Polycomb Repressive Complex 2 Coordinates with Sin3 Histone Deacetylase Complex

bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Polycomb repressive complex 2 coordinates with Sin3 histone deacetylase complex

2 to epigenetically reprogram genome-wide expression of effectors and regulate

3 pathogenicity in Magnaporthe oryzae

5 Zhongling Wu1,§, Jiehua Qiu2,§, Huanbin Shi2, Chuyu Lin1, Jiangnan Yue1, Zhiquan Liu2,

6 Wei Xie1, Yanjun Kou2* and Zeng Tao1*

8 1State Key Lab of Rice Biology, Ministry of Agriculture Key Laboratory of Molecular

9 Biology of Crop Pathogens and Insects, Institute of Biotechnology, Zhejiang University,

10 Hangzhou, China.

11 2State Key Lab of Rice Biology, China National Rice Research Institute, Hangzhou,

12 China

13 § These authors contributed equally.

14 * Correspondence: [email protected] (Z.T.)，[email protected] (Y.K.).

19 Running head: Reprogramming of effectors during Magnaporthe oryzae–rice

20 interaction

30 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

31 Abstract

32 The strict suppression and reprogramming of gene expression are necessary at different

33 development stages and/or in response to environment stimuli in eukaryotes. In Rice

34 Magnaporthe oryzae pathosystem, effectors from pathogen are kept transcriptionally

35 silenced in the vegetative growth stage and are highly expressed during invasive growth

36 stage to adapt to the host environment. However, the mechanism of how such effectors

37 are stably repressed in the vegetative stage and its roles during rice blast infection

38 remain unclear so far. Here, we showed that all subunits of Polycomb Repressive

39 Complex 2 are required for such repression by direct H3K27me3 occupancy and

40 pathogenic process in M. oryzae. Suppression of polycomb-mediated H3K27me3

41 causes an improper induction of effectors during vegetative growth thus simulating a

42 host environment. Notably, the addition subunit P55 not only acts as the bridge to

43 connect with core subunits to form a complex in M. oryzae, but also recruits Sin3

44 histone deacetylase complex to prompt H3K27me3 occupancy for stable maintenance

45 of transcriptional silencing of the target genes in the absence of PRC1. In contrast,

46 during invasive growth stage, the repressed state of effectors chromatin can be partially

47 erased during pathogenic development resulting in transcriptional activation of

48 effectors therein. Overall, Polycomb repressive complex 2 coordinates with Sin3

49 histone deacetylase complex to epigenetically reprogram genome-wide expression of

50 effectors, which act as molecular switch to memorize the host environment from

51 vegetative to invasive growth, thus contributing to the infection of rice blast.

58 Key words: rice blast; PRC2; histone deacetylation; Sin3-HDAC; transcriptional

59 reprogramming

60 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

61 Introduction

63 Organisms need to reprogram gene expression properly in different development stages

64 or environment stimuli, which suppressing unnecessary genes is the most of important

65 process (Cavalli and Heard, 2019, Netea et al., 2016). Stable maintenance of repressed

66 gene expression states is achieved partly by the propagation of specific chromatin

67 modifications (Cavalli and Heard, 2019). Evolutionary conserved polycomb repressive

68 complexes (PRC) plays a vital role in such repression and contributes to facultative

69 heterochromatin (Schuettengruber et al., 2017, Wiles and Selker, 2017, Margueron and

70 Reinberg, 2011). PRC is involved in various biological processes, including

71 maintaining cellular and tissue identity in multicellular organisms and regulating phase

72 transitions in plants (Margueron and Reinberg, 2011, Blackledge et al., 2015). In

73 mammals and higher plants, there are two main polycomb group complexes, PRC1 and

74 PRC2 (Lanzuolo and Orlando, 2012). PRC1, including Pc, Ph, and Psc, compacts

75 chromatin and catalyzes the monoubiquitylation of histone H2A. PRC2, including core

76 subunits proteins, Ezh (Kmt6), Su(z)12, Esc (Eed) and additional subunits

77 RbAp48/Nurf55 (P55), catalyzes the methylation of histone H3 at lysine 27 (Wiles and

78 Selker, 2017, Schuettengruber et al., 2017). The core PRC2 complex is conserved from

79 Drosophila to mammals and higher plants, while the PRC1 complex is not

80 evolutionarily conserved. Notably, PRC1 has not been identified in fungi so far

81 (Margueron and Reinberg, 2011, Ridenour et al., 2020).

83 In the fungi kingdom, disruption of PRC usually reprograms genome-wide gene

84 expression, leading to abnormal growth and reduced pathogenicity (Ridenour et al.,

85 2020, Wiles and Selker, 2017). In Fusarium graminearum, deletion of core subunits of

86 PRC2 resulted in the complete loss of H3K27me3 modification, ~2,500 genes up-

87 regulation, as well as severe defects in growth and pathogenicity (Connolly et al., 2013).

88 In Magnaporthe oryzae, deletion of KMT6 eliminated all H3K27me3 modifications,

89 resulted in a decrease in sporulation and highly reduced pathogenicity in wheat and

90 barley (Pham et al., 2015). In Neurospora crassa, loss of core subunits also abolished bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

91 all H3K27me3 modification, but only accompanied by slight growth defects (Jamieson

92 et al., 2013). In the yeast Cryptococcus neoformans, loss of EZH2, Eed1 or additional

93 subunit Bnd1 removed all H3K27me3 modification, while loss of the novel accessory

94 component Ccc1 resulted in regional reduction and relocalization of H3K27me3

95 modification on the chromosome (Dumesic et al., 2015). In symbiotic fungus Epichloe

96 festucae, H3K27me3 coupled with H3K9me3 controls expression of symbiosis-specific

97 genes, such as genes related to alkaloid bioprotective metabolites (Chujo and Scott,

98 2014). Although many studies have been done on the PRC complex in fungi, how the

99 PRC2 effectively regulates gene expression and stably maintains the repressive

100 H3K27me3 modification on the target chromatin in the absence of PRC1 remains

101 largely unclear (Ridenour et al., 2020, Wiles and Selker, 2017).

102

103 During plant–pathogen interaction, pathogens have evolved multiple layer of

104 strategies to invade host effectively, including secreting effectors to modulate rice

105 immunity and ensure progressive infection (Fouche et al., 2018). Reprogramming the

106 expression of the effectors by the pathogen is often used as an effective strategy to

107 invade the host (Fouche et al., 2018). In addition, recent studies showed that

108 transcriptional polymorphism with effectors contributes to the adaption of pathogenic

109 microbes to environmental changes and co-evolution with host (Fouche et al., 2018).

110 In the soybean root rot pathogen Phytophthora sojae, occupancy of H3K27me3 at

111 Avirulence gene Avr1b leads to transcriptional silencing and fails to induce the Rps1b

112 mediated disease resistance (Wang et al., 2020). However, in the vegetative growth

113 stage, how to maintain the stable suppression of expression of effectors remains unclear.

114

115 Rice blast, caused by M. oryzae, is the most devastating disease of rice and

116 threatens food security worldwide. In M. oryzae–rice interaction, the majority of the

117 effectors are kept transcriptional silencing or expressed relatively low in the vegetative

118 growth stage (Dong et al., 2015, Sharpee et al., 2017, Jeon et al., 2020), but are de-

119 repressed during invasive growth stage (Dong et al., 2015, Jeon et al., 2020). During

120 preparing our manuscript, a really good study found that H3K27 dynamics associate bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

121 with altered transcription of in planta induced genes in M. oryzae (Zhang et al., 2021).

122 Here, we not only find that histone modification H3K27me3 is required for genome-

123 wide transcriptional silencing of effectors during vegetative growth stage in M. oryzae,

124 but also present the detailed and novel mechanism beyond these findings. First, all

125 subunits of PRC2, are required for H3K27me3-meditating polycomb silencing on the

126 effectors and pathogenicity, which the addition subunit P55 acts as the bridge to connect

127 with the core subunits to form a complex in M. oryzae. Furthermore, P55 recruits Sin3

128 histone deacetylase complex to coordinate with PRC2 and prompts H3K27me3

129 occupancy on the target chromatin. During invasive growth stage, the repressed

130 chromatin state on the effectors can be partially “erased”, resulting in the transcriptional

131 activation of effectors. In addition, we also reveal the important role of Sin3 histone

132 deacetylase complex in transcriptional reprogramming the genome-wide expression of

133 effectors, as well as in pathogenicity.

134

135 Results

136 Kmt6, as well as other PRC2 subunits, is indispensable for H3K27me3

137 modification in M. oryzae

138

139 In M. oryzae, Kmt6 (MGG_00152) was reported as the writer of H3K27me3

140 modification which is associated with altered transcription of in planta induced genes

141 in M. oryzae (Pham et al., 2015, Zhang et al., 2021). However, how H3K27

142 trimethylation achieve stably transcriptional silencing of effectors during vegetative

143 growth remains largely unknown. To answer this question, ∆kmt6 was created in the

144 wild-type (WT) M. oryzae strain B157. As reported, the expression levels of

145 representative effectors during vegetative growth stage exhibited significant increased

146 expression levels than that of the WT (Figure 1a)(Khang et al., 2010, Mosquera et al.,

147 2009, Sharpee et al., 2017). To verify whether the increased transcriptional expression

148 of effectors would enhance accumulation and secretion of effectors during vegetative

149 growth stage, the BAS4-GFP construct was introduced into the ∆kmt6 strain. As shown

150 in the Figure 1b, the Bas4-GFP signal was clearly evident in the conidia, and the apical bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

151 and subapical regions of the hyphae of the ∆kmt6 mutant, but was not detectable in

152 those of the WT. These results indicated that removal of H3K27me3 modification leads

153 to untimely expression of BAS4 during vegetative growth stage similar with that found

154 naturally during invasive growth stage (Figure 1b).

155

156 Polycomb-group genes were first identified in Hox regulation in Drosohpila and

157 are usually assembled with Polycomb repressive complex 1(PRC1) and PRC2

158 (Blackledge et al., 2015, Ridenour et al., 2020). To identify the candidate PRC1 and

159 other PRC2 subunits in M. oryzae, BLASTp was used to search for the orthologs from

160 M. oryzae 70-15 genomes (taxid: 242507) with the query sequences from Neurospora

161 crassa, Arabidopsis thaliana, and Drosophila melanogaster (Table S1). Three unique

162 PRC2 core subunits, Kmt6 (MGG_00152), Eed (MGG_06028), Suz12 (MGG_03169),

163 and one additional subunit P55 (MGG_07323) were obtained, while no PRC1 subunits

164 was hit even by low stringency BLAST in M. oryzae (Table S1, Figure S1).

165

166 To investigate whether Kmt6, Eed, Suz12 and P55 form a complex, we first fused

167 these proteins with GFP and examined their subcellular localization in M. oryzae. As

168 shown in the Figure 2a, all these subunits were co-localized Hoechst-stained nuclei,

169 suggesting that these components may form a complex in the nucleus like PRC2 in

170 other species (Figure 2a). Then, yeast two-hybrid assay was conducted to test whether

171 these subunits are physically associated in vitro. KMT6, Suz12, Eed and P55 were

172 cloned to the prey and bait vectors respectively. These results showed that the additional

173 subunit P55 interacts with other three core subunits, and Kmt6 interacts with Eed in the

174 yeast cells (Figure 2b). Furthermore, co-immunoprecipitation assays with strains

175 expressing Eed-GFP and Kmt6-Flag, P55-GFP and Kmt6-Flag, P55-GFP and Suz12-

176 Flag, P55-GFP and Eed-Flag respectively further confirmed these interactions in vivo

177 (Figure 2c-f). Taken together, these results suggested that Kmt6, Eed, Suz12 and P55

178 form a complex, and P55 serves as the bridge to connect the PRC2 components.

179 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

180 To explore whether Eed, Suz12, and P55 are indeed required for H3K27me3

181 modification, deletion mutants of Suz12, Eed and P55 were created by homolog

182 recombination in the WT. Subsequently, the protein levels of histone lysine methylation

183 were detected with specific antibodies using Western blotting assay. The levels of

184 H3K27me3 were almost undetectable in the ∆kmt6, ∆eed and ∆suz12 mutants, while

185 the level of H3K27me3 in the ∆P55 still retained half level of the WT (Figure 2f), which

186 indicated that P55 is not essential for H3K27me3 modification as the core subunits.

187 Furthermore, the decreased levels of H3K27me3 in the mutants were completely

188 restored in the complementary strains respectively (Figure 2f). Meanwhile the levels of

189 H3K4me3 and H3K36me3 had no obvious change in all aforementioned strains by

190 comparing with that of WT (Figure S2). We conclude that Kmt6, Suz12 and Eed are

191 fully and specifically required for H3K27me3 modification, while P55 partially

192 contributes to H3K27me3 modification.

193

194 All PRC2 subunits are required for mycelia growth, conidiation, and

195 pathogenicity in M. oryzae

196

197 To investigate the function of PRC2 complex in M. oryzae, mycelia growth and

198 conidiation were assessed in the ∆kmt6, ∆eed, ∆suz12, ∆p55, as well as their

199 complementary strains. Similar with the ∆kmt6, ∆suz12 and ∆eed strains exhibited

200 decreased mycelia growth and dramatically reduced conidiation, which had similar

201 phenotype with recent report (Zhang et al., 2021) (Figure 3a-c). Notably, ∆p55 had

202 more severe phenotype in the mycelia growth (Figure 3a-b), suggesting that P55 had

203 wider functions beside for acting as the bridge in the PRC2 complex. These results

204 indicated that H3K27me3 is required for the mycelia growth and conidiation in M.

205 oryzae.

