CHARACTERIZATION OF NOVEL G PROTEIN-COUPLED
RECEPTOR GENES AND THE NOVEL LIGAND APELIN
by
Dennis K. Lee
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Pharmacology
University of Toronto
O Copyright by Dennis K. Lee 1999 National Library Bibliotheque nationale 1*1 of Canada du Canada Acquisitions and Acquisitiins et Bibliographie Services sewices bibliographiques 395 Wellington Streeî 395. rue W~gtoc) WONKlAW OrtawaON KlAW Canada canada
The author has granted a non- L'auteur a accordé une licence non exclusive licence ailowing the exclusive permettant à fa National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distn'bute or seil reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be p~tedor otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation. Characterization of Novel G Protein-Coupleci Receptor Genes and the Novel Ligand Apelin Dennis K. Lee, MeSc. 1999 Department of Pharmacology University of Toronto
G protein-coupled receptors (GPCRs) make up the large family of integral membrane bound proteins which mediate the signaling of extracellular stimuli to intracelMar responses via activation of heterotrimeric G proteins and their subsequent interaction with effector proteins. GPCRs have been implicated in a number of physiologicd Functions including behaviour. homeostasis, cognition, appetite, and drug addiction. This thesis describes the molecular characterization of the human and rat genes encoding apelin, the cognate ligand for the APJ receptor. Human and rat DNA sequences encoding apelin were retrieved by a search of the GenbanP databases, their full length sequences cloned and used as probes for expression analyses. Comparative sequence and tissue distribution analyses revealed both apelin and the APJ receptor to resemble the angiotensin II peptide and the angiotensin Il receptors, suggesting roles in similar physiological systems. In addition, a degenerate PCR strategy, database searching and the patent literature revealed DNA sequences encoding novel GPCRs, namely the thyrotropin-releasing hormone receptor TRH-R2,orphan GPCRs GPR54,
GPR57, GPR58, GPR6 1, GPR62 and a pseudogene, vGPR57. With the initiai discovery of each of these sequences, full length GPCR-encoding sequences were detennined and used for mRNA distribution analyses by northern blot and in situ hybridization. In addition, novel GPCR-encoding genes were localized to chromosomes by fluorescence in situ h ybridization (FISH) and expressed for pharmacological characterization. ACKNOWLEDGEMENTS
1 would Iike to thank my supervisors, Dr. Brian F. O'Dowd and Dr. Susan R.
George, for their support and guidance and for the opportunity to pursue my degree under their direction. 1 would also like to express my gratitude to Tuan Nguyen for his work on cloning rat apelin cDNA, TRH-R2, GPR54 and yGPR57, Regina Cheng for her work on the northern blot and in situ hybridization anaIyses, and Yang Liu for her work on isolating and sequencing the GPCR search clones- I would also thank Dr- Adriano
Marchese, Marek Sawzdargo, Ziedong Xie, Teresa Fan and the members of the O'Dowd and George lab, both past and present, for their generous and amiable counsel, technical support and our collaborative efforts at work and play. In addition, 1 wish to thank Brett
Clayton and acknowledge his excellent work on the three-dimensional schematic of the
GPR54 receptor. Finally, 1 would Iike to thank my family and friends for their love and support, in hopes that 1 have returned both in kind- PUBLICATIONS
This thesis contains work that has been published in or submitted to the scientific literature:
A~ehand APJ Lee, D.K., Cheng, Ra,Nguyen, T., Fan, T., Kariyawasam, A.P., Liu, Y., Osmond, D.H., George, S.R., and O'Dowd, B.F. "Charactenzation of apelin, the ligand for the APJ receptor", J. Neurochem. In press.
TRH-R2 O'Dowd, B.F., Lee, D.K., Huang, W., Nguyen, T.. Cheng, R., Liu, Y., Wang, B., Gershengorn, MC, and George, S.R. "TRH-R2 exhibits simiiztr binding and acute signaling but distinct replation and anatomic distribution compared to TRH-RI". Mol. Endocrin. In press.
GPR54 Lee, D.K.. Nguyen, T., O'Neill, G.P., Cheng, R., Liu, Y., Howard, A. D., Coulombe, N., Tan, C.P., Tang-Nguyen, A.-T., George, S.R., and O'Dowd, B. F. "Discovery of a receptor related to the galanin receptors". FEBS Lett. (1999) 446, 103- 107.
vGPR57. GPR57. GPR58 Lee, D.K., Lynch, KR., Nguyen, T., Xie, Z., Cheng, R., Saldivia, V.R., Liu, Y., Liu. I.S.C.. Heng, H.H.Q.,Seeman, P., George, S.R., O'Dowd, B.F. and Marchese. A. "Cloning and characterization of additional members of the G protein-coupled receptor farnily". Submitted.
OTHER PUBLICATIONS
Lee, D.K., Nguyen, T., Porter, C.A., Cheng, R., George, S.R., and O'Dowd, B.F. 'TWO related G protein-coupled recepton: The distribution of GPR7 in rat brain and the absence of GPR8 in redents". Brain Res. Mol. Brain Res- (1999) 71,96403.
Sawzdargo, M., Nguyen, T., Lee, D.K., Lynch, KR., Cheng, R.. Heng, H.H.Q., George, S.R.. and O'Dowd, B.F. "Identification and cloning of three novel human G protein- coupled receptor genes GPR52, yGPR53 and GPR55: GPR55 is extensively expressed in human brain". Brain Res. Mol. Brain Res. (1999) 64, 193-198. TABLE OF CONTENTS
PAGE
TITLE PAGE I
ABSTRACT II
ACKNOWLEDGEMENTS III
PUBLICATIONS IV
TABLE OF CONTENTS v
LIST OF ABBREVIATIONS IX
LIST OF TABLES X
LIST OF FIGURES XI
1.0 INTRODUCTION
Overview of Introduction 1
The GPCR family 2
Agonists for GPCRs 5
Discovery of GPCR Genes by Molecular Cloning 6
Discovery of GPCR Genes by Database Searches 13
Reverse Pharmacology: Assigning Ligands to Novel GPCRs 16
Researc h Objectives 22
2.0 MATERIALS AND METHODS
2.1 Materials
2.1.1 Chernical Reagents 2.1.2 Enzymes
2.1.3 Isotopes and Ligands
2.1.4 Oiigonucieotides
2.1.5 Kits
2.1.6 CeU lines, Plamnids and DNA Libraries
2.2 Methods
Computationd DNA and Protein Sequence Andysis
PCR: Polymerase Chain Reaction
GenbankTMDatabase Searches
Subcloning of PCR Products
DNA Minipreparation, Restriction Digestion and
Electrophoresis
DNA Sequencing
DNA Probe Extraction and Radiolabelhg by Nick
Translation
Genomic and cDNA Library Screening
Bacteriophage DNA Preparation
2.2.10 Southern Blotting
2.2.11 Northern Blotting
2.2.12 In Situ Hybridization
2.2.13 Chromosomal localization
2.2.14 Creation of an Intronless GPR58 Receptor Gene
Expression Construct 2.2.15 Maxi DNA Preparation
2.2.16 Calcium Phosphate TC811Sfection
2.2.17 Membrane Preparation and Binding Studies
3.0 RESULTS
Determination of the Human Apelin Genomic Structure
and Cloning of Rat Apeiin cDNA
mRNA Tissue Distribution of Apelin and the APJ Receptor
Discovery and Cloning of the TRH-R2 Receptor Gene
mRNA Tissue Distribution of the TRH-R2 Receptor
Discovery and Cloning of the GPR54 Receptor
mRNA Tissue Distribution of the GPR54 Receptor
Discovery and Cloning of the GPR57 and GPR58 Receptor
Genes and a Pseudogene FR57
GPR57 and GPRSS Expression
Attempted Pharmacological Characterization of the
GPR58 Receptor
Chromosomal Locaîization of the GPR58 Receptor Genes and 74
Pseudogene yGPR57
Discovery and Cloning of the GPR61 and GPR62 Receptor 74
Genes
mRNA Tissue Distribution of the GPR61 Receptor 79 4.0 DISCUSSION
4.1 Apelin: Characterization of the Endogenous Peptide 80
Ligand for the APJ Receptor
4.2 TRH-R2: Discovery and Characterization of a Second 82
GPCR for Thyrotropin-Releasing Hormone
4.3 GPR54: Discovery and Characterization of a NoveI GPCR 85
related to the Gala& Receptors
4.4 GPR57 and GPR58: Discovery of a Novel Subfamily of 86
GPCRs
4.5 GPR61 and GPR62: Discovery of a Novel Subfdyof 88
GPCRs
4.6 Conclusions 89
5.0 REFERENCES 91 LIST OF ABBREVIATIONS
ATP adenosine triphosphate BLAST basic local aiignment search tool bp base pairs cDNA complementary DNA CHO chinese hamster ovary DAPI 4' '6'-diamidino-2-pheny lindole DNA deoxyribonucleic acid EST expressed sequence tag FISH fluorescence in situ hybridization GPCR(s) G protein-coupled receptor(s) G protein guanine nucleotide regulatory protein GU(s) G protein-coupled receptor kinase GSS genomic survey sequences hr hours HTGS high throughput genomic sequence MAGE Integrated Molecular Analysis of Gene Expression IPTG isopropylthio-B-D-galactosidase kb kilobase pairs LB Luria-Bertani media min minutes mRNA messenger RNA NCB 1 Nationai Center for Biotechnology Information nr non-redundant oGPCR orphan G protein-coupled receptor ORFW open reading frame(s) PCR polymerase chain reaction PKA CAMP-dependentprotein kinase A PKC protein kinase C RNA ribonucleic acid Pm revolutions per minute SDS sodium dodecyl sulfate sec seconds STS sequence tagged sites TM transmembrane domain Tm thyrotropin-releasing hormone UTR(s ) untranslated region(s) x-gal 5-bromo-4-chloro-3-indolyl-B-D-galactosidase LIST OF TABLES PAGE
Table 1 Rhodopsin family of GPCRs with known endogenous ligands 7
Table 2 Orphan GPCRs 18 LIST OF FIGURES
FIGURE PAGE
The G protein-coupled receptor: Structure and Conserved Residues
Alignment of oGPCRs used for design of degenerate oligonucleotides
ApeIin amino acid sequence alignrnents and the human apelin genomic structure
Northem blot analyses of human and rat preproapelin mRNA
In situ hybridization analyses of rat preproapelin mRNA
In situ hybridization analyses of rat AHMA
Amino acid sequence aiignment between rat TRH-R 1 and TRH-W
Northem blot analyses of rat TRH-R2 mRNA
In situ hybridization analyses of rat TRH-R2 mRNA
Schematic representation of the GPR54 receptor
Nonhern blot anaiyses of rat GPR54 rnRNA
In situ hybridization of rat GPR54 mRNA
Sequence of the vGPR57 pseudogene
Amino acid sequence aiignment between GPR57, GPR58 and related receptors
FISH analyses for iyGPR57 and GPR58
Amino acid sequence alignment between GPR6 1, GPR62 and related receptors
Northem blot analyses of human and rat GPR6 1 1.0 INTRODUCTION
1.1 Overview of Introduction
G protein-coupled receptors (GPCRs) represent the largest farnily of integral plasma membrane proteins mediating the signd transduction of external stimuli to the interna1 environment of cells. As a result of its size and diversity, the GPCR family is collectivel y the largest group of targets for today ' s pharmaceutical reagents and research
(Stade1 et ai., 1997). Over the last two decades, molecular cloning of genes encoding
GPCRs has greatly facilitated the understanding of these signal transduction systems by permitting in vitro expression and investigation of GPCRs. In addition, moIecular cloning has resulted in the discovery of most of the GPCRs known today, which has provided an abundance of novel pharrnaceutical targets for exarnination and an impetus for the identification of many as yet undiscovered transmitter systems in the brain and periphery .
This thesis describes the discovery and characterization of six novel genes encoding GPCRs and a GPCR pseudogene, as well as the characterization of apelin, a novel peptide agonist for the GPCR, APJ. An introduction to the GPCR family is first presented followed by a brief exarnination of the diversity of GPCR ligands. This is followed by an account of successful strategies, both past and present, in cloning novel
GPCRs and the current efforts in assigning ligands to novel GPCRs. The introduction will conclude with a final word on research objectives. 1.2 The GPCR family
The GPCR farnily contains a diverse group of cell-surface mediators of signal transduction, its size exceeding other cell-surface protein receptors including the tyrosine kinase receptors, guanylyl cyclase receptors and ligand-gated ion channels. The GPCR family has nearly 300 unique members (not including the odorant GPCRs) (Marchese et al., 1999), a membership that is expected to grow to over 400 by the completion of the human genomic project (Stade1 et al., 1997). GPCR-encoding genes have been isolated from a variety of species, from mamrnalian species to fish, birds, and even extending to various plants, fungi and single ce11 organisms.
GPCRs act through G proteins, to which they are bound during their basal or inactive state. Upon activation, GPCRs undergo a conformational change, which releases the G protein as active a and By subunits into the cytosol. These subunits regulate the activity of downstrearn effectors, such as adenylyl cyclase and phospholipase C, which in turn regulates second messenger levels and subsequent intracelIular cascade reactions resulting in a cellular response.
GPCRs are characterized by their serpentine-like structure of seven hydrophobic a-helical transrnembrane domains (TM) connected by alternating intracellular and extracellular loops and flanked by an extracellular amino-terminus and intracellular carboxy-terminus (Fig. 1).
TM regions are 20 to 27 amino acids in length and contain a number of conserved amino acid residues and motifs found throughout the GPCR family. TM 1 usually contains a conserved "GN motif while TM2 is often characterized by a "(N/S)LAXAD" motif (Fig. 1). Perhaps the best known GPCR motif is the "DRY" sequence found at the Fig. 1. The G protein-couplod receptor: Structure and Conserved Residues. Show are conserved residues, motifs and generai structure of a G protein-coupled receptor. The rectangle represents the outer cellular membrane spanned seven times by a single polypeptide protein with an extracellular amino terminus (indicated by "NH2"), three extracellular and intracellular loops, and the intracellular carboxy terminus (indicated by "COOH). A disulphide bridge joining two cysteines is shown as a bent bar, and a palmitoylated cysteine is shown, creating a fourth intracellular loop. TM3 and second intracellular loop junction (Fig. l), which is thought to play a role in
receptor activation (Gether and Kobilka, 1998). While conserved substitutions are found
within this motif, the central arginine is almost invariably conserved. This arginine is
hypothesized to be confined within a hydrophilic pocket composed of conserved polar
residues in TM 1, TM2 and TM7, and only exposed to the cytoplasrnic interior of the ceIl
during receptor activation (Gether and Kobilka, 1998). TM'S 2,4,5, 6 and 7 contain well
conserved aromatic residues and prolines (Fig. 1) which are thought to conuibute to
ligand poçket stabilization and receptor activation (Sealfon et al., 1995; Wess et al.,
1993). Another weil conserved motif among GPCRs is the "(N/D)PXXY1 motif found in
TM7 (Fit. l), which has been implicated to play a role in receptor endocytosis (Ferguson
and Washbum, 1998).
While the extracellular and intracellular portions of GPCRs exhibit a wide variety
of lengths and poor sequence conservation between different GPCRs, a number of
conserved residues and motifs still exist within these regions which are responsible for
post-translat ional modifications essential for proper receptor func tion. "NX(S/T)"
consensus sequences for asparagine-linked glycosylation are found in the arnino terminus
and extracellular loops (Fig. 1). Cysteines are often conserved in the first and second extracellular loops (Fig. 1) which are believed to form disulphide bridges with each other
to stabilize the GPCR (Probst et al., 1992)- In the third intracellular loop and carboxy
terminus, serine and threonine residues (usually accompanied by nearby acidic residues)
are potential sites for phosphorylation by GPCR kinases (GRK), a mechanism which
initializes agonist-dependent desensitization (Krupnick and Benovic, 1998). In addition
to GRK sites, the intracellular loops and the carboxy terminus often contain CAMP- dependent protein kinase (PKA) and protein kinase C (PKC)consensus sites for phosphorylation essential for regulating GPCR signailing in both agonist-dependent and independent desensitization (Ferguson et al., 1996). Finally, palmitoylation of cysteines found in the carboxy terminus near to TM7 have been identified and are thought to anchor the cysteines to the ce11 membrane, in turn creating a fourth intracellular loop
(Bouvier et al., 1995). The precise function of this fourth intracellular loop is still being in vestigated.
1.3 Agonisa for GPCRs
While different GPCRs al1 share similar structures and conserved residues, the external stimuli or ligands they bind are a diverse group, ranging from light to various small chernical compounds to large complex molecules and even enzymes. For example. the first GPCR cloned was rhodopsin, which is activated upon exposure to photons of light. Ligands known to stimulate GPCRs include small biogenic amines (eg. acetylcholine, epinephrine, norepinephrine, dopamine, and histamine), nucleosides and nucleotides (eg. adenosine, adenine and uridine), phospholipids (eg. sphingosine 1- phosphate and lysophosphatidic acid) and peptide neurotransmitters and hormones (eg. opioids, somatostatin, fomyl peptide, thyrotropin- releasing hormone, angiotensin II. apelin and orexins). A GPCR can also act as its own ligand. In the case of thrombin and other protease-activated receptors, cleavage of a portion of the amino terminus leaves a truncated amino terminus, which in turn acts as a tethered ligand for the receptor (Ji et al.,
1998). 1.4 Discovery of GPCR Genes by Molecular Cloning
Currently, the favoured methods of novel GPCR discovery rely heavily on the significant levels of sequence identity or homology found amongst GPCRs, particularly within conserved regions of the TM domains. Homology cloning (eg. low-stringency library screening, PCR with degenerate oligonucleotide primers and database searching) has proven to be successful, and constitutes the major method of GPCR discovery, as seen in Table 1, which lists current GPCRs of the Rhodopsin farnily with known ligands.
However, it was not until the first few GPCRs were cloned and sequences compared that receptor similarities were known to exist. Initial ventures to clone GPCRs by protein purification relied on receptor pharmacology (ie. known ligands were used to isolate their receptors), known tissue expression and required large amounts of the receptors
(Marchese et al.. l998a). While time consuming and technical ly demanding. this technique allowed the isolation of receptors without any prior knowledge of their DNA sequences. Purified GPCRs were cleaved into fragments and sequenced. These sequences were used to design oligonucleotides, which in mm were used to screen cDNA libraries from tissues known to express these receptors. The full open reading frames
(OWs) of the receptors were deduced from the positive cDNAs retrieved by screening
(Marchese et al., 1998a). Protein purification yielded the first cloned genes encoding
GPCRs, which included the P2-adrenergic (Dixon et al., 1986), Ml acetylcholine (Kubo et al., 1986), M2 acetylcholine (Peralta et al., 1987), a2A-adrenergic (Kobilka et al.. l987a), and the a 1B-adrenergic (Cotecchia et al., 1988) receptors.
