CRISPR-Clear: a fieldable detection procedure for potential CRISPR-Cas9 gene drive based bioweapons

Anna C. Nieuwenweg,1,2 Martijn M. van Galen,1 Angelina Horsting,1 Jorrit W. Hegge,2 Aldrik H. Velders,1 Vittorio Saggiomo1* 1 Laboratory of BioNanoTechnology, Wageningen University and Research, Axis, Bornse Weilanden 9, 6708 WG Wageningen, the Netherlands. E-mail: [email protected] 2 Laboratory of Microbiology, Department of Agrotechnology and Food Sciences, Wageningen University, 6708WE Wageningen, The Netherlands

Abstract: Rapid progression in genetic modification research has made gene editing increasingly cheaper and easier to use. CRISPR-Cas9 for example, allows for the specific alteration of the genome of an organism with relative simplicity and low costs. This raised a worrying question; can genetic modification techniques be used to create novel bioweapons? A specific scenario is the initiation of a synthetic gene drive for malicious purposes. A synthetic gene drive can be used to quickly spread a mutation through an entire population. This mutation could alter vectors in such a way that they will spread human diseases or eradicate essential organisms. Since a gene drive spreads efficiently through a population, timely detection is essential. Thus, a quick and field deployable screening method is needed to counteract the malicious use of gene drives. Here, we show a battery-operated, sensitive screening method, named CRISPR-Clear, for the detection of gene drive modified organisms. CRISPR-Clear is based on the combination of three components: 1) A DNA amplification technique known as loop-mediated isothermal amplification (LAMP) for detecting the presence of a gene drive; b) a portable battery-operated Arduino device which heats up the sample to allow DNA amplification, and c) a naked-eye visualization of the results. We designed and tested six LAMP primers targeting a Cas9 endonuclease-based gene drive, assembled a battery-operated Arduino device and tested the naked-eye visualization method. In addition, we were able to detect the presence of the Cas9 gene, extracted from a transformed bacteria, providing a proof-of-concept of the CRISPR-Clear device.

Introduction: The rapid progression in genetic modification research has made specific genome editing increasingly cheaper and easier to use [1]. Leading in the current genome editing techniques is the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated protein 9 or CRISPR-Cas9 [2]. CRISPR-Cas9 was first discovered in a natural immune system that protects bacteria against foreign DNA. This natural system can be converted into a potent genome editing tool, capable of making specific modifications without leaving any traces in the modified DNA. CRISPR are palindromic sequences on the bacterial genome and are part of the bacterial defense systems against alien DNA. The repeats contain DNA sequences from earlier encounters. This library of foreign DNAs is used to detect and destroy viruses or plasmids that bear that specific DNA. With the use of RNA harboring these sequences, CRISPR associated (Cas) proteins recognize and cut the alien DNA when the bacterial cell is invaded. Several CRISPR-Cas systems, among which CRISPR-Cas9 have been repurposed for genome editing. CRISPR-Cas9 can be programmed with a synthetic single guide RNA (sgRNA), enabling it to bind and cut a genomic target at any desired location. This way genes can be removed or replaced. Potential applications include curing genetic diseases, crop improvement and the development of biological platforms that can produce various compounds [3]. The simplicity of the CRISPR-Cas9 technique has made genome-editing so simple that it can, literally, be done at home by untrained personnel [4]. With great power, comes great responsibility. In fact, the simplicity and costs of this particular genetic modification technique raised questions about the consequences for biosecurity and, if it could be used to create novel bioweapons [5]. An exploitable novel type of bioweapons based on CRISPR-Cas9 is, for example, the use of gene drives which would allow the genome editing of an entire population. A gene drive [6] is a genetic element that increases its own chance of being inherited by ensuring homozygosity. To initiate a gene drive, the CRISPR-Cas9 gene needs to be implemented in the host genome [7]. Cas9 is utilized to edit, remove or add genes and facilitates the introduction of an additional copy of the Cas9 gene on the other chromosome. The organism will be, thus, homozygotic for the mutation and the Cas9 gene, and will pass it on to the entire offspring. This effect can be used to spread a genetic modification quickly through a population (Figure 1). Figure 1. Schematic representation of gene drive spreading through generations. Green dots show gene drive carrying individuals and grey dots represent wild type organisms. Heterozygous individuals carrying the gene drive will become homozygous allowing the mutation to rapidly spread through a population.