206

207 To analyse the function of PRC2 components in pathogenicity, conidia of the WT,

208 mutant and complementary strains were collected and then inoculated on the

209 susceptible rice cultivar CO39 (Oryza sativa). As the number of conidia from mutants bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

210 highly reduced (15-25% of the WT) (Figure 3c), low concentration of conidia (5 × 104/

211 mL) were used in the rice seedling infection assay. Compared with WT, which caused

212 the characteristic spindle-shaped blast lesions with grey centres, mutant strains formed

213 relative fewer and restricted lesions (Figure 3d-e). To further decipher these

214 observations, the appressoria formation on the inductive hydrophobic surface and rice

215 sheath were investigated. Although no obvious change in appressoria formation at 24

216 hpi (hour post inoculation) was found in the mutant strains (data not shown), the

217 invasive growth displayed significant difference between the mutants and WT (Figure

218 3f). Nearly 90% appressoria from the WT strain successfully penetrated the rice sheath,

219 while only 60% appressoria from the deletion mutants were capable of penetration

220 (Figure 3f) at 40 hpi. Moreover, the formation of secondary invasive hyphae in the

221 mutant strains was less than that of WT. These results indicated that H3K27me3 is

222 necessary for penetration and invasive hyphal growth.

223

224 Core subunits of PRC2, together with P55, suppress genome-wide gene expression,

225 including effectors, at vegetative growth stage

226

227 To explore the roles of H3K27me3 in the transcriptional regulation in M. oryzae, high-

228 throughput sequencing (RNA-seq) was performed using the vegetative mycelia with

229 three biological repeats. As H3K27me3 always contributes to transcriptional silencing

230 on target genes, the mutant strains would be expected to enrich with high ratio of de-

231 repressed genes. As expected, totally 19.2%, 18.6%, 20.1% and 15.4% of genome-wide

232 genes were identified as up-regulated genes (UEG) with equal or greater than 2-fold

233 change (Log2 > 1, P<0.05), while only 5.3%, 6.0%, 8.8% and 3.3% of genes were

234 identified as down-regulated genes (DEG) in the ∆kmt6, ∆eed, ∆suz12 and ∆p55 strains

235 respectively (Log2 <-1, P<0.05) (Figure 4a). As the core subunits of PRC2, ∆kmt6, ∆eed

236 and ∆suz12 shared 80-86% overlaps (2144 genes) in their UEG (Figure S3a). The high

237 ratio of co-regulated genes further indicated that Kmt6, Eed and Suz12 function in the

238 same complex. Moreover, the predominant roles of de-repressed regulation in the

239 mutants of core subunits suggested that H3K27me3 modification played conserved bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

240 roles as transcriptional repressors in M. oryzae (Figure 4a). Although P55 was thought

241 as additional subunit which was different from other three core subunits, there was no

242 obvious difference in the gene sets between the ∆kmt6-UEG and ∆p55-UEG strains

243 (P=0) (Figure S3b). These results further confirmed that core subunits of PRC2,

244 together with P55, function in the same complex and regulate similar biological

245 processes.

246

247 To explore the detailed biological process involved in PRC2, Gene Ontology (GO)

248 analysis was conducted with ∆kmt6-UEG. Biological process as “interaction with host

249 via secreted protein” were significantly enriched (Figure S3c). This was consistent with

250 our hypothesis that H3K27me3 modification contributes to suppress the expression of

251 effectors at vegetative growth stage. To further address this question, gene sets of

252 putative genome-wide effectors, including 134 (only 124 effectors had reads in our

253 RNA-seq) and 247 (only 246 effectors had reads in our RNA-seq) effectors from two

254 different literatures respectively, were extracted for further analysis (Sharpee et al.,

255 2017, Dong et al., 2015). Compared with the WT, nearly 51.6% (64/124) and 42.7%

256 (105/246) effectors exhibited significantly increased expression in the ∆kmt6 strain

257 (Figure 4b and S4). To preclude the specificity of strain background, similar analysis

258 was performed with the ∆kmt6 mutant in the Guy11 background. The ratio of up-

259 regulated effectors in the ∆kmt6 either in B157 or Guy11 background were significantly

260 enriched with similar tendency (Figure 4b and S5a-c). We concluded that H3K27me3

261 is specifically required in the suppression of effectors during vegetative growth stage

262 in M. oryzae.

263

264 In addition, loss of H3K27me3 modification not only activated the expression of

265 effectors, but also activated some infection-specific genes such as those encoding

266 cutinases and cell-wall degrade enzymes, which indicated that the absence of

267 H3K27me3 could partially mimic host-derived signal. Therefore, we compared the

268 gene sets between ∆kmt6-UEG and UEG from 36 hpi and 72 hpi in planta from

269 published RNA-seq respectively (Jeon et al., 2020). The results showed that 30.1% bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

270 (820/2654) of 36 hpi-UEG and 33.1% (778/2353) 72 hpi-UEG were significantly

271 overlapped with ∆kmt6-UEG (Figure S6a-b).

272

273 H3K27me3 occupancy is associated with increased transcription in the PRC2

274 mutants

275

276 To further depict whether H3K27me3 directly deposits on the chromatin of effectors,

277 we attempted to map the genome-wide H3K27me3 occupancy using chromatin

278 immunoprecipitation assay followed by high-throughput sequencing (ChIP-seq) in the

279 WT and ∆kmt6 strains. The intensity of H3K27me3 occupancy in the ∆kmt6 mutant

280 was barely detectable (Figure S7a), which was consistent with the role of Kmt6 as the

281 H3K27me3 writer in M. oryzae. Compared with the ∆kmt6 mutant, totally 1082

282 significant peaks were identified in the WT (Log2 > 1, P < 0.05), which were

283 corresponded to 1033 genes and mainly spread within gene bodies (Supplemental

284 Figure 7a-b). To verify whether ∆kmt6-UEG were directly associated with the loss of

285 H3K27me3 occupancy, the gene sets between ∆kmt6-UEG under low or high threshold

286 and H3K27me3-marked genes were compared. With low threshold (Log2 > 1, P < 0.05),

287 23.5% (645 of 2743) of ∆kmt6-UEG were marked with directly H3K27me3 occupancy

288 (Figure S7c). while with stringent threshold (Log2 > 3, P < 0.05)，40.1% (532 of 1327)

289 of ∆kmt6-UEG were marked with H3K27me3 (Figure S7c). Together, the de-repressed

290 genes in the ∆kmt6 are highly correlated with the absence of H3K27me3 occupancy.

291

292 Next, GO analysis was conducted with H3K27me3-occupancy genes. Biological

293 process “interaction with host via protein secreted” were highly enriched (Figure 4c),

294 similar with the results from the ∆kmt6-UEG. Significantly, 26.7% (33 of 124) and 19.9%

295 (49 of 246) of effectors were directly marked with H3K27me3 modification (Figure 4d

296 and S7d). The chromatin of representative effectors as BAS3, BAS4, SPD5 and SPD10

297 enriched with H3K27me3 modification in the WT but nearly undetectable in the ∆kmt6

298 mutant (Figure 4e). Consistently, the increased expression of examined effectors

299 accompanied with almost undetectable H3K27me3 level in the ∆kmt6 with ChIP-qPCR bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

300 assay (Figure 1a and 4f). In addition, gene sets of 36 hpi-UEG and 72 hpi-UEG in

301 planta were also highly marked with H3K27me3 (Figure S6a-b) and the chromatin state

302 of four cutinases loci was validated with ChIP-qPCR (Figure S7e). These results further

303 indicated that the H3K27me3 modification directly associates with transcriptional

304 silencing on the effectors and infection-specific genes.

305

306 P55 recruits Sin3 histone deacetylase complex to form a co-suppression complex

307

308 How PRC2 performs stable transcriptional silencing on the target chromatin in the

309 absence of PRC1 remains unclear (Ridenour et al., 2020, Margueron and Reinberg,

310 2011). As a chromatin assembling factor and histone-binding WD40-repeat proteins,

311 ortholog of the additional subunit P55 was reported to associate with other co-

312 suppression complex to conduct transcriptional silencing in other organisms (Mehdi et

313 al., 2016, Gu et al., 2011). As the additional subunit of PRC2 in M. oryzae, P55 acts as

314 the bridge to connect other core subunits together and ∆p55 exhibited more severe

315 phenotype than other mutants in our experiments. We postulated that P55 may recruit

316 other co-suppression machinery to help PRC2 to stably maintain polycomb silencing.

317 To address this possibility, P55 was fused to the bait vector and putative histone

318 deacetylases were cloned individually in the prey vector for yeast-two-hybrid assays.

319 As a result, we found that P55 interacted with four components of Sin3 histone

320 deacetylases complex in yeast two-hybrid assays (Figure 5a). Sin3 histone deacetylases

321 complex has been well characterized in yeast and other organisms (Huang et al., 2019,

322 Grzenda et al., 2009, Adams et al., 2018), which the core components of Sin3 histone

323 deacetylase complex includes histone deacetylase Hos2 (MGG_01633)(Lee et al.,

324 2019), major regulatory protein Sin3 (MGG_13498), other subunits Sap18

325 (MGG_05680) and Sap30 (MGG_11142) in M. oryzae. Moreover, Sap30 interacted

326 with other three components as Hos2, Sin3 and Sap18 in yeast which indicated that

327 these components function in the same complex (Figure S8a). Coimmunoprecipitation

328 assays with the strains expressing P55-GFP/Sin3-Flag, and P55-GFP/SAP18-Flag

329 further confirmed that P55 is physically associated with Sin3-HDAC in vivo (Figure bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

330 5b-c).

331

332 To explore the function of Sin3-HDAC in M. oryzae, the deletion mutants of Sin3,

333 Sap18 and Sap30 were created. Among these mutants, ∆sin3 exhibited severe

334 phenotype similar to ∆p55, including decreased fungal growth, severely reduced

335 conidiation, as well as highly reduced pathogenicity (Figure 5d-h). To investigate

336 whether Sin3-HDAC contributes to the histone deacetylation activity in vivo, the global

337 levels of histone acetylation were checked in the WT and ∆sin3 strains. Among the

338 examined acetylated residues, at least the levels of H3K4ac, H3K27ac and H4K5ac

339 were significantly increased in the ∆sin3 strain than that of WT (Figure 6a and S8b).

340 The increased level of H3K4ac in the ∆sin3 was further confirmed by ChIP-seq assay.

341 The global H3K4ac occupancy in the ∆sin3 was significantly increased than that of WT,

342 which further confirmed that Sin3-HDAC has histone deacetylation activity in M.

343 oryzae (Figure S8c). As loss of histone deacetylation would accompany with genome-

344 wide gene activation, we conducted RNA-seq with total RNA extracted from the ∆sin3

345 and WT strains. In the vegetative growth stage, deletion of Sin3 dramatically altered

346 the expression of nearly 38% of genome-wide genes compared with WT. Totally, 3049

347 genes were up-regulated (Log2 > 1, P < 0.05), and 1454 genes were down-regulated

348 (Log2 < -1, P < 0.05) which implied that Sin3 also acts as a transcriptional repressor

349 similar with P55 and Kmt6 (Figure 6b). Based on these results, we conclude that Sin3-

350 HDAC contributes to histone deacetylation activity and acts as a transcriptional

351 repressor to regulate genome-wide gene expression in M. oryzae.

352

353 Sin3-HDAC co-operates with PRC2 to prompt transcriptional repression on the

354 target genes

355

356 To explore the transcriptional correlation between Sin3-HDAC and PRC2, the

357 transcriptional profiles of the ∆sin3 and ∆kmt6 strains were compared. A total of 1489

358 genes which were 54.3% of ∆kmt6-UEG and 48.8% of ∆sin3-UEG were significantly

359 overlapped (P=0) (Figure 6c). To further address whether Sin3-HDAC contributes to bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

360 H3K27me3-mediated transcriptional silencing, we investigated whether ∆sin3-UEG

361 are enriched with H3K27me3 occupancy. The results showed that with lower stringent

362 threshold (Log2 > 1, P < 0.05), 16.2% (495 of 3049) of ∆sin3-UEG were occupied with

363 H3K27me3 modification. While with higher stringent threshold (Log2 > 3), 26.8% (396

364 of 1478) of ∆sin3-UEG were directly associated with H3K27me3 occupancy (Figure

365 6d). Meanwhile, enhanced H3K4ac and H4K5ac levels were also observed in the

366 ∆kmt6 and other PRC2 deletion mutants (Figure S8d). These results suggested that

367 Sin3-mediated histone deacetylation contributes to PRC2-mediated transcriptional

368 silencing on the target genes.

369

370 Next, GO analysis was conducted with ∆sin3-UEG. The term of “interaction with

371 host via protein secreted” were highly enriched (Figure S9), which was similar with

372 the results from RNA-seq in the ∆kmt6 strain, indicating that Sin3-HDAC and PRC2

373 may coordinately regulate the expression of effectors. Therefore, the putative effectome

374 that includes 124 and 246 predicted members were further investigated in the ∆sin3-

375 UEG (Dong et al., 2015, Sharpee et al., 2017). The results showed that 49.2% (61 of

376 124, 121/246) predicted effectors exhibited significantly increased expression in the

377 ∆sin3 strain (Figure 6e). To verify these results from RNA-seq analysis, RT-qPCR was

378 performed with three independent repeats in the WT and ∆sin3 strains. Consistently,

379 the expression of the BASs and SPDs in ∆sin3 were significantly de-repressed in the

380 vegetative growth stage (Figure 6f). In addition, a precocious and significant induction

381 of BAS4-GFP signal was found in the conidia and vegetative hyphae of ∆sin3, thus

382 indicating that deletion of Sin3 leads to Bas4 accumulation and secretion during the

383 vegetative growth stage (Figure S10).

384

385 Taken together, these results conclude that P55 recruits Sin3-HDAC as a co-

386 repressor complex to maintain stably transcriptional silencing on the target genes,

387 including a large scale of effectors, during vegetative growth in M. oryzae.