An alternative GPCR discovery method was expression cioning, which involved mRNA extraction from tissues known to express the GPCR in question. This mRNA was Table 1. Rhodopsin famiiy of GPCRs with known endogenous ligands.
[ Receptors Cloning Strategy Species Genbank Acc. # 1
Adenosine Al PCR human Adenosine Au PCR human Adenosine Aze PCR rat Adenosine A3 PCR rat
Adrenergic al* low strhgency human Adrenergic ale protein purification hamster Adrenergic al0 low stringency rat Adrenergic au protein purification human Adrenergic low stringency rat Adrenergic azc Iow stringency human Adrenergic Pl low stringency human Adrenergic P2 protein purification hamster Adrenergic B3 low m-ngency human
Anaphylatoxin C3a low stringency human Anaphylatoxin CSa low stringency human
Angiotensin ATlA expression cloning rat Angiotensin ATlB PCR rat Angiotensin AT2 expression cloning rat
Apelin PCR human
Bombesin 66, Iow stringency rat Bombesin BB2 protein purification mouse Bombesin BB3 low stringency guine pig
Bradykinin B1 expression cloning human Bradykinin B2 expression cloning rat
Cannabinoid (brain) CB1 Iow stnngency rat Cannabinoid (periphery) CB2 ?CR human
Chemokine CCR1 PCR human Chemokine CCR2 PCR human Chemokine CCR3 low stringency human Chemokine CCR4 PCR hurnan Chemokine CCRS PCR human Chemokine CCRG PCR human Chemokine CCR? PCR human Chemokine CCR8 PCR human Chemokine CCR9 PCR mouse
Chemokine CXCR1 expression cloning human Chemokine CXCR2 Iciw stringency human Chemokine CXCR3 PCR human Chemokine CXCR4 PCR COW Chemokine CXCRS PCR human
Chemokine CX,CR1 PCR human Table 1. (Continueci)
1 Receptor Cloning Stmtagy Specks Geribank Acc. # 1
Cholecystokinin CCKA protein purification rat Cholecystokinin CCKa expression cloning dog
Dopamine 01 PCR human Dopamine 02 low stringency rat Dopamine 03 low stringency rat Dopamine 04 low stringency human Dopamine 05 low strigency human
Endothelin ETA expression cloning cow Endothelin E' expression cloning rat
Follicle-stimulating hormone (FSH) low stringency rat
expression cloning human low stringency human
Galanin type-1 expression cloning human Galanin type-2 PCR human Galanin type-3 PCR human
Gonadotropin-releasing hormone PCR mouse (GnRH)
Histamine Hl expression cloning COW Histamine Hz PCR dog Histamine H3 database human
Leukotriene LTB4 low stringency human Leukotriene CysLT1 database human
Lutropin-choriogonadotropin protein purification rat hormone (LH-CG)
Lysophosphatidic acid PCR mouse
Melanocortin MC1 PCR human Melanocortin MC2 PCR human Melanocortin MC3 low stringency rat Melanocortin MC4 PCR mouse Melanocortin MC5 PCR human
Melatonin MLlA expression cloning Xenopus Melatonin MLIB PCR human
Motilin MTL-RI low stringency human
Muscarinic Acetlycholine Ml protein purification pig Muscarinic Acetlycholine M2 protein purification pig Muscarinic Acetlycholine M3 low stringency rat Muscarinic Acetlycholine M4 low stringency rat Muscarinic Acetlycholine MS low stringency human Table 1. (Continued)
Receptor Cloning Stratagy Species Genbank Acc. # 1
Neurokinin NK1 (substance P) low stringency rat Neurokinin NK2 (substance K) expression cloning COW Neurokinin NK3 (neuromedin K) low stringency rat Neurokinin NK4 expression cloning human
Neuropeptide Y Y1 low stringency rat Neuropeptide Y YI-like low stringency mouse
Neuropeptide Y Y2 expression cloning human Neuropeptide Y Y4 low stringency human Neuropeptide Y Y5 expression cloning rat
Neurotensin NTRl expression cloning rat Neurotensin NTR2 low stnngency rat
Opioid 6 expression cloning mouse Opioid K PCR mouse Opioid p PCR rat Orphanin ?CR human
low stringency human low strïngency human protein purification human
database human database human
Oxytocin expression cloning human
Platelet-activating Factor expression cloning guinea pig
Prolactin-releasing peptide PCR human
Prostanoid EP, low stringency mouse Prostanoid €Pz low stringency human Prostanoid EP3 low çtn'ngency mouse Prostanoid €PI low stringency mouse Prostanoid OP PCR mouse Prostanoid FP PCR bovine Prostanoid IP low stringency human Prostanoid TP protein purification human
Protease-activated 1 expression cloning human Protease+activated 2 low stringency mouse Protease-activatcd 3 PCR rat Protease-activated 4 database human
Purinoceptor P2yT PCR guinea pig Purinoceptor P2y2 expression cloning mouse Purinoceptor P2ys low sbingency chicken Purinoceptor PZy4 PCR human Purinoceptor PZy6 low sûingency rat Purinoceptor P2yI PCR Xenopus Table 1. (Continued)
[ Receptor Cloning Stratsgy Species Genbank Act. # 1
Purinoceptor P2Yll low stringency human
Serotonin 5-HT,, low stringency human Serotonin 5-Hf,, PCR human Serotonin 5-Hf,, PCR human Serotonin 5-Hf,, PCR monkey Serotonin 5-HT,, low sûingency mouse Serotonin 5-Hf, low stringency rat Serotonin 5-HT,, low stringency rat Serotonin 5-HT2, expression cfoning rat Serotonin 5-HT, PCR rat Serotonin 5-HT,, PCR mouse Serotonin 5-HT,, PCR mouse Serotonin 5-HT, PCR rat Serotonin 5-HT, PCR rat
Somatostatin sstl PCR human Sornatostatin sstZ PCR human Somatostatin ssb low stringency mouse Somatostatin sst, low stringency rat Sornatostatin sstS PCR rat
Sphingosine 1-phosphate differential hyb. human
Thyrotropin-releasing hormone expression cloning mouse CTW
Thyrotropin-stimulating hormone PCR human (TSW
Vasopressin VIA expression cloning rat Vasopressin VIB PCR human Vasopressin V2 PCR rat used to construct cDNA libraries, which were divided into pools and the transcribed mRNA from each pool injected into Xenopus laevis oocytes or mammalian cells and assayed using the ligands under investigation. Positive ce11 lines were further subdivided and the above procedure repeated until a single cDNA was isolated, which was sequenced and used to predict the ORF encoding the GPCR (Marchese et al., 1998a).
Like the protein purification technique, expression cloning was technically demanding and did not require previous knowledge of the GPCR structure or sequence. However, if successful, expression cloning would retrieve specific DNA encoding the desired receptor. The first cDNAs encoding novel GPCRs isolated by this technique included the neurokinin NK2 (Masu et al., 1987) and serotonin 5-HT2C (Julius et al., 1988) receptors.
With the discovery and sequencing of the fint cloned genes and cDNAs encoding
GPCRs, it became evident that GPCRs shared common seven TM structures, and more
importantly, significant levels of sequence identity, particularly within the TM dornains.
With each novel GPCR-encoding gene or cDNA cloned, highest levels of sequence identity were observed between GPCRs which bound the same ligand. To a lesser degree, strong sequence identities were also observed between GPCRs which bound different but stmcturally similar ligands. New strategies employed to isolate novel
GPCR genes were based on shared sequence identity. Low-stringency hybridization was the first of these homology cloning techniques, and involved screening of cDNA and genomic libraries with radiolabeled fragments of DNA encoding previously cloned
GPCRs. Each search required optimizing the stringency of probe binding, either by varying wash temperature or salt-concentration conditions, to retrieve novel related genes
(or paralogues) without significant levels of non-GPCR hybndization signals. The low- stringency hybridization method to discovering novel GPCR-encoding DNA proved to be a faster and less arduous a task than its predecessors, and was used to successfully clone genes and cDNAs encoding the muscarinic M3 and M4 (Bonner et ai., 1987), dopamine
D3 (Sokoloff et al., 1990), D4 (OIMalley et al., 1992), D5 (Sunahara et al., 1991) and serotonin 5-HT 1A (Fargin et ai., 1988; Kobilka et al.. 1987b) receptors.
Finally, what has proven to be the fastest and most powefil molecular method of discovering novel GPCR-encoding genes, is the polymerase chain reaction (PCR) utilizing degenerate oligonucleotides. First devised as a means to amplify quickly and selectively any known fragment of DNA (Mullis and Faloona, 1987), PCR has become invaluable in novel GPCR discovery by exploiting the conservation of shon sequences or motifs found in the GPCR family. PCR utilizing a set of two primers (sense and antisense) based on conserved sequences found in a wide variety of different GPCRs increases the odds of amplifying an even wider assortment of GPCR-encoding DNA fragments, regardless of the difference of sequences found encoded between the two prirners. By cornparison, the low-stringency screening technique is limited in the variety of positive GPCR signals by the use of probes encoding large stretches of a particular
GPCR. The TM3 "DRY" and TM7 "(N/D)PXXY motifs, in particular, have proven to be valuable sequences upon which to design PCR primers for GPCR gene discovery. In our laboratory, 10 novel GPCRs, named GPRl through GPRIO, were found using the same set of degenerate oligonucleotide primers designed frorn TM3 and TM7 (Heiber et al., 1995; Marchese et al., 1994; Marchese et al., 1995; OIDowd et al., 1995). The strategy of using degenerate oligonucleotides (which are composed of a mixture of primers with substituted nucleotides at specific locations) further diversifies the mixture of PCR-amplified GPCR-encoding DNA by the degenerate nature found wi thin the genetic code. Among the first GPCRs to be discovered in this manner were four novel
GPCRs with unknown ligands (Libert et al., 1989), three of which were later characterized to be the adenosine Al (Libert et al., 1991), A2A (Furlong et al., 1992), and serotonin 5-HTlD (Maenhaut et al., 199 1) receptors. Other novel GPCRs quickly followed, inciuding the dopamine Dl (Sunahara et al., 1990), the long fom of D2
(O'Dowd et aI., 1990), histamine H2 (Gantz et al-, 1991), serotonin 5-HTlB (Jin et al.,
1992) and melanocortin MC 1 and MC2 (Mountjoy et al., 1992) receptors.
1.5 Discovery of GPCR Genes by Database Searches
Over the past decade, gene discovery has been greatly enhanced by the introduction of nucleotide and protein sequence databases. Of particuiar importance are the GenbankTMdatabases maintained and made accessible to the public by the National
Center for Biotechnology Information (NCBI), a division of the National Library of
Medicine. Such databases include the non-redundant (or "nr", a comprehensi ve collection of known gene, cDNA, protein and genomic contig sequences), the expressed sequence tag (EST), the sequence tagged sites (STS), genomic survey sequences (GSS) and high throughput genomic sequences (HTGS) databases. These databases are updated daily, with data exchanged with other collaborating databases such as the DNA Databank of Japan and the EMBL Data Library. Each Genbankm sequence entries are given unique accession numbers, are annotated with bibliographic and biological data, and are accessible by either word searches (eg. accession number, author, sequence name, etc.) or may be retrieved by BLAST (Basic Local Alignment Search Tool), a computer sequence similarity search program executed via the internet (http://www.ncbi.nlm.nih.pv)
(Altschul et al., 1997). As an extension of the traditional molecular homology cloning techniques already in place, database BLAST searching utilizing sequences of known
GPCRs has retrieved many novel GPCR sequences (Table l), taking full advantage of the high-throughput, daily growth of these databases. Examples of GPCR discovered by database searching include GPR19 (O'Dowd et al., 1996) and GPR24 (Kolakowski et al.,
1996) receptors.
One particularly noteworthy database is the EST database, which has been responsible for the majority of novel GPCR sequences found by database searching. The
EST database is made up of short, partial sequences of cDNA (usuaily 150 to 400 bp in length), sampled from various cDNA libraries representing an enormous variety of animal species and tissue types. The advantages of searching the EST database stem from the sheer size of the database (which accounts for approximately 70% of
GenbankTM entries), the diversity of its entries (by species and tissues sarnpled) and the database's representation of only expressed sequences, which excludes intron and other non-coding sequences. However, the EST database does have problems with sequence redundancy (which are inherit in any high-throughput system) as well as underrepresentation of less abundant genes and genes expressed only in discrete tissues.
A typical search of the EST database with any GPCR sequence usuaIly retrieves thousands of sequences, of which only the first few hundred are shown. With the rapid expansion of gene discovery by database searching over the past decade, the vast yield of any current database search will represent known sequences. However, careful sequence analyses of these searches still reveal ESTs with novel GPCR-like sequences. Such ESTs can often be ordered from the IMAGE (Integrated Molecular Analysis of Gene
Expression) consortium, who in a collaboration with the Washington University Genome
Sequencing Center contribute the vast majority of ESTs submitted to Genbankmf, and used as probes to determine full-length GPCR-encoding sequences,
Two other databases of note are the HTGS and nr databases, which respectively house in-progress and completed genomic contig sequences. The submission of these sequences continue as part of the world-wide effort to sequence the genomes of various species, including the human genome. The process is generally broken down into two steps: mapping of yeast artifical chromosomes and radiation hybrids and sequencing individual artificial chromosomes localized to mapped regions. High throughput sequencing is made possible by cutting the artificial chromosomes into smaller overlapping fragments which can be subcloned into the pUC plasmid or Ml3 phage vectors. These fragments are sequenced and deposited as unordered sequences or unfinished sequences with gaps into the HTGS database. Further gap-determining sequencing and determination of order by sequence analysis of overlapping fragments yield final sequences, usually well over 100 kb in length, which are deposited in the nr database. In terms of novel gene discovery, the genomic sequence databases contain underrepresented genes not found in the EST databases. Disadvantages of genomic database searching include the inclusion of intronic sequences and size of the databases, which currently pale in cornparison to the EST databases. However, the sequencing of the human genome, which is scheduled for completion within three years (Venter et al.,
1998), holds the promise of the discovery of every human (and subsequently, mammalian) gene, including the entire family of GPCRs. 1.6 Reverse Pharmacology: Assigning Ligands to Novel GPCRs
As stated earlier, the first GPCR-encoding genes were discovered using their endogenous (or cognate) ligands as probes. These GPCRs were then expressed and translated into functional proteins, ready for the investigation of their signalling pathways, mechanisms of regulation, etc. However, the method of discovering GPCR- encoding genes and cDNAs by homology cloning has Ieft investigators with the major obstacie of assigning each novel GPCR to an endogenous ligand, a process which has been dubbed "reverse pharmacology" (Stade1 et al., 1997). When a GPCR is first discovered by homology cloning it is termed an "orphan" GPCR (oGPCR), requiring a cognate ligand for purposes of classification and further physiological study. Early oGPCRs found their cognate ligand by their high level of sequence identity (usually 40% or greater) with other GPCRs. For example, the serotonin 5-HT1A receptor was originally an oGPCR known as G21, yet strong sequence identity to the 5-HT2C receptor led to its elucidation as another serotonin receptor (Fargin et al., 1988). In other cases,
GPCRs with less than 40% sequence identity have been found to share the same cognate ligand. In such instances, the tissue distributions of oGPCRs can play a major role in determining the cognate ligand. For example, the cannabinoid CB 1 receptor was originally an oGPCR with little sequence identity with other known GPCR sequences, yet expression analyses of CB 1 mRNA revealed strong overlap with the expression patterns of cannabinoid receptors (Matsuda et al., 1990)-
However it is generally diffxcutt to assign ligands to oGPCRs by sequence identity and expression analyses, and it is evident that a large body of unknown cognate Iigands exist for the GPCR family. As a result, the list of oGPCRs has grown to number close to 100, constituting nearly a third of the GPCRs currently cloned (Table 2). The major problem of assigning ligands to the current list of oGPCRs stems from the general equation of proper GPCR characterization, which requires knowledge of an agonist, the
GPCR itself, and the determination of G protein (of which there are many types) and effector systems involved. Identification of an agonist and its GPCR can elucidate which
G protein and effector system are involved. In return, knowledge of the GPCR and its effector systems aIIows for assays to determine a cognate ligand. However, the exclusion of both ligand and effector system identities makes the characterization of current oGPCRs a daunting task, requiring new and inventive strategies for reverse pharrnacology.
