DOCSLIB.ORG

Abstracts from the 3Rd International Genomic Medicine Conference (3Rd IGMC 2015) Jeddah, Kingdom of Saudi Arabia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Abstracts from the 3Rd International Genomic Medicine Conference (3Rd IGMC 2015) Jeddah, Kingdom of Saudi Arabia BMC Genomics 2016, Volume 17 Suppl 6 DOI 10.1186/s12864-016-2858-0 MEETING ABSTRACTS Open Access Abstracts from the 3rd International Genomic Medicine Conference (3rd IGMC 2015) Jeddah, Kingdom of Saudi Arabia. 30 November - 3 December 2015 Published: 20 July 2016 O1 Correspondence: Nobutaka Hirokawa ([email protected]) – Regulation of genes by telomere length over long distances Center of Excellence in Genomic Medicine Research, King Abdulaziz Jerry W. Shay University, Jeddah, 21589, Saudi Arabia University of Texas Southwestern Medical Center, Dallas, Texas, USA BMC Genomics 2016, 17(Suppl 6):O2 BMC Genomics 2016, 17(Suppl 6):O1 Kinesin super family protein 2A (KIF2A) is an ATP-dependent micro- The ends of linear chromosomes are called telomeres that resemble tubule destabilizer, that belongs to the kinesin-13 family. It is highly broken DNA. However, the telomeres are protected from the DNA expressed in juvenile brains, but its postnatal function has not been damage responses due to the formation of a looping structure (T- determined due to mortality in KIF2A-deficient mice. In addition, loop) and by “capping” the telomeres with a series of shelterin KIF2A is a causal gene in human Malformation of Cortical Develop- proteins. It is generally thought the main, if not only, function of telo- ment (MCD) with epilepsy, but the contribution of KIF2A to its meres is protection from DNA damage responses. When telomeres pathogenesis is not yet understood due to the small number of hu- get very short due to normal replicative aging, cells stop dividing man patients. In this study, we first analyzed the prenatal function due to loss of the telomere end protective functions. We have previ- of KIF2A using kif2a-KO mice. These mice were pale, breathed ir- ously reported that telomeres may also have additional functions in regularly, and exhibited frequent twitching in addition to malforma- human cells. Telomeres are characterized by a distinct chromatin tions resembling those in kif2a-mutated human patients. To structure with spreading of heterochromatin into the subtelomeric determine the post-migration function of KIF2A, we generated regions, but little is known about the chromatin conformation of hu- newly tamoxifen-inducible conditional knockout mice. Despite suc- man telomeres. We have previously shown, using a luciferase re- cessful neuronal migration, all offspring displayed hyper-activity, porter introduced into telomeres, that there is a 10-fold decreased weight loss, severe cortical/hippocampal-focus epilepsy, and died. expression of the reporter compared to the reporter introduced into Interestingly, KIF2A was highly expressed in excitatory axons, in cor- internal genomic loci. This phenomenon is known as Telomere Pos- tical neurites in layers II/III/V and in dentate mossy fibers (MF). In ition Effects (TPE). We have also found that a human gene, interferon the cortex, the loss of KIF2A generated aberrant axon sprouting in stimulating gene 15 (ISG15), (~1 M base pairs from the 1p36.33 telo- those layers. In the hippocampus, the loss of KIF2A resulted in the mere) is silenced in young cells with long telomerase, upregulated in development of hippocampal sclerosis, MF sprouting, and recurrent cells with short telomeres and silenced again in old cells with experi- excitatory circuits resembling but different from TLE. These pheno- mentally hTERT (telomerase) elongated telomeres. However, we ob- types developed without excitation. cKO granule cells exhibited served genes between ISG15 and the telomere are not regulated by failed axon/dendrite determination, and developed multiple short classic telomere position effects (TPE). To distinguish this type of axons throughout the entire molecular layer. These results suggest telomere length dependent regulation of gene expression from that KIF2A is crucial postnatally for establishing accurate neuronal classic TPE, we have termed this type of regulation Telomere Position circuits, in addition to its role in prenatal cell survival, migration, Effects Over Long Distances (TPE-OLD). We discovered using 3D co- and axon elongation. FISH and a modification of Hi-C (chromosome capture followed