Numerous applications have been envisioned which use a gene drive to solve global agricultural, medical and environmental problems. For example, agricultural and ecological pests can be eradicated by modifying the evolutionary fitness or propagation traits of certain species [8]. Furthermore, it would be possible to use gene drive technology to eliminate hosts carrying vector-borne diseases such as Malaria, Zika or Dengue [9]. The potential of gene drives to alter mosquitoes so that they will no longer spread human diseases or to restore ecosystems has been widely discussed [10]. But more sinister applications have been identified as well: altering pests so they will start to spread human diseases, making agricultural pests unsusceptible to conventional pesticides or the disturbance of ecosystems by targeting essential organisms [11]. In fact, after the initial proof of principle of gene drive technology in 2015, 26 scientists published a letter in the journal Science calling for safety measures for experimenting with gene drive, even in a laboratory setting [12]. Even an accidental outbreak can have far- reaching consequences for the ecosystem. The possibility of using gene drives on purpose as a bioweapon is even more worrisome. For this reason, scientists have already started to design procedures to undo gene drives [13]. However, the first step, before initiating a security protocol or undoing a gene drive, lies in the detection of gene drives in the host organisms. Time is essential when dealing with gene drives, as mutations must be detected before the modified genetic element has time to spread through the population. Conventional methods of detection are time-consuming, because they require transport of organisms or specimens to a lab. Furthermore, analysis techniques like sequencing are time- consuming and expensive. MinION, a portable sequencing device, decreased the time of sequencing and the price with respect to more lab-oriented instruments. However, the DNA must be purified before sequencing analysis, making this methodology rather cumbersome [14] and not applicable in-field. Hence, a quick and easily operated screening method is required that can detect the presence of a gene drive immediately in the field. A DNA amplification method can be used as detection method, as it will amplify the specific target sequence only if the target DNA is present.

This leaves the question what DNA should be targeted, because CRISPR-Cas9 modifications by themselves do not leave traces in the modified genome. Fortunately, gene drives have an important difference compared to a normal (induced) CRISPR Cas9 mutation: a gene drive can only function if the endonuclease itself is embedded within the host genome. This means that the presence of a foreign endonuclease is an excellent marker to identify whether or not a gene drive has been introduced in an organism. We therefore envision a detection method based on the amplification of the Cas9 endonuclease sequence inserted in the genome. One classic example of a DNA amplification method for detection of specific DNA sequence is the Polymerase Chain Reaction (PCR) [15]. In our approach, we employ another amplification technique known as Loop-Mediated Isothermal Amplification (LAMP) [16] to amplify the Cas9 endonuclease sequence. LAMP is more specific, cheaper and quicker than the conventional polymerase chain reaction (PCR) [16]. In addition, the LAMP reaction is isothermal, making it easier to use for an in-field screening method. To perform the LAMP reaction in the field, a cheap battery-operated Arduino system containing temperature-controlled reaction cells can be used. In addition, a quick visualization by naked eye is needed to verify the outcome of the amplification of the target sequence. Thus, if the organism contains a CRISPR-Cas9 gene drive element, the target sequences will be amplified and detected. In this research we show our approach for the in-field detection of CRISPR-Cas9 gene drive modified organisms. It consists of three components: 1) a suitable LAMP primer set that detects the proper target sequence; 2) a battery-operated and cheap device that can set and maintain the temperature at which the LAMP reaction takes place and 3) a visualization method that allows for a quick read-out of the outcome without the need of additional laboratory equipment.

Material and methods: LAMP primers and LAMP reaction We designed multiple primer sets for the Cas9 sequence from Streptococcus pyogenes (also called SpyCas9) using Primer Explorer version 5. Each primer set consisted of six primers. All designs were checked for primer dimerization, unwanted possible side reaction for the LAMP, using Thermofischer Tool. The specificity of the primers was checked using NCBI primer blast software. A g-block of 343 base pairs from the S. pyogenes Cas9 sequence was ordered from IDT. Based on dimerization and specificity results, one set of six primers was ordered and tested for nonspecific amplification by measuring melting curve temperatures using real-time LAMP Genie II instrument with a LAMP reaction mixture from OptiGene. The sequences and reaction concentration of the primers can be found in table 1. The composition of the LAMP reaction mixture of OptiGene can be found in table 2. For each reaction 25 µL was used.