Recent successes in assigning ligands to oGPCRs have involved various screening strategies to isolate peptide ligands. While such screening techniques have varied sornewhat in their use of particular assays (eg. calcium mobilization, adenylyl cyclase activity, change in the rate of extracellular pH), they are in essence the sarne. Briefly, oGPCRs are expressed in various ce11 lines with established GPCR and G protein expression and downstream effector system machinery and assayed with tissue extract fractions from regions known to express the oGPCR (Wilson et al., 1998). Fractions exhibiting specific dose-responses may contain the cognate ligand, and undergo further fractionation until the ligand is purified. The first successfully isolated ligand by this method was orphanin FQhociceptin (Meunier et al., 1995; Reinscheid et al., 1995), a neuropeptide found to be the endogenous ligand for the oGPCR, ORLI (Bunzow et al.,
1994; Mollereau et al., 1994), utilizing brain extracts which inhibited adenylyl cyclase Tobie 2. Orphan GPCR. ( ~ornoloqy Imm8 ~~ 1%- IAedonNo- IRemua f OPlOtD AND SOMATOSTATiN GPW human 629b GPR8 O'üowd et al.. 1995 RECEPTOR-UKE 4036sst5
human û2?6 GPRï O'DoHlid et a.. 1995 (5%ss15
human 33% ssQ Kolakowski et al.. 1996 32% ssts
rat 29% popioid Marchese et al.. 1995 28% -4
rat 37% WR2 Lee et al.. 1999 35% GALRl
CHEMOKlNE RECEPTOR-UKE GPF12 t%Uman 41% CXCR3 Marches et aL. 1944 4096 CCR7
CKRX hUITm 53% €01 unpublished 43% CCRI
mwse 53% CKRX unpu büshed 36% CCRI
mouse 62% CCR 1 Gao and Murphy. 1995 50% CCFW
GPR28 human 43% CCR7 unpubiiihed 38% CCR6
STRL33 hufnan 37% CCR7 Liao et al.. 1997 37% CCR6
PPRI bovine 39?6 CCR7 Matsuaka et al.. 1993 37% GPm8
glod rat 33% FIE1 Hanison et al.. 1993 30% CCR9
ROC1 human 33% gl Od tiben et al.. 1989 30% CXCR2
TWSFl human 22% GPRS Spangenberg et al.. 1998 14% CCR6
CLRl chicâen 51% BLR-1 Gupta et ai.. 1998 36% CXCRl
Dez human 37% GPRl Methner et al.. 1997 35% FPR2
FPRK human 72% FPR2 Bao et al.. 1992 56% FPRl
FPR2 human 72% FPRL2 Bao et al.. 1992 69% FPRl
GPRl human 37% Dez Marchese el al.. 1994 34% FPR2
GPR30 human 3Z6 FPRL2 O'Dawd et al.. 1998 32% FPR2
hum 39% FPRl Marchese et aL. 1998 35% FPRL2
mous8 36% GPR32 Marctiese el al.. 1998 36% Dez Table 2. (Continw ~~ornoloqy hn8 bod.0 1% ldmtm IAcauion No, IRohmlcm 1
CHEMOAlïRACTANT GPR44 human Maniiese et al.. 1999 RECEPTOR-LIKE (con't)
mus oncoggne hum 34% MRG Young et al.. 1986 26% CSoR
MRG human 34% mas OllOOQene Monmt et al.. 1991 34% CSeR
#TA rat 32% mas oncogene Ross et al.. 1990 33% MRG
GPR53p human 35% MRG Çawzdargo et al.. 1999 28% mas oncogene
ANGIOTENSM RECEPTOR-UKE GPRlS huITW'I 34% GPR25 Heiber et al.. 1996 3t% APJ
GPR25 human 34% GPRIS Jung et al.. 1997 32% APJ
CANNABlNOfD RECEPTOR-LIKE GPR3 human Marchese et al.. 1994
GPRG human Heiber et al.. 1995
GPRl2 rat 57% GPW ldne et al.. 1991 56% GPR6
€DG4 human 46% EDGB Gmîer et al.. 1998 44% EDG-1
GPR4 RECEPTOR-LIKE OGRl human Xu and Casey. 1996
GPR4 human Heiber et al.. 1995
TDAGB human Kyaw et al.. 1998
G2A mouse 34% GPR4 Weng et ai.. 1998 31% OGRl
NEUROPEPTIDE Y RECEPTOR-LIKE GIR rnow Ham.gan et al.. 1991
GPR19 human 27% GalRl O'Dowd et al.. 1996 26% NPY Y2
GPR22 human 26% NPY Y6 O'Dowd et al.. 1997 24% CCKA
AMINE RECEPTOR-LIKE PNR human Zeng et al.. 1998
GPR26 human unpublished
GPR27 mou= O'Dowd et al.. 1998
AGRS rat lshuaka et ai.. 1994 Table 2 (Con AMINE RECEPTOR-UKE(-3) GPR21 27% Om U66580 O'Dowd et al.. 1997 24% PSW4 26% -4 u92642 WlpriMi 23% &AR GPR45 70% PSP24 AF118266 Marchese et al.. 1999 21% NK2 A-2 21% ÇHTIF U47928 Ansan-Lan et ai.. 1946 19% 5-HTlE GPR52 71% GPR21 Am96784 Samdargo et al.. 1999 27% H2 RE2 25% &.AR Am91890 ungwished 2so4cAR GPA57 5996 GPR58 NIA WJw- 37% PNR WU58 599: GPRn WA unpublished 42% PNR GPR61 2% GPRM NIA unp- 3û% ÇkK6 GPR62 27% GPR61 N'A unpublm 28% ÇHT6 P2 RECEPTOR-CIKE GPR23 53% RBintmn U66578 Jung et al.. 1997 33% 'P2Y10" RBintron 53% GPFi23 L11910 Tagududa et al.. 1993 38% P2Y4 GPR35 32% GPR23 AM27957 O'Dawd et ai.. 1998 30% HM74 'P2Y 1O- 34% RBintmn AF000545 UnpuMished 339i GPR23 GPR17 35% P2Y2 U33447 Rapott et ai.. 1996 34% MY4 GPRl8 30% RBintron L42324 Gantz et al.. 1997 29% GPRl7 HM74 36% GPR3l 010923 Nomura et al.. 1993 29% P2Yi GPR31 36% Hm4 U654ûî Zingani et ai.. 1997 29% P2Y t RSC338 33% Hg63 D 13626 unpublished 28% lp2y €81 2 33% RBintron Dl77 Birkenùach et al.. 1993 30% CCRl Hg63 33% RSC338 AFOM986 Jacobs et al.. 1997 28% PAFR GPR41 98% GPR42 -4688 Samdargo et al.. 1997 41% GPR43 GPR42 98% GPR41 AM24689 Samtiaqo et ai.. 1997 28% GPR23 GPR40 31% GPR43 AF024ôô7 Samdargo et al.. 1997 26% CXCRI PZ RECEPTOR-UKE (eon't) GPR43 human Samdargo et al.. 1997 GPW human O'Dawd et al, 1997 GPW human Marchese el al.. 1999 GPRSS human Sawdargo et ai.. 1999 NEUROTENSIN RECEPTOR-LIKE GHS-R human Howard et al.. 1996 GPR38 human 67% GHSR McKee et al.. 1997 34% MR2 GPR39 human McKee et al.. 1997 ûPR66 human 38% GPR38 Tan et al.. 1998 34% GHS-R MELATONIN RECEPTOR-LIKE human ENDOTHELIN RECEPTOR-LIKE human feng et al.. 1ç97 human Valdenaire et al.. 1998 GLYCOPROTEIN HORMONE LGRS human 26% FSH-R McOOMI~el al.. 1998 RECEPTOR-LIKE 25% LH-R OPSlN RECEPTOR-UKE Encephalopsin human Blackshaw et al.. 1999 RGR human Shen et ai.. 1994 stimulation in ceIl lines expressing ORLl. More recent discovenes utilizing these screening methods include the hypocretin/orexin peptides for the hypocretin/orexin receptors 0x1 and 0x2 (Sakurai et al., 1998), the prolactin-releasing peptide (Hinuma et al., 1998) for the GPR 1O receptor (Marchese et al., 1993, the apelin peptide (Tatemoto et al., 1998) for the APJ receptor (O'Dowd et al., 1993) and the melanin-concentrating hormone (Chambers et al., 1999; Saito et al., 1999) for the GPR24 receptor (Kolakowski et al.. 1996). 1.7 Research Objectives In this research, 1 proposed to isolate and characterize novel genes encoding GPCRs to provide additionai receptors for use in the reverse pharmacology method of GPCR ligand discovery. The identification of such novel transmitter systems creates a basis for the discovery of novel therapeutic agents and study of GPCR-linked disease and disorders. As an extension of characterizing GPCRs, 1 also proposed to characterize apelin, a novel ligand discovered by reverse pharrnacoIogy for the oGPCR, APJ. Based upon the sequence and structural similarities between apelin and a hormone/neurotransrnitter angiotensin II as well as between the APJ and angiotensin AT1 recepton, 1 hypothesized a significant degree of correspondence between the expression patterns and physiological roles of apelin and angiotensin II. To further the understanding of the apelin system, apelin and APJ mRNA distribution patterns and apelin's physiological functions were investigated and compared to the angiotensin II system. 2.0 METHODOLOGY 2.1 Materials 2.1.1 Chemical Reagents Bacto@ aga., BactoO tryptone, BactoB yeast extract were purchased from Difco. 1 kb DNA ladder was purchased from Life Technologies. Acrylamide and dex tran sulfate were purchased from Caledon. B isacrylamide, ammonium persul fate, agarose, low-melt agarose and urea were purchased from ICN- Salmon sperm deoxyribonucleic acid was purchased from Sigma; glycine and AG@ 50 1 -X8 resin from Bio-Rad; ethidium bromide, bromophenoi blue and xylene cyan01 FF from International Biotechnologies hc.; phenol from Toronto Research Chemicals; chloroform frorn JT Baker; ethanol and methanol from Consolidated AIcohols Ltd.; and sodium chloride, ammonium acetate, potassium phosphate and magnesium chloride from Mallinchrodt. Sodium citrate and potassium acetate were from J. T. Baker, sodium hydroxide from Anachemia, sodium acetate from BDH. Calcium chloride was from Fisher Scientific. Ammonium acetate, calcium chloride, potassium chloride, potassium hydroxide and magnesium sulphate were from BDH. Ampicillin was from BI; maltose from Toronto Research Chemicals; glucose from BDH; IPTG (isopropyl- 1 -thio-p-D-galactoside) and Xgal (5-bromo-4-chloro-3-indoly1-~-D-galactoside)from BRL; and tris base from ICN. Boric acid, EDTA (ethylenediaminetetracetic acid) and glacial acetic acid were purchased from BDH. Hydrochloric acid, SDS (sodium dodecyl sulfate) from Bio-Rad: glycerol and isopropanol from BDH; adenosine 5'-triphosphate, dATP, dCTP, dGTP, and dTTP from Pharmacia. 2.1.2. Enzymes Restriction enzymes and modifying enzymes (Klenow fragment, alkaline phosphatase, T4 DNA ligase and T4 polynucleotide kinase) were purchased from Pharmacia. Taq DNA polymerase was from Life Technologies. Pfum DNA polymerase was from Stratagene. Advantagem Taq was from Clontech. Proteinase K was from United States Biochemical. 2.1.3. Isotopes and Ligands a-)'P-dCTP was from ICN. ~-"s-~ATPwas from Amersham. The ligands methiothepin, mianserin and SDZ-205,557HCl were purchased from RBI. 2.1.4 Oligonucleotides Oligonucleotides used for PCR and sequencing were obtained from either Biotechnology Service Centre, University of Toronto or the ACGT Corporation, 2.1.5 Kits T7 SequencingTMkits was from Pharmacia Biochemicals. Maxi prep kit and Gel Extraction kit were from Qiagen. TOPO TA- cloning kit was from Invitrogen. Nick translation ket was from Amersham. NACS Prepacm columns were from Bethesda Research Laboratories. Nylon membranes were either from Amersharn or Mill ipore. The Calcium Phosphate Transfection kit was from Life Technologies. 2.1.6 CeU lines, Plasmids and DNA Libraries E. coli bacterial strain DlOB was from Stratagene. PBluescript SK(-) plasmid was from Stratagene and pcDNA3 plasmid was from Invitrogen. Marathon-readym whole-brain cDNA for human and rat. EMBL3 'I7fSp6 human genomic library, human hypothalamus library, and rat 5' stretch brain cDNA Iibrary in hgtl1 were from Clontech. 2.2 Methods 2.2.1 Computational DNA and Protein Sequence Analysis DNA Strider v.2.1 sequence analysis software was used for storage, manipulation and analysis of nucleotide and protein sequences. Nucleotide sequences were translated into 6 potential reading frames and analyzed manually for ORFs. Hydropathy plots (KyIe-Doolittle index) were utilized for analysis of arnino acid sequences. 2.2.2 PCR: Polymerase Chain Reaction PCR reaction mixtures contained 1 pg DNA, 200 ng of each primer, 5 pl of 10X PCR buffer (100 rnM Tris-HC1 (pH 8.3), 500 rnM KI), 3 mM MgCl?, 0.25 mM each of dATP, dCTP, dGTP, and dïTP, and 2.5 U Taq, Pfu, or Advantage Taq polymerase. The PCR amplifications were done using a Perkin-Elmer Cetus thermal cycler under the foIIowing conditions: 94 "C for 30 sec, followed by 30 cycles of 94 "C for 30 sec, annealing at 45 "C, 50 OC, 55°C or 68 OC for 30 sec, and extension at 68 'C or 72 'C for 1 min to 3.5 min, and final extension at 68 "Cor 72 "Cfor 7 min. For human apelin, primers used to perforrn MCE (Frohman et al., 1988) on Marathon-readyTh' human whole brain cDNA included the Marathon-linker primers supplied by the manufacturer and gene-specific primers as follows: for the 3' end, 5'- CGATGGGAATGGGCTGGAAGACGG-3' with a nested primer 5'-GCAATGTCCGC- CACCTGGTGCAGC-3', for the 5' end, 5'-CCGCTGGCGGCGGAATTTCCTCC-3' wi th a nested primer 5'-CTGCCAGGGCCCTGGCCCATTCC-3'.Primers flanking the vector cloning site used to amplify rat apelin cDNA using a library-screened isolated plaque as a template were are follows: Pl (5'-GGTGGCGACGACTCCTGGAGC-3') and P2 (5' -GACACCAGACCAACTGGTAAT-3*)- Degenerate oligonucleotide primers used to isolate DNA fragments encoding TRH-R2 and GPR54 were designed from conserved sequences encoding TM3 and TM7 of GPR l through GPR IO, GPRL4, GPR 15, GPRl9 through GPR25, GPR27, GPR30 and GPR31 (Fig. 2). The primer sequences for TM3 and TM7 were: Degl (5'- CTGACCGGCATGA(C/G)(C/T)(NG/T)T(C/GR)GA(C)CG(C)TA-3) and Deg2 (5'-GAAGGCGTAGA(C/GTT)(C/G)A(A/C/GTT)(A/CIG)GG(A/G)TT-3'). These primers were used to amplify a rat brain 5' suetch cDNA library. The TM7 or antisense primer was also paired with two primers specific for the 5' and 3' regions flanking the cDNA library inserts named PI and P2 (shown above). The full length ORF encoding GPR54 was obtained from the rat 5' stretch cDNA library by PCR amplification with the fol low ing primers: P3 (5'-ATGGCCGCAGAGGCGACG-3') and P4 (5'- TCAGAGTGGGGCAGTGTG-3'). Human genomic DNA was amplified by PCR using oligonucleotide primers based upon sequences encoding GPR57 (P5: 5'-CTCATCCTCCTGGAAAGA-3';P6: 5'- TAACAATCTCATTTGCAA-3') and GPR58 (PT ST-TGCTCAGTG(G/T)C(A/C/G/T)- AT(A/CIT)GA(C/T)(A/C)G-3';P8: 5' -ACCATATATTAACGGATT-3'). Transrnembrane 3 Transmembrane 7 GPR3 L L A 1 T V D R Y N P 1 1 Y A F GPRl CT G AACCCCATCCTWTA~ GPFP CTG AATCCCGT~CTCTACGCCTTC WfU CT~ GPRQ CTG GPRS CTG GPFB CTG AACCCCTTCCTCTACGCCTTS GPFPB CTA AACCCCTTCCTCTACGCCTTT GPR9 CTGGCCTGCATCAGCTTTGACCGCTA AA~~~G~TG~T~TA~G~~T~ GPRIO CTE JACCACCATCGC~G~GGA~C~CTA ILL l.3 AACCCCTTCATCTACGCCTGG ffiPR14 CT 9 AATCCCTTGCT&TAC~TCT~ CTCACTTGCAT GAGTGT Ic TIc'&lT~c AT CAT CGT GGACCGCTA C AT TGATAGATA TTT GGACAGATA1 TGT GGA T c GOTE CAT CAT TGACCGCTA HGT GAGCGT GGACCGCTA OMOCGT CFJCCGCTA CTT CGACCGCTA -TTTGGACCG~TA CTGACCGGCATGACCATCGACCGATA AACCCCATCATCTACGCCTTC GTG G T C T GC GC T T T G G T primer Deg-1 primer 089-2 (antl-parallel) Fig. 2. Alignment of oGPCRs used for design of degeneiate oligonucleotides. Transmernbrane regions used for design indicated at top with a sample arnino acid sequence from GPR3. Conserved nucleotides are boxed and shaded. Degenerate primer Deg-1 and Deg-2 are shown at bottom. For convenient comparison to the transmembrane 7 sequences, the anti-parallel sequence for Deg-2 is shown. For GPR61, primers designed from a rabbit patent encoding TM3 (PIS: 5'- ATCAATGTGGAGCGCTAC-3') and TM6 (P 16: 5'-GAAGTAGGGCAACCAACA-3') were used to amplify human and rat genomic DNA. To obtain the ORF for human GPR61, RACE (Frohman et al., 1988) was performed on Marathon-readyTMhuman whole brain cDNA including the Marathon-linker primers supplied by the manufacturer and gene-specific primers as follows: for the 3' end, 5'-ACGTAGTCCACCCCATGCG- CTACG-3' with a nested primer 5'-TGCTGGTGGGTGTGTGGGTGAAGG-3',for the 5' end, 5'-CCTTCACCCACACACCCACCAGC-3'with a nested primer 5'- GCGCACCTCGTAGCGCATGGGGTGGACTACG-3'. The GPR62 ORF was amplified using primers P 17 (5'-ATGGCCAACTCCACAGGGCTG3') and P 18 (5'- TCAGGAGAGAGAACTCTCAGG-3'). 2.2.3 Genbankng Database Searches The EST, HTGS and nr sequence databases maintained by NCI were queried with amino acid sequences of human preproapeIin and selected GPCRs using the sequence similarity program TBLASTN (Altschul et al., 1997). For GPCR searches, retrieved sequences were examined for recognizable GPCR TM motifs and novelty of sequence by comparison with sequences of known GPCRs contained within the nr database. 2.2.4 Subcloning of PCR Products 5 pl of PCR products were separated by electrophoresis on regular agarose as described in section 2.2.5 to confirm expected sizes of amplified products. The remaining PCR sample was subcloned by the TOPO TA cloning kit following the protocol supplied by the manufacturer or by the following protocol: the PCR sarnple was phenol/chlorofonn extracted, precipitated with sodium acetate (3 M, pH 5.2) and 100% ethanol. The pellet was resuspended in 24 pl TE buffer (IO mM Tris-HCl (pH 8.0). 1 mM EDTA), 2 pl one-phor-al1 buffer (Pharmacia), 2 pl 1 rnM ATP, 1 pl T4 polynucleotide kinase (5 U) and incubated at 37 OC for 15 min. pBluescript or pcDNA3 plasmid vector was digested with EcoRV endonuclease and dephosphorylated by treatrnent with alkaline phosphatase (5 U) and incubated at 37 OC for 1 hr. The altered PCR product and vector were electrophoresed on a low-melt agarose gel stained with ethidium bromide, bands of the appropriate size excised from the gel, melted together at 70 "C for 5 min, cooled at 37 "C for 10 min, T4 ligase (5 U) and ATP (ImM) added, and incubated at roorn temperature ovemight. The mixture was then melted and transfomed into competent bacteria, plated ont0 Li3 plates containing arnpiciliin (100 pg/ml), IPTG and X-gal, and incubated ovemight at 37 OC. 2.2.5 DNA Minipreparation, Restriction Digestion and Electrophoresis Colonies were picked from LB plates and transferred to 5 ml of LB media and incubated for 16 hr at 37 'C in an orbital shaker. The culture was then centrifuged at 6000 rpm for 2 min at 4 OC, the pellet resuspended in 100 pl of solution I (50 mM gIucose, 10 mM EDTA and 25 mM Tris-HCI (pH 8.0)). lysed for 2 min in 200 pl of solution II (0.2 N NaOH and 1% SDS) and incubated on ice for 3 min after addition of 170 pl of solution III (5 M sodium acetate (ph 5.2)). The mixture was centrifuged at 11000 rpm for 2 min and supernatent transfered to a new microcentrifuge tube. The plasmid DNA was phenol/chlorofonn extracted, ethanol precipitated and washed with 70% ethanol and dned before resuspension in LOO pl TE buffer (10 rnM Tris-HCI (pH 8.0) and 1 mM EDTA (pH 8.0)). 5 pl of DNA were incubated for restriction digestion in a solution with 1 pl of RNase and 1 X enzyme buffer (1 mM Tris-acetate (pH 7.3, 1 mM magnesium acetate, 5 mM potassium acetate), 10 U of restriction enzyme to a total volume of 20 pl. Sarnples were loaded with 1 kb ladder into separate wells in an agarose gel stained with ethidium bromide, electrophoresed in 1X TAE buffer and analyzed under UV light and photographed. 2.2.6 DNA Sequencing 40 pl of miniprep plasmid DNA was denatured in 5 pl alkali solution (7mM EDTA and 2 M NaOH) for 5 min, neutralized in 25 pl of neutralizing solution (3 M sodium acetate, pH 5.2), precipitated with 100% ethanol, washed in 70% ethanol and the pellet resuspended in 100 pl double-distilled, filtered water. 