by high-throughput sequencing), that there are a significant number of O3 genes within the first 10 M bases distal to the telomere on many Integration of metagenomics and metabolomics in gut chromosomes regulated by telomere length with genes closer to the microbiome research telomere not being regulated by TPE. Maryam Goudarzi1 and Albert J. Fornace Jr.1,2,3,4 1Department of Biochemistry and Molecular & Cellular Biology, Lombardi O2 Comprehensive Cancer Center. Georgetown University, Washington, DC, The microtubule destabilizer KIF2A regulates the postnatal USA; 2Department of Oncology, Lombardi Comprehensive Cancer establishment of neuronal circuits in addition to prenatal cell Center, Georgetown University, Washington, DC, USA; 3Department of survival, cell migration, and axon elongation, and its loss leading Radiation Medicine, Lombardi Comprehensive Cancer Center, to malformation of cortical development and severe epilepsy Georgetown University, Washington, DC, USA; 4Center of Excellence Noriko Homma1, Ruyun Zhou1, Muhammad Imran Naseer2, Adeel G. in Genomic Medicine Research (CEGMR), King Abdulaziz University, Chaudhary2, Mohammed Al-Qahtani2, Nobutaka Hirokawa1,2 Jeddah, KSA 1Department of Cell Biology and Anatomy, Graduate School of Correspondence: Albert J. Fornace Jr. ([email protected]) – Medicine, the University of Tokyo, Tokyo 113-0033, Japan; 2Center of Center of Excellence in Genomic Medicine Research (CEGMR), King Excellence in Genomic Medicine Research, King Abdulaziz University, Abdulaziz University, Jeddah, KSA Jeddah, 21589, Saudi Arabia BMC Genomics 2016, 17(Suppl 6):O3 © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. BMC Genomics 2016, Volume 17 Suppl 6 Page 2 of 78 The gut is the largest reservoir of microbes in the body, harboring more O5 than 100 trillion microorganisms in a well-balanced communication RPL27A is a target of miR-595 and deficiency contributes to with the host factors. The gut microbiota plays an essential role in a ribosomal dysgenesis wide range of biological functions such as digestion and the develop- Heba Alkhatabi ment of immunological responses. The microbial community compos- Centre of Excellence in Genomic Medicine Research, King Abdulaziz ition and diversity is important in maintaining the homeostatis in the University, Jeddah, Saudi Arabia host. Factors, which may influence the gut microbial composition in- BMC Genomics 2016, 17(Suppl 6):O5 clude diet, environmental exposures, age, genetics, and many more. Re- cent advances in technology, particularly 16S rRNA sequencing and Myelodysplasia with monosomy 7 or deletion 7q has a dismal prog- mass spectrometry have enabled us to survey these microbial commu- nosis and high propensity for leukaemic transformation. The exact nities at the phylogenetic level and assess the host/microbes co- pathogenesis of these disorders remains elusive. We investigated metabolism. The metagenomic studies have shed light on the func- functional consequences of deletion of microRNAs (miRNAs) residing tional composition of the gut microbiota and have determined that in on chromosome 7q, focusing on miR-595. Using a novel assay, sev- diseases such as inflammatory bowel disease (IBD) there is an increase eral targets for miR-595 were identified, including a large ribosomal in functions of the auxotrophic and pathobiont bacteria. A number of subunit RPL27A. RPL27A downregulation induced p53 activation, studies have also pointed to an increase in the sulfate-reducing bac- apoptosis and inhibited proliferation. Importantly, p53-independent teria, such as Desulfovibrio, in IBD. On the other hand, metabolomics effects were identified secondary to a reduction in the ribosome sub- studies have revealed that taurine-conjugated bile acids increase the unit 60s with associated ribosome dysgenesis. Of note, RPL27A over- availability of free sulfur causing an expansion of the sulfate-reducing expression showed no significant effects on p53 mRNA levels but did pathobiont Bilophila wadsworthia, which drive colitis in genetically sus- enhance proliferation. In normal CD34+ cells, RPL27A knockdown ceptible IL10−/− but not wild-type mice. Furthermore, an increased in preferentially blocked erythroid proliferation and differentiation. glutathione transport and riboflavin metabolism and a decrease in bio- Lastly, miR-595 appears significantly downregulated in MDS patient synthesis of amino acids have been reported in ulcerative colitis pa- samples possessing -7/-7q anomalies compared to those with normal tients, which is indicative of increased predisposition for managing karyotype. We postulate that haploinsufficency of miR-595 in patients oxidative stress, a hallmark of an inflammatory environment. Our with -7/del 7q may contribute to disease pathogenesis via RPL27A current studies