388

389 H3K27me3 modification is “erased” from the chromatin of effectors loci during M. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

390 oryzae–rice interaction

391 To address whether the activated expression of effectors during infection stage is

392 associated with reduced H3K27me3 occupancy, we attempted to conduct ChIP-qPCR

393 to check H3K27me3 enrichment on chromatin of the effectors as BAS3, BAS4, SPD5

394 and SPD10 using in vivo infected rice leaves with the WT strain. The results showed

395 that expression of four tested effectors was significantly induced from 24 hpi to 72 hpi

396 (Figure 7a). Subsequently, 72 hpi-infection leaves were collected for ChIP assay.

397 Compared with the mycelia, the relative H3K27me3 abundance of 72 hpi-infection

398 leaves dramatically reduced at the chromatin regions of BAS3, BAS4 and SPD5, except

399 SPD10, which indicated that the activated expression of effectors would be partially

400 caused by removing of H3K27me3 modification (Figure 7b).

401

402 Discussion

403

404 In this study, we have revealed how H3K27me3 modifies the expression of genome-

405 wide effectors and contributes to infection of M. oryzae. Suppression of H3K27me3

406 improperly activated the expression of effectors in the vegetative growth stage, as well

407 as highly decreased pathogenicity. We also revealed a new mechanism that the

408 additional subunit P55 acts as the bridge to connect core subunits to form a complex

409 and recruits Sin3-HDAC to prompt H3K27me3 occupancy on the effectors, therefore

410 stably maintain polycomb silencing in the absence of PRC1. During invasive growth

411 stage, the repressed chromatin state on effectors is partially “erased”, subsequently the

412 expression of effectors is activated to promote the infection of M. oryzae.

413

414 Epigenetic modification was correlated with genome plasticity and stability, help

415 pathogen effective adaption to host environments (Chadha and Sharma, 2014, Wang et

416 al., 2020, Cavalli and Heard, 2019). In M. oryzae, epigenetic modification as histone

417 (de)methylation and (de)acetylation have been extensively explored in different

418 biological processes such as infection structure morphogenesis, developmental

419 transition and autophagy. Histone deacetylases Tig1 and Hos2 regulate infectious bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

420 growth and asexual development in M. oryzae (Ding et al., 2010, Lee et al., 2019).

421 H3K4 methyltransferase Set1 contributes to appressorium formation, conidiation and

422 pathogenicity with transcriptional activation on the infection-related genes (Pham et

423 al., 2015). Histone acetyltransferase Gcn5 negatively regulates light-induced

424 autophagy and conidiation through acetylated the autophagy protein Atg7 (Zhang et al.,

425 2017). MoSNT2 plays key roles in infection-associated autophagy through recruiting

426 histone deacetylase complex on the target chromatin (He et al., 2018). Recently, Zhang

427 et al. elucidated that H3K27 dynamics associate with altered transcription of in planta

428 induced genes, including effectors, in M. oryzae (Zhang et al., 2021). In our study, we

429 found that all core subunits of PRC2, together with the additional subunit P55, are

430 required for H3K27me3-meditating polycomb silencing on the effectors in the

431 vegetative growth stage and pathogenicity. Our results also revealed that histone

432 modification H3K27me3, coordinately mediated by PRC2 and Sin3 histone

433 deacetylase complex, directly suppresses most of the genome-wide effectors

434 expression. Previous studies suggested that pathogen effectors are rapidly evolved and

435 especially distributed in regions with high genome plasticity. In M. oryzae, effectors do

436 not have common motifs or conserved cis-elements that contribute to their adaptability

437 to host environment (Sanchez-Vallet et al., 2018, Dong et al., 2016). Thus, H3K27me3

438 seems to preferentially modify the poorly conserved or newly evolved effectors to

439 “guard” the genome through transcriptional silencing (Dong et al., 2015, Sanchez-

440 Vallet et al., 2018, Fouche et al., 2018). Whenever necessary, such as in response to the

441 host environment, fungal pathogens redistribute H3K27me3 and evoke transcriptional

442 activation, then the activated effectors help the pathogens to better adapt to and

443 colonize their host (Fouche et al., 2018).

444

445 Polycomb silencing has been extensively studied in multicellular organisms, which

446 is conserved from Drosophila to mammals and higher plants, as well as in the fungi

447 kingdom (Margueron and Reinberg, 2011, Ridenour et al., 2020, Wiles and Selker,

448 2017, Schuettengruber et al., 2017). The core subunits Kmt6, Suz12 and Eed are

449 necessary for H3K27me3 modification and transcriptional silencing (Wiles and Selker, bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

450 2017). However, the role of P55, the additional subunit of PRC2, remains obscure in

451 fungi. In F. graminearum, the homolog of subunit p55 is not involved in H3K27me3

452 modification (Ridenour et al., 2020). In N. crassa, P55 (NPF) is critical for H3K27me3

453 in a region-dependent manner (Jamieson et al., 2013). In our research, we found that

454 P55 plays a critical role in H3K27me3-mediated transcriptional silencing in M. oryzae.

455 First, P55 acts as the bridge to connect three core components together. Second,

456 disruption of P55 largely reprograms gene expression, which significantly overlaps

457 with those of Δkmt6 and is directly associated with H3K27me3 occupancy. Third, P55

458 recruits Sin3-HDAC to form the co-suppression complex with PRC2.

459

460 The Sin3-HDAC corepressor complex is usually associated with a large number of

461 DNA-binding transcription factors or corepressors to achieve specific and timely

462 regulation of local chromatin and transcription (Grzenda et al., 2009). In Sin3 histone

463 deacetylase complex, Sap30 serves as the bridge and stabilizing molecule and Sap18

464 also involves in the apoptosis and splicing associated protein (ASAP) complex (Adams

465 et al., 2018, Grzenda et al., 2009, Julia I. Qüesta, 2016). In our study, we found that

466 P55 recruits Sin3 histone deacetylase complex to form co-suppression complex.

467 Furthermore, Sin3 functions as a transcriptional repressor and participates in the

468 effectors-related biological process similar to PRC2. All these results suggested that

469 Sin3-HDAC would promote H3K27me3 occupancy and facilitate PRC2 machinery in

470 stably maintaining condensed chromatin status and achieving gene silencing

471 coordinately. In addition, it is possible that Sin3-associated transcription factors or

472 corepressors help H3K27me3 recruitment properly (Adams et al., 2018). This finding

473 not only provides a plausible explanation that PRC2 could stably maintain

474 transcriptional silencing in the absence of PRC1, but also elucidates the molecular clue

475 of transcription output caused by crosstalk between histone methylation and

476 (de)acetylation in M. oryzae.

477

478 Establishment and maintenance H3K27me3 to local chromatin depends on histone

479 “reader” and series of trans/cis-regulatory factors which act in corporate or alone bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

480 (Kassis and Brown, 2013, Xiao et al., 2017). One of the best example of epigenetically

481 reprograming is regulation of floral repressor Flowering Locus C (FLC) under

482 vernalization (winter cold exposure) in model plant Arabidopsis (Luo and He, 2020).

483 In our study, we found that the silenced effectors would be de-repressed with reduced

484 H3K27me3 occupancy during invasive growth stage. Consistent with FLC as

485 molecular switch to “remember” vernalization in Arabidopsis (Luo and He, 2020),

486 transcriptional reprogramming of some specific effectors in M. oryzae may act as the

487 molecular switch to “remember” the host environment. However, it is still unknown

488 how the repressed chromatin is “erased” and how the activated state is established

489 during invasive growth stage. Given the destined effectors, it is worthy to further

490 elucidate these detailed mechanisms.

491 492 Materials and Methods 493 Fungal strains and culture conditions 494 495 The M. oryzae WT strain B157 and Guy11 were used as background strain to obtain 496 transformants in this study, which were kind gifts from the Indian Institute of Rice 497 Research (Hyderabad, India). All the WT in this study is B157, except for those marked 498 with Guy11. For growth assessment of M. oryzae, strains were grown on the prune agar 499 medium (PA) for 7 d (Kou et al., 2017). For conidiation, strains were grown on CM 500 medium at 28℃ in the dark for 2 d, followed by growth under continuous lights for 5 501 d. 502 503 Plasmid construction 504 505 To create the deletion mutants of KMT6, Eed, Suz12, P55, Sin3, Sap18 and Sap30, the 506 standard one-step gene replacement strategy was used in this study. Briefly, 507 approximate 1-kb of 5'UTR and 3'UTR regions were amplified and ligated sequentially

508 to the flanking of Hygromycin，Sulf or Bar gene cassette in the pFGL821 (Addgene,

509 58223), pFGL820 (Addgene, 58222) or pFGL822 (Addgene, 58225) respectively (Kou 510 et al., 2017). The sequences of plasmids were confirmed by sequencing and 511 subsequently introduced into the B157 strain by Agrobacterium tumefaciens mediated bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

512 transformation (ATMT). To generate the localization and complementary vectors, the 513 eGFP and TrpC terminator were cloned to pFGL820 to obtain pFGL820-GFP-TrpC 514 terminator. The fragments containing about 1.5-kb of promotor and coding region were 515 amplified (primers listed in Table S2) and then cloned to pFGL820-GFP-TrpC 516 terminator. After conformed by sequencing, the resultant plasmids were introduced into 517 corresponding deletion mutants respectively by ATMT. 518 519 To generate the constructs of pRP27-KMT6-Flag, pRP27-Suz12-Flag and pRP27- 520 P55-Flag for co-immunoprecipitation assay, the coding sequence were cloned to 521 pFGL822-pRP27-Flag or pFGL820-pRP27-eGFP. The confirmed plasmids were 522 introduced into deletion mutants respectively by ATMT. Primers used in the 523 experiments were listed in Table S2. 524 525 Live cell imaging and image processing 526 527 The CM cultivated hypha were stained with 100 μg/mL Hoechst 33342 (Sigma, 14533) 528 for 20 min to visualize nuclei. Live cell epifluorescence microscopy imaging was 529 performed with LSM700 (CarlZeiss Inc.), using the requisite conditions established for 530 detecting GFP or Hoechst signals. Image processing was performed using image J 531 (http://fiji.sc/wiki/index.php/Fiji). These experiments were conducted with two 532 independent repeats. 533 534 Appressorial formation assay 535 536 For appressoria formation assay, conidia were harvested from 7-d-old cultures and 537 resuspended in sterile water at a concentration of 105 conidia per mL. 10 μL droplets of 538 the conidial suspension were inoculated on the hydrophobic plastic cover slips and 539 incubated in high humidity at room temperature (Kou et al., 2017). The appressoria 540 were quantified at 24 hpi. Photographs were taken with an Olympus BX53 wide field 541 microscope equipped with bright field optics. 542 543 Rice seedling and rice sheath infection assay 544 545 Rice seedling infection assays were performed as described with 5x104/ mL conidial bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

546 suspension (Kou et al., 2017). Disease symptoms of infection assays were assessed on 547 7 dpi. The infection assays were repeated three times. For the invasive hyphal 548 development assay, 21-d-old healthy rice seedlings (CO39) were used for sheath 549 preparation. Conidial suspension was inoculated into the rice sheath and incubated in 550 the growth chamber with the photoperiod of 16-h light and 8-h dark at 25°C. The 551 inoculated sheath was trimmed manually and observed by using an Olympus BX53 552 wide field microscope at 40 hpi. 553 554 Yeast two-hybrid analysis 555 Yeast two-hybrid assays were performed in the yeast strain Y2Hgold with Matchmaker 556 two-hybrid system (Clontech) according to manufacturer’s instruction. The baits and 557 preys were cloned to pGADT7 and pGBKT7 respectively. The transformants were 558 grown on the basic medium without tryptophan and leucine at 30°C for about 2 d, and 559 subsequently the direct interaction between two proteins were tested with grown on the 560 selective medium without tryptophan, leucine, histidine and adenine for 4-6 d. 561 562 Western blotting analysis 563 564 For detecting Flag/GFP-tagged proteins, 0.1 g mycelia cultured in the liquid CM for 2 565 d were collected. Total protein was extracted with lysis buffer (50 mM Tris-HCl pH 566 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton 100 and 1 × protein inhibitor). The 567 resulting protein was separated by 8-15% SDS polyacrylamide gel electrophoresis 568 (SDS-PAGE) and transferred to PVDF membrane, subsequently detected by 569 immunoblotting with anti-Flag (Sigma, A8592) or anti-GFP (Abcam, ab290) antibody. 570 571 For detecting histones, the nuclei of 0.5 g mycelia were isolated with extraction

572 buffer (20 mM Tris pH 7.5, 20 mM KCl, 2 mM MgCl2，25% Glycerol, 250 mM Sucrose,

573 0.1 mM PMSF, 5 mM beta-mercaptoethanol, 1 × proteinase inhibitors) and filtered 574 through two layers of Miracloth (Millipore). Then the histones were extracted with lysis 575 buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton 100 and 1 × 576 protein inhibitor). Total histones were separated by 15% SDS-PAGE gel and protein 577 blots were detected with anti-H3 (Millipore, 06-755), anti-H3K27me3 (Abcam, 578 ab6002), anti-H3K4me3 (Abcam, ab1012), anti-H3K36me3 (Abcam, ab9050), anti- bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