5 pl of this denatured DNA was sequenced by the Sanger dideoxy method using the T7 SequencingTMkit and following a protocol supplied by the manufacturer. Sequencing samples were denatured by incubation at 85 OC for 3 min prior to loading on a polyacrylamide gel (100 ml of gel soiution containing 8 g acrylamide, 20 ml 5X TBE, 0.69 g N, N'bisacrylamide, 41 g urea, 0.54 ml of 10% ammonium persulfate and 50 pl TEMED). The gel was electrophoresed in 1X TBE running buffer (one liter of 5X TBE containing 54 g Tris-base, 27.5 g boric acid, 20 ml of 0.5 M EDTA) at 2000 V for 3-4 hours. Gels were fixed with a mixture of 10% methanol and 10% glacial acetic acid, transferred to filter paper and vacuum dried at 80 "C for I5 min. The gels were then exposed to Kodak XAR film overnight. 2.2.7 DNA Probe Extraction and Radiolabelihg by Nick Translation Probes consisted of DNA fragment cut from vectors by restriction digestion (see section 22.5) and electrophoresed on a low-melt agarose gel stained with ethidium bromide. excised from the gel. and extracted and radiolabeled with a-3'~-dCTPusing the Gel Extraction kit and nick translation kit respectively. following the protocol supptied by the manufacturer. The probes were purified using NACS PrepacTM mini columns according to the protocol supplied by the manufacturer (Gibco BRL). 2.2.8 Genomic and cDNA Library Screening A human hEMBLSP6/T7 genomic library, human hypothalamus library and rat brain 5' stretch cDNA library were screened with radiolabeled probes obtained by nick translation. The libraries were titered to yield approximately 50000 plaques per plate and plates lifted with replica nylon filters as per manufacturers instructions. The filters were prehybridized with 50% formamide, 2X SSC ( 0.3 M NaCl and 0.030 M sodium citrate (pH 7)), 10X Denhardt's solution (0.2% polyvinylpyrrolidone, 0.2% Ficoll and 0.2% B S A), O. 1 % SDS, O. 1% sodium pyrophosphate, 20% dextran sulphate and 50 mghl sheared salmon sperrn DNA. Probe was added and hybridization occurred overnight at 42 "Cand terminated with two washes in solution (0.2X SSC and 1% SDS) at 55 OC. The fiIters were exposed to Kodak XAR film with an intensifying screen at -70 OC for 3 days. 2.2.9 Bacteriophage DNA Preparation To purify bacteriophage DNA from library screening, - 10 pl of bacteriophage particles was added to a bacterial culture of E.coli LE392 grown to exponential phase in LB containing 0.1% glucose and 10 rnM MgCl, and incubated overnight at 37 "C under continuous agitation. The culture was centrifuged at 6000 rpm at 4 "C for 2 min, the supernatent transferred to a ultracentrifuge tube, and the supernatent centrifuged for 30 min at 4 "C at 30000 rpm using a SW41 rotor in a Beckman Optima L-80 ultracentrifuge- The pellet was resuspended in 400 pl SM (1 liter SM contains 5.8 g NaCI, 5 ml 2% gelatin, 50 ml LM Tris-HCI (pH 73, 2 g MgSO,) with proteinase K (1 mg/ml) and incubated for 2 hr at 37 "C. DNA was phenol/chloroform extracted, ammonium acetate (7.5 LM, pH 5.2) and ethanol precipitated, and resuspended in 100 pl TE buffer. 2.2.10 Southem Blotting Phage DNA from genomic library screening was digested with various restriction endonucleases (see section 2.2.5), electrophoresed alongside 1 kb ladder on an agarose gel stained with ethidium bromide and photographed together with a fluorescent der. The gel was transferred to a HybondfM-N nylon membrane using a vacuum apparatus (Tyler Research Instruments) as per manufacturers instructions. Briefly, the gel was first placed in denaturing solution (0.5 M NaOH and 1.5 M NaCI) followed by neutrdizing solution (0.5 M Tris-HC1 (pH 7.4) and 1.5 M NaCI) and finally in 800 ml 1OX SSC for 2 hr. The nylon and transferred DNA were UV cross-linked with a StratalinkerB UV crosslinker (Stratagene). Blots were hybridized and washed as described in section 2.2.8. 2.2.11 Northem Blotting Both human and rat tissues were probed with respective hurnan and rat DNA probes for northern blot analyses. Total RNA was extracted from tissues by the method described previously (Chomczynski and Sacchi, 1987). Tissues were frozen and homogenized by polytron in solution (SM guanidium thiocyanate (pH7.2) and 8% P- mercaptoethanol), phenoVchloroform extracted, RNA precipitated by acetic acid and ethanol, pellet resuspended in DEPC-treated sterÏle water and poly(~)*RNA isolated using oligo-dT spin columns (mRNA isolation kit, Pharmacia) as per manufacturers instructions. The poly(~)' RNA was heat denatured and size fractionated by electrophoresis on a 1 % formaldehyde agarose gel. The quality of the poly(A)' RNA was inspected by ethidium bromide visualization under UV light. The RNA was transferred ont0 a nylon membrane and cross-linked (see section 2.2.10). The blot was then hybridized with a nick-translated a-"P-dCTP labeled probe (see section 2-27), washed in 2X SSPE (3 M NaCl, 0.2 M sodium hypophosphate and 0.2 M EDTA (pH 7.4)) and 0.1 % SDS at 50 OC for 2 min, washed again with O. 1X SSPE at 50 "C for 2 hr. The blot was exposed to Kodak XAR film with an intensifying screen at -70 "C for at least one week. 2.2.12 In Situ Hybridization Rat brain sections were probed with rat DNA probes. Male rats (Charles River) were killed by decapitation and their brains removed within 30 sec and frozen quickly in dry ice. The brains were sectioned at 14 pm thickness using a Reichert-Jung cryostat at -10 "C and thaw-mounted ont0 microscope slides. These sections were fixed in 4% paraformaldehyde in 0.02% DEPC sterile water for 20 min at 4 OC, washed for 5 min in cold phosphate buffered saline (pH 7.4), dehydrated through graded alcohols, air-dned and stored at -70 OC. DNA probes were labeled as in section 2.2.7 but with a-"s-dC~~. Brain sections were incubated for 2 hr at 42 "C in prehybridization solution (containing 50% deionized formamide, 0.6 NaC1, 10 mM Tris-HCI (pH 7.5). 10% dextran sulfate. 1 ri, polyvinylpyrrolidone, 2% SDS. 100 rnM DTT, and 200 pg/ml hemng sperrn DNA). The labeled probe was added (106 cpm/slice) and allowed to hybridize for 16 hr. Sections were washed greater increments of annealing stringency (ie* increasing temperature and descreasing salt concentration) dehydrated in a graded alcohol series, exposed to Dupont MRF-34 x-ray film for 4-6 weeks at -70 "C and developed. As a control, adjacent brain sections were treated with RNase and hybridized with the radiolabeled probe to confirm specificity of the hybridization. 2.2.13 Chromosomal localization Fluoresescence in situ hybridization (FISH) was performed as previously described (Heng et al., 1992; Heng and Tsui, 1993) to localize genes to regions on human chromosomes. Human lymphocytes were cultured in an a-minimal essential medium (a- MEM) supplemented with 10% fetal calf serum and phytohemagglutinin (PHA) at 37 "C for - 3 days. The cultures were ueated with BrdU (0.18 rnghl, Sigma) for another 16 hr to synchronize the ce11 population, washed three times with semmfree medium and incubated at 37 "C for 6 hr in a-MEM with thymidine (2.5 pg/mI, Sigma). Cells were harvested and slides made using hypotonic treatment, fixation and air drying. Slides were aged for a few days, heated at 55 'C for 1 hr, treated with RNase A and denatured in solution (70% formamide and 2X SSC) for 1 min at 70 'C followed by dehydration by ethanol. Purified bacteriophage DNA probes containing the gene of interest (see section 2.3.9) were biotinylated with dATP using a Bionick labeling kit (BRL),denatured at 75 'C for 5 min in solution (containing 50% formamide and 10% dextran sulphate) and loaded ont0 slides. Following overnight hybridization, detection and amplification, the FISH signals and diamidino phenylindolote (DAPI) banding pattern were visualized by fluorescence microscopy and photographed on Kodak slide film ASA 800/1600. In addition to the FISH technique, chromosomal localization mapping was also performed using a Southem blot analysis (see section 2.2.10) of a human rnonochromosoma~somatic ce11 hybrid panel (BIOS laboratones) as per manufacturers instructions. Finally, human contigs revealing novel GPCR-encoding genomic sequences (see section 2.2.3) were annotated with chromosomal locatizations. 2.2.14 Creation of an Intronless GPR58 Receptor Gene Expression Constmct To construct the full-length ORF of GPR58, two DNA fragments encoding the two exons of GPR58 were amplified and joined from human genomic DNA by PCR. Fragment 1 was amplified using oligonucleotide primers based upon the GPR58 5' untranslated region (UTR) (P9: 5'-TGACAAAA'M'CTATCTGTTCTTG-3')and the 3 ' end of exon 1 (P 10: 5'-CATACTATATGGCATGATGG-3').Fragment 2 was arnplified using primers based upon the 5' end of exon 2 (Pl 1: 5'-ATCAGATCGGT- GGAGAACTGC-3') and the sequence surrounding the stop codon (P12: 5'- TGCAGAAAAAGCCTACTCACTTTC-3'). PCR conditions were as shown in section 2.2.2. The PCR products were subcloned into the pCR 2.1 -TOPO vector (Invitrogen) with the TOPO TA Cloning Kit and sequenced. Fragments 1 and 2 were joined and amplified to form the full GPR58 ORF by two further rounds of PCR using primers whose sequence spanned both fragments (Pi3: Y-ATAGTATGATCAGA- TCGGTGGAGA-3' ; P 14: 5'-GATCTGATCATACTATATGGCAT-G-3'). A second round of PCR amplified an aliquot of the first round with primers P9 and P12. The PCR products were subcloned into pcDNA3 and sequenced to verify correct orientation for expression. 2.2.15 Maxi DNA Preparation The GPR58/pcDNA3 construct was prepared for transfection using the Maxi prep kit as per manufacturers instructions (Qiagen). Bnefly, bacterial cultures of E. coli transforrned with GPRSWpcDNA3 constructs were grown overnight in LB media containing ampicillin (IO0 pg/ml) at 37 OC under constant agitation. Cultures were centrifuged to produce pellets, resuspended in Buffer 1, lysed in Buffer P2 and bacterial debris precipitated with chilled Buffer P3 for 10 min at 4 T and centrifuged at 12000 rpm for 30 min at 4 OC. The supernated was gravity-eluted through an equilibrated Qiagen-Tip, washed, the DNA precipitated with isopropanol, washed with 70% ethanol, and resuspended in TE buffer. 2.2.16 Calcium Phosphate Transfection Cells were transfected using the Calcium Phosphate Transfection System as per manufacturers instructions. Briefly, COS-7 cells were cultured in a-MEM containing IO% fetal bovine semm at 37 "Cin 5% CO2and plated in a LOO mm tissue culture dish (1 x 106 cellsllO0 mm dishl10 ml complete medium) 24 hr pnor to transfection. Cells were supplied with fresh complete medium 3 hr pt-ior to transfection, with each dish containing 100 pl IOX HBS buffer (HEPES,NaCl), 15 pl 1 N NaOH, 70 pl calcium phosphate, 10 pl phosphate solution, 1 pg carrier DNA, 10 pg plasmid and brought up to 1 ml with sterile water. Cells were treated with cdciurn-phosphate DNA precipitate for 16 hr in complete medium at 37 "C in 5% CO2, replaced with fresh medium and incubated a further 24 hr. 2.2.17 Membrane Preparation and Binding Studies Cells were harvested in a binding buffer (containing 50 m.Tris-HC1 (pH 7.8), 5 rnM MgC12, 1 mM EGTA, leupeptin (5 pal), soybean trypsin (10 pg/pl) and benzamidine (10 pal))- Cells were homogenized twice using a Polytron (Brinkmann) for 20 sec and collected by centrifuging at 800 rpm for 10 min at 4 OC. Pellets were resuspended in binding buffer and used imrnediately for radioligand binding studies. Ce11 membranes (25 pg to 80 pg protein) were incubated with radioligands for 1 hr at room temperature in the presence or absence of competing agents. Nonspecific binding was defined as the radioactivity remaining bound in the presence of 10 pM of cornpetitor. Binding actions were stopped by adding chilled 50 mM Tris-HC1, pH 7.4 and rapid filtration over Whatman FGIC glas fiber filters. Filters were washed twice with 5 ml chilled solution (containing 50 mM Tris-HC1, pH 7.4) and the bound radioactivity detennined by using a liquid scintillation counter. The data were analyzed by nonlinear least square regression utilizing the computer program GraphPad. 3.0 RESULTS 3.1 Determination of the Human Apelin Genomic Structure and Cloning of Rat Apelin cDNA The apelin peptide was discovered by a reverse pharmacology method using the APJ receptor expressed in Chinese Hamster Ovary (CHO) cells (Tatemoto et al., 1998). WhiIe the apelin protein sequence was reported , no DNA sequences or detailed tissue distributions were reported. Ln order to investigate the physiological hnctions of apelin and APJ, 1 first endeavored to determine the DNA sequence of the apelin gene and mRNA distributions of apelin and APJ. A search of the Genbankm database with the human preproapelin peptide sequence retrieved a human genomic DNA sequence mapped to chromosome Xq25-26.1 (Clone-ID PAC 454M7, Genbankm Acc. #AL022 162). This gene sequence revealed the presence of an intron -6 kb in length with recognized introdexon boundaries interrupting the OEW at the position encoding ~ly~(Fig. 3). Using oligonucleotide pimers encoding portions of the second deduced exon, 1 performed 5' and 3' RACE of Marathon-readymf hurnan whole brain cDNA (RACE primers in section 2.2.2). 3' RACE amplified a DNA fragment -1.4 kb in size and analysis revealed a sequence identical to PAC 454M7 intempted by an intron -800 bp in length 3' of the stop codon (Fig. 3c). 5' RACE amplified several fragments, the largest -250 bp in length and identical to PAC 454M7 sequence, but was truncated upstream of the sequence encoding the start methionine. The 3' RACE fragment was used to screen a human hypothalamus Iibrary, resulting in the purification of four cDNA phage. Sequence analysis of one phage 40 Bovine Rat YLVKPRTSRT Hurnan HLVQPRGSRN Bovine "niYLVQPRGPRS Apelin Angiotensin II ( PAC 454M7 Met Stop (98072) (92070) Fig. 3. Apelin amino acid sequence aiignments and the human apelin genomic structure. (A) An alignment of amino acid sequences of rat preproapelin with human and bovine preproapelin. Conserved amino acids are shown boxed. The mature apelin peptide are shaded. Numeric amino acid positions are indicated on the right. (B) An alignment of amino acid sequences of human apelin and angiotensin II. Consewed amino acids are shown boxed. (C) The genomic structure of the human preproapelin gene as found in the human PAC 454M7 clone (GenBank Accession # AL022162). Nucleotide positions of PAC 454M7 defining preproapeiin gene exons (boxes) are shown at the top. The ORF is shown in black, with the nucleotide positions of the start and stop codons shown at bottom. revealed additional 5' UTR sequence found in PAC 454M7 (Fig. 3c). Sequence analysis of the 13 amino acid mature peptide revealed identity, albeit lirnited, to angiotensin U (Fig. 3b). The proposed start methionine did not conform to a Kozak consensus sequence due to the presence of an adenosine immediately following the start codon (Kozak, 1996). The peptide sequence following the start methionine included a signal secretory peptide hydrophobic region followed by a stretch of polar amino acids. 1 conducted a seatch of the EST database with the hurnan preproapelin peptide sequence and retrieved a rat EST (GenbankTM Accession #AA94283 1) which partially encoded the 5' portion of rat preproapelin. Primers based on this sequence were designed and arnplified a 425 bp fragment from a rat brain 5' stretch cDNA library. This fragment was used to screen the same library arnplified, resulting in the purification of three phage. These phage were arnplified using prîmers designed upon regions flanking the cDNA library inserts (Primers Pl and P2 in section 2.2.2). Sequence analysis revealed a phage (-1.5 kb in size) which encoded a protein with identity to the reported human preproapelin. The rat preproapelin cDNA encoded a peptide of 77 amino acids (identical in size to human and bovine), with identities of 82% and 77% with human and bovine preproapelin respectively (100% identity within the mature peptide) (Fig. 3a). Similar to the human preproapelin cDNA, the reported start codon for rat preproapelin did not appear to conform to the Kozak consensus sequence, again by the presence of an adenosine irnrnediately following the start codon. 3.2 mRNA Tissue Distribution of Apelin and the APJ Receptor Northem blot analysis with a 3' RACE derived human cDNA probe reveaied preproapelin mRNA detected as two bands migrating at 3.5 and 3.0 kb in extracts of several human brain regions including the caudate nucleus, thalamus, hypothalamus, hippocampus, midbrain, basal forebrain and frontal cortex (Fig. 4a). Northern analysis utilizing the rat preproapelin-encoding cDNA as a probe revealed preproapelin mRNA detected as two bands at 3.7 and 3.1 kb in several rat brain and peripheral tissue extracts including the frontal cortex, cortex, striatum, midbrain, hippocampus, medulla pons, cerebellum, pituitary, olfactory tubercle, septum, adrenal, vas deferens, testis, intestine, kidney, and in the fetus (Fig. 4b and c). Higher levels of expression were indicated by strong signals in the heart and faint signals were also detected in the spleen and liver (Fig. 42). In situ hybridization anaiysis of rat brain utilizing the same probe used in the rat northern analysis revealed preproapelin mRNA was abundantly expressed in cerebral cortex in the frontal, parietal, and more caudal striate regions encompassing the somatosensory areas, such as the primary visual, auditory and olfactory cortices (Fig. 5). There was also dense expression in the claustmm, anterior and posterior cingulate, retrosplenial area, the subiculum and the olfactory tubercle. The medial and lateral septal nuclei, nucleus of the diagonal band and the caudate-putamen had moderate labeling. Several thalarnic nuclei were very densely labeled, such as the anterodorsal, mediodorsal, ventroposterior, ventromedial, centrolateral and the media1 habenular nuclei, whereas others such as the anteromedial thalamic nucleus had a much lower expression level. Overall in hypothalamus, preproapelin rnRNA was not widely distributed, with dense Fig. 4. Northern blot analyses of human and rat preproapelin mRNA. The distribution of preproapelin rnRNA in human (A) and rat (B and C) tissues. Each lane contained 10 pg of poly(A)+ RNA isolated from various tissues. Fig. 5. In situ hybridization analyses of rat preproapelin mRNA. Darkfield autoradiograms of coronal sections of rat brain showing the localization of preproapelin mRNA, showing in distance from bregma according to the stereotactic coordinates (Paxinos and Watson, 1982). Shown are representitive sections at Ievels relative to the bregma at -0.3 mm (A), -0.5 mm (B), -1.8 mm (C), -2.8 mm (D), -3.9 to -4.2 mm (E) and -5.8 mm (F). 