Load more

Recommended publications
  • 2021 International Conference on Intelligent Biology and Medicine (ICIBM 2021)
    2021 International Conference on Intelligent Biology and Medicine (ICIBM 2021) August 08-10, 2021 Virtual via Zoom Hosted by: The International Association for Intelligent Biology and Medicine (IAIBM), Temple University, The Perelman School of Medicine, University of Pennsylvania, and The University of Texas Health Science Center at Houston 1 TABLE OF CONTENTS Welcome .……………………………….…………………………... 4 Acknowledgments ……………………………….…………………. 5 Schedule ……………………………….………………………….... 9 Keynote speakers’ information ……………………………….….. 24 Eminent Scholar Talks ………….……………………………….. 32 Workshop and tutorial information …………………………… 40 Session information ……………………………….……………… 46 Poster session abstracts ……………………………….…………… 107 About IAIBM ……………………………………………….……. 136 Special Acknowledgements……...……………….………………… 137 2 Sponsorships……………………………………………………… 138 3 Welcome to ICIBM 2021! On behalf of all our conference committees and organizers, we welcome you to the 2021 International Conference on Intelligent Biology and Medicine (ICIBM 2021), co-hosted by The International Association for Intelligent Biology and Medicine (IAIBM), Temple University, and the Perelman School of Medicine at the University of Pennsylvania. Given the rapid innovations in the fields of bioinformatics, systems biology, and intelligent computing and their importance to scientific research and medical advancements, we are pleased to once again provide a forum that fosters interdisciplinary discussions, educational opportunities, and collaborative efforts among these ever growing and progressing fields. We are proud to have built on the successes of previous years’ conferences to take ICIBM 2021 to the next level. This year, our keynote speakers include Drs. James S. Duncan, Chunhua Weng, Ben Raphael, and Ying Xu. We also have four eminent scholar speakers from Drs. Yue Feng, Graciela Gonzalez-Hernandez, Kai Tan, and Wei Chen. These researchers are world-renowned experts in their respective fields, and we are privileged to host their talks at ICIBM 2021.
    [Show full text]
  • Next Generation Exome Sequencing of Paediatric Inflammatory Bowel
    Inflammatory bowel disease ORIGINAL ARTICLE Next generation exome sequencing of paediatric Gut: first published as 10.1136/gutjnl-2011-301833 on 28 April 2012. Downloaded from inflammatory bowel disease patients identifies rare and novel variants in candidate genes Katja Christodoulou,1 Anthony E Wiskin,2 Jane Gibson,1 William Tapper,1 Claire Willis,2 Nadeem A Afzal,3 Rosanna Upstill-Goddard,1 John W Holloway,4 Michael A Simpson,5 R Mark Beattie,3 Andrew Collins,1 Sarah Ennis1 < Additional materials are ABSTRACT published online only. To view Background Multiple genes have been implicated by Significance of this study these files please visit the association studies in altering inflammatory bowel journal online (http://dx.doi.org/ 10.1136/gutjnl-2011-301833). disease (IBD) predisposition. Paediatric patients often What is already known on this subject? manifest more extensive disease and a particularly < For numbered affiliations see Genome-wide association studies have impli- end of article. severe disease course. It is likely that genetic cated numerous candidate genes for inflamma- predisposition plays a more substantial role in this group. tory bowel disease (IBD), but evidence of Correspondence to Objective To identify the spectrum of rare and novel causality for specific variants is largely absent. Dr Sarah Ennis, Genetic variation in known IBD susceptibility genes using exome Furthermore, by design, genome-wide associa- Epidemiology and Genomic sequencing analysis in eight individual cases of childhood Informatics Group, Human tion studies are limited to the study of Genetics, Faculty of Medicine, onset severe disease. common variants and overlook the functionally University of Southampton, Design DNA samples from the eight patients underwent detrimental variation imposed by rare/novel Duthie Building (Mailpoint 808), targeted exome capture and sequencing.