579 H3K4ac (Active motif, 39381), anti-H3K9ac (PTMBIO, PTM-112), anti-H3K18ac 580 (PTMBIO, PTM-158), anti-H3K27ac (Abcam, ab177178) and anti-H4K5ac (Millipore, 581 07-327) antibody. The relative intensity of Western blots was quantified by Image J 582 software. 583 584 Co-immunoprecipitation assays 585 586 To perform co-immunoprecipitation assays, 0.5 g mycelia cultured in the liquid CM for 587 2 d were harvested. Total protein was extracted with lysis buffer (50 mM Tris-HCl pH 588 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton 100 and 1 × protein inhibitor) and 589 subsequently precipitated with anti-Flag M2 Magnetic beads (Sigma, M8823) or GFP- 590 Trap (Chromotek, gtma-20) respectively according to the manufacture’s instruction. 591 The precipitated protein and input control were detected by the Western blotting with 592 anti-Flag (Sigma, A8592) or anti-GFP (Abcam, ab290) antibody. 593 594 mRNA expression analysis with RT-qPCR 595 596 Total RNA was extracted from CM cultivated mycelia for 2 d from three biological 597 repeats using the TRIzol (Invitrogen, USA) reagent. Subsequently total RNAs were 598 reversely transcribed into cDNAs with commercial kits (TOYOBO, FSQ-301) 599 according to the manufacturer’s instruction. RT-qPCR was performed using SYBR 600 Green qPCR Master Mix (TOYOBO, QST-100) in the LightCycler480 system (Roche). 601 The constitutively expressed tubulin gene (MGG_00604) was used as endogenous 602 control to normalize amount of cDNA templates. Primers used in the experiments were 603 listed and described in Supplemental Table 2. 604 605 RNA-seq analysis 606 607 Total RNA was extracted from mycelia from three biological repeats using the TRIzol 608 (Invitrogen, USA) reagent according to the manufacturer’s instruction. RNAs were 609 sequenced separately at Novogene, using Illumina Hiseq X-Ten with Hiseq-PE150 610 strategy. The clean reads were mapped to the reference genome of M. oryzae (M. oryzae 611 70-15 assembly MG8 from NCBI) using TopHat software with default settings 612 (Daehwan Kim, 2013). For analysis of differential expression, the assembled transcripts bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

613 from three independent biological replicates in the WT and deletion mutants were 614 included and compared using Cuffdiff with default settings (Trapnell et al., 2010). Gene 615 with false discovery rate (FDR) threshold of 0.05 in conjunction with at least 2-fold 616 change in expression level was considered differentially expressed. To calculate the 617 significance of the overlap of two gene sets, P value with Fisher’s exact test for 618 overlapping was performed on online (the total number of genes in the M. oryzae 619 genome used was 14317) (http://nemates.org/MA/progs/overlap_stats.html). GO 620 analysis for enriched biological processes was perform using DAVID 621 (https://david.ncifcrf.gov/home.jsp) with default settings. 622 623 ChIP and ChIP-seq analysis 624 625 The ChIP experiments with mycelia were conducted as previous reports with minor 626 modification (He et al., 2018, Tao et al., 2017). Briefly, 1 g mycelia were crosslinked 627 with 1% formaldehyde for 20 mins and stopped with 125 mM glycine for 5 mins at 628 room temperature. Samples were ground with liquid nitrogen and resuspended in the 629 nuclei isolating buffer (10 mM Tris pH 8.0, 10 mM Sodium butyrate, 400 mM Sucrose, 630 0.1 mM PMSF, 5 mM Beta-Mercaptoethanol, 1 × proteinase inhibitors). Subsequently 631 the precipitated nuclei were used to total chromatin extraction with 1 mL lysis buffer 632 (50 mM HEPES pH7.5, 150 mM NaCl, 1mM EDTA, 10 mM Sodium butyrate, 0.1% 633 deoxycholate, 0.1% SDS, 1% Triton X-100, 1mM PMSF and 1 × Roche protease 634 inhibitor Cocktail). The obtained chromatin was sonicated into DNA fragments

635 between 200-500 bp using Diagenode Bioruptor (high setting, 16 cycles，every cycle

636 with 30 seconds “on” and 30 seconds “off”). 20 μL chromatin solution? was used to 637 input DNA extraction and the remainder was pre-cleared with 10 μL protein A 638 Dynabeads (Thermofisher, 10001D) for 1 h. Then, the chromatin was incubated with 639 anti-H3K27me3 (Abcam, ab6002) or anti- H3K4ac (Active Motif, 39381) overnight at 640 4°C. Another 20 μL protein A Dynabeads was used to capture protein-DNA mixture 641 and washed for three times. Protein-DNA mixture was reverse-crosslinked, and DNA 642 was recovered with phenol-chloroform extraction. The recovered DNA was used as 643 template for followed ChIP-qPCR and ChIP-seq. Two biological repeats were carried 644 out. 645 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

646 For ChIP-seq assay, the purified DNA was used as library construction with the 647 NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, E7645L). High- 648 throughput sequencing was carried out using Illumina Hiseq-PE150 by Novogene 649 Corporation (Beijing, China) for Illumina (Langmead et al., 2009). Subsequently the 650 clean read pairs were mapped to the reference genome with Bowtie2 (Version 2.2.8) 651 (Langmead and Salzberg, 2012) and enriched peaks were called by MACS2 (Version 652 2.1.1) with default parameters (Zhang et al., 2008). The data was imported into the 653 integrative genomics viewer (IGV) for visualization (James T Robinson, 2011). To 654 assign peaks to proximal genes, the distance of 3-kb flanking the peak summit were 655 extracted. To validate ChIP-seq results, ChIP-qPCR assay with two independent repeats 656 was performed. The level of examined fragments was relative to internal reference gene 657 TUB5 using quantitative real-time PCR. The PCR primers were listed and described in 658 Table S2. 659

660 Data availability

661

662 The ChIP-seq and RNA-seq datasets generated in this article were deposited in the Gene

663 Expression Omnibus (GEO) under the accession number GSE166690. 664

665 Acknowledgments

666

667 We thank Dr. Naweed I. Naqvi of the National University of Singapore for helpful

668 suggestions and critically reading manuscript. Thanks to Dr. Zhou Ming of Zhejiang

669 University for help of bioinformatics analysis. Thanks to Dr. Qi Zhenyu of agricultural

670 experimental station of Zhejiang University for controlling the light environment of

671 artificial climate chamber.

672

673 Funding

674

675 This research was supported in part by the National Natural Science Foundation of

676 China (31970534 to Z.T., 32000103 to Y.K.), the Fundamental Research Funds for the bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

677 Central Universities (2019QNA6014 to Z.T.), key R&D project of China National Rice

678 Research Institute, grand number “CNRRI-2020-04”, and Open Project Program

679 (20190301 to Z.T.) of State Key Laboratory of Rice Biology. This project was supported

680 by the Chinese Academy of Agricultural Sciences under the “Elite Youth” program, the

681 Agricultural Sciences and Technologies Innovation Program and Hundred-Talent

682 Program of Zhejiang University.

683 The funders had no role in the design of the study; in the collection, analyses, or

684 interpretation of data; in the writing of the manuscript, or in the decision to publish the

685 results.

686

687 Author contributions

688

689 Y.K. and Z.T. conceived and designed the experiments; Y.K., J.Q. and Z.W. performed

690 the experiments; H.S., C.L., J.Y., Z.L. and W.X. provided technical assistance and

691 contributed reagents/materials/analysis tools; Y.K. and Z.T. wrote the paper.

692

693 Competing interests: The authors declare no conflict of interest.

694

695

696 References 697 ADAMS, G. E., CHANDRU, A. & COWLEY, S. M. 2018. Co-repressor, co-activator and general transcription 698 factor: the many faces of the Sin3 histone deacetylase (HDAC) complex. Biochem J, 475, 3921- 699 3932. 700 BLACKLEDGE, N. P., ROSE, N. R. & KLOSE, R. J. 2015. Targeting Polycomb systems to regulate gene 701 expression: modifications to a complex story. Nat Rev Mol Cell Biol, 16, 643-649. 702 CAVALLI, G. & HEARD, E. 2019. Advances in epigenetics link genetics to the environment and disease. 703 Nature, 571, 489-499. 704 CHADHA, S. & SHARMA, M. 2014. Transposable elements as stress adaptive capacitors induce genomic 705 instability in fungal pathogen Magnaporthe oryzae. PLoS One, 9, e94415. 706 CHUJO, T. & SCOTT, B. 2014. Histone H3K9 and H3K27 methylation regulates fungal alkaloid biosynthesis 707 in a fungal endophyte-plant symbiosis. Mol Microbiol, 92, 413-34. 708 CONNOLLY, L. R., SMITH, K. M. & FREITAG, M. 2013. The Fusarium H3K27me3 KMT6 regulates 709 development and expression of secondary metabolite gene clusters. PLoS Genet, 9, e1003916. 710 DAEHWAN KIM, G. P., COLE TRAPNELL, HAROLD PIMENTEL, RYAN KELLEY AND STEVEN L SALZBERG 2013. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

711 TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and 712 gene fusions. Genome Biol, 14, R36. 713 DING, S. L., LIU, W., ILIUK, A., RIBOT, C., VALLET, J., TAO, A., WANG, Y., LEBRUN, M. H. & XU, J. R. 2010. 714 The Tig1 histone deacetylase complex regulates infectious growth in the rice blast fungus 715 Magnaporthe oryzae. Plant Cell, 22, 2495-508. 716 DONG, Y., LI, Y., QI, Z., ZHENG, X. & ZHANG, Z. 2016. Genome plasticity in filamentous plant pathogens 717 contributes to the emergence of novel effectors and their cellular processes in the host. Curr 718 Genet, 62, 47-51. 719 DONG, Y., LI, Y., ZHAO, M., JING, M., LIU, X., LIU, M., GUO, X., ZHANG, X., CHEN, Y., LIU, Y., LIU, Y., YE, W., 720 ZHANG, H., WANG, Y., ZHENG, X., WANG, P. & ZHANG, Z. 2015. Global genome and 721 transcriptome analyses of Magnaporthe oryzae epidemic isolate 98-06 uncover novel effectors 722 and pathogenicity-related genes, revealing gene gain and lose dynamics in genome evolution. 723 PLoS Pathog, 11, e1004801. 724 DUMESIC, P. A., HOMER, C. M., MORESCO, J. J., PACK, L. R., SHANLE, E. K., COYLE, S. M., STRAHL, B. D., 725 FUJIMORI, D. G., YATES, J. R., 3RD & MADHANI, H. D. 2015. Product binding enforces the 726 genomic specificity of a yeast polycomb repressive complex. Cell, 160, 204-18. 727 FOUCHE, S., PLISSONNEAU, C. & CROLL, D. 2018. The birth and death of effectors in rapidly evolving 728 filamentous pathogen genomes. Curr Opin Microbiol, 46, 34-42. 729 GRZENDA, A., LOMBERK, G., ZHANG, J. S. & URRUTIA, R. 2009. Sin3: master scaffold and transcriptional 730 corepressor. Biochim Biophys Acta, 1789, 443-50. 731 GU, X., JIANG, D., YANG, W., JACOB, Y., MICHAELS, S. D. & HE, Y. 2011. Arabidopsis homologs of 732 retinoblastoma-associated protein 46/48 associate with a histone deacetylase to act 733 redundantly in chromatin silencing. PLoS Genet, 7, e1002366. 734 HE, M., XU, Y., CHEN, J., LUO, Y., LV, Y., SU, J., KERSHAW, M. J., LI, W., WANG, J., YIN, J., ZHU, X., LIU, X., 735 CHERN, M., MA, B., WANG, J., QIN, P., CHEN, W., WANG, Y., WANG, W., REN, Z., WU, X., LI, P., 736 LI, S., PENG, Y., LIN, F., TALBOT, N. J. & CHEN, X. 2018. MoSnt2-dependent deacetylation of 737 histone H3 mediates MoTor-dependent autophagy and plant infection by the rice blast fungus 738 Magnaporthe oryzae. Autophagy, 14, 1543-1561. 739 HUANG, F., YUAN, W., TIAN, S., ZHENG, Q. & HE, Y. 2019. SIN3 LIKE genes mediate long-day induction of 740 flowering but inhibit the floral transition in short days through histone deacetylation in 741 Arabidopsis. Plant J, 100, 101-113. 742 JAMES T ROBINSON, H. T., WENDY WINCKLER, MITCHELL GUTTMAN, ERIC S LANDER, GAD GETZ & JILL 743 P MESIROV 2011. Integrative genomics viewer. Nature, 29, 24-26. 744 JAMIESON, K., ROUNTREE, M. R., LEWIS, Z. A., STAJICH, J. E. & SELKER, E. U. 2013. Regional control of 745 histone H3 lysine 27 methylation in Neurospora. Proc Natl Acad Sci U S A, 110, 6027-32. 746 JEON, J., LEE, G. W., KIM, K. T., PARK, S. Y., KIM, S., KWON, S., HUH, A., CHUNG, H., LEE, D. Y., KIM, C. Y. & 747 LEE, Y. H. 2020. Transcriptome profiling of the rice blast fungus Magnaporthe oryzae and its 748 host Oryza sativa during infection. Mol Plant Microbe Interact, 33, 141-144. 749 JULIA I. QüESTA, J. S., NUNO GERALDO, HAILONG AN, CAROLINE DEAN 2016. Arabidopsis transcriptional 750 repressor VAL1 triggers Polycomb silencing at FLC during vernalization. 353, 485-488. 751 KASSIS, J. A. & BROWN, J. L. 2013. Polycomb group response elements in Drosophila and vertebrates. 752 Adv Genet, 81, 83-118. 753 KHANG, C. H., BERRUYER, R., GIRALDO, M. C., KANKANALA, P., PARK, S. Y., CZYMMEK, K., KANG, S. & 754 VALENT, B. 2010. Translocation of Magnaporthe oryzae effectors into rice cells and their bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

