School of Medicine Oregon Health & Science University

CERTIFICATE OF APPROVAL

This is to certify that the Ph.D dissertation of

Gregory Kennard Scott

Has been approved

Mentor

Committee Member

Michael Forte Committee Member Regulation of PACS-1-directed protein trafficking

By

Gregory KennardcS_cott

A Dissertation

Presented to the Neuroscience Graduate Program and the Oregon Health & Science University School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy

May 2006 Table of Contents

CHAPTER 1. INTRODUCTION ...... 1 Overview ...... : ...... I The biosynthetic and endocytic pathways ...... 4 identity ...... 7 Phospholipids ...... 8 The ARF and GTPases ...... 9 SNAREs ...... 13 Itinerant membrane proteins ...... 14 Sorting motifs and adaptor proteins ...... 18 Tyrosine motifs, dileucine motifs and the adaptor proteins ...... 18 Acidic-dileucine motifs and the GGAs ...... 21 Acidic cluster motifs and PACS-1 ...... 25 Tip47 and the complex ...... 29 CK2 ...... 31 Conclusion ...... 33 CHAPTER 2 ...... 35 The phosphorylation state of an autoregulatory domain controls PACS-1- directed protein traffic Gregory K. Scott, Feng Gu, Colin M. Crump, Laurel Thomas, Lei Wan, Yang Xiang and Gary Thomas. Published in the EMBO Journal , December 1, 2003, 22(23):6234-6244

Introduction ...... 37 Results ...... 41 Discussion ...... 49 Materials and Methods ...... 55 Figure Legends ...... 63 CHAPTER 3 ...... 7 4 A PACS-1, GGA3 and CK2 complex regulates CI-MPR trafficking Gregory K. Scott, Hao Fei, Laurel Thomas, Guruprasad R. Medigeshi and Gary Thomas. Submitted for publication

Introduction ...... 76 Results ...... 77 Discussion ...... 90 Meterials and Methods ...... 95 Figure Legends ...... 101 CHAPTER 4. DISCUSSION ...... 117

11 11

APPENDIX APPENDIX C. C. PRELIMINARY PRELIMINARY RESULTS RESULTS ...... 212 212

Figure Figure Legends Legends ...... 202 202

Discussion Discussion ...... 196 196

Results Results ...... 188 188

Experimental Experimental Procedures Procedures ...... 183 183

Introduction Introduction ...... 180 180

Abstract Abstract ...... 179 179

In In press press in in The The Journal Journal of of Biological Biological Chemistry Chemistry

and and Gary Gary Thomas Thomas

Subbian, Subbian, Chien Chien Hui Hui Hung, Hung, Sean Sean S. S. Molloy, Molloy, Franc;ois Franc;ois Jean, Jean, Ujwal Ujwal Shinde Shinde

Sylvain Sylvain F. F. Feliciangeli, Feliciangeli, Laurel Laurel Thomas, Thomas, Gregory Gregory K. K. Scott, Scott, Ezhilkani Ezhilkani

enzyme enzyme activation activation

Identification Identification of of a a pH pH sensor sensor in in the the furin furin propeptide propeptide that that regulates regulates

APPENDIX APPENDIX B. B. FURIN FURIN ACTIV ACTIV ATION ATION ...... l78 l78

Figure Figure Legends Legends ...... 168 168

6.0. 6.0. Summary Summary of of pathways pathways trafficking ...... 162 162

5.0. 5.0. Incorporation Incorporation of of endocytosed endocytosed VZV VZV glycoproteins glycoproteins into into virion virion envelopes envelopes ...... 159 159

4. 4. VZV VZV Glycoprotein Glycoprotein H H ...... 157 157

3. 3. VZV VZV Glycoprotein Glycoprotein B B ...... 154 154

2. 2. VZV VZV Glycoprotein Glycoprotein gi gi ...... 153 153

1. 1. Glycoprotein Glycoprotein gE gE ...... 151 151

Introduction Introduction ...... 150 150

In In Press Press with with Horizon Horizon Press, Press, Fa112006 Fa112006

and and Gary Gary Thomas. Thomas.

Charles Charles Grose, Grose, Lucie Lucie Guruprasad Guruprasad Maresova, Medigeshi, Medigeshi, Gregory Gregory K. K. Scott, Scott,

envelopment envelopment and and egress egress

Endocytosis of of Varicella-Zoster Varicella-Zoster Virus Virus glycoproteins: glycoproteins: virion virion

APPENDIX APPENDIX A. A. VZV VZV REVIEW REVIEW ...... 148 148

Conclusion Conclusion ...... 127 127

Implications Implications for for neuronal neuronal function function ...... 126 126

Implications Implications for for PACS-2 PACS-2 ...... 125 125

Implications Implications for for GGA GGA binding binding ...... 123 123

Implications Implications for for CK2 CK2 binding binding and and activation activation ...... 121 121

Implications Implications for for PACS-1 PACS-1 regulation regulation ...... 119 119

Implications Implications for for P P ACS-1 ACS-1 cargo cargo binding binding ...... 118 118

Summary Summary ...... 117 117 Acknowledgments

I am deeply indebted to my advisor, Dr. Gary Thomas, whose support, advice and scientific mentoring was essential for the development of this project and my training as a research scientist. I am also indebted to Laurel Thomas, who has contributed greatly to these studies, and has kept the lab running smoothly. Together, Gary and Laurel run a tight ship, and this dissertation reflects their hard work and determination to produce high quality research.

The Thomas Lab is a team environment and the work presented in this dissertation could not have been done without the help of others. I was especially lucky to work with Feng

Gu and Hao Fei, who each contributed greatly to these studies. I am also indebted to the members of the Thomas Lab, past and present who have been great advisors, collaborators and friends. Several individuals worked hard to keep my graduate training successful and interesting. Many thanks to: Neal Alto, Joe Asian, Rachel Dresbek, Chien­

Hui Hung, Stefanie Kaech-Petrie, Tom O'Hare and Oleg Varlamov.

Finally, I extend special thanks to my parents, who have supported me through all levels of education, and to Laura Baraff, who has kept me sane through graduate school.

lll

iv iv

trafficking trafficking and and sorting sorting of of itinerant itinerant proteins proteins in in the the TGN/endosomal TGN/endosomal system. system.