    [Show full text]
  • Abstracts for the ??Evolutionary Medicine Conference
    Ashdin Publishing Journal of Evolutionary Medicine ASHDIN Vol. 3 (2015), Article ID 235924, 45 pages publishing doi:10.4303/jem/235924 Abstracts CONFERENCE PROCEEDINGS Abstracts for the “Evolutionary Medicine Conference: Interdisciplinary Perspectives on Human Health and Disease” at the University of Zurich, Switzerland (July 30–August 1, 2015) Kaspar Staub,1 Nicole Bender,2 Paul Ewald,3 and Frank Ruhli¨ 1 1Institute of Evolutionary Medicine, University of Zurich, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland 2Institute of Social and Preventive Medicine, University of Bern, Finkenhubelweg 11, CH-3012 Bern, Switzerland 3Department of Biology, University of Louisville, Louisville, KY 40292, USA Address correspondence to Frank Ruhli,¨ [email protected] Received 17 Aril 2015; Revised 11 May 2015; Accepted 14 May 2015 Copyright © 2015 Kaspar Staub et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Summary In summer 2015, the “Evolutionary Medicine Conference diseases. The discipline is now at a turning point at which a 2015: Interdisciplinary Perspectives on Human Health and Disease” rigorous application of evolutionary insights to the medical takes place at the Institute of Evolutionary Medicine, University of sciences will require not only assessing the validity of the Zurich, Switzerland. This international conference is the first of its kind in Europe and brings together eight distinguished keynote speak- full spectrum of possible explanations for each disease ers from all over the world as well as experts from different disci- but the interplay of different contributors to illness within plines (including medicine, anthropology, molecular/evolutionary biol- and between the three broad categories of causal factors: ogy, paleopathology, archeology, history, psychology, epidemiology, genetic, infectious, and environmental.
    [Show full text]
  • BIOL 5112/3112: Fundamentals of Genomic Evolutionary Medicine
    BIOL 5112/3112: Fundamentals of Genomic Evolutionary Medicine Dr. Sudhir Kumar 602A SERC s.kumar@ temple.edu LECTURE BioLife Science 332 Wednesday: 5:30-8:00 pm OFFICE HOURS By appointment Offered in the Spring semester BIOL 5112 SECTION 001 [26318] (For graduate students) BIOL 3112 SECTION 001 [27340] (For undergraduate students) (Graduates and undergraduate attend the lectures together at the same time in the same room. However, undergraduate students will work in small groups in the semester-long student case study projects. Graduate students will work individually on case-study projects.) Prerequisite: Biology 2112 with a grade of C or better. Course Description: Modern evolutionary theory offers a conceptual framework for understanding human health and disease. In this course we will examine human disease in evolutionary contexts with a focus on modern techniques and genome-scale datasets. We ask: What can evolution teach us about human populations? How can we understand disease from molecular evolutionary perspectives? What are the relative roles of negative and positive selection in disease? How do we apply evolutionary principles in to diagnose diseases and develop better treatments? Students will become familiar with current research through guided case studies. This course focuses on discovery-based learning. Course Learning Objectives 1. Explain key concepts of evolutionary biology and medicine from a genomic perspective 2. Integrate key evolutionary concepts and principles to explain various aspects of human health and disease 3. Develop familiarity with current research relevant to evolutionary and genomic medicine 4. Evaluate how genomics and phylomedicine fit into the broader context of modern healthcare 5.
    [Show full text]
  • An Evolutionary Telescope to Explore and Diagnose the Universe of Disease Mutations
    Review Phylomedicine: an evolutionary telescope to explore and diagnose the universe of disease mutations Sudhir Kumar1,2, Joel T. Dudley3,4, Alan Filipski1,2 and Li Liu2 1 School of Life Sciences, Arizona State University, Tempe, AZ 85287-4501, USA 2 Center for Evolutionary Medicine and Informatics, The Biodesign Institute, Arizona State University, Tempe, AZ 85287-5301, USA 3 Division of Systems Medicine, Department of Pediatrics, Stanford University School of Medicine, Stanford, CA 94305, USA 4 Biomedical Informatics Training Program, Stanford University School of Medicine, Stanford, CA 94305, USA Modern technologies have made the sequencing of per- robust picture of the amount and types of variations found sonal genomes routine. They have revealed thousands within and between human individuals and populations. of nonsynonymous (amino acid altering) single nucleo- Any one personal genome contains more than a million tide variants (nSNVs) of protein-coding DNA per ge- variants, the majority of which are single nucleotide var- nome. What do these variants foretell about an iants (SNVs) (Figure 1b). With the complete sequencing of individual’s predisposition to diseases? The experimen- each new genome, the number of novel variants discovered tal technologies required to carry out such evaluations at is decreasing, but the total number of known variants is a genomic scale are not yet available. Fortunately, the growing quickly (Figure 2a). Our knowledge of the number process of natural selection has lent us an almost infinite of disease genes and the total number of known disease- set of tests in nature. During long-term evolution, new associated SNVs has grown with these advances [12].