755 subsequent cell-to-cell movement. Plant Cell, 22, 1388-403. 756 KOU, Y., TAN, Y. H., RAMANUJAM, R. & NAQVI, N. I. 2017. Structure-function analyses of the Pth11 757 receptor reveal an important role for CFEM motif and redox regulation in rice blast. New Phytol, 758 214, 330-342. 759 LANGMEAD, B. & SALZBERG, S. L. 2012. Fast gapped-read alignment with Bowtie 2. Nat Methods, 9, 760 357-9. 761 LANGMEAD, B., TRAPNELL, C., POP, M. & SALZBERG, S. L. 2009. Ultrafast and memory-efficient 762 alignment of short DNA sequences to the human genome. Genome Biol, 10, R25. 763 LANZUOLO, C. & ORLANDO, V. 2012. Memories from the polycomb group proteins. Annu Rev Genet, 46, 764 561-89. 765 LEE, J., LEE, J. J. & JEON, J. 2019. A histone deacetylase, MoHOS2 regulates asexual development and 766 virulence in the rice blast fungus. J Microbiol, 57, 1115-1125. 767 LUO, X. & HE, Y. 2020. Experiencing winter for spring flowering: A molecular epigenetic perspective on 768 vernalization. J Integr Plant Biol, 62, 104-117. 769 MARGUERON, R. & REINBERG, D. 2011. The Polycomb complex PRC2 and its mark in life. Nature, 469, 770 343-9. 771 MEHDI, S., DERKACHEVA, M., RAMSTROM, M., KRALEMANN, L., BERGQUIST, J. & HENNIG, L. 2016. The 772 WD40 domain protein MSI1 functions in a histone deacetylase complex to fine-tune abscisic 773 acid signaling. Plant Cell, 28, 42-54. 774 MOSQUERA, G., GIRALDO, M. C., KHANG, C. H., COUGHLAN, S. & VALENT, B. 2009. Interaction 775 transcriptome analysis identifies Magnaporthe oryzae BAS1-4 as Biotrophy-associated 776 secreted proteins in rice blast disease. Plant Cell, 21, 1273-90. 777 NETEA, M. G., JOOSTEN, L. A., LATZ, E., MILLS, K. H., NATOLI, G., STUNNENBERG, H. G., O'NEILL, L. A. & 778 XAVIER, R. J. 2016. Trained immunity: A program of innate immune memory in health and 779 disease. Science, 352, aaf1098. 780 PHAM, K. T., INOUE, Y., VU, B. V., NGUYEN, H. H., NAKAYASHIKI, T., IKEDA, K. & NAKAYASHIKI, H. 2015. 781 MoSET1 (histone H3K4 methyltransferase in Magnaporthe oryzae) regulates global gene 782 expression during infection-related morphogenesis. PLoS Genet, 11, e1005385. 783 RIDENOUR, J. B., MOLLER, M. & FREITAG, M. 2020. Polycomb repression without bristles: facultative 784 heterochromatin and genome stability in fungi. Genes (Basel), 11, 638. 785 SANCHEZ-VALLET, A., FOUCHE, S., FUDAL, I., HARTMANN, F. E., SOYER, J. L., TELLIER, A. & CROLL, D. 2018. 786 The genome biology of effector gene evolution in filamentous plant pathogens. Annu Rev 787 Phytopathol, 56, 21-40. 788 SCHUETTENGRUBER, B., BOURBON, H. M., DI CROCE, L. & CAVALLI, G. 2017. Genome regulation by 789 Polycomb and Trithorax: 70 years and counting. Cell, 171, 34-57. 790 SHARPEE, W., OH, Y., YI, M., FRANCK, W., EYRE, A., OKAGAKI, L. H., VALENT, B. & DEAN, R. A. 2017. 791 Identification and characterization of suppressors of plant cell death (SPD) effectors from 792 Magnaporthe oryzae. Mol Plant Pathol, 18, 850-863. 793 TAO, Z., SHEN, L., GU, X., WANG, Y., YU, H. & HE, Y. 2017. Embryonic epigenetic reprogramming by a 794 pioneer transcription factor in plants. Nature, 551, 124-128. 795 TRAPNELL, C., WILLIAMS, B. A., PERTEA, G., MORTAZAVI, A., KWAN, G., VAN BAREN, M. J., SALZBERG, S. 796 L., WOLD, B. J. & PACHTER, L. 2010. Transcript assembly and quantification by RNA-Seq reveals 797 unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol, 28, 798 511-5. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

799 WANG, L., CHEN, H., LI, J., SHU, H., ZHANG, X., WANG, Y., TYLER, B. M. & DONG, S. 2020. Effector gene 800 silencing mediated by histone methylation underpins host adaptation in an oomycete plant 801 pathogen. Nucleic Acids Res, 48, 1790-1799. 802 WILES, E. T. & SELKER, E. U. 2017. H3K27 methylation: a promiscuous repressive chromatin mark. Curr 803 Opin Genet Dev, 43, 31-37. 804 XIAO, J., JIN, R., YU, X., SHEN, M., WAGNER, J. D., PAI, A., SONG, C., ZHUANG, M., KLASFELD, S., HE, C., 805 SANTOS, A. M., HELLIWELL, C., PRUNEDA-PAZ, J. L., KAY, S. A., LIN, X., CUI, S., GARCIA, M. F., 806 CLARENZ, O., GOODRICH, J., ZHANG, X., AUSTIN, R. S., BONASIO, R. & WAGNER, D. 2017. Cis 807 and trans determinants of epigenetic silencing by Polycomb repressive complex 2 in 808 Arabidopsis. Nat Genet, 49, 1546-1552. 809 ZHANG, S., LIANG, M., NAQVI, N. I., LIN, C., QIAN, W., ZHANG, L. H. & DENG, Y. Z. 2017. Phototrophy and 810 starvation-based induction of autophagy upon removal of Gcn5-catalyzed acetylation of Atg7 811 in Magnaporthe oryzae. Autophagy, 13, 1318-1330. 812 ZHANG, W., HUANG, J. & COOK, D. E. 2021. Histone modification dynamics at H3K27 are associated with 813 altered transcription of in planta induced genes in Magnaporthe oryzae. PLoS Genet, 17, 814 e1009376. 815 ZHANG, Y., LIU, T., MEYER, C. A., EECKHOUTE, J., JOHNSON, D. S., BERNSTEIN, B. E., NUSBAUM, C., MYERS, 816 R. M., BROWN, M., LI, W. & LIU, X. S. 2008. Model-based analysis of ChIP-Seq (MACS). Genome 817 Biol, 9, R137. 818 819 820 821 822 823 824 825 826 827 828 829 830 831 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

(a) 8 BAS1 3.2 BAS2 3.2 BAS3 100 BAS4 6 2.4 2.4 75

4 1.6 1.6 50

2 0.8 0.8 25

0 0 0 0 expression level A 320 SPD5 1000 SPD10 12 Avr-Pi9 320 ACE1

240 750 9 240

160 500 6 160

80 250 3 80 RelativemRN 0 0 0 0 WT Δkmt6 WT Δkmt6 WT Δkmt6 WT Δkmt6 (b)

Figure 1. Loss of KMT6 results in activation of effectors in the vegetative growth stage in M. oryzae. (a) Relative expression level of representative effectors in the WT and ∆kmt6 strains by qRT-PCR. The β-tubulin gene was used as the endogenous reference gene. Bar means standard error of three biological repeats. (b) Confocal microscopy image of Bas4-GFP in the vegetative and in planta growth stages of the WT and ∆kmt6 strains. In the WT, Bas4-GFP fluorescence is only presented in the in planta growth stage, while in the ∆kmt6, Bas4-GFP fluorescence could be detected in the conidia, apical hypha, subapical hypha and invasive hypha. Bar = 5 μm. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

(a) KMT6-GFP SUZ12-GFP EED-GFP P55-GFP GFP Hoechst Merged

(b) SD (-WL) SD (-WLHA) Kmt6 Suz12 Eed P55 AD Kmt6 Suz12 Eed P55 AD

Kmt6

Suz12

Eed

P55

(c) (d) (e) input IP with Flag input IP with Flag input IP with Flag Eed-GFP + + + + P55-GFP + + + + P55-GFP + + + + Suz12-Flag - + - + Kmt6-FLAG - + - + Kmt6-Flag - + - + Anti-GFP Anti-GFP Anti-GFP Anti-Flag Anti-Flag Anti-Flag (f) (g) input IP with Flag P55-GFP + + + + 1.00 0.08 0.04 0.06 0.34 1.04 0.89 0.77 1.15 Eed-FLAG - + - + H3K27me3 Anti-GFP

Anti-Flag H3

WT eed p55 kmt6 Δ Δ suz12 Δ eed-C p55-C Δ kmt6-C suz12-C Δ Δ Δ Δ Figure 2. Core subunits Kmt6, Eed, Suz12, together with P55, are involved in the Poly-comb repressive complex 2 in M. oryzae. (a) Confocal microscopy-based subcellular localization of PRC2 subunits fused with GFP. The GFP signal co-localized with Hoechst (10 μg/mL) stained nuclei. Bar = 5 μm. (b) Yeast-two-hybrid assay of PRC2 components Kmt6, Eed, Suz12 and P55. The bait and prey plasmids were co-transformed into yeast strain Y2Hgold respectively, then the transformants were grown on basal medium SD (-WL, without tryptophan and leucine) and selective medium SD (-WLHA, without tryptophan, leucine, histidine and adenine). (c-f) Co-immuoprecipitation (CoIP) was performed with the strains expressing both Kmt6-Flag and Suz12-GFP, P55-GFP and Kmt6-Flag, P55-GFP and Suz12-Flag, or P55-GFP and Eed-Flag. (g) Western blot detection of histone H3 and histone bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

methylation H3K27me3 in the WT, ∆kmt6, ∆eed, ∆suz12 and ∆P55 strains. The intensity abundance was measured and calculated relative to that of the WT. Two repeated biological experiments were carried out and the results were similar.

(a)

WT Δkmt6 Δkmt6-C Δsuz12 Δsuz12-C Δeed Δeed-C Δp55 Δp55-C (b) (c) 24

5 ) 2 4

/cm 18 5 3 12 2

Diameter (cm) Diameter 1 6

0 10 x Conidia(1 0

WT eed p55 WT eed p55 kmt6 Δ kmt6 Δ Δ suz12 Δ eed-C p55-C Δ suz12 Δ eed-C p55-C kmt6-CΔ Δ Δ kmt6-CΔ Δ Δ Δ suz12-C Δ suz12-C

(d) Δ (e) Δ

a (%) a

e R

WT WT kmt6 eed p55 kmt6 eed p55 Δ suz12 Δ eed-C Δ p55-C Δ suz12 Δ eed-C Δ p55-C kmt6-CΔ Δ Δ kmt6-CΔ Δ Δ Δ suz12-C Δ suz12-C (f) Δ Δ 120

100 type I

80 type II 60

40 type III 20

Infectious hyphae type (%) type hyphae Infectious type IV 0

WT eed p55 kmt6 Δ Δ suz12 Δ eed-C p55-C kmt6-C Δ suz12-C Δ Δ Δ Δ Figure 3. PRC2 complex is required for fungal growth and pathogenicity in M. oryzae. (a) Radical growth of the WT, ∆kmt6, ∆eed, ∆suz12, ∆P55 and their complementation strains. Colonies of indicated strains were grown on the PA medium for 7 d, then both up and bottom sides of colonies were imaged. (b) Statistical analysis of colonies diameters of tested strains on the PA medium. (c) Bar charts showing the conidia that produced in the indicated strain of M. oryzae. (d) Observation and statistical analysis of invasive hypha growth in rice sheath cells at 40 hpi. Four types of invasive hypha (illustrated in the right panel with corresponding column): no penetration, penetration with primary hyphae, with differentiated secondary invasive hyphae, and invasive hyphae spreading into neighbouring cells, were quantified. Data represents mean ± SD bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

of three independent repeats, with n = 300 appressoria per analysis. Scale bar = 5 μm. (e) Blast infection assays using rice seedlings (Oryza sativa L., cultivar CO39). Deletion of KMT6, EED, SUZ12 and P55 impaired the pathogenicity of M. oryzae. (f) Relative lesions area of indicated strains. The relative area of lesions was quantified by Image J software. Data represents the mean ± SD from three independent replicates.

(a) (b) 100% 2271 80% 2743 2671 2882 60% Δ

60.5% 40% 59.7% Δ

20%

fector genes fector f 0%

-20% 470 765 864 1257

-40% Number of e of Number

eed p55 kmt6 -60% Δ Δ Δ suz12 Δ >1 -1~1 <-1 NA -80% Fold change (log ) Up-regulated genes 2 -100% Down-regulated genes

metabolic process P = 3.9×10-11 effectors_124 transmembrane transport H3K27me3

interaction with host via protein secreted 91 33 1000 carbohydrate metabolic process xylan catabolic process

nucleoside metabolic process H3K27me3 0 10 20 30 Gene_counts (e)

WT input [0-300] BAS3 BAS4 SPD5 SPD10 WT IP [0-300] input [0-300] [0-300]

H3K27me3 IP WT [0-300] [0-100] [0-4000] [0-150] [0-300] [0-100] [0-4000] [0-150] Δkmt6

RNAseq 1.0 kb

(f) BAS3 BAS4 SPD5 SPD10 TUB5

1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 Relative Relative H3K27me3 enrichment to WT Δkmt6 WT Δkmt6 WT Δkmt6 WT Δkmt6 Figure 4. PRC2-mediated H3K27me3 activity is necessary for the suppression of effectors during vegetative growth stage in M. oryzae. (a) Summary of up- and down-regulated genes in the different PRC2 component mutants with RNA-seq analysis. The number at the top or bottom is the number of DEGs in the mutant. The Y-axis is the percentage of up- and down-regulated genes in all DEGs. Data was obtained from three independent biological repeats. (b) The distribution of 124 effectors based on the expression change in ∆kmt6-UEG (B157) and ∆kmt6-UEG (Guy11) compared with that of their WT respectively with our RNA-seq analysis. (c) GO analysis of H3K27me3 marked genes. (d) The Venn diagram showing statistically significant overlap between gene sets of H3K27me3 marked genes and putative 124 effectors. (e) Genome browser views of H3K27me3 occupancy from bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

ChIP-seq and expression pattern from RNA-seq of selected genes. ChIP-seq was conducted with two biological repeats. The number areas were reads per million (RPM). (f) ChIP-qPCR verified the enrichment of H3K27me3 at the chromatin of selected effectors. The examined regions were shown at the bottom. The relative enrichments were calculated by relative quantitation from two biological repeats, which was standardized with internal control TUB5, and then compared with that of WT. Bar represents standard error from three technical repeats.