TGN. TGN. These These results results identify identify a a CK2-controlled CK2-controlled phosphorylation phosphorylation cascade cascade regulating regulating

278

PACS-1 PACS-1 Ser promoting promoting binding binding of of P P ACS-1 ACS-1 to to CI- , , MPR MPR to to retrieve retrieve the the receptor receptor to to the the

releasing releasing GGA3 GGA3 from from CI-MPR CI-MPR and and early early . endosomes. Bound Bound CK2 CK2 also also phosphorylates phosphorylates

required required for for CI-MPR CI-MPR sorting. sorting. PACS-1-bound PACS-1-bound CK2 CK2 stimulates stimulates GGA3 GGA3 phosphorylation, phosphorylation,

Accordingly, Accordingly, we we found found that that PACS-1 PACS-1 links links GGA3 GGA3 to to CK2, CK2, forming forming a a multimeric multimeric complex complex

association association of of CK2 CK2 with with these these trafficking trafficking molecules molecules coordinates coordinates their their sorting sorting activity. activity.

binding. binding. Experiments Experiments performed performed in in this this dissertation dissertation test test the the hypothesis hypothesis that that an an intimate intimate

cargo cargo binding, binding, CK2 CK2 phosphorylation phosphorylation of of the the GGA3 GGA3 autoregulatory autoregulatory domain domain inhibits inhibits cargo cargo

However, However, whereas whereas CK2 CK2 phosphorylation phosphorylation of of the the PACS-1 PACS-1 autoregulatory autoregulatory domain domain promotes promotes

MPR MPR is is also also controlled controlled by by the the CK2 CK2 phosphorylation phosphorylation of of an an autoregulatory autoregulatory domain. domain.

by by PP2A. PP2A.

Similar Similar to to our our findings findings for for PACS-1, PACS-1, GGA3 GGA3 binding binding to to the the phosphorylated phosphorylated CI­

278 278 show show Ser adjacent adjacent to to the the acidic acidic cluster cluster is is phosphorylated phosphorylated by by CK2 CK2 and and dephosphorylated dephosphorylated

as as an an autoregulatory autoregulatory domain domain that that controls controls PACS-1-directed PACS-1-directed sorting. sorting. Biochemical Biochemical studies studies

PACS-1, PACS-1, which which is is highly highly similar similar to to acidic acidic cluster cluster sorting sorting motifs motifs on on cargo cargo molecules, molecules, acts acts

coordinates coordinates these these opposing opposing roles roles is is unknown. unknown. This This thesis thesis shows shows that that an an acidic acidic cluster cluster on on

a a CK2-phosphorylated CK2-phosphorylated acidic acidic cluster cluster trafficking trafficking motif motif to to bind bind the the CI-MPR. CI-MPR. But But how how CK2 CK2

TGN TGN retrieval. retrieval. Despite Despite executing executing opposing opposing sorting sorting steps, steps, GGA3 GGA3 and and PACS-1 PACS-1 both both utilize utilize

mediated mediated by by GGA3, GGA3, which which directs directs TGN TGN export, export, and and PACS-1, PACS-1, which which directs -to­ directs

(TGN) (TGN) to to . lysosomes. Cycling_ Cycling_ of of CI-MPR CI-MPR between between the the TGN TGN and and early early endosomes endosomes is is

highly highly regulated regulated sorting sorting itinerary itinerary to to deliver deliver hydrolases from from the the trans-Golgi trans-Golgi network network

The The cation-independent cation-independent mannose-6-phosphate mannose-6-phosphate receptor receptor (CI-MPR) (CI-MPR) follows follows a a Abstract Abstract List of Figures

Chapter 1 Figure 1. Intracellular Transport Pathways 4 Figure 2. Examples of phosphoinositides and Rab and ARF GTPases that are localized 8 to specific membranes within eukaryotic cells Figure 3. Organelle identity specifies coat recruitment 10 Figure 4. Late secretory protein sorting 15 Figure 5. Schematic diagram of the APs 19 Figure 7. Model of GGA3 activation 21 Figure 6. Diagram of GGA3 showing domain organization and protein interactions 22 Figure 8. Schematic diagram of PACS-1 proteins 26 Figure 9. Ribbon diagram of the CK2 holoenzyme 31

Chapter 2

Figure 1. PACS-1 Ser278 is phosphorylated by CK2 and dephosphorylated by PP2A 68

Figure 2. Phosphorylation of PACS-1 Ser278 promotes PACS-1 binding to cargo proteins 69 Figure 3. Phosphorylated PACS-1 directs endosome-to-TGN transport 70

Figure 4. Expression of PACS-1 S278A blocks HIV -1 Nef-mediated MHC-1 71 downregulation.

Figure 5. Expression ofPACS-1 S278A disrupts furin and CI-MPR localization 72 Figure 6. A working model of the CK2/PP2A regulation of PACS-1 sorting activity 73

Chapter 3 Figure 1. PACS-1 binds to GGA3 109 Figure 2. PACS-looAmut disrupts CI-MPR trafficking 110 Figure 3. PACS-1 is required for CI-MPR function 111 Figure 4. PACS-1 associates with CK2 112 Figure 5. PACS-1 binding to CK2~ activates CK2 113 Figure 6. PACS-lcKmut redistributes CI-MPR, furin and GGA3 and controls GGA3 114 phosphorylation Figure 7. Working model of PACS-1/GGA3/CK2 controlled CI-MPR trafficking 115 Sup. Figure 1. siRNA depletion of PACS-1 does not effect CI-MPR half-life 116

Chapter 4 Figure 1. Model of PACS-1 function 118

Appendix A Figure 1. Amino acid sequences of the cytosolic domains of VZV glycoproteins gE, gH, 172 gland gB Figure 2. Endocytosis assay . 173 Figure 3. Identification of biotinylated VZV glycoproteins on infected cells and purified 174 virions Figure 4. Endosomal trafficking of the VZV glycoproteins 175 Figure 5. Egress and exocytosis of virions from a cytosolic vacuole 176

v

VI VI

Figure Figure 2. 2. PACS-1 PACS-1 binds binds 212 212 to to PI3P PI3P

Figure Figure 1. 1. PACS-1 PACS-1 forms forms 212 212 an an oligomer oligomer in in cells cells

Appendix Appendix C C

Figure Figure 5. 5. PACS-2 PACS-2 and and COPI COPI localize localize H69K:fur/f/ha H69K:fur/f/ha to to the the ER ER 210 210

69 69 Figure Figure 4. 4. The The protonation protonation state state of of His affects affects the the subcellular subcellular localization localization of of 209 209 furin furin

activation activation in in vivo vivo

69 69 Figure Figure 3. 3. The The protonation protonation state state of of His controls controls propeptide propeptide excision excision and and enzyme enzyme 208 208

activation activation in in vitro vitro

69 69 Figure Figure 2. 2. His controls controls the the pH-sensitive pH-sensitive furin furin propeptide propeptide cleavage cleavage and and enzyme enzyme 207 207

Figure Figure 1. 1. Homology Homology modeling modeling of of the the furin furin propeptide propeptide 206 206

Appendix Appendix B B List of Tables

Chapter 1 Table 1. List of published PACS-1 cargo proteins. 28

Appendix A Table 1. Endocytosis motifs in herpesvirus gH homologs. 177

Appendix B Table 1. Furin cleavage of peptidyl substrates 211

Vll

Vlll Vlll

SNARE SNARE Soluble Soluble NSF-attachment NSF-attachment Protein Protein Receptor Receptor

Phox Phox PX PX Homology Homology Domain Domain

Ptdlns Ptdlns Phosphatidylinositol Phosphatidylinositol

PP2A PP2A Protein Protein Phosphatase Phosphatase 2A 2A

PKD-2 PKD-2 Polycystin-2 Polycystin-2

PKA PKA Protein Protein Kinase Kinase A A

PI3K PI3K Phosphatidy Phosphatidy linositol-(3 linositol-(3 )-kinase )-kinase

PACS-2 PACS-2 Phosphofurin Phosphofurin Acidic Acidic Cluster Cluster Sorting Sorting Protein-2 Protein-2