    [Show full text]
  • Phylomedicine: an Evolutionary Telescope to Explore and Diagnose the Universe of Disease Mutations
    TIGS-899; No. of Pages 10 Review Phylomedicine: an evolutionary telescope to explore and diagnose the universe of disease mutations 1,2 3,4 1,2 2 Sudhir Kumar , Joel T. Dudley , Alan Filipski and Li Liu 1 School of Life Sciences, Arizona State University, Tempe, AZ 85287-4501, USA 2 Center for Evolutionary Medicine and Informatics, The Biodesign Institute, Arizona State University, Tempe, AZ 85287-5301, USA 3 Division of Systems Medicine, Department of Pediatrics, Stanford University School of Medicine, Stanford, CA 94305, USA 4 Biomedical Informatics Training Program, Stanford University School of Medicine, Stanford, CA 94305, USA Modern technologies have made the sequencing of per- robust picture of the amount and types of variations found sonal genomes routine. They have revealed thousands within and between human individuals and populations. of nonsynonymous (amino acid altering) single nucleo- Any one personal genome contains more than a million tide variants (nSNVs) of protein-coding DNA per ge- variants, the majority of which are single nucleotide var- nome. What do these variants foretell about an iants (SNVs) (Figure 1b). With the complete sequencing of individual’s predisposition to diseases? The experimen- each new genome, the number of novel variants discovered tal technologies required to carry out such evaluations at is decreasing, but the total number of known variants is a genomic scale are not yet available. Fortunately, the growing quickly (Figure 2a). Our knowledge of the number process of natural selection has lent us an almost infinite of disease genes and the total number of known disease- set of tests in nature.
    [Show full text]
  • Evolutionary Analysis of Selective Constraints Identifies Ameloblastin
    Delsuc et al. BMC Evolutionary Biology (2015) 15:148 DOI 10.1186/s12862-015-0431-0 RESEARCH ARTICLE Open Access Evolutionary analysis of selective constraints identifies ameloblastin (AMBN) as a potential candidate for amelogenesis imperfecta Frédéric Delsuc1, Barbara Gasse2 and Jean-Yves Sire2* Abstract Background: Ameloblastin (AMBN) is a phosphorylated, proline/glutamine-rich protein secreted during enamel formation. Previous studies have revealed that this enamel matrix protein was present early in vertebrate evolution and certainly plays important roles during enamel formation although its precise functions remain unclear. We performed evolutionary analyses of AMBN in order to (i) identify residues and motifs important for the protein function, (ii) predict mutations responsible for genetic diseases, and (iii) understand its molecular evolution in mammals. Results: In silico searches retrieved 56 complete sequences in public databases that were aligned and analyzed computationally. We showed that AMBN is globally evolving under moderate purifying selection in mammals and contains a strong phylogenetic signal. In addition, our analyses revealed codons evolving under significant positive selection. Evidence for positive selection acting on AMBN was observed in catarrhine primates and the aye-aye. We also found that (i) an additional translation initiation site was recruited in the ancestral placental AMBN,(ii)ashortexon was duplicated several times in various species including catarrhine primates, and (iii) several polyadenylation sites are present. Conclusions: AMBN possesses many positions, which have been subjected to strong selective pressure for 200 million years. These positions correspond to several cleavage sites and hydroxylated, O-glycosylated, and phosphorylated residues. We predict that these conserved positions would be potentially responsible for enamel disorder if substituted.