Primer Reaction concentration sequence (5’ to 3’)

B3 0.2 µM GGCCACAACCAGTACACTG

F3 0.2 µM AGGAGAAATCGTGTGGGACA

BIP 0.8 µM CCGAAAAGGAACAGCGACAAGC-GAGAATCGAATCCGCCGTAT

FIP 0.8 µM CCTCCGGTCTGTACTTCGGTCT-GGGATTTCGCGACAGTCC

loop B 0.4 µM TGATCGCACGCAAAAAAGATTGGGA

loop F 0.4 µM CGGCATGGACAGGACCTTC

Table 1 Overview of LAMP primer sequences and concentration.

Device: The CRISPR-Clear device runs on an Arduino UNO Rev3 microcontroller and it is based on our previously reported Arduino Lamp Shield [17]. All electronic components were soldered onto an Arduino Rev3 ProtoShield, which was stacked on top of the Arduino controller. The heating blocks consist of a 200 µm NiCr resistance wire and a thermistor (EPCOS B57540G1104F Thermistor 100kΩ) embedded in a PDMS elastomer (Sylgard, 10:1 elastomer:curing agent), using the ESCARGOT technique [18]. For each heating block, a constant 100 kOhm resistor was soldered onto the ProtoShield. A metal-oxide-semiconductor field-effect transistor (MOSFET) was used for each heating block to regulate the current flowing through the resistance wires. To power the heating blocks, four 18650 Li-ion batteries (3.7 V, 2550 mAh, Samsung ICR18650-26) were connected in a 2 series-2 parallel arrangement. The Arduino device is powered separately by 9V, 300 mAh block battery (Ansmann maxE 6LR61 NiMH). A poly lactic acid (PLA) case was designed using SketchUp and 3D-printed with an Ultimaker 2+ 3D printer. The device was programmed in Arduino 1.8.5 IDE; the program code can be found in the SI. The heating blocks were calibrated using a thermal camera to ensure that they were heated to the optimal LAMP reaction temperature of 65˚C.

Visualisation: To visualize the successful amplification of the target DNA a WarmStart Colorimetric kit from NEB was evaluated. This specific colorimetric kit shifts in color when the pH changes. It shows a pink color (pH >6.8) for negative results and a yellow color (pH <6.8) for positive results. When the LAMP reaction occurs and amplifies the target DNA, pyrophosphate is released, decreasing the pH of the mixture. Therefore, the color of the mixture will turn yellow when the LAMP amplification reaction is successful. To prepare the samples 12.5 μL WarmStart Colorimetric LAMP 2X Master Mix is used. Followed by 2.5 μL LAMP Primer mix, 1 μL target DNA and 9 μL dH2O ending with a total volume of 25 μL. The primer concentrations recommended for the NEB WarmStart Colorimetric kit is given in table 3.

primer Reaction concentration

B3 0.2 µM

F3 0.2 µM

BIP 1.6 µM

FIP 1.6 µM

loop B 0.4 µM

loop F 0.4 µM

Table 2 Overview of required primer concentrations for NEB WarmStart Colorimetric kit.

Extraction of the DNA To test the CRISPR-Clear device, we used an Escherichia coli with a Cas9-pET-28b vector as the sample. We chose for the Cas9-pET-28b vector because it was readily available, it concerned the SpyCas9 version and because the vector is frequently used for genome editing experiments in the lab. In addition, an E. coli containing the pET-28b vector without Cas9 served as the negative control. This empty vector was also readily available at the lab. Although LAMP can be performed on “dirty” samples without the need to purify DNA beforehand, a DNA extraction step is still necessary. Like in all DNA amplification experiments, the DNA must be released from the cells and exposed for successful recognition and amplification. Here, the DNA of the target organism was extracted with extraction buffer consisting of 1 m of PEG Buffer. The composition of the buffer was 60% tetraethylene glycol and 20 mM KOH with a pH of 13.3– 13.5 [19]. The tubes were shaken by hand for 1 min, then 10 μL of the prepared sample is transferred into a tube containing 90 μL distilled water shaken by hand for 1 min thereafter, 1 μL is transferred into the master mix. This pretreatment can be done in the field as it is faster and easier to perform with respect to PCR pretreatment which require the purification of the DNA from bacterial cells residues.

Results and discussion Primer results We evaluated 6 different sets of primers for the amplification of the SpyCas9 sequence. To assess the ability of the designed primers to detect the target DNA, we amplified the g-block DNA which contains part of the Cas9 sequence, and measured the melting curve using real time LAMP Genie II instrument. The temperature was kept constant at 65˚C for 30 minutes. One of the tested primer set successfully amplified the target sequence, giving an amplicon in the expected range between 88 and 89 ˚C, as can be seen in figure 2 B. Absence of other melting temperatures outside of the expect range, indicates that the amplicon is indeed the target sequence and no dimers of the primers were formed [20]. In absence of the target DNA, no melting curve is observed in the control reaction, indicating that no aspecific amplification take place.