Phosphofurin Phosphofurin PACS-1 PACS-1 Acidic Acidic Cluster Cluster Sorting Sorting Protein-1 Protein-1

Negative Negative Nef Nef Factor Factor

Multi-vesicular Multi-vesicular MVB MVB Body Body

MR MR Middle Middle Region Region

MHC-I MHC-I Major Major Histocompatibility Histocompatibility Complx-1 Complx-1

Late Late LE LE Endosome Endosome

Low Low LDLR LDLR Density Density Lipoprotein Lipoprotein Receptor Receptor

Hepatocyte-growth- Hrs Hrs factor- receptor receptor Substrate Substrate

HIV HIV Human Human ImunoDeficiency ImunoDeficiency Virus Virus

HCMV HCMV Human Human Cytomegalovirus Cytomegalovirus

GFP GFP Green Green Fluorescent Fluorescent Protein Protein

GEF GEF Guanine Guanine Nucleotide Nucleotide Exchange Exchange Factor Factor

GAT GAT GGA GGA and and TOM TOM Domain Domain

GTPase-activating GTPase-activating GAP GAP Protein Protein

GAE GAE y-Adaptin y-Adaptin Ear Ear Domain Domain

FBR FBR Furin Furin Binding Binding Region Region

ER ER Endoplasmic Reticulum

ENTH ENTH Epsin NH2-terrninal NH2-terrninal Homology Homology Domain Domain

EEA1 EEA1 Early Early Endosome Endosome Antigen Antigen 1 1

EE EE Early Early Endosome Endosome

5 5 ,6-dichlorobenzimidazole ,6-dichlorobenzimidazole DRB DRB

C- Terminal Terminal CTR CTR Region Region

CPO CPO Carboxypeptidase Carboxypeptidase D D

COP COP Coatomer Protein Protein

CK2 CK2 Protein Protein Kinase Kinase CK2 CK2

CK CK 1 1 Protein Protein Kinase Kinase CK CK 1 1

CI-MPR CI-MPR Cation-independent Cation-independent Mannose-6-phosphate Mannose-6-phosphate Receptor Receptor

CD-MPRCation-dependent CD-MPRCation-dependent Mannose-6-phosphate Mannose-6-phosphate Receptor Receptor

Clathrin-Coated -Coated CCV CCV V V esic~e esic~e

Bin/ Bin/ BAR BAR Amphiphysin/R Amphiphysin/R vs vs

ARR ARR Atropin Atropin Related Related Region Region

Arf Arf ADP-ribosylation ADP-ribosylation Factor Factor

AP AP Adaptor Adaptor Protein Protein or or Assembly Assembly Polypeptide Polypeptide

ANTH ANTH AP180 AP180 NH2-terrninal NH2-terrninal Homology Homology Domain Domain

List List of of Abbreviations Abbreviations SNXl 1 SNX2 Sorting Nexin 2 TBB 4,5 ,6, 7 -tetrabromo-2-azabenzimidazole Tf Transferrin Receptor TGN trans-Golgi Network TIP47 Tail-interacting Protein of 47 kD TOM Target ofMyolB VAMP4 Vesicle Associated Membrane Protien 4 VHS Vps26, Hrs, Starn Domain Vps26 26 vsv Vesicular Stomatitis Virus HPS Hermansky-Pudlak syndrome BACE ~-secretase

IX X Chapter 1. Introduction

CHAPTER 1. INTRODUCTION

Overview

The central hypothesis of this dissertation is that protein kinase CK2 (CK2) controls a phosphorylation cascade that regulates the function of phosphofurin acidic cluster sorting protein (PACS)-1 and Golgi-localized, y-ear-containing, ARF-binding protein (GGA)-3, and thus, trafficking of certain itinerant membrane proteins in the trans-Golgi network

(TGN)/endosomal system. Itinerant membrane proteins utilize cytosolic sorting motifs, which interact with components of the cellular protein trafficking apparatus, to segregate into nascent vesicles bound for target . PACS-1 and GGA3 bind to acidic cluster and acidic-dileucine sorting motifs, respectively, both of which overlap on the cytosolic domain of the cation-independent mannose-6-phosphate receptor (CI-MPR).

Cycling of CI-MPR between the TGN and early endosomes is mediated by GGA3, which directs TGN export, and PACS-1, which directs endosome-to-TGN retrieval. However, information pertaining to the regulation of PACS-1, and how PACS-1 and GGA3 utilize an overlapping motif on the CI-MPR, was hitherto unknown. Experiments performed to address this hypothesis evaluate if CK2 phosphorylation of a potential autoregulatory domain on PACS-1 controls PACS-1-directed trafficking events, if CK2 directly associates with P ACS-1 to control phosphorylation of the P ACS-1 autoregulatory domain, and if the PACS-1/CK2 complex controls the sorting activity ofGGA3.

This chapter provides an introduction to vesicular trafficking through the TGN and endosomal systems. I discuss how subcellular localization of itinerant membrane proteins is directed, paying special attention to the sorting proteins PACS-1 and GGA3. Finally, I

2 2

biochemical- methods methods to to show show that that PACS-1 PACS-1 interacts interacts directly directly with with the the regulatory regulatory subunit subunit

sorting sorting motifs. motifs. With With the the help help of of other other Thomas Thomas Lab Lab members, members, I I used used cellular- and and

trafficking trafficking of of itinerant itinerant membrane membrane proteins proteins that that contain contain acidic acidic cluster cluster and and acidic-dileucine acidic-dileucine

Studies Studies in in Chapter Chapter 3 3 describe describe a a PACS-1, PACS-1, GGA3, GGA3, and and CK2 CK2 complex, complex, which which regulates regulates

the the sorting sorting machinery. machinery.

within within the the TGN/endosomal TGN/endosomal system system through through the the phosphorylation phosphorylation state state of of both both cargo cargo and and

TGN. TGN. These These results results suggest suggest that that coordinated coordinated signaling signaling events events regulate regulate protein protein transport transport

molecule molecule that that selectively selectively blocks blocks retrieval retrieval of of PACS-1-regulated PACS-1-regulated cargo cargo molecules molecules to to the the

Ala Ala substitution, substitution, which which ~ ~ does does not not bind bind to to cargo cargo proteins, proteins, yields yields an an interfering interfering PACS-1 PACS-1

278 278

cargo, cargo, whereas whereas 278 278 a a Ser Ala Ala substitution substitution decreased decreased ~ ~ this this interaction. interaction. Moreover, Moreover, the the Ser

278 278

cluster cluster or or substitution substitution of of Ser Asp Asp increased increased the the ~ ~ interaction interaction between between PACS-1 PACS-1 and and

