinc transporter ZnT8 expression but is not required for normal glucose homeostasis in mice," Proceedings of the national Academy of Sciences, vol. 106, no. 35, pp. 14872-14877, 2009.

[56] J. Flannick, G. Thorleifsson, N. Beer, S. Jacobs, N. Grarup, N. Burtt, A. Mahajan, C. Fuchsberger, G. Atzmon, R. Benediktsson and J. Blangero, "Loss-of-function mutations in SLC30A8 protect against type 2 diabetes," Nature genetics, vol. 46, no. 4, p. 357, 2014.

[57] S. Kleiner, D. Gomez, B. Megra, E. Na, R. Bhavsar, K. Cavino, Y. Xin, J. Rojas, G. Dominguez- Gutierrez, B. Zambrowicz, G. Carrat, P. Chabosseau, M. Hu, Y. G. D. Murphy, G. A. Rutter and J. Gromada, "Mice harboring the human SLC30A8 R138X loss-of-function mutation have increased insulin secretory capacity," Proceedings of the National Academy of Sciences, vol. 115, no. 32, pp. E7642-E7649, 2018.

[58] L. Schäffer, C. Brand, B. Hansen, U. Ribel, A. Shaw, R. Slaaby and J. Sturis, "A novel high- affinity peptide antagonist to the insulin receptor," Biochemical and biophysical research communications, vol. 376, no. 2, pp. 38-=383, 2008.

[59] L. Knudsen, B. F. Hansen, P. Jensen, T. Å. Pedersen, K. Vestergaard, L. Schäffer, B. Blagoev, M. B. Oleksiewicz, V. V. Kiselyov and P. De Meyts, " Agonism and antagonism at the insulin receptor," PloS one, vol. 7, no. 12, 2012.

[60] R. Lawson, W. Maret and H. Hogstrand, "ZnT8 Haploinsufficiency Impacts MIN6 Cell Zinc Content and β-Cell Phenotype via ZIP-ZnT8 Coregulation," International journal of molecular sciences, vol. 20, no. 21, p. 5485, 2019.

[61] Z. Mao, H. Lin, W. Su, J. Li, M. Zhou, Z. Li, B. Zhou, Q. Yang, M. Zhou, K. Pan and J. He, "Deficiency of ZnT8 Promotes Adiposity and Metabolic Dysfunction by Increasing Peripheral Serotonin Production," Diabetes, vol. 68, no. 6, pp. 1197-1209., 2019.

[62] K. Smidt, S. Pedersen, B. Brock, O. Schmitz, S. Fisker, J. Bendix, L. Wogensen and J. Rungby, "Zinc-transporter genes in human visceral and subcutaneous adipocytes: lean versus obese," Molecular and cellular endocrinology, vol. 264, no. 1-2, pp. 68-73, 2007.

[63] R. Giacconi, M. Malavolta, L. Chiodi, G. Boccoli, L. Costarelli, A. Bonfigli, R. Galeazzi, F. Piacenza, A. Basso, N. Gasparini and L. Nisi, "ZnT8 Arg325Trp polymorphism influences zinc transporter expression and cytokine production in PBMCs from patients with diabetes," Diabetes research and clinical practice, vol. 144, pp. 102-110, 2018.

[64] R. Cheng-Xue, A. Gómez-Ruiz, N. Antoine, L. A. Noël, H.-Y. Chae, M. A. Ravier, F. Chimienti, F. C. Schuit and P. Gilon, "olbutamide controls glucagon release from mouse islets differently than glucose: involvement of KATP channels from both α-cells and δ-cells," Diabetes, vol. 62, no. 5, pp. 1612-1622, 2013.

[65] A. Solomou, G. Meur, E. Bellomo, D. Hodson, A. Tomas, S. Li, E. Philippe, P. Herrera, C. Magnan and G. Rutter, "The zinc transporter Slc30a8/ZnT8 is required in a subpopulation of pancreatic α cells for hypoglycemia-induced glucagon secretion," Journal of Biological Chemistry, pp. jbc-M115, 2015.

[66] M. Gannon, C. Shiota, C. Postic, C. V. Wright and M. Magnuson, "Analysis of the Cre‐ mediated recombination driven by rat insulin promoter in embryonic and adult mouse pancreas," genesis, vol. 26, no. 2, pp. 139-142, 2000.

[67] F. Chimienti, A. Favier and M. Seve, "ZnT-8, a pancreatic beta-cell-specific zinc transporter," Biometals, vol. 18, no. 4, pp. 313-317, 2005.

[68] N. Havu, G. Lundgren and S. Falkmer, "Zinc and manganese contents of micro-dissected pancreatic islets of some rodents. A microchemical study in adult and newborn guinea pigs, rats, Chinese hamsters and spiny mice," Acta Endocrinol, vol. 86, no. 3, pp. 570-577, 1977.

[69] K. E. Syring, K. J. Bosma, J. K. Oeser, M. Shiota and R. M. O'Brien, "The Diabetes Susceptibility Gene SLC30A8 that Encodes the Zinc Transporter ZnT8 is a Pseudogene in Guinea Pigs Potentially Contributing to Low Guinea Pig Islet Zinc Content.," Journal of molecular evolution, vol. 86, no. 9, pp. 613-617, 2018.

[70] S. J. Chan, V. Episkopou, S. Zeitlin, S. K. Karathanasis, A. MacKrell, D. F. Steiner and A. & Efstratiadis, "Guinea pig preproinsulin gene: an evolutionary compromise?," Proceedings of the National Academy of Sciences of the United States of America, vol. 81, no. 16, pp. 5046-5050, 1984.