3v, third ventricle; 4v, fourth ventricle; 7, facial nucleus; AC, anterior cingulate cortex; AD, anterodorsai thalamic nucleus; AM, anterornedial thalamic nucleus; APT, anterior pretectat area; AUD, auditory area; CA, field of Ammon's horn; Ch. choroid plexus; CL, centrolateral thalamic nucleus; CP, caudate putamen; DG, dentate gyrus; DK, nucleus of Darkschewitsch; DM, dorsomedial hypothalamic nucleus: FP, C frontoparietal cortex; IC, inferior colliculus; IPN, interpeduncular nucleus; LG, lateral geniculate complex; LS, lateral septal nucleus; MA, magnocellular preoptic nucleus: MD, mediodorsal thalamic nucleus; MG, medial geniculate nucleus; MEA, media1 amygdaloid nucleus; MEPO, median preoptic nucleus; MH, media1 habenular nucleus; MPO, medial preoptic area; OB, olfactory bulb; OT, olfactory tubercle; PAG, petiaqueductal gray; PB, parabrachial nucleus; PE, periventricular hypothalamic nucleus; Pi, pineal gland; PO, primary olfactory cortex; PT, parietal region; PVN, paraventricular hypothalamic nucleus; RS, retrosplenial area; S5, sensory root of the trigeminal nerve; SC, superior colliculus; SF, septofimbrial nucleus; SH, septohypothalamic nucleus ; SO, supraoptic hypothalamic nucleus; SS, primary somatosensory area; STISTH, subthalamic nucleus; SUB, dorsal subiculum; TS, tnangular septal nucleus; V, vestibular nucleus; VAL, ventral anterior-lateral complex thalamus; VIS, primary visud area; VM, ventromedial thalamic nucleus; VP, ventroposterior thalamic nucleus; ZI, zona incerta. Fig. 5. (Continued) Fig. 5. (Continued) Fig. 5. (Continued) labeling visualized only in the magnocellular neurons, with sparse signal present in the media1 preoptic area, periventricular, ventromedial and dorsornedial nuclei. In hippocampus, preproapelin mRNA was present in the CA regions of Ammon's horn and the dentate gyrus. In midbrain, preproapelin mRNA expression was detected in the medial and lateral geniculate complex, and very dense signal was observed in the zona incerta and the subthalamic nucleus. Prominent expression was also detected in the anterior pretectal nucleus, interpeduncular nucleus. inferior colliculus and the nucleus of Darkschewitsch, with somewhat lesser amounts in the superior colliculus and the periaqueductal gray. Preproapelin rnRNA was also present in the pineal gland, parabrachial nucleus and the nucleus of the trigeminal nerve. Previously. the APJ receptor gene was cloned in Our laboratory (O'Dowd et al., 1993). DNA encoding the rat APJ receptor was used as a probe for in situ hybridization of rat brain, which revealed the distribution of mRNA encoding the APJ receptor was detennined in comparable sections as mapped for preproapelin (Fig. 6). APJ mRNA was rnuch more discretely expressed, with extremely dense expression in the choroid plexus lining the cerebroventricular system. There was abundant expression detected in the olfactory bulb and the pineal gland. APJ mRNA was highly concentrated in the paraventricula. nucleus and supraoptic nucleus of the hypothalamus, and was also present in the Islands of Calleja, olfactory tubercle, dentate gyrus and the pontine gray. Sparse labeling of cortex was evident, in the frontoparietal and pnmary olfactory regions. Fig. 6. In situ hybridization analyses of rat APJ mRNA. Darkfield autoradiograrns of sagittal and coronal sections of rat brain showing the localization of APJ receptor mRNA (A through D). (A) shows a lateral representative section at 0.4 mm. Also shown are representitive sections at levels relative to the bregma at 1.2 mm (B), -1.8 mm (C) and - 4.8 mm (D). See Fig. 5 for abbreviation definitions. Fig. 6. (Continued) O 3.3 Discovery and Cloning of the TRE-R2 Receptor Cene With the previous success of homology cloning by the degenerate PCR method, 1 proceeded to design new degenerate primers in the highly conserved TM3 and TM7 regions, yet based over a wider spectrum of GPCRs in order to diversify the products arnplified and therefore increase my chances of arnplifying novel GPCR-encoding DNA. To isolate novel GPCR genes, 1 aligned the TM3 and TM7 regions of various GPCRs cloned in our Iaboratory inciuding GPRl through GPRlO, GPR14, GPRIS, GPR19 through GPR25, GPR27, GPR30 and GPR3 1 and designed two new degenerate prirners, Deg 1 and Deg2 (Fig. 2). A rat brain 5' stretch cDNA Iibrary was amplified by PCR with De@ paired with two prirners specific for the 5' (primer Pl) and 3' (primer P2) regions flanking the cDNA library inserts to further increase the degeneracy of the search. One PCR product (-400 bp) was found to encode a novel GPCR from TM4 to TM7, sharing the greatest translated sequence identity of 448 to the thyrotropin releasing hormone receptor TRH-Ri. This cDNA was labeled with [32~]d~TP-aand used to probe the same rat brain cDNA library. which resulted in the isolation of two cDNA clones. These clones were amplified by PCR using primers Pl and P2 and the products subcloned into the pcDNA3 vector. Both cDNAs reveded identical sequences encoding the full-length receptor, which 1 named TRH-R2. TRH-R2 encoded a protein of 352 amino acids which shared the greatest sequence identity of 68% in the TM domains with TRH-RI (Fig. 7). TRH-R1 had many conserved residues and motifs typical of the GPCR family, including an asparagine in TM 1, an aspartate in TM2. prolines in TM'S 5 through 7, one consensus sequence for N-Iinked glycosylation in the amino terminus. cysteines in N 1 -Y)1 CI - x W a Y < C 2 V) t a > C O UY UY a a z Y UI ur < d O C O a rr V) > Y A a C < A t >O UY < 2 > > C t Ot t an O aa t a x > W, C t A - Our O 0 > O 2 z ax Wur WY UYa tW w a fAt cn rra UI r au 2 Our W r gj -< >a if Fig. 8. Northern blot analyses of rat TRH-R2 mRNA. Each lane contains 10 pg of poly(~)+RNA isolated from various rat tissues. The molecular size is indicated on the right. the first and second extracellular loops, a PKA/PKC consensus sequence in the third intracellular loop and two possible palmitoylation cysteine sites in the carboxy tail. In a collaboration with Dr. Marvin C. Gershengorn of the Department of Medicine, Weill Medical College of Corne11 University, TRH-R2 was expressed in COS cells and found to have similar affinities for thyrotropin-releasing hormone (thyroliberin, TRH) with the mouse and rat TRH-RI receptors in affinity and cornpetition binding experiments (O'Dowd et al., in press). in addition. binding experiments for mouse and rat TRH-RI and the rat TRH-R2 receptors with TRH analogs also revealed binding with similar affinities (O' Dowd et al., in press). Together, these binding data experiments revealed TRH-R2 to be a second thyrotropin-releasing hormone receptor. 3.4 mRNA Tissue Distribution of the TRH-R2 Receptor Tissue distribution of TRH-R2 mRNA transcripts was obtained by northern blot analysis using a cDNA fragment encoding TM-R2 from TM4 to TM7 and poly(~)+ RNA isolated from various rat tissues. In the brain, a major transcript of 9.4 kb length (and a faint band of 3.8 kb length) was seen in the pons, hypothalamus and midbrain (Fig. 8). Faint bands of 9.4 kb length were also found in the striatum and pituitary (data not shown). TRH-R2 receptor mRNA distribution visualized, by in situ hybridization histochemistry, revealed abundant expression in very discrete nuclei and regions of rat brain (Fig. 9). There was extremely dense expression in frontoparietal cortex, particularly in the primary somatosensory and motor areas, and also in the pnmary visual area and primary olfactory cortex. Strong signais were also present in other areas of Fig. 9. In situ hybridization analyses of rat TRH-R2 mRNA. Darkfield autoradiograms of coronal sections of rat brain showing the localization of preproapelin mRNA, showing in distance from bregma according to the stereotactic coordinates (Paxinos and Watson, 1982). Shown are representitive sections at levels relative to the bregma at -0.7 mm (A), -0.8 mm (B), -1.3 mm (C), -3.3 mm (D), -3.9 mm (E), -5.3 mm (F),-6.8 mm (G), and -7.9 mm (H). (I) Sagittal section of rat brain 2.4 mm from the midline. (J) Section through pituitary gland. ACg, anterior cingulate area; AHi, amygdalohippocarnpal area; My, anterior hypothalamic nucleus; AP, antenor lobe of pituitary; AV, anteroventral nucleus; BST, bed nucleus of the stria terminalis; CM, central media1 nucleus of thalamus; CR, centrai nucleus raphe; DGgr, dentate gyrus crest; En, endopiriform nucleus; FrP, frontoparietal cortex; FrPm, primary motor area; FrPss, primary somatosensory area; HDB, nucleus of the diagonal band; IC, inferior colliculus: [P. interpeduncular nudeus; LI), laterodorsal nucleus of thalamus; LGd, lateral geniculate nuclear complex, dorsal part; LH, lateral hypothalamic area: LP, lateral posterior nucleus of thalamus; MeA, media1 nucleus of amygdala; MGd, dorsal mediai geniculate nuclear complex; MGv, ventral media1 geniculate nuclear complex; MHb, media1 habenular nucleus; MPO, medial preoptic area of hypothalamus; MR, mesencephalic reticular nucleus; MRN, mesencephalic reticular nucleus; NIL, neurointermediate lobe of pituitary; OT, olfactory tubercle; PAG, periaqueductal gray; PB, parabrachial nucleus; PCg, posterior cingulate area; PH, posterior hypothalamic nucleus; PMd, dorsal premammillary nucleus; PMv, ventral premarnmillary nucleus; PN, pontine nucleus; PO, primary olfactory cortex; PRN, pontine reticular nucleus; PRt, pontine reticular nucleus; PVH, paraventricular nucleus of hypothalamus; PVT, paraventricular nucleus of thalamus; Rem, nucleus reuniens, media1 part; RL, rostral linear raphe nucleus; RSp, retrospenial area; S, subiculum; SAG, nucleus sagulum; SC, superior colliculus; Sd, dorsal subiculum; Sp, pyramidal layer of the subiculum; STh, subthalarnic nucleus; Str, striate areas of primary visual cortex; Sv, ventral subiculum: VL, ventrolateral nucleus of thalamus; VM, ventromedial nucleus of thalamus; VP, venteroposterior nucleus of thalamus; VTA, ventral tegmental area; 23, zona incerta. Fig. 9. (Continued) Fig. 9. (Continued) Fig. 9. (Continued) Fig. 9. (Continued) Fig. 9. (Continued) cortex, such as the anterior cingulate area, concentrated in the deeper rather than in the superficial layers of cortex. Further caudally, TRH-R2 mRNA expresssion was moderately dense also in the posterior cingulate area, retrosplenium, striate areas and throughout the subiculum in both dorsal and ventral portions. Several thalamic nuclei displayed extremely dense labeling, such as the paraventricular, centromedial, anteroventral, and ventroposterior thalamic nuciei and the media1 habenular nucleus. TRH-R2 mRNA was present less abundantly in other thalamic nuclei, such as the laterodorsal, lateroposterior and ventromedial nuclei. and the media1 reuniens nucleus. In hypothalamus, TRH-R2 mRNA was most abundant in the anterior hypothalamic area, and also present in the medial preoptic and lateral hypothalamic areas, the paraventricular nucleus and some of the mammillary nuclei. Moderate labeling was also seen in the bed nucleus of the stria terminalis, the nucleus of the diagonal band, some of the arnygdaloid nuclei and in the subthalarnic nucleus. The geniculate nuclear complex contained very dense expression in the medid geniculate, in both the dorsal and ventral divisions of the nucleus, whereas in the Iateral geniculate, moderate expression was observed largely in the dorsal division. In midbrain, a punctate pattern of TRH-R2 mRNA expression was observed in the superior colliculus, penaqueductal gray and the mesencephalic reticular nucleus. Small amounts of mRNA were present in the ventral tegmental area. The pontine gray expressed TRH-R2 mRNA very abundantly, and the central and rostral Iinear raphe nuclei showed moderately dense labeling as well. Lesser amounts were evident in the in ferior colliculus, the nucleus sagulum, the pontine reticular nucleus and the parabrachial nucleus. TRH-R2 receptor mRNA was detected in pituitary gland, as sections revealed a very small amount of labeling in the anterior lobe, whereas the neurointermediate lobe was devoid of any signal. 3.5 Discovery and Cloning of the GPR54 Receptor In addition to TRH-R2, the degenerate PCR approach dso retrieved DNA panially encoding the novel GPCR, GPR54. The degenerate primers Degl and Deg2 were used to arnplify the 5' stretch rat brain cDNA Iibrary. One of the resulting rat clones appeared to partially encode a galanin-like receptor. The partial cDNA was radiolabeled and used to screen the cDNA library employed in the degenerate PCR. Two positive plaques were purified and their inserts amplified by PCR with the Pl and P2 primers flanking the cloning site of the hgtl 1 vector. Sequence analysis revealed that each plaque encoded a region of a putative GPCR from TM3 to the carboxy terminus identical to each other and the originai probe. A second round of screening of 1 x IO6 plaques freshly plated from the same library y ielded an additional three positive plaques. PCR amplification of these positive plaques with Pl and P2, each paired with an interna1 primer, revealed that only one of these positive plaques contained the entire ORF. This plaque was purified, the insert subcloned into pBluescript and was confirmed to contain the 5' end of the full-length ORF. Finally, two specific primers from the 5' and 3' ends of the ORF were used to arnplify the full length rat cDNA 1.2 Kb clone, named GPR54. Sequence analysis revealed the cloned GPR54 ORF to be 1 19 1 bp in length encoding a protein of 396 arnino acids, identical to the previous phage clones and the original probe and sharing significant identities with the galanin receptors (Fig. 10). Conserved residues and consensus sequences of the GPCR family present in GPR54 included an asparagine Fig. 10. Schematic representation of the GPR 54 receptor. GPR54 (string of yellow and blue spheres) in a ce11 membrane. Blue spheres represent amino acids conserved with the galanin receptors GdR1, GalR2, and GalR3. Green branches = glycosylation sites; red spheres = PKAPKC sites and orange spirals = palmitoyaltion sites. A disdphide bride is indicated between extracellular loops 1 and 2. in TM 1, an aspartate in TM2, prolines in TM'S 4 through 7, three consensus sequences for N-linked glycosylation in the amino terminus, cysteines in the first and second extracellular loops, a PKNPKC consensus sequence in the second intracellular loop, a PKC consensus sequence in the third intracellular loop and three possible pdmitoylation cysteine sites in the carboxy tail. A BLAST search with the rat GPR54 sequence revealed high identity with a hurnan 3.5 Mb contig located in chromosome 19p13.3 containing a serine protease gene cluster (Genbankm accession # AC005379). Sequence analysis revealed a previously unrecognised 3.3 kb intron-containing human orthologue of GPR54 encoding a protein 398 amino acids in length and sharing a translated arnino acid identity of 8 1% (10% identity in the TM regions). The genomic sequence revealed four introns located in TM2 (-800 bp, interrupting the translated FYI..ANL sequence), TM3 (-800 bp, interrupting IQQ..VSV), TM4 (-250 bp, interrupting WVG..SAA) and in the third intracellular loop (- 180 bp, interrupting ALQ..GQV). In a collaboration with Dr. Gary O'Neill of the Department of Biochemistry and Molecular Biology, Merck Frosst Center for Therapeutic Research, GPR54 was tested as a possible galanin receptor. GPR54 expressed in COS cells revealed no specific binding with 125~-hurnangalanin (Lee et al., 1999). As a control experiment, the galanin receptor, GaIR1, was expressed in COS cells and revealed high affinity and specific binding for l251-human galanin. Despite the high level of sequence identity between GPR54 and GalRI, ~~k54does not appear to be another galanin receptor. 