278 278 domain domain for for PACS-1 PACS-1 function. function. CK2 CK2 phosphorylation phosphorylation of of Ser within within the the PACS-1 PACS-1 acidic acidic

phosphorylated phosphorylated by by CK2, CK2, and and that that this this cluster cluster of of acidic acidic residues residues act act as as an an autoregulatory autoregulatory

cellular-methods cellular-methods 278 278 to to establish establish that that PACS-1 PACS-1 is is a a phosphoprotein, phosphoprotein, that that Ser is is

site. site. With the the With help help of of other other Thomas Thomas lab lab members, members, I I used used biochemical-, biochemical-, cell-free- and and

on on itinerant itinerant membrane membrane proteins proteins and and which which constitute constitute a a consensus consensus CK2 CK2 phosphorylation phosphorylation

278 sequence sequence reveals reveals residues-S EEEEE-that EEEEE-that are are similar similar to to acidic acidic cluster cluster sorting sorting motifs motifs

the the ability ability of of PACS-1 PACS-1 to to bind bind to to acidic acidic cluster cluster motifs. motifs. Inspection Inspection of of the the PACS-1 PACS-1 protein protein

Studies Studies in in Chapter Chapter 2 2 describe describe the the identification identification of of an an autoregulatory autoregulatory domain domain that that controls controls

regulation regulation of of protein protein trafficking. trafficking.

also also include include a a description description of of protein protein kinase kinase CK2, CK2, a a kinase kinase that that has has manifold manifold roles roles in in the the

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction of CK2. This interaction stimulates CK2 activity and controls phosphorylation of the

PACS-1 autoregulatory domain. While this work was ongoing, two key observations came to light: 1) we discovered that PACS-1 directly interacts with the cytosolic sorting protein GGA3, and 2) GGA3's sorting activity was reported to be controlled by the CK2 phosphorylation of an autoregulatory domain (Doray et al., 2002b; Ghosh and Kornfeld,

2003a). However, CK2 control of GGA3 is directly opposite that of PACS-1: while CK2 phosphorylation of the PACS-1 autoregulatory domain promotes cargo binding, CK2 phosphorylation of the GGA3 autoregulatory domain inhibits cargo binding. Therefore, we used cellular- and biochemical-methods to show PACS-1 recruits CK2 to phosphorylate both PACS-1 and GGA3, thereby inactivating GGA3 and activating

PACS-1, thus causing PACS-1 to bind CI-MPR and direct its retrieval to the TGN. These findings demonstrate a regulatory "switch" controlled by CK2 phosphorylation, which dictates anterograde and retrograde transport of the CI-MPR in the TGN/endosomal system.

In Chapter 4, I discuss the findings presented in Chapters 2 and 3, present a model that integrates these findings in the context of other published results and my preliminary data regarding PACS-1 function (presented in Appendix C), and suggest future experiments.

Additionally, Appendix A includes a review entitled "Endocytosis of varicella-Zoster

Virus glycoproteins: virion envelopment and egress" and Appendix B includes a study describing the autocatalytic activation of the furin endoprotease that I co-authored. Taken together, studies completed for this dissertation demonstrate a novel regulatory mechanism for protein sorting in the TGN/endosomal system.

3

4 4

govern govern the the mechanics mechanics of of the the endocytic endocytic and and biosynthetic biosynthetic pathways, pathways, connecting connecting the the plasma plasma

The The organelles, organelles, cytosolic cytosolic factors, factors, and and modification modification steps, steps, that that allow allow vesicular vesicular trafficking trafficking

subject subject of of this this thesis thesis (Bonifacino (Bonifacino and and Glick, Glick, 2004; 2004; Gu Gu et et al., al., 2001). 2001).

adaptor adaptor complexes, complexes, protein protein and and lipid lipid kinases kinases and and phosphatases, phosphatases, and and PACS-1, PACS-1, the the main main

membrane membrane factors, factors, including including GTPases, GTPases, phosphoinositides, phosphoinositides, motor motor proteins, proteins, coat coat proteins, proteins,

Efficient Efficient and and correct correct completion completion of of these these steps steps requires requires a a wide wide array array of of cytosolic cytosolic and and

can can be be loosely loosely divided divided into into four four basic basic steps: steps: budding, budding, transport, transport, docking, docking, and and fusion. fusion.

vesicles vesicles bud bud from from a a membrane membrane compartment compartment the the organelle organelle "matures". "matures". Vesicular Vesicular transport transport

vesicular vesicular transport transport or or organelle organelle maturation. maturation. These These processes processes are are intrinsically intrinsically linked-as linked-as

between between organelles organelles is is essential essential for for these these cellular cellular processes processes to to take take place place and and occurs occurs via via

and and energy energy production production (Behnia (Behnia et et el., el., 2005). 2005). Efficient Efficient transport transport of of protein protein and and lipid lipid

protein protein secretion, secretion, nutrient nutrient uptake, uptake, degradation degradation of of membrane membrane and and internalized internalized proteins, proteins,

homeostasis, homeostasis, which which control control cellular cellular functions functions such such as as production production of of membrane membrane proteins, proteins,

Eukaryotic Eukaryotic cells cells evolved evolved a a system system of of membrane-bound membrane-bound organelles organelles essential essential for for

The The biosynthetic biosynthetic and and endocytic endocytic pathways pathways

like like complexes complexes exist exist but but are are not not represented represented in in this this figure. figure. From From Bonifacino Bonifacino and and Glick, Glick, 2004. 2004.

known known or or presumed presumed locations locations of of COPII COPII (blue), (blue), COPI COPI (red), (red), and and clathrin clathrin (orange). (orange). Additional Additional coats coats or or coat­

lysosomal/vacuolar, lysosomal/vacuolar, and and endocytic endocytic pathways. pathways. Transport Transport steps steps are are indicated indicated by by arrows. arrows. Colors Colors indicate indicate the the

Figure Figure 1. 1. Intracellular Intracellular Transport Transport Pathways. Pathways. Schematic Schematic diagram diagram of of the the compartments compartments of of the the secretory , ,

~ ~ ~

ER ER

Chapter Chapter 1. 1. Introduction Introduction Chapter I. Introduction membrane to the endoplasmic reticulum (ER; Figure 1; Bonifacino and Glick, 2004;

Palade, 1975). Membrane and lumenal proteins are synthesized at the ER and, once folded, travel to the Golgi compartment (Kleizen and Braakman, 2004; Mancias and

Goldberg, 2005). From the Golgi, proteins move on to the trans-Golgi network (TGN).