    [Show full text]
  • Molecular Evolution
    Molecular Evolution Justin Fay Center for Genome Sciences Department of Genetics 4515 McKinley Ave. Rm 4305 [email protected] Molecular evolution is the study of the cause and effects of evolutionary changes in molecules Species 1 GGCAGTGACATTTTCTAACGCGAAGGTACTT Species 2 GGCAGCGCCATTTTCTAATGCGAGGGTACTT Species 3 GGCAGCGCCATTGTCTAATGCGAGGGTACTT ***** * **** ***** **** ******* Phylogenetics Archea Divergence times Human-chimp-neanderthal Comparative Genomics Ultraconserved sequences (mutation and selection) ENCODE Fox2p Phylogenetics Methods Table 1. Number of possible rooted and unrooted trees. Table 2. Distance matrix. Sequence A B C Number of Number of rooted Number of A sequences trees unrooted trees B d(AB) 2 1 1 C d(AC) d(BC) 3 3 1 D d(AD) d(BD) d(CD) 4 15 3 Each d is the distance (substitution rate) 5 954 105 between pairs of sequences 10 34,459,425 2,027,025 Taxonomists have long debated phylogenetic methods. D C There are many types of methods: Character state methods (also called cladistic methods), like A B parsimony. Distance or similarity based methods (also called phenetic Software: methods), like UPGMA. PAUP Maximum likelihood and Bayesian Methods. PHYLIP MEGA Parsimony (non-parametric) and Maximum likelihood MrBayes (parametric) are both used when phylogeny is critical. Gene trees vs Species trees 1. Orthology 2. Independence (no concerted evolution or horizontal transfer) Orthologs are genes created by speciation events. Paralogs are genes created by duplication events. Homologs are genes that are similar because of shared ancestry. Duplication Orthologues and paralogues can be distinguished by i) synteny or ii) phylogeny. Speciation Species 1 Species 2 Gene Conversion and Horizontal Gene Transfer Locus 1 Chr02 HHF1 HHT1 Species tree Locus 2 Chr14 HHT2 HHF2 Vertebrate to Bacteria Bacteria to Vertebrate No conversion Gene Conversion (true phylogeny) Molecular Evolution (Comparative Genomics) 1.
    [Show full text]
  • Substitutions Into Amino Acids That Are Pathogenic in Human Mitochondrial Proteins Are More Frequent in Lineages Closely Related to Human Than in Distant Lineages
    Substitutions into amino acids that are pathogenic in human mitochondrial proteins are more frequent in lineages closely related to human than in distant lineages Galya V. Klink1, Andrey V. Golovin2 and Georgii A. Bazykin1,3 1 Sector of Molecular Evolution, Institute for Information Transmission Problems (Kharkevich Institute) of the Russian Academy of Sciences, Moscow, Russian Federation 2 Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University, Moscow, Russian Federation 3 Center for Data-Intensive Biomedicine and Biotechnology, Skolkovo Institute of Science and Technology, Skolkovo, Russian Federation ABSTRACT Propensities for different amino acids within a protein site change in the course of evolution, so that an amino acid deleterious in a particular species may be acceptable at the same site in a different species. Here, we study the amino acid-changing variants in human mitochondrial genes, and analyze their occurrence in non-human species. We show that substitutions giving rise to such variants tend to occur in lineages closely related to human more frequently than in more distantly related lineages, indicating that a human variant is more likely to be deleterious in more distant species. Unexpectedly, substitutions giving rise to amino acids that correspond to alleles pathogenic in humans also more frequently occur in more closely related lineages. Therefore, a pathogenic variant still tends to be more acceptable in human mitochondria than a variant that may only be fit after a substantial perturbation of the protein structure. Submitted 30 August 2017 Accepted 16 November 2017 Subjects Evolutionary Studies, Genomics Published 12 December 2017 Keywords Fitness landscape, Pathogenic mutations, Homoplasy, Mitochondria Corresponding author Georgii A.
    [Show full text]
  • Earth Biogenome Project: Sequencing Life for the Future of Life PERSPECTIVE Harris A
    PERSPECTIVE Earth BioGenome Project: Sequencing life for the future of life PERSPECTIVE Harris A. Lewina,b,c,d,1, Gene E. Robinsone, W. John Kressf, William J. Bakerg, Jonathan Coddingtonf, Keith A. Crandallh, Richard Durbini,j, Scott V. Edwardsk,l,F´elix Forestg, M. Thomas P. Gilbertm,n, Melissa M. Goldsteino, Igor V. Grigorievp,q, Kevin J. Hackettr, David Hausslers,t, Erich D. Jarvisu, Warren E. Johnsonv, Aristides Patrinosw, Stephen Richardsx, Juan Carlos Castilla-Rubioy,z, Marie-Anne van Sluysaa,bb, Pamela S. Soltiscc, Xun Xudd, Huanming Yangee, and Guojie Zhangdd,ff,gg Edited by John C. Avise, University of California, Irvine, CA, and approved March 15, 2018 (received for review January 6, 2018) Increasing our understanding of Earth’s biodiversity and responsibly stewarding its resources are among the most crucial scientific and social challenges of the new millennium. These challenges require fundamental new knowledge of the organization, evolution, functions, and interactions among millions of the planet’s organisms. Herein, we present a perspective on the Earth BioGenome Project (EBP), a moonshot for biology that aims to sequence, catalog, and characterize the genomes of all of Earth’s eukaryotic biodiversity over a period of 10 years. The outcomes of the EBP will inform a broad range of major issues facing humanity, such as the impact of climate change on biodiversity, the conservation of endangered species and ecosystems, and the preservation and enhancement of ecosystem services. We describe hurdles that the project faces, including data-sharing policies that ensure a permanent, freely available resource for future scientific dis- covery while respecting access and benefit sharing guidelines of the Nagoya Protocol.