(a) (b) P55 BD BD SD SD SD SD input IP with Flag AD (-WL) (-WLHA) (-WL) (-WLHA) P55-GFP + + + + Sin3-Flag - + - + Hos2 Anti-GFP Anti-Flag Sin3

(d) (e) Diameter (cm) Diameter

WT Δsin3 Δsin3-C Δsap18 Δsap30 T W Δsin3 Δsin3-CΔsap18Δsap30

(f) (g) (h)

)

/cm

Conidia (10 Conidia

e R

T T T W sin3 W W Δ sap18sap30 Δsin3 Δsin3 Δsin3-CΔ Δ Δsin3-CΔsap18Δsap30 Δsin3-CΔsap18Δsap30

Figure 5. P55 associates with Sin3-HDAC complex which is required for pathogenicity in M. oryzae. (a) Yeast-two-hybrid assay of P55 and Sin3-HDAC component HDAC, Sin3, Sap18, and Sap30. The bait and prey plasmids were co-transformed into yeast strain Y2Hgold respectively, then the transformants were grown on basal medium SD (-WL) and selective medium SD (-WLHA). (b-c) Co-immunoprecipitation assays were performed with the strains expressing Sin3-Flag and P55-GFP, Sap18-Flag and P55-GFP. (d-e) Radical growth of the SIN3-HDAC deletion strains on the PA medium cultured for 7 d. (f) Deletion of Sin3 resulted in decreased conidiation. (g-h) Sin3-HDAC is required for pathogenicity of M. oryzae. Rice seedling infection assay of the WT and Sin3-HDAC deletion strains with cultivar Co39. Similar results were obtained from two biological repeats. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

(a) 2.2 (b) 100% (c) H3K4ac 2743 2271 80% 3049 P = 0 1.6 60% Δkmt6_UEG Δsin3_UEG H3K9ac 40% 380 1.3 790 1174 H3K18ac 20% 0% 1109 1.3 464 386 H3K27ac -20% 470 P = 0 765 P = 0 2.0 -40% 1454 H4K5ac 312 -60% p55 sin3 kmt6 Δ Δ Δ H3 -80% Up-regulated genes Δp55_UEG -100% Down-regulated genes WT Δsin3

(d) (e) -140

P = 4.2×10 sin3

Δ 49.2% effectors Δsin3_UEG _124 （ in effectors_246 Log2>3)

538 99 396 1082 1472 49.2% effectors

Δsin3_UEG H3K27me3 -87 （Log >1) of Number P = 1.0×10 2 >1 -1~1 <-1 NA Fold change (log ) (f) 2 8 16 48 16 BAS4 BAS1 BAS2 BAS3 6 12 36 12

4 8 24 8

2 4 12 4

0 0 0 0 expression level expression A 24 Avr-Pi9 6.0 SPD5 400 SPD10 1000 ACE1 18 4.5 300 750

12 3.0 200 500

Relative mRN Relative 6 1.5 100 250

0 0 0 0 WT Δsin3 WT Δsin3 WT Δsin3 WT Δsin3

Figure 6. Sin3-HDAC coordinates with PRC2 to prompt H3K27me3-mediated transcriptional silencing on effectors. (a) Levels of histone acetylation at the examined residues were measured by Western blotting assay in the WT and ∆sin3 strains. The number at the top of band is the relative intensity calculated by Image J software. Similar results were obtained from three biological repeats. (b) Summary of up- and down-regulated genes in the ∆p55 and ∆sin3 by comparing with that of WT. The number at the top or bottom is the number of DEG in the mutant. The Y-axis is the percentage of up- and down-regulated genes in all DEG. Data was obtained from three biological repeats. (c) The Venn diagram showing statistically significant overlaps among genes sets of ∆sin3-UEG, ∆p55-UEG and ∆kmt6-UEG. P value with Fisher’s exact test for overlapping between gene sets were labeled. (d) The Venn diagram showing statistically significant overlap between genes bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

sets of H3K27me3-marked genes and ∆sin3-UEG. (e) The distribution of putative 124 and 246 effectors based on the expression change in ∆sin3-UEG. (f) Relative expression level of representative effectors were checked in WT and ∆sin3 by qRT-PCR. Data represents mean±SD of three independent biological replicates.

(a)

Relative expression level expression Relative Relative expression level expression Relative hours post inoculation hours post inoculation (b)

BAS3 BAS4 SPD5 SPD10

TUB5

Relative H3K27me3 Relative enrichment to enrichment 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 mycelia 72 hpi mycelia 72 hpi mycelia 72 hpi mycelia 72 hpi (c)

Figure 7. H3K27me3 modification is “erased” from the chromatin of effectors at the early stage of infection. (a) The expression of the effectors BAS3, BAS4, SPD5, and SPD10 were induced by host. (b) H3K27me3 modification at the chromatin of effectors was removed at the early stage of infection. (c) Model of effectors reprogramming during transition from vegetative growth to in planta growth. During vegetative growth stage, PRC2 coordinates with Sin3 histone deacetylase complex suppresses the expression of effectors in M. oryzae, while during the invasion growth stage, H3K27me3 modification is “erased” upon the perception of signals from host, then the effectors are expressed. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Supporting Information

Article title: Suppression of histone modification epigenetically reprograms the genome-wide expression of effectors during Magnaporthe oryzae–rice interaction

The following Supporting Information is available for this article: Figure S1. Phylogenetic analysis of PRC2 components in M. oryzae. Figure S2. Detection of H3K4me3 and H3K36me3 level in the deletion strains by Western blot analysis. Figure S3. Bioinformatics analysis of PRC2 subunits based on RNA-seq. Figure S4. Expression pattern of effectors in the PRC2 mutants. Figure S5. Expression pattern of effectors in the ∆kmt6(Guy11) mutant. Figure S6. Absence of H3K27me3 partially mimics host-derived signal. Figure S7. H3K27me3 modification deposits on the chromatin of effectors and infection-specific genes during vegetative growth stage. Figure S8. Sin3 histone deacetylase complex contributes to histone deacetylation. Figure S9. GO analysis on gene sets of ∆sin3-UEG. Figure S10. Confocal microscopy-based subcellular localization of Bas4-GFP in the vegetative and in planta growth stages in the WT and ∆sin3 strains. Table S1. Components of polycomb repressive complex in M. oryzae, N. crassa, A. thaliana, and D. melanogaster. Table S2. Primers used in this study. Table S3. Strains used in this study. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

80 AtClf 99 AtSwn 84 AtMea 81 DmEz NcSet-7 100 100 Kmt6 30 CnEhz2 30 CnCcc1 CnBnd1 DmSez12 AtFis2 34 99 AtEmf2 99 AtVrn2

100 NcSuz12 Suz12

100 NcEed 98 Eed 81 AtFie 93 98 DmEsc CnEed1

74 100 NcP55 P55

100 CnMsl1

94 AtMsl1-5 94 DmNurf55 0.20 Figure S1. Phylogenetic analysis of PRC2 components in M. oryzae. The phylogenetic tree of PRC2 components from M. oryzae (highlighted with bold font), N. crassa, A. thaliana, and D. melanogaster was constructed by CLUSTAL_W and MEGA 7 programs using neighbor-joining method with 1000 bootstrap replicates. Genbank accession numbers of these protein were listed in S1 Table.

1.00 1.13 0.90 0.99 0.80

H3K36me3 1.00 0.82 0.98 0.83 0.92

H3K4me3

T W eed p55 kmt6 suz12 Δ Δ Δ Δ Figure S2. Detection of H3K4me3 and H3K36me3 level in the deletion strains by Western blot analysis. The number at the top of band was the relative intensity calculated with Image J software. Two biological replicates were carried out with similar results.

(a) (b) P = 3.5×10-226 Δsuz12_UEG P = 0 Δkmt6_UEG Δkmt6_UEG H3K27me3

182 211 195 328 988 335

463 2144 1110 332 60 53 P = 0 -158 P = 0 P = 0 P = 1.9×10

645 135

Δp55_UEG Δeed_UEG

(c)

transmembrane transport interaction with host via protein secreted carbohydrate metabolic process

metabolic process

cellulose catabolic process

cellular nitrogen compound biosynthetic process

xylan catabolic process

nucleoside metabolic process

DNA integration

carbohydrate transport

lipid catabolic process

response to stress Δkmt6_UEG

0 20 40 60 Gene_counts

Figure S3. Bioinformatics analysis of PRC2 subunits based on RNA-seq. (a) The Venn diagram showing statistically significant overlaps among genes sets of the ∆kmt6-UEG, ∆suz12-UEG and ∆eed-UEG. P value for overlapping between gene sets was obtained by Fisher’s exact test. (b) The Venn diagram showing significant overlap among gene sets of ∆kmt6-UEG, ∆p55-UEG and H3K27me3 marked genes. (c) GO analysis on gene sets of the ∆kmt6-UEG. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

WT Δp55 Δkmt6 Δeed Δsuz12 MGG_08024 MGG_15972 MGG_05127 MGG_09693 1.5 MGG_08411 MGG_01974 MGG_10914 MGG_00283 1 MGG_04546 MGG_16175 MGG_05456 0.5 MGG_09627 MGG_16171 MGG_05389 MGG_05410 0 MGG_00614 MGG_18108 MGG_07355 MGG_16585 −0.5 MGG_08992 MGG_03865 MGG_01953 MGG_16693 −1 MGG_03326 MGG_14725 MGG_07969 −1.5 MGG_17155 MGG_17556 MGG_08715 MGG_15443 MGG_09379 MGG_02166 MGG_00230 MGG_00245 MGG_18036 MGG_02239 MGG_02154 MGG_09675 MGG_05083 MGG_18105 MGG_10720 MGG_07900 MGG_11610 MGG_08355 MGG_07624 MGG_10318 MGG_08376 MGG_08348 MGG_08817 MGG_09378 MGG_08944 MGG_04263 MGG_02223 MGG_16977 MGG_08482 MGG_15459 MGG_17239 MGG_08506 MGG_07625 MGG_08515 MGG_08441 MGG_06224 MGG_16058 MGG_08428 MGG_08799 MGG_08546 MGG_17244 MGG_10455 MGG_18041 MGG_10798 MGG_09629 MGG_12930 MGG_12655 MGG_04776 MGG_11072 MGG_09605 MGG_16353 MGG_16869 MGG_07630 MGG_09134 MGG_14523 MGG_06953 MGG_09019 MGG_08300 MGG_17464 MGG_03585 MGG_16714 MGG_17425 MGG_05751 MGG_06347 MGG_00043 MGG_00380 MGG_00120 MGG_01009 MGG_00047 MGG_04795 MGG_02778 MGG_17249 MGG_01455 MGG_08971 MGG_02220 MGG_02546 MGG_14156 MGG_16570 MGG_08491 MGG_15267 MGG_17896 MGG_14006 MGG_16647 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure S4. Expression pattern of effectors in the PRC2 mutants. Heat maps illustrated expression changes of genome-wide effectors in different PRC2 mutant compared with that of WT B157. Three biological replications of RNA-Seq sequencing were conducted on independent samples.

(a) 10 BAS1 6.0 BAS2 8 BAS3 200 BAS4

7.5 4.5 6 150

5.0 3.0 4 100

2.5 1.5 2 50

expression level expression 0 0 0 0 A

16 SPD5 8 SPD10 24 Avr-Pi9 80 ACE1

12 6 18 60

8 4 12 40 RelativemRN

4 2 6 20

0 0 0 0 Δkmt6 Δkmt6 Δkmt6 Δkmt6

(b) (c) transmembrane transport Δ 51.2% metabolic process 48.0% Δ interaction with host via protein

secreted by type II secretion system effectors

carbohydrate metabolic process

cellular nitrogen compound

biosynthetic process of Number Δkmt6-UEG xylan catabolic process (Guy11） >1 -1~1 <-1 NA 0 20 40 60 Fold change (log 2 ) Gene_counts

Figure S5. Expression pattern of effectors in the ∆kmt6(Guy11) mutant. (a) Relative expression level of representative effectors in Guy11 and ∆kmt6(Guy11). Values are means ± SD of three biological replicates. (b) GO analysis on gene sets of the ∆kmt6-UEG (Guy11). (c) The distribution of putative 246 effectors based on the expression level change in the ∆kmt6-UEG (B157) and ∆kmt6-UEG (Guy11).

(a) (b) Δkmt6_UEG H3K27me3 Δkmt6_UEG H3K27me3

400 406 1517 328 1565 339

239 245 533 581 60 49 -60 -56 P = 9.0×10 P = 2.6×10 P = 1.0×10-70 P = 2.3×10-24 1758 1517

36 hpi_UEG in planta 72 hpi_UEG in planta

Figure S6. Absence of H3K27me3 partially mimics host-derived signal. (a) The Venn diagram shows statistically significant overlaps among genes sets of the ∆kmt6-UEG, 36 hpi_UEG in planta and H3K27me3 marked genes. (b) The Venn diagram represents statistically significant overlaps among genes sets of ∆kmt6-UEG, 72 hpi_UEG in planta and H3K27me3 marked genes.