Strategically located at the boundary of the biosynthetic and endocytic pathways, the

TGN acts as a sorting station for membrane proteins and lipids moving through the biosynthetic pathway by segregating them into nascent vesicles bound for specific organelles including the endosomes, lysosomes and plasma membrane (Griffiths et al.,

1985; Gu et al., 2001). The TGN also receives molecules internalized from the cell surface via the endocytic pathway. From the cell surface, these molecules are transported via clathrin-coated vesicles to the early endosomes, where initial sorting occurs

(Anderson et al., 1977). A plethora of reports hs illuminated the many possible trafficking itineraries an internalized molecule may follow. From the early endosomes, molecules can return to the cell surface via tubular recycling endosomes (van Dam et al., 2002), travel farther along the endocytic pathway to multivesicular late endosomes and ultimately to the lysosomes for degradation, or internalized proteins can travel directly to the TGN. These trafficking steps are thought to occur by vesicular transport from the cell surface to the early endosome and then by a process of compartment maturation to the lysosomes (Rink et al., 2005; Stoorvogel et al., 1991). Endosome maturation involves the vesicular recycling of cellular proteins either back to the cell surface, or to the TGN, thus escaping degradation in the lysosomes. Therefore, the TGN/endosomal system can be considered a network of membrane bound compartments constantly fluctuating in time, and not a collection of static individual organelles.

5

6 6

Kadota, Kadota, 1969; 1969; Keen Keen and and Willingham, Willingham, 1979). 1979). The The coat coat protein protein was was purified purified from from pig pig brain brain

leading leading to to formation formation of of coated coated vesicles vesicles that that are are 50-150 50-150 nM nM in in diameter diameter (Kanaseki (Kanaseki and and

This This bristle-coat bristle-coat forms forms a a lattice lattice that that induces induces membrane membrane curvature curvature at at sites sites of of endocytosis endocytosis

membranes membranes of of mosquito mosquito oocytes oocytes and and termed termed "bristle-coated "bristle-coated pits" pits" (Roth (Roth and and Porter, Porter, 1964). 1964).

Vesicle Vesicle coats coats were were first first observed observed by by electron electron microscopy microscopy (EM) (EM) at at the the cell cell and and internal internal

vesicles vesicles that that allow allow entry entry into into and and control control of of the the cell. cell.

advantage advantage of of the the cell's cell's trafficking trafficking machinery, machinery, tricking tricking the the cells cells vesicular vesicular coats coats to to form form

1996), 1996), thereby thereby "evading" "evading" the the immune immune system system (Collins (Collins et et al., al., 1998). 1998). These These viruses viruses take take

(HIV)-1 (HIV)-1 down down regulates regulates the the major major histocompatibility histocompatibility complex complex (MHC-1; (MHC-1; Schwartz Schwartz et et al., al.,

2000; 2000; Marsh Marsh and and Helenius, Helenius, 2006). 2006). For For instance, instance, the the human human immunodeficiency immunodeficiency virus virus

the the cell cell surface surface receptors receptors that that signal signal a a viral viral infection infection (Marsh (Marsh and and Pelchen-Matthews, Pelchen-Matthews,

infectious infectious virus. virus. In In addition, addition, several several viruses viruses use use the the endocytic endocytic pathway pathway to to downregulate downregulate

TGN TGN and and endosomes endosomes then then travel travel toward toward and and fuse fuse with with the the plasma plasma membrane, membrane, releasing releasing

endosomal endosomal compartments compartments (re-envelopment). (re-envelopment). Virion-containing Virion-containing vacuoles vacuoles form from from form the the

envelopment), envelopment), then then obtains obtains it's it's final final membrane membrane envelope envelope by by budding budding into into the the TGN TGN or or

inner inner nuclear nuclear membrane membrane and and fuses fuses with with the the outer outer nuclear nuclear membrane membrane (envelopment/de­

Grose, Grose, 1988). 1988). The The viral viral DNA-containing DNA-containing capsid capsid assembles assembles in in the the nucleus, nucleus, buds buds across across the the

"envelopment/de-envelopment/ie-envelopment" "envelopment/de-envelopment/ie-envelopment" pathway pathway for for virion virion assembly assembly (Jones (Jones and and

replicate replicate within within the the cell. cell. For For example, example, Herpes-viruses Herpes-viruses are are proposed proposed to to use use an an

compose compose a a cellular cellular Achilles Achilles heel: heel: infectious infectious viruses viruses use use these these systems systems to to enter enter and and

The The endocytic endocytic and and biosynthetic biosynthetic pathways pathways are are essential essential for for homeostasis, homeostasis, but but they they also also

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction in 1975 and called "clathrin" to indicate the lattice-like structure it forms (Pearse, 1976).

Clathrin coated vesicles (CCVs) are found in all eukaryotic cells and tissue (Roth, 2006).

Of particular interest for this dissertation, CCV s control biogenesis of dense core granules in neuroendocrine cells (Tooze and Tooze, 1986) and mediate protein transport between the TGN and endosomes in all cells (Friend and Farquhar, 1967). Initially, clathrin was thought to control all vesicular traffic. However, studies of the budding yeast

Saccharomyces cerevisiae (Novick et al., 1980), and the use of a cell-free assay to measure intra-Golgi transport (Balch et al., 1984), soon led to the identification of COPI and COPII: clathrin-independent vesicle coats of the early secretory pathway (Barlowe et al., 1994; Waters et al., 1991). The COPI and COPII complexes form vesicles at the cis­

Golgi and ER, respectively, to direct transport between these organelles. COPI may also direct clathrin independent transport within the endosomes (Whitney et al., 1995). A prominent focus in the field of intracellular transport is to determine how assembly of these coat proteins occurs at specific "donor" sites and how selection of "cargo" molecules to be included in the budding vesicle is determined.

Organelle identity

Each organelle has a unique membrane signature that enables cytosolic coat proteins to correctly identify donor membrane sites and initiate vesicle budding, and for docking and fusion of vesicles with acceptor membranes. This signature consists of a combination of several factors, including derivatives of phosphatidylinositol (Ptdlns), GTPases and soluble NSF-attachment Protein Receptors (SNAREs), as well as the effector proteins that regulate these molecules. These factors compose an organelle "map" that the cellular

7

8 8

phosphatidylinositol phosphatidylinositol kinases kinases and and phosphatases, phosphatases, creating creating a a short-lived short-lived signal signal to to recruit recruit

The The presence presence of of these these phosphoinositides phosphoinositides on on cytosolic cytosolic membranes membranes is is regulated regulated by by

2 (Ptdlns(3)P)) (Ptdlns(3)P))

and and late late (phosphatidylinositol-3,5-phosphate (phosphatidylinositol-3,5-phosphate (Ptdlns(3,5)P endosomes. endosomes. )) ))

2 4,5-phosphate 4,5-phosphate (Ptdlns(4,5)P as as well well as as early early (phosphatidylinositol-3-phosphate (phosphatidylinositol-3-phosphate )), )),

TGN TGN (phosphatidylinositol-4-phosphate (phosphatidylinositol-4-phosphate (Ptdlns(4)P)), (Ptdlns(4)P)), cell cell surface surface (phosphatidylinositol-

are are the the derivatives derivatives of of phosphatidylinositol phosphatidylinositol (Ptdlns), (Ptdlns), found found on on the the cytosolic cytosolic leaflets leaflets of of the the

organelle organelle membranes membranes (Haucke, (Haucke, 2005). 2005). Most Most notable notable for for the the purposes purposes of of this this introduction introduction

Different Different phospholipids phospholipids recruit recruit effector effector proteins proteins to to the the cytosolic cytosolic leaflet leaflet of of specific specific