    [Show full text]
  • Natural Selection on Various Sites of Ribosomal Proteins: a Cladistic View
    Zoological Systematics, 41(1): 1–47 (January 2016), DOI: 10.11865/zs.201601 ORIGINAL ARTICLE Natural selection on various sites of ribosomal proteins: a cladistic view Haoyang Wu1 †, Yang Liu1 †, Yanhui Wang1 †, Jinzhong Lin2, Qiang Xie1 *, Wenjun Bu1 1Department of Zoology and Developmental Biology, College of Life Sciences, Nankai University, Tianjin 300071, China 2National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China †These authors contributed equally to this work *Corresponding authors, E-mail: [email protected] Abstract Deducing the function of certain sites within a protein necessitates a priori recognition of the strength of selective pressure. Currently, statistical method is the only option to evaluate the degree of conservation. In the statistical framework, the types of selective pressure can be divided into classifications of negative, nearly neutral and positive. However, such quantitative methods may omit some crucial amino acid sites among the nearly neutral results. In this study, we propose that the cladistic information can be also important to evaluate the functional importance of various amino acid sites. The ribosomal proteins of 62 eukaryotic species were chosen as the case for statistical and cladistic analysis. The evolutionary changes of each site in the aligned sequences were matched on a currently well-accepted cladogram of eukaryotes. Hundreds of synapomorphic sites were discovered in various clades, in which only part of them were suggested to be potentially significant in the statistical framework. Notably, the mutation on His213 of RPL10 in human beings, which are synapomorphic in vertebrates but only be identified as being under neutral selection, is account for the disease Autism.
    [Show full text]
  • Earth Biogenome Project: Sequencing Life for the Future of Life PERSPECTIVE Harris A
    PERSPECTIVE Earth BioGenome Project: Sequencing life for the future of life PERSPECTIVE Harris A. Lewina,b,c,d,1, Gene E. Robinsone, W. John Kressf, William J. Bakerg, Jonathan Coddingtonf, Keith A. Crandallh, Richard Durbini,j, Scott V. Edwardsk,l,F´elix Forestg, M. Thomas P. Gilbertm,n, Melissa M. Goldsteino, Igor V. Grigorievp,q, Kevin J. Hackettr, David Hausslers,t, Erich D. Jarvisu, Warren E. Johnsonv, Aristides Patrinosw, Stephen Richardsx, Juan Carlos Castilla-Rubioy,z, Marie-Anne van Sluysaa,bb, Pamela S. Soltiscc, Xun Xudd, Huanming Yangee, and Guojie Zhangdd,ff,gg Edited by John C. Avise, University of California, Irvine, CA, and approved March 15, 2018 (received for review January 6, 2018) Increasing our understanding of Earth’s biodiversity and responsibly stewarding its resources are among the most crucial scientific and social challenges of the new millennium. These challenges require fundamental new knowledge of the organization, evolution, functions, and interactions among millions of the planet’s organisms. Herein, we present a perspective on the Earth BioGenome Project (EBP), a moonshot for biology that aims to sequence, catalog, and characterize the genomes of all of Earth’s eukaryotic biodiversity over a period of 10 years. The outcomes of the EBP will inform a broad range of major issues facing humanity, such as the impact of climate change on biodiversity, the conservation of endangered species and ecosystems, and the preservation and enhancement of ecosystem services. We describe hurdles that the project faces, including data-sharing policies that ensure a permanent, freely available resource for future scientific dis- covery while respecting access and benefit sharing guidelines of the Nagoya Protocol.
    [Show full text]