3.6 mRNA Tissue Distribution of the GPR54 Receptor Both northem blot and in situ hybridization analyses of GPR54 were performed with a DNA probe encoding GPR54 from TM3 to TM7. The tissue distribution of GPR54 was obtained by northem blot analysis using poly(A)' RNA isolated from various rat tissues (Fig. 1 1). In the brain, multiple RNA transcripts with a complex pattern were detected in the medulla pons, midbrain, hippocampus, cortex, frontal cortex. and striatum. The most intense band was approximateiy 3.7 Kb in length, with a single, larger transcript of approximately 12 Kb length detected in the liver and intestine only. No transcripts were revealed in the cerebellum or kidney tissues. Using in situ hybndization of rat brain sections. the distribution of GPR54 mRNA was found to be discretely localized to many areas (Fig. 12). The highest levels of expression were seen in hypothalamic and amygdaloid nuclei. GPR54 mRNA was highly expressed in the zona incerta, ventral tegrnental area, dentate gyrus, hypothalarnic arcuate nucleus, dorsomedial hypothalamic nucleus, primary olfactory cortex, lateral habenular nucleus, lateral hypothalamic area, locus coenileus, and the corticai and mediai nuclei of the amygdala. GPR54 mRNA was also concentrated in the superior colliculus. medial preoptic area, anterior hypothalamic area, posterior hypothalamic nucleus, periaqueductal gray, parafascicular thalamic nucleus, parabrachial nucleus, and ventral premammillary nucleus. The signals detected in the septohypothalamic nucleus, inferior colliculus, media1 nucleus of the amygdala, mesencephalic reticular nucleus and retrosplenial cortex were diffuse and less abundant. Figure 11. Northern blot analyses of rat GPR54 mRNA. Northern blot analysis of the tissue distribution of GPR54 rnRNA in rat brain. Each lane contained 5 pg of poly(A)' RNA isolated from various rat tissues. Figure 12. In situ hybridization of rat GPR54 mRNA. Darkfield autoradiograms of sagittal and coronal sections of rat brain showing the localization of GPR54 receptor mRNA showing in distance according to the stereotactic coordinates (Paxinos and Watson, 1982). (A) shows a lateral representative section at 0.9 mm. Also shown are representitive sections at levels relative to the bregma at -3.3 mm (B), -3.8 mm (C) and - 6.3 mm (D). Aco, cortical nucleus of the amygdala; AHy, anterior hypothalamic area; Arc, hypothalamic arcuate nucleus; IC, inferior colliculus; CA, field of Ammon's horn; DG, dentate gyrus; DM, dorsornedial hypothalamic nucleus; LC, locus coeruleus; LH, lateral hypothalamic area, LHb, lateral habenular nucleus; MeA, media1 nucleus of the amygdala; MPO, medial preoptic area; MN,mesencephalic reticular nucleus; PAG, periaqueductal gray; PB, parabrachial nucleus; PF, parafascicular thalarnic nucleus; PH. posterior hypothalamic nucleus; PMV, ventral premammillary nucleus; PO, primary olfactory cortex; RSpl, retrosplenial cortex; SC, superior colliculus; SHy, septohypothalamic nucleus; VTA, ventral tegmental area; 21, zona incerta. Fig. 12. (Continued) Fig. 12. (Continued) 3.7 Discovery and Cioning of the GPR57 and GPR58 Receptor Genes and a Pseudogene yrGPR57 Recently, various novel genes have been found in the patent literature, including those encoding novel GPCRs. However, certain patents are limited to only sequence data, ofter, from a non-human source, contain little if any data on expression distributions or function, and are generally unknown to the scientific community. In my efforts to characterize novel GPCR-encoding genes, 1 have begun investigation of several patented GPCR genes. Human genornic DNA was PCR amplified using primers P5 and P6, based upon a patent (#EP 0859055-Ml)gene sequence HNHCI32. 1 obtained a gene very similar to HNHC132 with the exception of two single base-pair substitutions and two single base- pair deletions. The first deletion resulted in a stop codon in TM3 and an ORF of only 309 bp encoding a 103 amino acid protein. In order to search for a gene identical to the patent sequence containing an ORF encoding a complete GPCR, this DNA was used to screen a human genomic library. Two phage were identified and PCR amplified with the P5 and P6 primers and a sequence analysis revealed both the amplified genomic DNA and genomic library gene products to be identical and both encoded a pseudogene, vGPR57 (Fig. 13), sharing a 99.6% bp identity with HNHCI32 (which was renamed GPR57). 1 obtained a rabbit sequence as revealed in a patent (# JP 1997051 795-Ail, GenbankTM Accession # E12664) which only partially encoded a novel GPCR. This sequence was used in a BLAST (Altschul et al., 1997) search of the GenbankTMGSS database to reveal human genomic clone 200SD7 (GenbankTMAccession # B52458) 5'- CTCATCC~CC~GGAAAGM~CAAGGGATAAAGCACC 1 98 ATG GAT CïA ACT TAT AIT' CCC GAA GAC CïA TCC AGT TGT CCA M TIT GTA MTAA* ATC Met Asp Leu Thr Tyr Lle Pro Glu Asp Leu Ser Ser Cys Pro Lys Phe Vai Asn Ile 30 158 CTG TCC TCC CAC CAA CCG CTC TTT TCA TGT CCA GCrT GAT AAT GTA TTC GGT TAT GAC TGG Leu Ser Ser His Gln Pro Leu Phe Ser Cys Pro Gly Asp Asn Val Phe Giy Tyr Asp Trp 30 TM 1 217 AGC CAT GAT TAT 'CA CTA TTt GGA AAC TI% GlT ATA ATG GTT TCC ATA TCG CAT lTC AAA Ser His Asp Tyr Leu Phe Gly Am Leu Val Ile Met Val Ser ïie Ser His Phe Lys 59 TM 2 277 CAG CIT CAC TCT CCC ACA AAC TIT CTG ATC CTC TCC ATG GCA ACC ACG CAC TTT CTG CïG GIn Leu His Ser Pro Thr Asn Phe Leu Ile Leu Ser Met Ala Thr Thr Asp Phe Leu Leu 79 337 GGT I7-ï GTC ATT ATG CCA TAC AGC ATA ATG CGA TCA GTG GAG AGT TGC TGG TAC TIT GGG Gly Pht Vd [Ir: &Met Pro Tyr Ser Ile Met Arg Sa Val Glu Ser Cys Trp Tyr Phe Giy 99 TM 3 397 GAT GGC TTT TGT AAA TTC CAC ACA AGC TTT GAC ATG ATG CTC AGA CTG ACC TCC AIT ITC Asp Gly Phe Cys Lys Phc His Thr Ser Phe Asp Met Met Leu Arg Leu Thr Ser Ile Phe 119 457 CAC CTC TGT TCC ATT CiCi AïT GAC CGA TTT TAT GCC GTG TGT TAC CCT l'TA CAT TAC ACA His Leu Cys Ser Ile Na Ile Asp Arg Phe Tyr Ah Val Cys Tyr Pm Leu His Tyr Thr 139 TM4 5 17 ACC .aATG ACG MCTCC ACC ATA AAG CAA CTG CI% GCA TiT TGC TGG TCA GTT CCT GCT Thr Lys Mct Thr Asn Ser Thr Ile Lys Gh Leu Leu Ala Phe Cys Trp Ser Val Pm AIa 159 577 CIT ITT TCT TTT GGT WA GIT CTA TCT GAG GCC GAT GTï TCC GGT ATG CAG AGC TAT AAG Leu Phe Ser Phe Gly Leu Val ku Ser Glu Ala Asp VaI Ser Gly met Gln Ser Tyr L-vs 1 79 63 7 ATA CTT GTT GCT TGC TI% AAT TTC TGT GCC ClT ACT 'ITC AAC h4A TTC TGG GGG ACA ATA Ile Leu Val Ala Cys Phe Asn Phe Cys Na Leu Thr Phe Asn Lys Phe Trp Gly ?hr Ile 199 TM 5 697 ITG TC ACT ACA TGT TTC TTï ACC CCT GGC TCC ATC ATG GïT GGT ARTAT GGC AAA ATC Leu Phe Thr Thr Cys Phe Phe ïhr Pro Gly Sa Ile Met Val Gly IIe Tyr Gly Lys Ile 219 757 TIT ATC G'IT TCC MCAG CAT GCT CGA GTC ATC AGC CAT GTG CCT GAA MCACA AAG GGG Phe Ile Val Ser Lys GIn His Ala kg Val Ile Ser His Vd Pro Glu Am Thr Lys Gly 23 9 817 GCX GTG -4iUAi\A CAC CTA TCC MGAAA AAG GAC -4GG AI\A GCA GCG AAG ACA CTG GGT ATA .Ma Vd Lys Lys His Leu Ser Lys Lys Lys Asp Arg Lys Ala Ah Lys Thr Leu Gly [Ie 259 TM 6 877 GTA ATG GGG GTG TTT CïG GCT TGC TGG T'TG CmTGT TIT ClT GCT GTT CTG AlT GAC CCA Vai Met GIy Val Phe Leu Ala Cys Trp Leu Pro Cys Phe Leu Ala Vai Leu Ile Asp Pm 279 937 TAC CT.4 GAC TAC TCC ACT CCC ATA CTA ATA TTG GAT CTT ïTA GTG TGG CïC CGG TAC TC Tyr Leu Asp Tyr Sa ïhr Pro [le Leu Ile Leu Asp Leu Leu Val Trp Leu Arg Tyr Phe 299 TLM7 997 AAC TCT ACT TGC AAC CCT CTT ATT CAT GGC T[T T?T AAT CCA TGG TTT CAG AAA GCA TTC Asn Ser Thr Cys Asn Pro Leu [le His Gly Ph<: Phe Asn Pro Trp Phe Gln Lys Na Phe 319 1 057 AAG TAC ATA GTG TCA GGA Mt ATA TLT AGC TCC CAT TCA GAA ACT GCA .4AT TTG TIT Cm Lys T-yr Ile Val Ser Gly Asn IIe Phe Ser Ser His Ser Glu Thr Ala Asn Leu Phe Pro 339 III3 GAA GCA CAT T.UTMGCTITGCAAAAGTGAATAGAATA?TGCAAATGAGAT~G-3' Glu Ala His Fig. 13. Sequence of the vGPR.57 pseudogene. Differences and deletions from GPEZ57 nucleotide sequence are indicated in lower case bold and by a "*" respectively. Without the frame shifts, the predicted TMç are shaded and labeled. Amino acids are numbered on the Ieft and nucleotides on the right. which partiaily encoded a receptor from the third intracellular loop to the stop codon with 92% identity to the rabbit sequence. Human genomic DNA was PCR amplified using a primer based on the TM6 encoded by clone 2005D7 (P8) and a degenerate primer designed from the sequence encoding TM3 of PNR, 5-HT, pseudogene, and the rabbit €12664 sequence (P7). A PCR product (-400 bp) revealed an 89% identity to the patented rabbit sequence, confirming a hurnan ortholog. This DNA was used to screen a human genomic library, revealing a phage encoding a novel GPCR, which 1 named GPR58. The sequence obtained was from the first extracellular loop to the stop codon, indicating the presence of an intron at the TMZ/first extracellular loop junction. Dunng the course of my work, a patent was released (# IP 1997238686-NI, Genbankm Accession # E13892) which included a gene named phBL5 encoding the human GPR58 ORF. To isolate the GPR58 ORF, two sets of human GPR58 primers (P9 through P12) were used to arnplify the two exons flanking the TM2Ifirst intracellular loop junction intron. The amplified fragments were joined in one round of PCR by the extension of primers whose sequences overlapped the two fragments (Pl3 and P14) and the OWwas amplified in a second PCR round with GPR58 5' and 3' UTR-specific primers P9 and P 12. GPR57 and GPR58 encoded proteins of 343 and 306 amino acids respectively. The sequences for GPR57 and GPR58 were aligned and found to have signifiant sequence similarity to each other (Fig. 14). Conserved residues and consensus sequences of the GPCR farnily present in the GPR57 and GPR58 receptors included an asparagine in TMI, an aspartate in TM2, prolines in TMs 4 through 7, cysteines in the first and second extracellular loops, and PKC consensus sequences in the second and third S.. .a . . . .a . . . .- ni. .m - OX. O0 intracellular loops. The sequence of the GPR58 ORF varied only by two thymine to cytosine substitutions compared with the phBL5 patent sequence, resulting in a conserved substitution of Mal3' in place of Val and a silent nucleotide variation encoding ~yr'? Given that these arnino acid differences are either silent or very well conserved and cause no shifts in the translational reading frames, they would probably have little if any effect on the mature GPR58 protein function. 3.8 GPR57 and GPR58 Expression Northern analysis was also performed for GPR57 and GPR58 on human tissue. Since the GPR57 and yGPR57 sequences shared 99.6% identity, the vGPR57 probe wouId also detect GPR57 mRNA transcnpts. For GPR57, revealed in the patent (# EP 0859055-Ail) to have been cloned from human hippocampus cDNA, no visible transcripts were detected in the pons, thalamus, globus pallidus, caudate, putamen or cerebellum. For GPR58 (revealed in patent # JP 199705 l795-AA to have been cloned from rabbit smooth muscle cDNA and in patent # JP 19972386864/1 from human cerebellum cDNA) no visible transcripts were detected in the pons, thalamus, hypothalamus, hippocampus, caudate, putamen, frontal cortex, basal forebrain, midbrain or Iiver. 3.9 Attempted Pharmacological Characterization of the GPRSS Receptor COS-7 cells were transfected with a construct encoding GPR58 and membranes harvested for ligand binding assays. For the receptor encoded by GPR58, [)H]-SHT was tested for binding in cornpetition expenments with three compounds: methiothepin (a 5- HT,antagonist), mianserin (a non-selective 5-HT antagonist) and SDZ-205,557 HCl (a 5- HT, antagonist). In each experirnent, no specific binding of serotonin to the GPR58 receptor was detected. 3.10 Chromosomal Localization of the GPR58 Receptor Genes and Pseudogene yGPR57 A Southern blot of a hurnan monochromosornal somatic ce11 hybrid panel with a probe encoding yGPR57 was performed. Given the 99.6% sequence identity between yGPR57 and GPR57.1 expected to see bands revealing the chromosornal localization of both vGPR57 and GPR57. A single band was detected (data not shown) suggesting that both vGPR57 and GPR57 localized to chromosome 6. FISH anaiysis of human metaphase spread chromosomes was used to identify the chromosomal localization of yGPR57 and GPR58. The phage clones were biotinylated and used for FISH mapping. The detailed positions were deterrnined based on the summary from 20 photographs of human chromosome 6 region q23-q24 for vGPR57 and chromosome 6 region q24 for GPR58 (Fig. 15). 3.11 Discovery and Cloning of the GPR61 and GPR62 Receptor Genes Another patented gene encoding a novel GPCR was patent # JP 8245697, which only partially encoded a rabbit GPCR. This sequence was used to design prirners encoding TM3 (PH)and TM6 (P16), which were used to amplify human and rat genomic DNA. PCR products -500 bp in length were subcloned and sequenced to reveal hurnan and rat DNA with >80% identity to the rabbit gene, comfirming them to be the Fig. 15. FISH analysis for yGPRS7 and GPR58. (A) represents yGPR57 and (B) GPR58, showing results of metaphase spread chromosomes probed with phage clones encoding vGPR57 or GPR58 and an ideogram summarizing the results of both FISH analyses. Each dot represents the location of a fluorescent signal on the chromosome using phage containing the yGPRS7 or GPR58 clone as a probe. human and rat orthologues. The human sequence was used to design primers for RACE (Frohman et al., 1988) to ampli@ Marathon-readyThfhuman whole brin cDNA. Both 3' and 5' cDNA ends were amplified successfully of 1.6 and 1.1 kb in respective size to elucidate the ORF encoding a 417 amino acid protein. The novel GPCR encoded shared identical sequence with the TM3-TM6 previously amplified, and was narned GPR6 1. The sequence for GPR61 was used to search the GenBankm databases. A search of the HTGS database retrieved what appeared to be a novel, intronless GPCR-encoding gene in a PAC clone (Accession #AC006255) localized to chromosome 3p2 1.1-2 1.9. The proposed start methionine for this ORF conformed to an adequate Kozak consensus sequence (Kozak, 1996) and was preceded by an in-frame stop codon. Primers were designed to arnplify human genomic DNA which amplified a product - 1.2 kb in length. This product was subcloned, sequenced, confirmed to encode a full-length ORF of 367 amino acid length with an identicai sequence to the GenBankTM retrieved PAC clone, and the GPCR encoded was named GPR62. The amino acid sequences for GPR61 and GPR62 were aligned and found to share low but significant sequence similarity, particularly within TM2, 5, 6 and 7 (Fig. 16). Conserved residues and consensus sequences of the GPCR family present in GPR6 1 and GPR62 included an asparagine in TMI, aspartate in TM2, prolines in TM'S 5 through 7 (and in TM 4 for GPR61), cysteines in the first and second extracellular loops, a PKA/PKC consensus sequence in the second intracellular loop, and a possible palmitoylation cysteine site in the carboxy tail. GPR61 had one consensus sequence while GPR62 had two consensus sequences for N-linked glycosylation in the amino terminus. Fig. 17. Northern blot analyses of human and rat GPR61. Each lane contains 10 pg of poly(~)+RNA isolated from various human (A) and rat (B) tissues. The molecular six is indicated on the right. 3.12 mRNA Tissue Distribution of the GPR61 Receptor To determine the expression patterns of GPR61, northem blots of human and rat tissue were performed using the human 3' RACE amplified DNA and rat DNA fragments encoding GPR61 as probes. As shown in Fig. 17, GPR61 reveais clear mRNA expression in certain regions of the brain. In the human, GPR61 mRNA was found as a single transcript in the caudare, putamen and thalamus of approximately 4.3 kb length. In rat tissues, GPR6l mRNA saw three transcripts of approximately 5.1, 3.8 and 3-2 kb length (3.8 kb being most prominent) in a variety of brain regions including the cerebellurn, frontal cortex, cortex, striatum, midbrain, hypothalamus, medulla pons, hippocampus, olfactory tubercle, pituitary and septa. 4.0 DISCUSSION 4.1 Apelin: Characterization of the Endogenous Peptide Ligand for the APJ Receptor Originally cloned in Our laboratory, the APJ gene encodes a receptor that most closely resembled the angiotensin receptor ATI, sharing an amino acid identity of 54% in the TM regions. However, the receptor displayed no specific binding for angiotensin II (O'Dowd et al., 1993). In a successful application of the "reverse pharmacology" technique, the apelin peptide was isolated from bovine stomach extracts using the bovine APJ receptor expressed in CHO cells, and its sequence used to obtain human and bovine cDNAs encoding preproapelin (Tatemoto et al., 1998). Subsequently, the entire protein sequences of both bovine and human preproapelin were deduced from the cDNAs. However, no cDNA sequences, detailed tissue distributions or physiological functional data for preproapeIin were reported. To further investigate the physiological functions of apelin I first endeavored to characterize the apelin gene to determine its genomic organization, sequence, and mRNA distribution. Previously, cDNA sequences and preliminary studies using synthetic peptides revealed the hurnan and bovine C-terminal regions of preproapelin to be identical and essential for specific binding to the APJ receptor (Tatemoto et al., 1998). Sequence analysis revealed high identities between human, bovine and rat preproapelin with 100% identity in the C-terminal 13 amino acids, which encodes the mature apelin peptide (Fig. 3a). In addition, a cornparison of the mature apelin peptide with angiotensin II revealed several conserved amino acids (Fig. 3b). perhaps not unexpected given the degree of similarity between their receptors, AT 1/AT2 and APJ. Interestingl y, the human apeiin genomic structure revealed an intron in the 3' UTR, which is rare. Both human and rat cDNAs displayed a lack of Kozak confonning start codons. While non-Kozak conforming start codons are rare, several cases have been reported (Kozak, 1996). In situ analysis of the brain revealed APJ mRNA to be more discretely expressed than preproapelin rnRNA, especially dong the cerebroventrïcular system, suggesting important CNS vascular functions. Future immunohistochemical studies will be aimed at cornparing the distributions of the APJ receptor and apelin peptide. A cornparison of CNS distributions of the APJ and AT1 receptors (Ferguson and Washburn, 1998) revealed high levels of both APJ and AT1 in the choroid plexus. Given the sequence similarities between angiotensin II and the apelin peptide, 1 also compared angiotensinogen, the precursor to angiotensin II, and preproapelin expression patterns. Apelin mRNA brain expression correlated well with angiotensinogen, which has been shown to possess a distinct expression pattern within the limbic and sensorimotor areas of the brain (Semia, 1995). Both preproapelin and angiotensinogen showed expression in the hippocarnpus, as well as such hypothalamic regions as the dorsal hypothalamic area, media1 preoptic area, and the ventrornedial hypothalamic nucleus. Two adjacent regions, the periventricular and paraventricular nuclei expressed preproapelin mRNA and angiotensinogen respectively. In the thalamus and midbrain, shared expression was seen in the venuoposterior thalamic nucleus, medial habenular nuclei, anterior pretectal area, periaqueductal gray, inferior and superior colliculi and the interpeduncular nucleus. Both preproapelin and angiotensinogen were seen in the anterior and posterior cingulate cortex, caudate putamen, media1 and lateral septal areas, and the primary olfactory cortex. In view of the sequence and distribution similarities between apelin and angiotensin II (as well as APJ and ATl/AT2), 1 predicted apelin would have similar physiological effects as angiotensin II, known to have a role in regulating blood pressure, fluid and electrolyte balance (Phillips et al., 1993; Saavedra, 1992) in addition to acting in various roles as a neurotransmitter (Ferguson and Washburn, 1998). In the periphery, apelin was widely expressed in many tissues with a particularly dense mRNA signal in the hem. indicating possible roles for apelin in blood pressue and hem rate. In a collaboration with Dr. Daniel H. Osmond of the Department of Physiology, University of Toronto, preliminary results of i.v. injections in rats reveaied apelin to have hypotensive properties, eliciting a brief drop in blood pressure (both systolic and diastolic), in contrast to the weI1-known vasopressor effects of angiotensin II (Lee et al., in press). Preliminary behavioural data was also collected, which demonstrated i-p. injected apelin ellicited short-term increases in drinking behaviour, in parallel with the thirst-promoting actions of angiotensin iI (Lee et ai., in press). In the future, further behavioural and physiological investigations will be conducted to fully characterize apelin-induced thirst and cardiovascular effects. 