P P hosphoinositides hosphoinositides

Munro, Munro, 2005). 2005).

trafficking trafficking machinery machinery uses uses to to identify identify target target membranes membranes (see (see Figure Figure 2; 2; Behnia Behnia and and

found found in in specialized specialized or or polarized polarized cells. cells. From From Behnia Behnia and and Munro, Munro, 2005. 2005.

ubiquitous ubiquitous cases, cases, but but there there are are many many more more GTPases, GTPases, especially especially Rabs, Rabs, that that are are less less well well characterized characterized or or are are

stack), stack), but but most most are are restricted restricted to to only only one one organelle. organelle. The The examples examples shown shown are are the the best-characterized best-characterized and and

and and Rabs Rabs in in green. green. Some, Some, such such as as ARFl, ARFl, are are found found in in multiple multiple locations locations (in (in this this case case throughout throughout the the Golgi Golgi

accumulation accumulation of of the the well-characterized well-characterized phosphoinositides. phosphoinositides. (C) (C) ARF ARF family family GTPases GTPases are are shown shown in in purple, purple,

of of phosphorylation phosphorylation occur occur in in vivo. vivo. (B) (B) A A schematic schematic illustration illustration of of the the major major sites sites of of intracellular intracellular

phosphatidylinositol phosphatidylinositol (Ptdlns) (Ptdlns) on on the the 3, 3, 4 4 or or 5 5 positions positions of of the the inositol inositol ring. ring. All All seven seven possible possible combinations combinations

membranes membranes within within eukaryotic eukaryotic cells. cells. (A) (A) Phosphoinositides Phosphoinositides are are generated generated by by phosphorylation phosphorylation of of

Figure Figure 2. 2. Examples Examples of of phosphoinositides phosphoinositides

and and Rab Rab and and ARF ARF G G TPases TPases that that are are localized localized to to specific specific

phosph.at~ phosph.at~

P!dlns P!dlns

A A

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction peripheral membrane proteins and vesicular coats. Many peripheral membrane proteins contain modular domains, which bind specific phospholipids. These domains include

FYVE domains and PHOX homology (PX) domains, which bind to Ptdlns(3)P (Burd and

Emr, 1998, Cheever et al., 2001); pleckstrin homology (PH) domains, which bind to

Ptdlns(4)P (Harlan et al., 1994); and AP180 NH2-terminal homology (ANTH) and Epsin

NH2-terminal homology (ENTH) domains, which bind to Ptdins(4,5)P (ltoh et al., 2001;

Ford et al., 2001). Phosphoinositides are also required for the recruitment of adaptor proteins to organelle membranes (see Figure 3 and discussed below). However, the cellular distribution of coat and adaptor proteins is more restricted then the distribution of phosphoinositides, indicating that other factors must also play a role.

The ARF and Rab GTPases

In addition to phosphoinositides, the ADP-ribosylation factor (ARF) and Rab (for Ras genes from rat brain; Touchot et al., 1987) GTPases act to recruit proteins involved with vesicular trafficking to organelle membranes (Behnia and Munro, 2005). As I discuss below, GTPases alternately bind guanosine diphosphate (GDP) and guanosine triphosphate (GTP) and, as the name implies, hydrolyze GTP to GDP. These two GTPase families cycle between GTP- and GDP-bound states as they bind and unbind membranes.

In the GTP-bound state, they adopt a conformation that interacts with the cytosolic leaflet of cellular organelles and effector proteins, whereas in the GDP-bound conformation, they adopt an alternate conformation and are cytosolic. GTP loading of ARF and Rab

GTPases is activated by guanine nucleotide exchange factors (GEFs), and GTP hydrolysis is activated by GTPase-activating proteins (GAPs). Though they contain many

9

10 10

binds binds to to target target membranes. membranes. The The myristoyl myristoyl group group inserts inserts into into membranes, membranes, but but the the ARF ARF is is

terminus terminus of of ARFs ARFs contains contains a a myristoyl myristoyl group group and and an an amphipathic amphipathic helix helix that that reversibly reversibly

suggest suggest ARF3 ARF3 mediates mediates intra-Golgi intra-Golgi transport transport (Volpicelli-Daley (Volpicelli-Daley et et al., al., 2005). 2005). The The N-

entirely entirely understood). understood). The The roles roles of of ARF2-ARF5 ARF2-ARF5 are are poorly poorly defined, defined, though though some some reports reports

and and Donaldson, Donaldson, 1997), 1997), initiate initiate AP-2/clathrin-dependent AP-2/clathrin-dependent endocytosis endocytosis (this (this function function is is not not

(Cavenagh (Cavenagh et et al., al., 1996), 1996), where where it it may may (Paleotti (Paleotti et et al., al., 2005), 2005), or or may may not not (Radhakrishna (Radhakrishna

for the the for cis-Golgi cis-Golgi (Barlowe (Barlowe et et al., al., 1994). 1994). ARF6 ARF6 is is localized localized to to the the cell cell membrane membrane

Rothman, Rothman, 1993). 1993). Sar1 Sar1 recruits recruits the the COPII COPII coat coat to to ER ER membranes membranes to to form form vesicles vesicles bound bound

and and endosomal endosomal membranes membranes (Puertallano, (Puertallano, 2001b; 2001b; Serafini Serafini et et al., al., 1991; 1991; Stamnes Stamnes and and

well well as as clathrin clathrin adapters adapters and and GGAs GGAs to to Golgi Golgi membranes membranes to to form form vesicles vesicles bound bound for for ER ER

several several ARF-like ARF-like GTPases GTPases (Behnia (Behnia and and Munro, Munro, 2005). 2005). ARF1 ARF1 recruits recruits the the COPI COPI coat coat as as

ARF1 ARF1 is is the the prototypical prototypical member member of of the the ARF ARF family, family, which which includes includes ARF1-6, ARF1-6, Sar1 Sar1 and and

identity. identity.

similarities, similarities, ARFs ARFs and and Rabs Rabs also also have have important important differences differences that that contribute contribute to to organelle organelle

Golgi Golgi resident resident isoforms isoforms of of phosphatidylinositol-4-kinase phosphatidylinositol-4-kinase (PI4K; (PI4K; Wang Wang et et al., al., 2003). 2003). From From G. G. Thomas. Thomas.