[71] K. Bosma, K. Syring, J. Oeser, J. Lee, R. Benninger, M. Pamenter and R. O’Brien, "Evidence that Evolution of the Diabetes Susceptibility Gene SLC30A8 that Encodes the Zinc Transporter ZnT8 Drives Variations in Pancreatic Islet Zinc content in Multiple Species," Journal of molecular evolution, vol. 87, no. 4-6, pp. 147-151, 2019.

[72] B. K. Podell, D. F. Ackart, M. A. Richardson, J. E. DiLisio, B. Pulford and R. J. Basaraba, "A model of type 2 diabetes in the guinea pig using sequential diet-induced glucose intolerance and streptozotocin treatment.," Disease models & mechanisms, vol. 10, no. 2, pp. 151-162, 2017.

[73] C. Merriman and D. Fu, "Down-regulation of the islet-specific zinc transporter-8 (ZnT8) protects human insulinoma cells against inflammatory stress," Journal of Biological Chemistry, vol. 294, no. 45, pp. 16992-17006, 2019.

[74] L. Egefjord, J. Jensen, C. Bang-Berthelsen, A. Petersen, K. Smidt, O. Schmitz, A. Karlsen, F. Pociot, F. Chimienti, J. Rungby and N. Magnusson, "Zinc transporter gene expression is regulated by pro-inflammatory cytokines: a potential role for zinc transporters in beta-cell apoptosis?," BMC endocrine disorders, vol. 1, no. 7, p. 9, 2009.

[75] A. Miura, K. Yamagata, M. Kakei, H. Hatakeyama, N. Takahashi, K. Fukui, T. Nammo, K. Yoneda, Y. Inoue, F. Sladek, M. Magnuson, H. Kasai, J. Miyagawa, F. Gonzalez and I. Shimomura, "Hepatocyte nuclear factor-4alpha is essential for glucose-stimulated insulin secretion by pancreatic beta-cells," J Biol Chem, vol. 281, no. 8, pp. 5246-5257, 2006.

[76] P. I. Lorenzo, F. Juárez-Vicente, N. Cobo-Vuilleumier, M. García-Domínguez and B. R. Gauthier, "The Diabetes-Linked Transcription Factor PAX4: From Gene to Functional Consequences," Genes, vol. 8, no. 3, p. 101, 2017.

[77] M. Z. Vatamaniuk, R. K. Gupta, K. A. Lantz, N. M. Doliba, F. M. Matschinsky and K. H. Kaestner, " Foxa1-deficient mice exhibit impaired insulin secretion due to uncoupled oxidative phosphorylation.," Diabetes, vol. 55, no. 10, pp. 2730-2736., 2006.

[78] J. Lee, M. Ristow, X. Lin, M. White, M. Magnuson and L. Hennighausen, "RIP-Cre revisited, evidence for impairments of pancreatic β-cell function," Journal of Biological Chemistry, vol. 281, no. 5, pp. 2649-2653., 2006.

[79] B. Wicksteed, M. Brissova, W. Yan, D. Opland, J. Plank, R. Reinert, L. Dickson, N. Tamarina, L. Philipson, A. Shostak and E. Bernal-Mizrachi, "Conditional gene targeting in mouse pancreatic β- cells: analysis of ectopic Cre transgene expression in the brain," Diabetes, vol. 59, no. 12, pp. 3090-3098, 2010.

[80] L. Deltour, P. Leduque, N. Blume, O. Madsen, P. Dubois, J. Jami and D. Bucchini, "Differential expression of the two nonallelic proinsulin genes in the developing mouse embryo," Proceedings of the National Academy of Sciences of the United States of America, vol. 90, no. 2, pp. 527-531, 1993.

[81] B. Thorens, D. Tarussio, M. Maestro, M. Rovira, E. Heikkilä and J. Ferrer, "Ins1 Cre knock-in mice for beta cell-specific gene recombination," Diabetologia, vol. 58, no. 3, pp. 558-565., 2015.

[82] A. Beery, "Inclusion of females does not increase variability in rodent research studies," Current opinion in behavioral sciences, vol. 23, pp. 143-149., 2018.

[83] E. Zeggini, M. N. Weedon, C. M. Lindgren, T. M. Frayling, K. S. Elliott, H. Lango, N. J. Timpson, J. R. Perry, N. W. Rayner, R. M. Freathy and J. C. Barrett, "Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes," Science, vol. 316, no. 5829, pp. 1336- 1341, 2007.

[84] S. Omori, Y. Tanaka, A. Takahashi, H. Hirose, A. Kashiwagi, K. Kaku, R. Kawamori, Y. Nakamura and S. Maeda, "Association of CDKAL1, IGF2BP2, CDKN2A/B, HHEX, SLC30A8, and KCNJ11 with

susceptibility to type 2 diabetes in a Japanese population," Diabetes, vol. 57, no. 3, pp. 791-795, 2008.

[85] N. D. Palmer, M. O. Goodarzi, C. D. Langefeld, J. Ziegler, J. M. Norris, S. M. Haffner, M. Bryer- Ash, R. N. Bergman, L. E. Wagenknecht, K. D. Taylor and J. I. Rotter, "Quantitative trait analysis of T2D susceptibility loci identified from whole genome association studies in the IRAS family study," Diabetes, 2008.

[86] S. Cauchi, S. Del Guerra, H. Choquet, V. D’Aleo, C. Groves, R. Lupi, M. McCarthy, P. Froguel and P. Marchetti, "Meta-analysis and functional effects of the SLC30A8 rs13266634 polymorphism on isolated human pancreatic islets," Molecular genetics and metabolism, vol. 100, no. 1, pp. 77-82, 2010.