4.2 TRH-R2: Discovery and Characterization of a Second GPCR for Thyrotropin-Releasing Hormone TRH is a tripeptide (pGlu-His-ProNH,) that functions as a hormone, a paracrine regulatory factor and a neurotransmitter/neuromodulator. Until recently, only a single GPCR for TRH was known (TRH-RI)(Gershengom and Osman, 1996). While our laboratory independently discovered TRH-R2, during the course of this work, TM-R2 was reported by two other groups (Cao et al., 1998; Itadani et al., 1998). Within the ORF of TRH-EU, the published sequences varied by two single nucleotide differences located in the regions encoding the N-terminal portion of TM4 and the carboxy terminus. Specificdly, one group reported an isoleucine and valine at arnino acid positions 143 and 347 respectively (Itadani et al., 1998), while the ocher reported a methionine and glutamic acid at these respective positions (Cao et al., 1998). By cornparison, our TRH-R2 sequence agreed with 11e143 in accordance with the fint report by Itadani's group (Itadani et al., 1998) but with ~11,1347as reported by Cao's group (Cao et ai.. 1998). In terms of ligand binding, it is noteworthy that of four amino acid residues within the transmernbrane helices and two within the extrace1Iula.r loops of mouse TRH-R1 (Straub et al., 1990) previously identified as sites of direct interaction with TRH (Gershengorn and Osman, 1996; Perlman et al., 1997), ail six residues are conserved in rat (de la Pena et al., 1992; Zhao et al., 1993), human (Duthie et al., 1993) and chicken TRH-RI (Sun et al., 1998) and rat TM-R2 (Cao et al., 1998; Itadani et al., 1998). This would suggest a likely similarity between the binding of TRH analogs by these receptors, with implications that differences could possibly exist in receptor tissue distribution. expression or down-regulation to necessitate the expression of a second TRH receptor. In fact, a collaboration with Dr. Marvin C. Gershengorn of the Department of Medicine, Weill Medicd ColIege of Corne11 University, reveded no differences in TRH and TRH-analog acute binding with TRH-RI or TRH-R2 (O'Dowd et al., in press). However, tissue distribution analyses and down-regulation studies did find differences between TRH-R1 and TRH-R2. In situ hybridization analysis revealed TM-R2 mRNA exhibited a distinct brain distribution with especially abundant levels of expression in areas of the cortex, thaiarnus and the pontine nucleus (Fig. 9). In addition, other areas of the midbrain including the medial and lateral geniculate nuclei, superior colliculus, periaqueductal gray, mesencephalic reticular nucleus, and central raphe nucleus displayed discrete levels of TRH-R2 mRNA expression. Together with strong distinct signals from various sensory and motor control areas in the cortex and thaiamus (e-g. the striate areas of the primary visual cortex, the paraventricular, centromedial, anteroventral and ventroposterior thdamic nuclei), TM-R2 may play roles in nociception, motor control and regdation of somatosensory transmission. Unlike the previous report (Cao et al., I998), expression of srnaIl arnounts of TM-R2 mRNA were found in the anterior lobe of the pituitary (as seen clearly against the absence of signal in the neurointermediate lobe of the pituitary ), suggesting possible roles for TRH-R2 in hormone regulation. Furthermore, dense IabeIing was seen in the hypothalamus in the antenor and lateral hypothalamic nuclei, as well as moderate levels of expression in the media1 preoptic area, paraventricular nucleus, posterior hypothalamic nucleus, and the ventral and dorsai premarnmillary nuclei, suggesting that TRH-R2 may play a role in appetite regulation, motivation or other hypothalamic functions. In addition, TRH-R2 was shown to ex h i bit more rapid agonist-stimulated intemalization kinetics and a greater degree of downregulation with prolonged agonist exposure than TRH-R1 (O'Dowd et al., in press). Finally, TRH-R2 expression levels appeared to be less variable than for TRH-R 1. While TRH-R2 exhibited a higher basal signaling activity than TRH-RI, chronic exposure (24 hr) of 1 pM TRH caused lesser induction of reporter gene transcription in cells expressing TRH-R2 than in cells expressing TRH-RI (O'Dowd et al., in press). 4.3 GPR54: Discovery and Characterization of a Novel GPCR related to the Galanin Receptors Using Gf RS4 in a BLAST search (Altschul et al., 1997), the highest identity was observed with the galanin receptor family of GPCRs. Specifically, GPR54 shared significant arnino acid sequence identities in the TM regions with rat galanin receptors GalRl(45%), GalR.3 (45%), and GalR2 (44%) (Fig. 10). Significantly, various residues in the human GalRl receptor shown to be important for high-affinity galanin binding (corresponding to His262, His265, Glu269, and Phe280 in rat GalR1; (Berthold et al., 1997; Kask et al., 1996)) were not conserved in GPR54. Among these however, only His262 is conserved among the three galanin receptors. In addition, the substitution of a tyrosine residue found in GPR54, GalR2 and GalR3 in place of Phe280 in GalRl was shown to have no significant effect on galanin binding (Berthoid et al., 1997) as opposed to previous studies where Phe280 was replaced by alanine in GalRl (Kask et al., 1996). A collaboration with Dr. Gary O'Neill of the Merck-Frosst Center for Therapeutic Research revealed GPR54 expressed in COS cells displayed no specific binding for galanin. However, the high levels of sequence identity between GPR54, GalR1. GalR2 and GalR3 suggest that GPR54's endogenous ligand is peptidergic in nature, and most likely has sequence and structural similarities to gaianin. Despite GPR54's inability to bind galanin, GPR54's CNS expression pattern was found to resemble those of galanin receptors. Specifically, rat GalRl mRNA expression is abundant in severai brain regions including the hypothalamus, arnygdala, hippocampus and locus coeruleus (Parker et al., 1995). Rat GalR2 mRNA expression is found in the mammilary nuclei, the dentate gyrus and posterior hypothalamic and arcuate nuclei (Kolakowski et al-, 1998). Rat GalR3 is found to be abundantly expressed in the CA regions of Ammon's horn and the dentate gyms with transcripts also detected in thalamic, hypothalamic, marnmilary and amygdaloid nuclei (Kolakowski et al., 1998). Overall, the significant levels of sequence sirnilarities between GPR54 with the galanin receptors, as well as the significant degree of overlap in mRNA tissue distribution, suggests the cognate ligand for GPR54 is a peptide neurotransmitter, perhaps involved with similar physiulogical systems as gdanin, making GPR54 a prime candidate for current reverse pharmacology ligand-discovering techniques. 4.4 GPR57 and GPRSS: Discovery of a Novel Subfamiiy of GPCRs Using GPR57 and GPR58 protein sequences in BLAST searches, the highest identities were observed with the PNR and serotonin 5-HT, receptors and a reported 5- HT, pseudogene (Fig. 14). The GPR57 encoded receptor shared identities with the GPR58 (59%). PNR (37%), the 5-HT, (30%) receptors and a 5-HT,pseudogene (35%). The GPM8 encoded receptor shared identities with the PNR (42%), and 5-HT, (34%) receptors and the 5-HT, pseudogene (49%). The vGPR57 sequence varied from GPR57 by two single nucleotide deletions and two nucleotide substitutions, maintaining an overall nucleotide identity of 99.6% (Fig. 13). The two deletions resulted in two frame shifts relative to GPR57 in the regions of the gene corresponding to the extracellular N-terminal segment and TM 1 respectively, the first leading to a stop codon in TM3 and an ORF of only 309 bp encoding a 103 amino acid protein. We have previously reported other GPCR pseudogenes vDRD5- 1, yDRD5-2 (Nguyen et al., 1991), @-HTR,, (Nguyen et al., I993), wGPR32 and yGPR33 (Marchese et al., 1998b), and @PR53 (Sawzdargo et al., 1999). The GPR58 receptor does not appear to encode an extraceIlular N-terminal segment. While other GPCRs with very short extracellular N-terminal segments have been identified (e-g. the adenosine Al receptor (Townsend-Nicholson and Shine. 1993, A2b receptor (Pierce et al., 1992) and histamine H2 receptor (Gantz et al., 1991)). the ORF of GPR58 appeared to start within the first TM with the identified initiation methionine conformed to an adequate Kozak sequence (Kozak, 1996). Both GPR57 and GPR58 displayed residues important for ligand binding comparable to those in biogenic amine-binding receptors. Specifically, an aspartate in TM3, threonine in TM5 and phenylalanine in TM6 shown to be important for ligand binding and stability in biogenic amine-binding receptors (Strader et al., !994) were conserved in both the GPR57 and GPR58 receptors. Previous reports have localized the receptor PNR at 6q23 (Zeng et al.. 1998) and the 5-HT,pseudogene at 6q22.1 (Liu et al., 1998). Together, vGPR57, GPR57, GPR58, PNR and the 5-HT,pseudogene appear to compose a family of oGPCR genes by sequence identity and that localize between q22- q24 on chromosome 6. While GPR58 did not bind serotonin; based on sequence identities and the conservation of several important residues with amine-binding GPCRs, 1 predict these receptors (and the functional receptor potentially encoded by a closely related paralog to the 5-HT, pseudogene) will bind the same endogenous amine-like ligand, perhaps of a type yet to be discovered. 4.5 GPR61 and GPR62: Discovery of a Novel Subfamily of GPCRs Overall, GPR6 1 and GPR62 were seen to share the greatest amino acid sequence with each other at 34%, with notable conservation of sequence in TM2, 5, 6, 7 and, surprisingly, within the intracellular loops (Fig. 16). Given these regions of conservation, GPR6 1 and GPR62 may bind the same cognate ligand, despite their low overall sequence identity. Using GPR6 1 and GPR62 amino acid sequences in BLAST searches (Altschul et al., 1997), sequence identities were seen, albeit low (c30 %), with other GPCRs. Of these, the highest levels of sequence identity were seen with various biogenic amine receptors (eg. the serotonin 5-HT6, adrenergic al A, fl3, and histamine H2 receptors), GPR54 (a galanin-like GPCR) and GPRlO (the receptor for the prolactin-releasing peptide (Hinuma et al., 1998)). NormaIIy, a routine BLAST search of newly cloned oGPCRs would suggest the nature of their cognate ligand by the sequence identities shared with known GPCRs. However, GPR61 and GPR62 do not seem to be close to any particular group of GPCRs, with sequence identities matching biogenic amine receptor as well as peptide receptors. Sequence analyses also revealed no short motif or even single amino acids known to be specifically conserved betweer? the various subfamilies of GPCRs. For example, the biogenic amine receptors, which were by far the largest group of GPCRs retrieved by GPR61 and GPR62 comparing BLAST searches, have a conserved aspartic acid found in TM3 (Ji et al., 1998) which is found in neither GPR6 1 or GPR62. Strategies to elucidate the cognate ligand for this novel subfamily of oGPCRs will have to stem from their tissue distribution patterns. GPR61 northern analysis of rat and human probes reveal strong expression in the brain, and indicates its cognate ligand is most likely a neurotransmitter. Future studies will include in situ hybridization analysis of rat GPR6 1 in rat brain, cloning the rat orthologue of GPR62 and determining the tissue distribution of rat and human GPR62, to further elucidate the potential physiological functions and identities of the cognate ligands for the two receptors. 4.6 Conclusions This thesis describes the characterization of the novel cognate ligand apelin for the APJ receptor as well as the discovery, isolation and characterization of six novel GPCR-encoding genes and cDNAs for TRH-R2, GPR54, GPR57, GPR58, GPR6 1, GPR62 and a pseudogene, yGPR57. The initial characterization of each gene has provided a basis for future investigations into the physiological roles for the proteins they encode. For apelin, sequence and tissue distribution analyses revealed strong cornparisons with the angiotensin II systern, which led to preliminary studies showing apelin to have roles in drinking behaviour and blood pressure. For TRH-R2, the cloning and characterization of a second thyrotropin-releasing hormone receptor has provided a new target to study the multiple physiologicd roles of TRH,which already include the stimulation of thyrotropin and prolactin from the pituitary gland, neurotransmitter and neurostimulatory effects, and links to certain diseases and disorders of the brain including Huntington's chorea, schizophrenia, Alzheimer's disease and depression. The oGPCRs presented in this thesis provide new targets for the reverse pharmacology techniques currently employed to assign cognate ligands to orphan receptors. For GPR54, sequence analysis and tissue distribution suggest its cognate ligand to be a galanin-like peptide. The two novel GPCR subfarnilies represented by GPR57lGPR58 and GPR61/GPR62 most likely, by their low sequence identities with other GPCRs, bind novel endogenous ligands yet to be discovered. With recent advances in reverse pharmacology, it is expected that these orphans will be assigned their endogenous ligands in the near hture, with subsequent studies elucidating their Function, increasing our knowledge of GPCR-mediated signaling and offering potential targets for the development of novel therapeutic agents for diseases and disorders. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. 1. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25,3389-402. Berthold, M., Kahl, U., Jureus, A., Kask, K., Nordvall, G., Langel, U., and Bartfai, T. (1997). Mutagenesis and ligand modification studies on galanin binding to its GTP- binding-protein-coupled receptor GaiRl .Eur J Biochem 249,60 1-6. Bonner, T. I., Buckley, N. J., Young, A. C., and Brann, M. R. (1987). Identification of a family of muscarinic acetylcholine receptor genes. Science 237,527-32. Bouvier, M., Loisel, T. P., and Hebert, T. (1995). Dynamic regulation of G-protein coupled receptor palmitoylation: potential role in receptor function. Biochem Soc Trans 23, 577-8 1. Bunzow, J. R., Saez, C., Mortrud, M., Bouvier, C., Williams, J. T., Low, M., and Grandy, D. K. (1994). Molecular cloning and tissue distribution of a putative member of the rat opioid receptor gene family that is not a mu, delta or kappa opioid receptor type. FEBS Lett 347, 284-8. Cao, J., O'DonnelI, D., Vu, H., Payza, K., Pou, C., Godbout, C., Jakob, A., Pelletier, M., Lembo, P., Ahmad, S., and Walker, P. (1998). Cloning and characterization of a cDNA encoding a novel subtype of rat thyrotropin-releasing hormone receptor. J Bi01 Chem 273. 3228 1-7. Chambers, J., Ames, R. S., Bergsma, D., Muir, A., Fitzgerald, L. R., Hervieu, G., Dytko, G. LU.,Foley, J. J., Martin, J., Liu, W. S., Park, J., Ellis, C., Ganguly, S., Konchar, S., Cluderay, J., Leslie, R., Wilson, S., and Sarau, H. M. (1999). Melanin-concentrating hormone is the cognate Iigand for the orphan G- protein-coupled receptor SLC- 1. Nature 300. 26 1-5. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chlorofom extraction. Anal Biochem 162, 156-9. Cotecchia, S., Schwinn, D. A., Randall, R. R., Lefkowitz, R. J., Caron, M. G., and Kobilka, B. K. (1988). Molecular cloning and expression of the cDNA for the hamster alpha 1- adrenergic receptor. Proc Natl Acad Sci U S A 85,7159-63. de la Pena, P., Delgado, L. M., del Camino, D., and Barros, F. (1992). Cloning and expression of the thyrotropin-releasing hormone receptor from GH3 rat anterior pituitary cells. Biochem J 284,891-9. Dixon, R. A., KobiIka, B. K., Strader, D. I., Benovic, J. L., Dohlman, H. G., FrieIle, T., Bolanowski, M. A., Bennett, C. D., Rands, E., Diehl, R. E., and et al. (1986). Cloning of the gene and cDNA for mammalian beta-adrenergic receptor and homology with rhodopsin. Nature 32 1, 75-9. Duthie, S. M., Taylor, P. L., Anderson, L., Cook, J., and Eidne, K. A. ( 1993). Cloning and functional characterisation of the human TMreceptor. Mol Ce11 Endocrinol 95, RI 1-5. Fargin, A., Raymond, J. R., Lohse, M. J., Kobilka, B. K., Caron, M. Ge,and Lefkowitz, R. J. (1988). The genornic clone G-21 which resembles a beta-adrenergic receptor sequence encodes the 5-HT 1A receptor. Nature 335,358-60, Ferguson, A. V., and Washburn, D. L. (1998). Angiotensin II: a peptidergic neurotransmitter in central autonornic pathways. Prog Neurobiol54, 169-92. Ferguson, S. S., Barak, L. S., Zhang, J., and Caron, M. G. (1996). G-protein-coupled receptor regulation: role of G-protein-coupled receptor kinases and arrestins. Can J Physiol Pharmacol 74, 1095- 1 10. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988). Rapid production of Full-length cDNAs frorn rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci U S A 85,8998-9002. Furlong, T. J., Pierce, K. D., Selbie, L. A., and Shine, J. (1992). Molecular characterization of a human brain adenosine A2 receptor. Brain Res Mol Brain Res 15, 62-6. Gantz, I., Munzert, G., Tashiro, T., Schaffer, M., Wang, L., DelValle, J., and Yarnada, T. ( 199 1). MoIecuIar cloning of the human histamine H2 receptor. Biochem Biophys Res Commun 178. 1386-92. Gershengorn, M. C., and Osman, R. (1996). Molecular and cellular biology of thyrotropin-releasing hormone receptors. Physiol Rev 76, 175-9 1. Gether, U., and Kobilka, B. K. (1998). G protein-coupled receptors. II. Mechanism of agonist activation. J Bi01 Chem 273, 17979-82. Heiber, M., Docherty, J. M., Shah, G., Nguyen, T., Cheng, R., Heng, H- H., Marchese, A., Tsui, L. C., Shi, X., George, S. R., and et al. (1995). Isolation of three novel human genes encoding G protein-coupled receptors. DNA Ceil Bi01 14, 25-35. Heng, H. H., Squire, J., and Tsui, L. C. (1992). High-resolution mapping of mammalian genes by in situ hybridization to free chromatin. Proc Natl Acad Sci U S A 89,9509- 13. Heng, H. H., and Tsui, L. C. (1993). Modes of DAPI banding and sirnultaneous in situ hybridization. Chromosoma 102, 325-32. Hinuma, S., Habata, Y., Fujii, R., Kawamata, Y., Hosoya, M., Fukusumi, S., Kitada, C., Masuo, Y., Asano, T., Matsumoto, H., Sekiguchi, M., Kurokawa, T., Nishimura, O., Onda, H., and Fujino, M. (1998). A prolactin-releasing peptide in the brain. Nature 393, 272-6. Itadani, H., Nakamura, T., Itoh, J., Iwaasa, H., Kanatani, A., Borkowski, J., Ihara, M., and Ohta, M. (1998). Cloning and characterization of a new subtype of thyrotropin- releasing hormone receptors. Biochem Biophys Res Commun 250,68-7 1. Ji, T. H., Grossmann, M., and Ji, 1. (1998). G protein-coupled receptors. 1. Diversity of receptor-ligand interactions. J Bi01 Chem 273, 17299-302. Jin, H., Oksenberg, D., Ashkenazi, A., Peroutka, S. J., Duncan, A. M., Rozmahel, R., Yang, Y., Mengod, G., Paiacios, 1. M., and O'Dowd, B. F. (1992). Characterization of the hurnan 5-hydroxytryptamine 1B receptor. J Bi01 Chem 267,5735-8. Julius, D., MacDermott, A. B., Axel, R., and Jessell, T. M. (1988). Molecular characterization of a functional cDNA encoding the serotonin Ic receptor. Science 241, 558-64. Kask, K., Berthold, M., Kahl, U., Nordvall, G., and Bardai, T. (1996). Delineation of the peptide binding site of the human galanin receptor. Embo 1 15, 236-44. Kobilka, B. K., Matsui, H., Kobika, T. S., Yang-Feng, T. L., Francke, U., Caron, M. G., Lefkowitz, R. J., and Regan, J. W. (1987a). Cloning, sequencing, and expression of the gene coding for the human platelet alpha 2-adrenergic receptor. Science 238,650-6. Kobilka, B. K., Frielle, T., Collins, S., Yang-Feng, T., Kobilka, T. S., Francke, U., Lefkowitz, R. J., and Caron, M. G. (1987b). An intronless gene encoding a potential member of the family of receptors coupled to guanine nucleotide regulatory proteins. Nature 329,759. Kolakowski. L. F., Jr., Jung, B. P., Nguyen, T., Johnson, M. P., Lynch, K. R., Cheng. R., Heng, W. H., George, S. R., and O'Dowd, B. F. (1996). Characterization of a human gene related to genes encoding somatostatin receptors. FEBS Lett 398,253-8. Kolakowski, L. F., Jr., O'Neill, G. P., Howard, A. D., Broussard, S. R., Sullivan, K. A., Feighner, S. D., Sawzdargo, M., Nguyen, T., Kargman, S., Shiao, L. L., Hreniuk, D. L., Tan, C. P., Evans, J., Abramovitz, M., Chateauneuf, A., Coulombe, N., Ng, G., Johnson, M. P., Tharian, A., Khoshbouei, H., George, S. R., Smith, R. G., and O'Dowd, B. F. ( 1998). Molecular characterization and expression of cloned human galanin receptors GALR2 and GALR3. 1 Neurochem 71,2239-5 1. Kozak, M. (1996). Interpreting cDNA sequences: some insights from studies on translation. Marnm Genome 7, 563-74. Knipnick, J. G., and Benovic, J. L. (1998). The role of receptor kinases and arrestins in G protein-coupled receptor regulation. Annu Rev Pharmacol Toxicol38,289-3 19. Kubo, T., Fukuda, K., Mikarni, A., Maeda, A., Takahashi, H., Mishina, M., Haga, T., Haga, K., Ichiyarna, A., Kangawa, K., and et al. (1986). Cloning, sequencing and expression of complementary DNA encoding the muscarinic acetylcholine receptor. Nature 323,411-6. Lee, D. K., Cheng, R., Nguyen, T., Fan, T., Kariyawasam, A. P., Liu, Y., Osmond, D. H., George, S. R., and O'Dowd, B. F. Characterization of apelin, the ligand for the APJ receptor. J Neurochem. In press. Lee, D. K., Nguyen, T., O'Neill, G. P., Cheng, R., Liu, Y., Howard, A. D., Coulornbe, N., Tan, C. P., Tang-Nguyen, A.-T., George, S. R., and ODowd, B. F. (1999). Discovery of a receptor related to the galanin receptors. FEBS Lett. 446, 103-7. Libert, F., Parmentier, M., Lefort, A., Dinsart, C., Van Sande, J., Maenhaut, C., Simons, M. J., Dumont, J. E., and Vassart, G. (1989). Selective amplification and cloning of four new members of the G protein-coupled receptor family. Science 244,569-72. Libert, F., Schiffmann, S. N., Lefort, A., Parmentier, M., Gerard, C., Dumont, J. E., Vanderhaeghen, J. J., and Vassart, G. (1991). The orphan receptor cDNA RDC7 encodes an A 1 adenosine receptor. Embo J IO, 1677-82. Liu, 1. S. C., Kusumi, I., Ulpian, C., Tdlerico, T., and Seeman, P. (1998). A serotonin-4 receptor-like pseudogene in humans. Brain Res Mol Brain Res 53, 98-103. Maenhaut, C., Van Sande, J., Massart, C., Dinsart, C., Libert, F., Monfenni, E., Giraido, E.. Ladinsky, H., Vassart, G., and Dumont, J. E. (1991). The orphan receptor cDNA RDC4 encodes a 5-HTlD serotonin receptor. Biochem Biophys Res Commun 180, 1460- 8. Marchese, A., Docherty, J. M., Nguyen, T., Heiber, M., Cheng, R., Heng, H. H., Tsui, L. C., Shi, X., George, S. R., and O'Dowd, B. F. (1994). Cloning of human genes encoding novel G protein-coupled receptors. Genomics 23,609- 18. Marchese, A., George, S. R., Kolakowski, L. F., Jr., Lynch, K. R., and O'Dowd, B. F. (1999). Novel GPCRs and their endogenous ligands: expanding the boundaries of physiology and pharmacology. Trends Pharmacol Sci 20,370-375. Marchese, A., George, S. R., and O'Dowd, B. F. (1998a). Cloning of G protein-coupled receptor genes: The use of homology screening and the polymerase chain reaction. In Identification and Expression of G Protein-Coupled Receptors, K. R. Lynch, ed. (New York: Wiley-Liss Inc.), pp. 1-26. Marchese, A., Nguyen, T., Malik, P., Xu, S., Cheng, R., Xie, Z., Heng, H-H., George, S. R,, Kolakowski, L. F., Jr., and O'Dowd, B. F. (1 998b). Cloning genes encoding receptors related to chemoattractant receptors. Genomics 50,28 1-6. Marchese, A., Heiber, M., Nguyen, T., Heng, H. H., Saidivia, V. R., Cheng, R,, Murphy, P. M., Tsui, L. C., Shi, X., Gregor, P., and et al. (1995). Cloning and chromosomal mapping of three novel genes, GPR9, GPRIO, and GPR14, encoding receptors related to interleukin 8, neuropeptide Y, and somatostatin receptors. Genomics 29,335-44. Masu, Y ., Nakayama, K., Tamaki, H., Harada, Y., Kuno, M., and Nakanishi, S. (1 987). cDNA cloning of bovine substance-[( receptor through oocyte expression system. Nature 329. 836-8. mats su da, L. A., Lolait, S. J., Brownstein, M. II, Young, A. C., and Bonner, T. 1. (1990). Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature 346,56 1-4. Meunier, J. C., Mollereau, C., Toll, L., Suaudeau, C., Moisand, C., Alvinene, P., Butour, J. L., Guillemot, J. C., Ferrara, P., Monsarrat, B., and et al. (1995). Isolation and structure of the endogenous agonist of opioid receptor- like ORL1 receptor. Nature 377,532-5. MoIlereau, C., Parmentier, M., Mailleux, P., Butour, J. L., Moisand, C., Chalon, P., Caput, D., Vassart, G., and Meunier, J. C. (1994). ORL1, a novel member of the opioid receptor farnily . Cloning, functional expression and localization. FEBS Lett 341, 33-8. Mountjoy, K. G., Robbins, L-S., Mortnid, M. T., and Cone, R. D. (1 992). The cloning of a family of genes that encode the melanocortin receptors- Science 257, 1248-5 1. Mullis, K. B., and Faloona, F. A. (1987). Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 155,335-50. Nguyen, T., Bard, J., Jin, H., Taruscio, D., Ward, D. C., Kennedy, J. L., Weinshank, R., Seeman, P., and O'Dowd, B. F. (1991). Human dopamine D5 receptor pseudogenes. Gene 109,21 1-8. Nguyen, T., Marchese, A., Kennedy, J. L., Petronis, A., Peroutka, S. J., Wu, P. H., and O'Dowd, B. F. (1993). An Alu sequence intempts a human 5-hydroxytryptaminelD receptor pseudogene. Gene 124,295-30 1. O'Dowd, B. F., Heiber, M., Chan, A., Heng, H. H., Tsui, L. C., Kennedy, J. L., Shi, X., Petronis, A., George, S. R., and Npyen, T. (1993). A human gene that shows identity with the gene encoding the angiotensin receptor is located on chromosome 1 1. Gene 136, 355-60. O'Dowd, B. F., Lee, D. K., Huang, W., Nguyen, T., Cheng, R., Liu, Y., Wang, B.. Gershengorn, M. C., and George, S. R. TM-R2 exhibits similar binding and acute signaling but distinct regulation and anatomic distribution compared to TRH-RI. Mol Endocrin. In press. O'Dowd, B. F., Nguyen, T., Lynch, K. R., Kolakowski, L. F., Ir., Thompson, M., Cheng, R., Marchese, A., Ng, G., Heng, H. H., and George, S. R. (1996). A novel gene codes for a putative G protein-coupled receptor with an abundant expression in brain. FEBS Lett 394,325-9. O'Dowd, B. F., Nguyen, T., Tirpak, A., Jarvie, K. R., Israel, Y., Seeman, P., and Niznik, H. B. (1990). Cloning of two additional catecholarnine receptors from rat brain. FEBS Lett 262, 8- 12. O'Dowd, B. F., Scheideler, M. A-, Nguyen, T,,Cheng, R., Rasmussen, J. S., Marchese, A.. Zastawny, R., Heng, H. H., Tsui, L. C., Shi, X., and et al. (1995). The cloning and c hromosomal mapping of two novel human opioid- somatostatin-li ke receptor genes. GPR7 and GPR8, expressed in discrete areas of the brain. Genomics 28, 84-9 1. O'Malley, K. L., Hannon, S., Tang, L., and Todd, R. D. (1992). The rat dopamine D4 receptor: sequence, gene structure, and demonstration of expression in the cardiovascular systern. New Bi01 4, 137-46. Parker, E. M., Izzarelli, D. G., Nowak, H. P., Mahle, C. D., ben, L. G., Wang, J., and Goldstein, M. E. (1995). Cloning and characterization of the rat GALRl gaianin receptor from Rin 14B insulinoma cells. Brain Res Mol Brain Res 34, 179-89. Paxinos, G. and Watson, C. (1982). The Rat Brain in Stereotaxic Coordinates. Academic Press, New York. Peralta, E. G., Winslow, J. W., Peterson, G. L., Smith, D. H., Ashkenazi, A., Ramachandran, J., Schimerlik, M. I., and Capon, D. J. (1987). Primary structure and biochemical properties of an M2 muscarinic receptor. Science 236,600-5. Perlman, J. H., Colson, A. O., Jain, R., Czyzewski, B., Cohen, L. A., Osman, R., and Gershengom, M. C. (1997). Role of the extracellular loops of the thyrotropin-releasing hormone receptor: evidence for an initial interaction with thyrotropin- releasing hormone. B iochemistry 36, 15670-6. Phillips, M. I., Speakman, E. A., and Kimura, B. (1993). Levels of angiotensin and molecular biology of the tissue renin angiotensin systems. Regul Pept 43, 1-20. Pierce, K. D., FurIong, T. J., Selbie, L. A., and Shine, J. (1992). MolecuIar cloning and expression of an adenosine A2b receptor from human brain. Biochem Biophys Res Commun 187.86-93. Probst, W. C., Snyder, L. A., Schuster, D. I., Brosius, J., and Sealfon, S. C. (1992). Sequence alignment of the G-protein coupled receptor superfarnily. DNA Ce11 Biol II, 1- 20. Reinscheid, R. K., Nothacker, H. P., Bourson, A., Ardati, A,, Henningsen, R. A., Bunzow, J. R., Grandy, D. K., Langen, H., Monsma, F. J., Jr., and Civelli, 0. (1995). Orphanin FQ: a neuropeptide that activates an opioidlike G protein- coupled receptor. Science 270,792-4, Saavedra, J. M. (1992). Brain and pituitary angiotensin. Endocr Rev 13,329-80. Saito, Y., Nothacker, H. P., Wang, Z., Lin, S. H., Leslie, F., and Civelli, 0. (1999). -Molecular characterization of the melanin-concenuating-hormone receptor- Nature 400, 265-9. Sakurai, T., Amemiya, A., Ishii, M., Matsuzaki, I., Chemelli, R. M., Tanaka, H., Williams, S. C., Richardson, J. A., Kozlowski, G. P., Wilson, S., Arch, J. R., Buckingham, R. E., Haynes, A. C., Cam, S. A., Annan, R. S., McNulty, D. E., Liu, W. S., Terrett, J. A.. Elshourbagy, N. A., Bergsma, D. J., and Yanagisawa, M. (1998). Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Ce11 92, 573-85. Sawzdargo, M., Nguyen, T., Lee, D. K., Lynch, K. R., Cheng, R., Heng, H. H. Q., George, S. R., and O'Dowd, B. F. ( 1999). Identification and cloning of three novel human G protein-coupled receptor genes GPRS2, PsiGPR53 and GPR55: GPR55 is extensively expressed in human brain [In Process Citation]. Brain Res Mol Brain Res 64, 193-8. Sealfon. S. C., Chi, L., Ebersole, B. J., Rodic, V., Zhang, D., Ballesteros, J. A., and Weinstein, H. (1995)- Related contribution of specific helix 2 and 7 residues to conformational activation of the serotonin 5-HT2A receptor. J Bioi Chem 270, 16683-8. Sernia, C. ( 1995). Location and secretion of brain angiotensinogen. Regul Pept 57, 1 - 18. Sokoloff, P., Giros, B., Martres, M. P., Bouthenet, M. L., and Schwartz, J. C. (1990). Molecular cloning and characterization of a novel dopamine receptor @3) as a target for neuroleptics. Nature 347, 246-5 1. Stadel, J. M., Wilson, S., and Bergsma, D. J. (1997). Orphan G protein-coupled receptors: a neglected opportunity for pioneer drug discovery. Trends Pharmacoi Sci 18,430-7. Strader, C. D., Fong, T. M., Tota, M. R., Underwood, D., and Dixon, R. A. (1994). Structure and function of G protein-coupled receptors. Annu Rev Biochem 63, 101-32. Straub, R. E., Frech, G. C., Joho, R. H., and Gershengorn, M. C. (1990). Expression cloning of a cDNA encoding the mouse pituitary thyrotropin- releasing hormone receptor. Proc Nat1 Acad Sci U S A 87,9514-8. Sun, Y. M., Millar, R. P., Ho, H., Gershengorn, M. C., and nling, N. (1998). Cloning and characterization of the chicken thyrotropin-releasing hormone receptor. Endoct-inology 139.3390-8. Sunahara, R. K., Guan, H. C., O'Dowd, B. F., Seeman, P., Laurier, L. G., Ng, G., George, S. R., Torchia, J., Van Tol, H. H.. and Nimik, H. B. (1991). Cloning of the gene for a human dopamine D5 receptor with higher affinity for dopamine than Dl. Nature 350, 6 14-9. Sunahara. R. K-,Niznik, H. B., Weiner, D. M., Stormann, T. M., Brann, M. R., Kennedy, J. L.. Gelernter, J. E., Rozmahel, R., Yang, Y. L., Israel, Y., and et al. (1990). Human dopamine DI receptor encoded by an intronless gene on chromosome 5. Nature 347,80- 3. Tatemoto, K., Hosoya, M., Habata, Y., Fujii, R., Kakegawa, T., Zou, M. X., Kawamata, Y., Fukusumi, S., Hinuma, S., Kitada, C., Kurokawa, T., Onda, H., and Fujino, M. ( 1998). Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem Biophys Res Commun 25I,47 1-6. Townsend-Nicholson, A., and Shine, J. (1992). Molecular cloning and characterisation of a human brain A f adenosine receptor cDNA. Brain Res Mo1 Brain Res 16,365-70. Venter, 1. C., Adams, M. D., Sutton, G. G., Kerlavage, A. R., Smith, H. O., and Hunkapiller, M. ( 1998). Shotgun sequencing of the human genome [see comments]. Science 280, 1540-2. Wess. I., Nanavati, S., Vogel, Z., and Maggio, R. (1993). Functionai role of proline and tryptophan residues highly conserved arnong G protein-coupled receptors studied by mutational analysis of the m3 muscarinic receptor. Embo J 12, 33 1-8. Wilson, S., Bergsma, D. J., Chambers, J. K., Muir, A. I., Fantom, K. G., Ellis, C., Murdock, P. R., Herrity, N. C., and Stadel, J. M. (1998). Orphan G-protein-coupled receptors: the next generation of drug targets? Br J Pharmacol 125, 1387-92. Zeng, Z., Fan, P., Rand, E., Kyaw, H., Su, K., Madike, V., Carter, K. C., and Li, Y. (1998). Cloning of a putative human neurotransmitter receptor expressed in skeletal muscle and brain. Biochem Biophys Res Commun 242,575-8. Zhao, D., Yang, J., Jones, K. E., Gerald, C., Suzuki, Y., Hogan, P., Chin, W. W., and Tashjian, A. Ha, Jr. (1993). MoIecular cloning of a complementary deoxyribonucleic acid encoding the thyrotropin-releasing hormone receptor and regulation of its messenger ribonucleic acid in rat GH cells. Endocrinology 132,2658.