1/clathrin 1/clathrin coat. coat. However, However, recruitment recruitment of of AP-1 AP-1 also also requires requires Ptdlns(4)P, Ptdlns(4)P, which which is is synthesized synthesized from from Ptdlns Ptdlns by by

TGN, TGN, ARFl ARFl is is recruited recruited by by BIGl BIGl or or BIG2 BIG2 (not (not shown), shown), which which are are both both ARFl ARFl GEFs GEFs that that recruit recruit the the AP-

cis - Golgi Golgi ARFl ARFl is is recruited recruited by by GBFl, GBFl, which which is is an an ARFl ARFl GEF. GEF. ARFl ARFl then then recruits recruits the the COPI COPI coat. coat. (C) (C) At At the the

which which is is a a GEF GEF that that is is also also an an integral integral ER ER membrane . protein. Sarl Sarl in in tum tum recruits recruits the the COPII COPII coat. coat. (B) (B) At At the the

Figure Figure 3. 3. Organelle Organelle identity identity specifies specifies coat coat recruitment. recruitment. (A) (A) Sarl Sarl is is recruited recruited to to ER ER membranes membranes by by SEC12, SEC12,

A A B B

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction not stabilized until theN-terminal amphipathic helix also interacts with the membrane-a process that requires GEF activation (Goldberg, 1998). In the cytosol, the N-terminal amphipathic helix binds to a hydrophobic pocket on ARF-GDP, preventing membrane insertion. The GDP/GTP switch causes a conformational change that displaces the N­ terminal helix out of its pocket and onto the membrane, allowing effector recruitment and vesicle formation. After formation of the vesicle, GAPs stimulate the ARF to hydrolize

GTP, resulting in a conformational change that triggers coat dissociation before vesicle fusion (Randazzo and Kahn, 1994; Serafini et al., 1991).

ARF GEFs, which are localized to specific membrane compartments, direct ARF recruitment to target organelles (Figure 3). For example, Sari is recruited to the ER by

SEC12, an integral ER membrane protein that functions as a Sari GEF (Barlowe and

Schekman, 1993), whereas ARF1 is recruited to the cis-Golgi by GBF1 (Kawamoto et al., 2002), or to the TGN by BIGI and BIGII (Yamaji et al., 2000). The importance of

GEFs for controlling ARF localization, and thus regulation of membrane protein trafficking, is illustrated by the microbial-based inhibitor of Sec7-like ARF GEFs,

Brefeldin A. Sec7 is a yeast ARF, whose mammalian homologous include GBF1, but not

Sari. Treatment of mammalian cells with BrefeldinA causes a massive disruption of protein trafficking through the secretory pathway, leading to redistribution of Golgi proteins into the ER (Lippincott-Schwartz et al., 1989). ·Paradoxically, this is due to an inhibition of Golgi-to-ER trafficking, by blocking COPI recruitment to the cis-Golgi and intermediate compartment (Donaldson et al., 1992; Helms and Rothman, 1992). While the exact mechanism for the redistribution of Golgi proteins to the ER remains unknown,

11

12 12

distinct distinct organelles organelles (Pfeffer (Pfeffer and and Aivazian, Aivazian, 2004). 2004). In In the the cytosol, cytosol, GTP GTP dissociation dissociation

al., al., 1995; 1995; Lombardi Lombardi et et al., al., 1993). 1993). A A system system of of Rab Rab effectors effectors mediates mediates targeting targeting of of Rabs Rabs to to

for for early early to to late late endosomal endosomal and and late late endosome endosome to to TGN TGN trafficking, trafficking, respectively respectively (Feng (Feng et et

Sluijs Sluijs et et al., al., 1992); 1992); and and Rab7 Rab7 and and Rab9, Rab9, which which both both mark mark the the late late endosome endosome and and function function

Sluijs Sluijs et et al., al., 1991), 1991), and and functions functions for for transport transport through through these these compartments compartments (van (van der der

(Wilcke (Wilcke et et al., al., 2000); 2000); Rab4, Rab4, which which is is found found at at early early and and recycling recycling endosomes endosomes (VanDer (VanDer

TGN TGN and and recycling recycling endosomes endosomes and and regulates regulates sorting sorting between between these these compartments compartments

endosomes endosomes (Gorvel (Gorvel et et al., al., 1991; 1991; Simonsen Simonsen et et al., al., 1998); 1998); Rabll, Rabll, which which is is found found at at the the

endosomal endosomal membranes membranes and and effects effects vesicular vesicular transport transport between between the the cell cell surface surface and and early early

Rabs Rabs function function at at endosomal endosomal membranes, membranes, including including Rab5, Rab5, which which is is localized localized to to early early

compartments compartments (Martinez (Martinez et et al., al., 1994; 1994; Plutner Plutner et et al., al., 1991; 1991; Tisdale Tisdale et et al., al., 1992). 1992). Several Several

function function at at the the level level of of the the ER ER and and Golgi Golgi to to regulate regulate trafficking trafficking through through these these

vesicular vesicular trafficking trafficking (Pfeffer (Pfeffer and and Aivazian, Aivazian, 2004). 2004). For For example, example, Rab1, Rab1, Rab2 and and Rab2 Rab6 Rab6

that, that, like like ARFs, ARFs, cycle cycle on on and and off off organelle organelle membranes membranes to to recruit recruit proteins proteins that that effect effect

2001 2001 ). ). The The Rabs Rabs constitute constitute a a family family of of over over 60 60 small small GTPases GTPases of of the the Ras Ras superfamily superfamily

mediate mediate specificity specificity of of vesicular vesicular fusion fusion with with target target membranes membranes (Zerial (Zerial and and McBride, McBride,

While While ARFs ARFs function function to to recruit recruit coat coat proteins proteins to to donor donor membranes, membranes, Rabs Rabs are are thought thought to to

of of ARF1, ARF1, the the same same organelle. organelle.

allow allow the the ARFs ARFs to to generate generate signaling signaling microdomains microdomains on on different different organelles, organelles, or or in in the the case case

fusion fusion of of the the Golgi Golgi with with the the ER ER (Nebenfuhr (Nebenfuhr et et al., al., 2002). 2002). These These complex complex interactions interactions

membrane membrane organization organization of of the the golgi, golgi, leading leading to to abhorrant abhorrant tubulogenesis tubulogenesis and and unorganized unorganized

one one possible possible explanation explanation is is that that blocking blocking COPI COPI recruitment recruitment to to the the cis-Golgi cis-Golgi disrupts disrupts the the

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction inhibitor (GDI) binds to and prevents two C-terminal phrenyl groups on the Rab from inserting into target membrane (Matsui et al., 1990). GDI displacement factor (GDF), found on the Rab target membrane, catalyzes transfer of the Rab phrenyl groups from

GDI to organelle membranes (Dirac-Svejstrup, 1997). Like ARFs, targeting of Rabs to distinct organelles can be mediated by GEF localization (Horiuchi, 1997). For instance, overexpression of Rabaptin 5, which recruits the Rab5 GEF, Rabex5, to early endosomal membranes, concentrates Rab5 on early endosomes (Horiuchi et al., 1997). Thus, Rabs contribute to specifying vesicle-target membrane fusion.

ARFs and Rabs function with phosphoinositides to direct trafficking events. For instance, early endosome antigen protein 1 (EEA 1; commonly used as a marker for the early endosome) requires both the presence of Ptdlns(3)P and the GTPase Rab5, to localize to the early endosome and regulate homotypic membrane fusion (Christoforidis, 1999;

Simonsen et al., 1998). In addition, the adaptor protein AP-1, uses an ARF1-GTP and

Ptdlns(4)P combination to recruit clathrin to TGN membranes (Wang et al., 2003).