Figure 2 A) Shows the amplification as a function of time, with blue being the control (no g- block present). B) Melting curve of the amplified DNA sequence; signal intensity as a function of temperature.

Device One important aspect of a quick detection protocol for CRISPR-Cas9 gene drives is the ability to perform the LAMP reaction in the field. As a solution to this problem, we have developed a portable device based on an open-source Arduino system reported before [19]. The system employs a reaction cell consisting of a Nickel-Chrome (NiCr) resistance wire and a thermistor embedded in a polydimethyl siloxane (PDMS) elastomer via the ESCARGOT method [19]. LAMP reactions are carried out in disposable 25 µL PCR tubes that can be inserted directly into the reaction cells. During the reaction, the temperature is continuously monitored by a thermistor embedded in the cell. When the temperature drops below the 65 ˚C required for the LAMP reaction, the Arduino controller heat the reaction cell by increasing the current of the NiCr resistance wire.

Our new device has two main improvements compared to the one we published earlier [18]. First, it is completely battery operated, so that multiple measurements can be performed independent of an external power source. The heating elements and the Arduino board are powered by separate batteries. This ensures that the Arduino board itself continues to function properly as the batteries are drained during a measurement. Alternatively, the Arduino can be powered via a USB or jack plug connection (scheme in Supplementary Information). As a second improvement, we incorporated one more reaction cell. This allows us to test both a sample and a control simultaneously, improving the overall speed and reliability of the system. A measurement can be initiated by flipping a switch on top of the device, which powers the Arduino board and starts heating the blocks. We used LEDs as a simple user feedback. During the measurement two LEDs inform the user if both reaction cells are functioning properly. The green LED turns on if the temperature in both reaction cells is within preset margins of the LAMP reaction temperature. Otherwise, the white LED is active. Thirty minutes after initiation both the green and white LED switch on simultaneously, informing the user that the experiment is finished.

Figure 3 Pictures from left to right: (left) an individual reaction cell, and the CRISPR Clear device both (centre) without and (right) with its lid. Arrow 1 points at the NiCr resistance wire, 2 at the thermistor. Arrow 3 in the second pictures points at the MOSFETs, 4 to the LEDs and 5 shows the heating blocks in the device. In the last picture, arrow 6 shows the power switch.

Visualization A quick detection in the field also requires a clear and immediate readout of whether the target sequence was detected and amplified by the LAMP reaction, preferably without additional equipment. For ease of use, this readout should give a binary yes-or-no answer and a have well-defined transition between the two states. We employ a commercially available colorimetric LAMP kit [1,8]. This mix uses the pH indicator phenol red to detect the pH drop that occurs during the LAMP reaction. Above pH 6.8 phenol red has a distinct pink color, while below this pH phenol red is yellow.

The primer set was tested with the colorimetric LAMP kit in a PCR instrument. Pictures of the reaction mixtures after incubation for 45 minutes at 65 °C in both the absence and presence of the target sequence are shown in figure 4a and figure 4b, respectively. As can be seen in figure 4b, the primer set targeting the Cas9 sequence from the pET-28b vector colored yellow, indicating a successful amplification. Furthermore, the reaction did give a negative readout in the absence of its target sequence, demonstrating that the reaction mixture including the primer set can distinguish between the presence and absence of the target sequence at the correct temperature within 45 minutes.

Further amplifications were performed in the CRISPR Clear device to determine whether a successful detection of the Cas9 sequence could be achieved in this device. Both a negative control which did not contain the Cas9 sequence and a sample which did were incubated simultaneously at 65°C. After 45 minutes of incubation, the sample containing the Cas9 sequence turned yellow, while the negative control remained pink (figure 4c).