(a) (b)

Chromosome 1 3 WT WT input WT IP 2 H3K27me3

(IP/input) Δkmt6 Input 2

1 H3K27me3 Δkmt6 IP Log Δkmt6 0 -3.0 TSS TTS 3.0 Kb

388 113 532 795 1303 197 49 984

Δkmt6_UEG H3K27me3 -226 （Log >1) P = 3.5×10 2

(e)

MGG_01943 MGG_11966 MGG_09100 MGG_03792

TUB5 Relative H3K27me3 Relative enrichment to enrichment 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 WT Δkmt6 WT Δkmt6 WT Δkmt6 WT Δkmt6

Figure S7. H3K27me3 modification deposits on the chromatin of effectors and infection-specific genes during vegetative growth stage. (a) The average H3K27me3 occupancy within 3 Kb genomic regions flanking the summit of H3K27me3 peaks in the WT and ∆kmt6 strains. (b) Genome browser views of H3K27me3 occupancy on the chromosome 1 in the WT and ∆kmt6 strains. (c) The Venn diagram shows statistically significant overlaps between gene sets of H3K27me3 marked genes and the ∆kmt6_UEG with threshold of Log2 > 1 and Log2 > 3 respectively. P value with Fisher’s exact test for overlapping between gene sets were labeled. (d) The Venn diagram shows significant overlap among gene sets of putative 246 effectors and H3K27me3 marked genes. (e) ChIP-qPCR verified the enrichment of H3K27me3 on the chromatin of infection- specific genes. The relative enrichments were calculated by relative quantitation of two biological repeats, which was standardized by internal control TUB5, and then compared with that of WT. Bar represents standard error from three technical repeats.

(a) (b) Sap30 BD BD SD SD SD SD AD (-WL) (-WLHA) (-WL) (-WLHA)

Hos2

sin3 Δ

Sin3 to H3 in H3 to

Sap18 Relative abumdance

WT eed p55 kmt6 suz12 Δ Δ Δ Δ

Figure S8. Sin3 histone deacetylase complex contributes to histone deacetylation. (a) Yeast-two-hybrid assay of interaction between Sap30 and other Sin3-HDAC components Hos2, Sin3, or Sap18. The bait and prey plasmids were co-transformed into yeast strain Y2Hgold respectively, then the transformants were grown on basal medium SD (-WL) and selective medium SD (-WLHA). (b) Relative abundance of examined protein blots in the WT and ∆sin3 strains. The standard error was obtained from three biological repetitions. (c) Bolt representation of the average H3K4ac occupancy within 3 Kb genomic regions flanking the summit of H3K4ac peaks in the WT and ∆sin3 mutant. (d) Western blotting assay detected the H4K5ac and H3K4ac modification in the deletion strains of PRC2 subunits. The number at the top of band was the relative intensity calculated with Image J. Two biological replicates were carried out with similar results.

carbohydrate metabolic process transmembrane transport metabolic process interaction with host via protein secreted endonucleolytic cleavage in ITS1 to separate SSU−rRNA xylan catabolic process rRNA processing DNA recombination endonucleolytic cleavage to generate mature 5'−end of SSU−rRNA cellulose catabolic process endonucleolytic cleavage in 5'−ETS of tricistronic rRNA transcript ribosome biogenesis maturation of 5.8S rRNA from tricistronic rRNA transcript mitotic recombination−dependent replicationfork processing cellular nitrogen compound biosynthetic process ribosomal large subunit biogenesis DNA replication response to stress maturation of LSU−rRNA from tricistronic rRNA transcript Δsin3-UEG 0 20 40 60

Figure S9. GO analysis on gene sets of ∆sin3-UEG.

Figure S10. Confocal microscopy-based subcellular localization of Bas4-GFP in

the vegetative and in planta growth stages in the WT and ∆sin3 strains. In the WT, Bas4-GFP fluorescence was only presented in the in planta growth stage, while in the ∆sin3, Bas4-GFP fluorescence could be detected during both vegetative and in planta growth stages, including the conidia, apical hypha, subapical hypha and invasive hypha. Bar = 5 μm.

Table S1. Components of polycomb repressive complex in M. oryzae, N. crassa, A. thaliana, and D. melanogaster.

Protein GenBank accession Species Subfamily name Gene ID numbers Neurospora crassa PRC2 NcSET-7 NCU07496 XP_965043.2 NcEED NCU05300 XP_962071.2 NcSUZ12 NCU05460 XP_963451.3 NcP55 NCU06679 XP_960994.2 Cryptococcus neoformans PRC2 CnEzh2 CNAG_07553 XP_012047965.1 CnMsl1 CNAG_03297 XP_012051157.1 CnBnd1 CNAG_07433 XP_012049647.1 CnEed1 CNAG_02345 XP_012050093.1 CnCcc1 CNAG_00083 XP_012046514.1 Magnaporthe oryzae PRC2 MoSET-7 MGG_00152 XP_003718975.1 MoSUZ12 MGG_03169 XP_003716821.1 MoEED MGG_06028 XP_003711877.1 MoP55 MGG_07323 XP_003715557.1 Arabidopsis thaliana PRC2 AtCLF AT2G23380 NP_179919.1 AtMEA AT1G02580 NP_563658.1 AtSWN AT4G02020 NP_567221.1 AtFIE AT3G20740 NP_188710.1 AtEMF2 AT5G51230 NP_199936.2 AtVRN2 AT4G16845 NP_567517.1 AtFIS2 AT2G35670 NP_565815.2 AtMSI1-5 AT5G58230 NP_200631.1 PRC1 AtEMF1 AT5G11530 NP_196714.1 AtRING1A AT5G44280 NP_199241.2 AtRING1B AT1G03770 NP_171873.2 AtLHP1 AT5G17690 NP_197271.1 AtBMI1A AT2G30580 NP_565702.1 AtBMI1B AT1G06770 NP_973775.1 AtBMI1C AT3G23060 NP_188946.2 Drosophila melanogaster PRC2 DmEz Dmel_CG6502 NP_524021.2 DmESC Dmel_CG14941 NP_477431.1 DmSUZ12 Dmel_CG8013 NP_652059.1 DmCaf Dmel_CG4236 NP_524354.1 PRC1 DmJARID2 Dmel_CG3654 NP_648324.1 DmPCL Dmel_CG5109 NP_476672.1 DmPH Dmel_CG18412 NP_476871.2 DmPSC Dmel_CG3886 NP_523725.2 DmPC Dmel_CG32443 NP_524199.1 DmRing Dmel_CG5595 NP_477509.1 DmKDM2 Dmel_CG11033 NP_649864.2 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Table S2. Primers used in this study.

Primer name Sequence (5’-3’) Use

KMT6-5F AATTGAATTC CGCATGGAGAACGTGCGATG amplifying KMT6 5' flanking sequence for gene deletion (pFGL821)

KMT6-5R AATTGGTACC GGCCTTGTCACTTTTGCTCCCT

KMT6-3F AATTCTGCAG GAGCAGTCGAGCGCACGGA amplifying KMT6 3' flanking sequence for gene deletion

KMT6-3R AATTAAGCTT CACCACGGTTGCTGGAGAGTACG

SUZ12-5F CGGAATTCCATCGTTGTCTCGGTGTTGC amplifying SUZ12 5' flanking sequence for gene deletion (pFGL821)

SUZ12-5R GGGGTACCTGGTGCGCTTAAGCATGAGA

SUZ12-3F AACTGCAGGCCCGAAACGTTCATACCAC amplifying SUZ12 3' flanking sequence for gene deletion

SUZ12-3R CCCAAGCTTTCTCGTGAAGAGAGTGCTGG

EED-5F CGGAATTCATTTCGGACTTCGGCACAGT amplifying EED 5' flanking sequence for gene deletion (pFGL821)

EED-5R GGGGTACCCGGTCCGATCCACGAAAAGA

EED-3F AACTGCAGTTGTCGCCGGGAGTAAGAAC amplifying EED 3' flanking sequence for gene deletion

EED-3R CCCAAGCTTCGAAATTCTGATGCGCGAGG

P55-5F CGGAATTCAATGAATGGGCGGGAGTCTG amplifying P55 5' flanking sequence for gene deletion (pFGL821)

P55-5R GGGGTACCTGCAATGGCCAATGAAACTCT

P55-3F AACTGCAGTGCCGAGTCGATCGTTAAGC amplifying P55 3' flanking sequence for gene deletion

P55-3R CCCAAGCTTTGTCGACCTTGTCAAGCTGTT

SIN3-5F GGAGAAACTCGAGAATTC TCAAGGCGAGTTAGGGCAG amplifying SIN3 5' flanking sequence for gene deletion (pFGL821)

SIN3-5R GAGTTCAGGCTTTTTCATATCTCGGAGAGGGTGGTTC

SIN3-3F TCCGAGGGCAAAGAAATAGCTTTGCAGTGACGAGCTGC amplifying SIN3 3' flanking sequence for gene deletion

SIN3-3R CAAGCTTGCATGCCTGCAGATTCTCGGTTGTGGCCCTC

SAP18-5F GGAGAAACTCGAGAATTCGTTGTAGGGATCGGCACG amplifying SAP18 5' flanking sequence for gene deletion (pFGL821)

SAP18-5R GAGTTCAGGCTTTTTCATGCAAGCGTCTTGATGTATT

SAP18-3F TCCGAGGGCAAAGAAATAGTCTGGGAAGCTGAGCTTT amplifying SAP18 3' flanking sequence for gene deletion

SAP18-3R CAAGCTTGCATGCCTGCAGGGAGTTAGGTGAAGCAAGTC

SAP30-5F GGAGAAACTCGAGAATTCAGTAGTGCTGGGTAAGCGATACCC amplifying SAP30 5' flanking sequence for gene deletion (pFGL821)

SAP30-5R GAGTTCAGGCTTTTTCATGTCTGGCTGGTGTGTATCTGGG

SAP30-3F TCCGAGGGCAAAGAAATAGCTGGGCGGTCTGGACATAGCTT amplifying SAP30 3' flanking sequence for gene deletion

SAP30-3R CAAGCTTGCATGCCTGCAGGGTCGAATCGCCCTATTTCCC

SIN3bp-5F GGAGAAACTCGAGAATTCAATTGCACTTGATCCAAT amplifying SAP30 5' flanking sequence for gene deletion (pFGL821)

SIN3bp-5R GAGTTCAGGCTTTTTCATGGGAGCAAGATGCCTCCG

SIN3bp-3F TCCGAGGGCAAAGAAATAGTCTGGGAAGCTGAGCTTT amplifying SAP30 3' flanking sequence for gene deletion

SIN3bp-3R CAAGCTTGCATGCCTGCAGAACGTATTTCACCAAGCTG

HOS2-5F AGTGAATTCTGAAGGAGGCTGGGAGATGAA amplifying HOS2 5' flanking sequence for gene deletion (pFGL821)

HOS2-5R AGTGGATCCGTACTTTGGGCTAAAGGTCAAAGG

HOS2-3F AGTGTCGACCAGAAGAGTCTTTCTCTTGCACCC amplifying HOS2 3' flanking sequence for gene deletion

HOS2-3R AGTAAGCTTGCCCTGGTCCCATATCCATTC

KMT6-TF AATCTCGTATAGAAGCACGCCTAGTT transformants screening

KMT6-IN-F GCCGCAGCTCGTAGCAACGC

KMT6-IN-R AGGGCCCGTCGTGTATGCAT

SUZ12-TF AACAGGCTCGTCTGGTATCAAGAGAA transformants screening

SUZ12-IN-F TTCCTTGACATAGAGAAGTGGCGTCT

SUZ12-IN-R GACATTGTCGCCGTAGAAGGAGAC bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

EED-TF AACCTGCTTACGACGAGCTGCTC transformants screening

EED-IN-F GGGCTACGTCGCCAAGATCAA

EED-IN-R ATGCGCCTTGTCACTAAGTTCCTT

P55-TF AAATGGGAACGTCATCCTACCATC transformants screening

P55-IN-F AACTATCGCATTCACCGTGTCCT

P55-IN-R GGCAAAAGTCTAGTGCGTTGATGG

SIN3-TF ATCGCCGCTATTATCGGCGA transformants screening

SIN3-IN-F CGGCTTCGTTGAATGGAAGTTCT

SIN3-IN-R TCATTGGTTCAGGCACAATGGG

SAP18-TF GAAGGCAGTTCTTCAGCGATG transformants screening

SAP18-IN-F GCGTTTCACAGGTTAGTGCTTTAC

SAP18-IN-R GCGACAGATCCGTCCTCCAGA

SAP30-TF GGCTCAGATATCGTTTTGGGCC transformants screening

SAP30-IN-F TCACGGCAATGGCAAGGACAA

SAP30-IN-R CGTTGCGACTTTGTGGACGAA

SIN3bp-TF GATTCGGTCGTATTGGTCGAGC transformants screening

SIN3bp-IN-F TCCCTGTGACCAAGAATCACCCT

SIN3bp-IN-R AACGACATCACCATTGATCCCAC

HOS2-TF CGACGAGTGTCTAGCCAGATTG transformants screening

HOS2-IN-F GACCTCAAGTTTAACCTCGGAGG

HOS2-IN-R GCCAAAGAGGATCATGGGAAT

KMT6-GFP-5f GCCGTTTACGGCAACCTCA construction of KMT6-GFP and complementation (pFGL820)

KMT6-GFP-5r AATTGGTACCAGGACCTCTACGATATCGTACAGG

KMT6-com-if GAGAATTCGAGCTCGGTACCGCTCGGTCGAGAATTGACTT

KMT6-com-iR GCAGGTCGACTCTAGATGGAACTTGTCGCGGAATAC

SUZ12-c-5f TATGGAGAAACTCGAGAATTCCATCGTTGTCTCGGTGTTGCG construction of SUZ12-GFP and complementation (pFGL820)

SUZ12-c-5r TGCTCACCATCAAGTCCACACAGTCATTACATAGCC

SUZ12-GFP-

Trpcf TGTGGACTTGATGGTGAGCAAGGGCGAGG

SUZ12-GFP-

Trpcr GACTCTAGAACTAGTGGATCCCGAGCCCTCTAAACAAGTGTACC

SUZ12-c-3f GAATTGCATGTCGACCTGCAGGGGCTATTGTAGCCGTGACTATC

SUZ12-c-3r ACGACGGCCAGTGCCAAGCTTTCTCGTGAAGAGAGTGCTGGAA

EED-c-5f TATGGAGAAACTCGAGAATTCATTTCGGACTTCGGCACAGTC construction of EED-GFP and complementation (pFGL820)

EED-c-5r CCCTTGCTCACCATTCTATGACTACCCTTTGGAACTGGT

EED-GFP-Trpcf CATAGAATGGTGAGCAAGGGCGAGG

EED-GFP-Trpcr GACTCTAGAACTAGTGGATCCCGAGCCCTCTAAACAAGTGTACC

EED-c-3f GAATTGCATGTCGACCTGCAGATCCGGGGTGTGTTTTTTGG

EED-c-3r ACGACGGCCAGTGCCAAGCTTCGAAATTCTGATGCGCGAG

P55-c-5f CGAGAATTCGAGCTCGGTACCAATGAATGGGCGGGAGTCTG construction of P55-GFP and complementation (pFGL820)

P55-c-5r TCCTCGCCCTTGCTCACCATGGGGCCCAGCTCGTCCAC

P55-GFP-Trpcf ATGGTGAGCAAGGGCGAGG

P55-GFP-Trpcr CGTTGGCACCTCGACTCTAGACGAGCCCTCTAAACAAGTGTACC

P55-c-3f GAATTGCATGTCGACCTGCAGAGGACGGTCCAGCTCCGA bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

P55-c-3f ACGACGGCCAGTGCCAAGCTTTGTCGACCTTGTCAAGCTGTTC

P55-c-F AGTCTCGAGAGCCCTGCCATTCGGTGTC

P55-c-R AGTGGATCCTGACAGACGTTTGTTGGTGGGA

SIN3-GFP-F TATTATGGAGAAACTCGAGAGCAAGGAAGCCCAGAAGCG construction of SIN3-GFP and complementation (pFGL820)

SIN3-GFP-R CACCATGGTACCGAGCTCTGCAGAAGACCCAGCACCG

flagKMT6F CGACGATAAGCTCGAGACGGGCAAGCTCGGTGCCCT construction of FLAG-KMT6 (pFGL822)

flagKMT6R TGTTTGATGAGCTGGGTACCTCAAGGACCTCTACGATATC

flagSUZ12F CGACGATAAGCTCGAGACTCCGCACGGCTTCAGACG construction of FLAG-SUZ12 (pFGL822)

flagSUZ12R TGTTTGATGAGCTGGGTACCTTACAAGTCCACACAGTCAT

flagEEDF CGACGATAAGCTCGAGGCCGGTGGCGACGCGTCGGG construction of FLAG-EED (pFGL822)

flagEEDR TGTTTGATGAGCTGGGTACCCTATCTATGACTACCCTTTG

flagP55F CGACGATAAGCTCGAGGCACCTCCTCCAGCCATGGA construction of FLAG-P55 (pFGL822)

flagP55R TGTTTGATGAGCTGGGTACCCTAGGGGCCCAGCTCGTCCA

flagSIN3F TGACGACGATAAGCTCGAGATGAATTCTCAACGGTCCCACG construction of FLAG-SIN3 (pFGL822)

flagSIN3R GGAACAAAAGCTGGGTACCTTATGCAGAAGACCCAGCACC

flagSAP18F TGACGACGATAAGCTCGAGATGATGGAGATGGACAGGAACG construction of FLAG-SAP18 (pFGL822)

flagSAP18R GGAACAAAAGCTGGGTACC TCAGGGGTATTTCCCGCGAT

flagSAP30F TGACGACGATAAGCTCGAGATGCCACCAGCAAAAGCACG construction of FLAG-SAP30 (pFGL822)

flagSAP30R GGAACAAAAGCTGGGTACCTCAGTTCTTCCTGCGTGTTCTCG

flagSIN3bpF TGACGACGATAAGCTCGAGATGGCAACCATGGCAACTGCTAC construction of FLAG-SIN3 (pFGL822)

flagSIN3bpR GGAACAAAAGCTGGGTACCTTATACAGAGCCGAGTTGAAGTAGAGC

flagHOS2F TGACGACGATAAGCTCGAGATGGATGCAGACTCATACAGATATCG construction of FLAG-HOS2 (pFGL822)

flagHOS2R GGAACAAAAGCTGGGTACCTTAAAACTCCATGGCTTGACCAAC

qBAS1-F CCGTCTATCGCGGCTGAAGATTAT amplifying MoBAS1for RT-PCR

qBAS1-R CGGGTAATAATTCTCCACCCGTCTA

qBAS2-F AGGGAGTCTGCTCCAACGAAGTCG amplifying MoBAS2 for RT-PCR

qBAS2-R TGCTTCTTGACCTGCTCCTTGGC

qBAS3-F TCCCAGACCACTTGCCGTACTCAG amplifying MoBAS3 for RT-PCR

qBAS3-R CAGCGCCGTTCAGGTTGCAGA

qBAS4-F GCTCAAGAAGAACGGCAAATGCG amplifying MoBAS4 for RT-PCR

qBAS4-R GGGATAGACGAGCCAGTAGCGCC

qSPD5-F TTAACTTCTTCGGCCACAAGACG amplifying MoSPD5 for RT-PCR

qSPD5-R GAGGCCGTCGTATTTGCAGTCCTC

qSPD8-F AGGGACGGTACGAAATTCGACACG amplifying MoSPD8 for RT-PCR

qSPD8-R GGCCGCGATATTCCGAGGTCT

qSPD10-F CAAGGCCACCAACACCGACCT amplifying MoSPD10 for RT-PCR

qSPD10-R TGCAGGCCCTTTGCAGGTTCT

qAvr-PiK-F CAACCCTGGTATTCCTGTACCCGAAT amplifying MoAvr-PiK for RT-PCR

qAvr-PiK-R CCCAGTTTGGACCAACTTTCATGTC

qAvr-PiZt-F CCAAAGAGGCTGGTCGCGATT amplifying MoAvr-PiZt for RT-PCR

qAvr-PiZt-R GAGAGAACATCAGTGGACGTCCC

qAvr-Pi9-F GGCCGAAGGTGACGCCAAGAT amplifying MoAvr-Pi9 for RT-PCR

qAvr-Pi9-R TTGGCACCAGCCATCATCGCA

qACE1-F GAGGGCACCAATAGCCTCGACCT amplifying MoACE1 for RT-PCR bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

qACE1-R CAGCGACGTTCTCGACCGACAC

qHEG13-F TTGCTCACCAAACGGTCACACG amplifying MoHEG13 for RT-PCR

qHEG13-R TGGTTGTCCGGCAACACGTTG

qβ-Tubulin-F CTGCCATCTTCCGTGGAAAGG analysis the expression level of β-tubulin gene of M.oryzae

qβ-Tubulin-R GACGAAGTACGACGAGTTCTTG

ChIP-qMPG1-F ACTAACTGACTGAGTGACTGAGGGACTT amplifying MoBAS1for ChIP-qPCR

ChIP-qMPG1-R GTGAGCTTTGGGATGATGAGAAGAG

ChIP-BAS3-F CTTGAAGACAGACCAGCAAATCGC amplifying MoBAS2 for ChIP-qPCR

ChIP-BAS3-R ATGGCAAAGGAGACGGTGGAGA

ChIP-BAS4-F CTCATTCTCAGCAATCGCCATCC amplifying MoBAS3 for ChIP-qPCR

ChIP-BAS4-R TCTGCACTGTTGTTGTCGGGGTA

ChIP-SPD5-F CCAGACATATCTACCACCAAGAAGGC amplifying MoBAS4 for ChIP-qPCR

ChIP-SPD5-R ATGGCGGCAATGTGGAGGATT

ChIP-SPD10-F CACCCGCAACGACAAAAAAGC amplifying MoSPD5 for ChIP-qPCR

ChIP-SPD10-R CCAGGAGCAAGGGGAGAACGA

ChIP-Tub5-F GTTGCAGCTAGCACAGACCA amplifying Moβ-tubulinfor ChIP-qPCR

ChIP-Tub5-R GTCGGGATTGATTGGATTTG

AD-KMT6F GCCATGGAGGCCAGTGAATTCATGACGGGCAAGCTCGGT construction of AD-KMT6 (pGADT7)

AD-KMT6R CAGCTCGAGCTCGATGGATCCTCAAGGACCTCTACGATATCGTACA

BD-KMT6F ATGGCCATGGAGGCCGAATTCATGACGGGCAAGCTCGGT construction of BD-KMT6 (pGBKT7)

BD-KMT6R CCGCTGCAGGTCGACGGATCCTCAAGGACCTCTACGATATCGTACA

AD-SUZ12F GCCATGGAGGCCAGTGAATTCATGACTCCGCACGGCTTCA construction of AD-SUZ12 (pGADT7)

AD-SUZ12R CAGCTCGAGCTCGATGGATCCTTACAAGTCCACACAGTCATTACATAGC

BD-SUZ12F ATGGCCATGGAGGCCGAATTCATGACTCCGCACGGCTTCA construction of BD-SUZ12 (pGBKT7)

BD-SUZ12R CCGCTGCAGGTCGACGGATCCTTACAAGTCCACACAGTCATTACATAGC

AD-EEDF GCCATGGAGGCCAGTGAATTCATGGCCGGTGGCGACGCG construction of AD-EED (pGADT7)

AD-EEDR CAGCTCGAGCTCGATGGATCCCTATCTATGACTACCCTTTGGAACTGG

BD-EEDF ATGGCCATGGAGGCCGAATTCATGGCCGGTGGCGACGCG construction of BD-EED （pGBKT7)

BD-EEDR CCGCTGCAGGTCGACGGATCCCTATCTATGACTACCCTTTGGAACTGG

BD-P55F ATGGCCATGGAGGCCGAATTCATGGCACCTCCTCCAGCC construction of BD-P55 （pGBKT7)

BD-P55R CCGCTGCAGGTCGACGGATCCCTAGGGGCCCAGCTCGTC

AD-P55F GCCATGGAGGCCAGTGAATTCATGGCACCTCCTCCAGCC construction of AD-P55 (pGADT7)

AD-P55R CAGCTCGAGCTCGATGGATCCCTAGGGGCCCAGCTCGTC

AD-SIN3F GCCATGGAGGCCAGTGAATTCATGAATTCTCAACGGTCCCACG construction of AD-SIN3 (pGADT7)

AD-SIN3R CAGCTCGAGCTCGATGGATCCTTATGCAGAAGACCCAGCACC

AD-SAP18F GCCATGGAGGCCAGTGAATTCATGATGGAGATGGACAGGAACG construction of AD-SAP18 (pGADT7)

AD-SAP18R CAGCTCGAGCTCGATGGATCCTCAGGGGTATTTCCCGCGAT

AD-SAP30F GCCATGGAGGCCAGTGAATTCATGCCACCAGCAAAAGCACG construction of AD-SAP30 (pGADT7)

AD-SAP30R CAGCTCGAGCTCGATGGATCCTCAGTTCTTCCTGCGTGTTCTCG

AD-SIN3bpF GCCATGGAGGCCAGTGAATTCATGGCAACCATGGCAACTGCTAC construction of AD-SIN3bp (pGADT7)

AD-SIN3bpR CAGCTCGAGCTCGATGGATCCTTATACAGAGCCGAGTTGAAGTAGAGC

AD-HOS2F GCCATGGAGGCCAGTGAATTCATGGATGCAGACTCATACAGATATCG construction of AD-HOS2 (pGADT7)

AD-HOS2R CAGCTCGAGCTCGATGGATCCTTAAAACTCCATGGCTTGACCAAC bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436344; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Table S3. Strains used in this study.

Strain Genotype description B157 Wild-type Δkmt6 deletion mutant of MGG_00152 in B157 Δkmt6-C expressing KMT6-GFP in Δkmt6 transformant Δsuz12 deletion mutant of MGG_03169 in B157 Δsuz12-C expressing SUZ12-GFP in Δsuz12 transformant Δeed deletion mutant of MGG_06028 in B157 Δeed-C expressing EED-GFP in Δeed transformant Δp55 deletion mutant of MGG_07323 in B157 Δp55-C expressing P55-GFP in Δp55 transformant Δsin3 deletion mutant of MGG_13498 in B157 Δsin3-C expressing SIN3-GFP in Δsin3 transformant Δsap18 deletion mutant of MGG_05680 in B157 Δsap30 deletion mutant of MGG_11142 in B157 Δsin3bp deletion mutant of MGG_10153 in B157 Δhos2 deletion mutant of MGG_01633 in B157 P55-FLAG pRP27-P55-FLAG in Δp55 transformant SUZ12-FLAG pRP27-SUZ12-FLAG in Δsuz12 transformant KMT6-FLAG pRP27-KMT6-FLAG in Δkmt6 transformant SIN3-FLAG pRP27-SIN3-FLAG in Δsin3 transformant EED-FLAG pRP27-EED-FLAG in Δeed transformant SAP18-FLAG pRP27-SAP18-FLAG in Δsap18 transformant HOS2-FLAG pRP27-HOS2-FLAG in Δhos2 transformant SUZ12-GFP/KMT6- FLAG pRP27-P55-FLAG in KMT6-FLAG transformant P55-GFP/KMT6-FLAG expressing P55-GFP in KMT6-FLAG transformant P55-GFP/SUZ12-FLAG expressing P55-GFP in SUZ12-FLAG transformant P55-GFP/EED-FLAG expressing P55-GFP in EED-FLAG transformant P55-GFP/SIN3-FLAG expressing P55-GFP in SIN3-FLAG transformant P55-GFP/SAP18-FLAG expressing P55-GFP in SAP18-FLAG transformant P55-GFP/HOS2-FLAG expressing P55-GFP in HOS2-FLAG transformant Guy11 Wild-type Δkmt6(Guy11) deletion mutant of MGG_00152 in Guy11