If our detection protocol is to be used to detect the Cas9 gene drives in organisms in the field, DNA has to be extracted from cells. Our protocol should include a method to extract DNA from the sample cells prior to the amplification. For this purpose, we diluted a solution of E. coli bacteria bearing the Cas9-pET-28b vector with a pH 13 PEG extraction buffer. As a negative control, an E. coli bacteria was used containing the pET-28b vector without the Cas9 sequence. Next, the diluted samples were incubated with the colorimetric LAMP kit and primer set in the CRISPR Clear device. After amplification in the CRISPR Clear device, the sample containing the vector with the Cas9 sequence gave a positive readout, whereas the sample containing the empty vector gave a negative readout (figure 4d).

a b c d

Figure 4. LAMP amplification results with the colorimetric visualization method. Tests were performed in a LAMP apparatus both (a) in absence and (b) in presence of the target sequence. The primer set was subsequently tested in the CRISPR-Clear Arduino device on (c) the g-block and (d) the target sequence extracted from E. coli containing the Cas9-pET- 28b vector. In c and d, the negative controls are shown on the left and the samples containing the target sequence on the right.

Conclusions In conclusion we have shown how to detect gene drive modified DNA sequences using a cheap, fast and fieldable home-build device based on Arduino. The detection is done by naked-eye but it can be simply improved by using photodetectors directly in the PDMS cell[18]. The results of this research, both on the application of LAMP and cheap devices, can be of great interest for the detection of DNA/RNA based bioweapons or for the screening of accidently escaped gene drive containing lab organisms.

Acknowledgements NWO Top Sector Student competition 2017 for the funding. Dr Cor Schoen for the insightful discussion on LAMP.

References

1. Germini, D., et al., A Comparison of Techniques to Evaluate the Effectiveness of Genome Editing. Trends in Biotechnology, 2018. 36(2): p. 147-159. 2. Hsu, Patrick D., Eric S. Lander, and F. Zhang, Development and Applications of CRISPR-Cas9 for Genome Engineering. Cell, 2014. 157(6): p. 1262-1278. 3. Barrangou, R. and J.A. Doudna, Applications of CRISPR technologies in research and beyond. Nature Biotechnology, 2016. 34(9): p. 933-941. 4. Zayner, J. DIY Human CRISPR. 2017; Available from: http://www.the- odin.com/diyhumancrispr/. 5. Clapper, J.R., Worldwide Threat Assessment of the US Intelligence Community. 2016, National Intelligence. 6. Esvelt, K.M., et al., Concerning RNA-guided gene drives for the alteration of wild populations. Elife, 2014. 3. 7. Gantz, V.M. and E. Bier, The mutagenic chain reaction: A method for converting heterozygous to homozygous mutations. Science, 2015. 348(6233): p. 442-444. 8. Dearden, P.K., et al., The potential for the use of gene drives for pest control in New Zealand: a perspective. Journal of the Royal Society of New Zealand, 2017: p. 1-20. 9. Gantz, V.M., et al., Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi. Proceedings of the National Academy of Sciences of the United States of America, 2015. 112(49): p. E6736-E6743. 10. Wintle, B.C., et al., A transatlantic perspective on 20 emerging issues in biological engineering. Elife, 2017. 6: p. 21. 11. Gurwitz, D., Gene drives raise dual-use concerns. Science, 2014. 345(6200): p. 1010- 1010. 12. Akbari, O.S., et al., Safeguarding gene drive experiments in the laboratory. Science, 2015. 349(6251): p. 927-929. 13. Koebler, J., Scientists are working on an 'Undo Button' for genetic experiments gone wrong, in Motherboard. 2015. 14. Shokralla, S., et al., Next-generation sequencing technologies for environmental DNA research. Molecular Ecology, 2012. 21(8): p. 1794-1805. 15. Morisset, D., et al., Alternative DNA amplification methods to PCR and their application in GMO detection: a review. European Food Research and Technology, 2008. 227(5): p. 1287-1297. 16. Notomi, T., et al., Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 2000. 28(12). 17. Velders, A.H., C. Schoen, and V. Saggiomo, Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection. BMC Research Notes, 2018. 11(1): p. 93. 18. Saggiomo, V. and A.H. Velders, Simple 3D Printed Scaffold-Removal Method for the Fabrication of Intricate Microfluidic Devices. Advanced Science, 2015. 2(9). 19. Chomczynski, P. and M. Rymaszewski, Alkaline polyethylene glycol-based method for direct PCR from bacteria, eukaryotic tissue samples, and whole blood. Biotechniques, 2006. 40(4): p. 454, 456, 458. 20. Ririe, K.M., R.P. Rasmussen, and C.T. Wittwer, Product Differentiation by Analysis of DNA Melting Curves during the Polymerase Chain Reaction. Analytical Biochemistry, 1997. 245(2): p. 154-160.