Together, ARFs, Rabs, and phospholipids serve as a "coincidence" detection system: peripheral proteins recognize target membrane by the short-lived presence of an activated

GTPase-phospholipid combination.

SNAREs

After a vesicle sheds its coat, it must find and fuse with the appropriate compartment, a process that requires a complex of N-ethyl-malaimide sensitive factor (NSF), soluble

NSF-Attachment Protein (SNAP) and two SNAREs: one found on the vesicle (v-

13

14 14

endocytosed endocytosed from from the the cell cell surface, surface, travel travel to to Rab5-positive Rab5-positive early early endosomes endosomes via via clathrin-

2004; 2004; Raiborg Raiborg et et al., al., 2003). 2003). Similarly, Similarly, low-density low-density lipoprotein lipoprotein receptors receptors (LDLRs) (LDLRs) are are

body body (MVB) (MVB) pathway pathway to to lysosomes lysosomes where where they they are are degraded degraded (Gruenberg (Gruenberg and and Stenmark, Stenmark,

compartment compartment of of early early endosomes endosomes and and are are delivered delivered via via the the late late endosome/ endosome/ multi multi vesicular vesicular

such such as as the the epidermal epidermal growth growth factor factor receptor receptor (EGFR), (EGFR), are are segregated segregated into into the the sorting sorting

endosomes endosomes via via early early endosomes endosomes (van (van Dam Dam et et al., al., 2002), 2002), whereas whereas growth growth factor factor receptors, receptors,

transferrin transferrin receptors receptors constitutively constitutively recycle recycle between between the the plasma plasma membrane membrane and and recycling recycling

membrane-bound membrane-bound compartments compartments depending depending on on the the protein protein and and its its function. function. For For example, example,

Membrane Membrane proteins proteins within within the the endocytic endocytic and and biosynthetic biosynthetic pathways pathways traverse traverse various various

Itinerant Itinerant membrane membrane proteins proteins

over over the the path path of of itinerant itinerant membrane membrane proteins proteins through through the the TGN/endosomal TGN/endosomal system. system.

identify identify donor donor and and target membranes membranes target add add an an additional additional layer layer of of specificity specificity and and control control

SNARE SNARE proteins proteins interact interact (Pfeffer (Pfeffer and and Aivazian, Aivazian, 2004). 2004). Requiring Requiring multiple multiple signals signals to to

docks docks with with the the donor donor membrane membrane when when it it encounters encounters a a Rab, Rab, and and fuses fuses when when cognate cognate

2000). 2000). SNAREs SNAREs function function with with Rabs Rabs to to direct direct membrane membrane fusion: fusion: an an incoming incoming vesicle vesicle

cognate cognate t-SNARE, t-SNARE, thereby thereby controlling controlling downstream downstream target target destination destination (McNew (McNew et et al., al.,

disassociate disassociate the the SNARE SNARE complex complex (Sollner (Sollner et et al., al., 1993). 1993). A A v-SNARE v-SNARE will will only only bind bind to to its its

Sutton Sutton et et al., al., 1998; 1998; Weber Weber et et aL, aL, 1998), 1998), after after which which NSF, NSF, an an ATPase, ATPase, hydrolizes hydrolizes ATP ATP to to

helix helix bundle bundle to to drive drive hetero- and and homo-typic homo-typic membrane membrane fusion fusion (Nichols (Nichols et et al., al., 1997; 1997;

specificity specificity of of fusion fusion (Pfeffer (Pfeffer and and Aivazian, Aivazian, 2004). 2004). SNARES SNARES and and SNAPs SNAPs form form a a four­

SNARES SNARES are are localized localized to to specific specific donor donor and and target target membranes membranes and and help help mediate mediate

SNARE) SNARE) and and one one found found on on the the target target membranes membranes (t-SNARE; (t-SNARE; Zerial Zerial and and McBride, McBride, 2001). 2001).

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction

Figure 4. Late secretory protein sorting. Depicted are the organelles of the late secretory pathway, and the adapter and coat proteins that mediate protein sorting between these compartments. As an example, the sorting pathways of the CI-MPR (red triangles) are illustrated, though many other itinerant membrane proteins use these sorting pathways and adapter complexes. The cytosolic tail of the CI-MPR contains several sorting motifs that interact with adaptor proteins to direct sorting between organelles. These motifs include tyrosine and dileucine motifs that bind to AP1-4, an acidic-dileucine motif that interacts with the GGAs and acidic cluster motif that binds to PACS-1 . The CI-MPR follows several late secretory trafficking pathways: anterograde transport from the TGN to early endosomes (EE) requires the GGAs and AP-1, retrograde transport from endosomes to the TGN may occur from early en do somes via P ACS-1 and AP-1, intermediate endosomes (IE) via the retromer complex, or from late endosomes (LE) via TIP47. The CI-MPR is retrieved from the endosomes to the TGN before reaching the (L). In addition, the CI-MPR is retrieved from immature secretory granules (ISG) to the TGN during maturation of mature secretory granules (MSGs), a transport step that requires GGA3 and AP-1. CI-MPR transport form the cell surface to early endosomes requires AP-2. coated vesicles, and then to Rab7 positive late endosomes using a vesicular-free maturation process (Rink et al., 2005). In addition, several itinerant membrane proteins recycle between the TGN, early and late endosomes to perform biological.functions.The steady-state localization of the cation-dependent (CD)- and CI-MPRs and the furin endoprotease is at the TGN; however, like other itinerant membrane proteins, these molecules cycle between the TGN, cell surface, immature secretory granules and endosomes (Figure 4; Griffiths et al., 1988; Molloy et al., 1999). Furin must traverse the

15

16 16

cells, cells, whereas whereas normal normal or or other other lysosomal lysosomal disease disease fibroblasts fibroblasts were were incapable incapable of of

1-cell 1-cell fibroblasts fibroblasts were were able able to to internalize internalize and and use use lysosomal lysosomal enzymes enzymes produced produced by by normal normal

lysosome lysosome and and suffer suffer numerous numerous defects, defects, including including mental mental retardation. retardation. The The observation observation that that

(Tondeur (Tondeur et et al., al., 1971 1971 ). ). Patients Patients with with I I -cell -cell disease disease exhibit exhibit buildup buildup of of lipids lipids in in the the

form form "inclusions" "inclusions" that that can can be be seen seen by by phase phase microscopy microscopy of of fibroblasts fibroblasts taken taken from from patients patients

inclusion inclusion (I)-cell (I)-cell disease, disease, so so named named because because the the lysosomes lysosomes become become so so swollen swollen that that they they

phosphotransferase phosphotransferase gene gene that that prevent prevent modification modification of of hydrolases hydrolases in in the the Golgi Golgi result result in in

sorting sorting pathway pathway causes causes lysosomal lysosomal storage storage disorders. disorders. For For example, example, mutations mutations in in the the

recycled recycled back back to to the the TGN TGN (Griffiths (Griffiths et et al., al., 1988). 1988). Disruption Disruption of of this this lysosomal lysosomal hydrolase hydrolase

releases releases from from the the receptor receptor in in the the lower lower pH pH of of the the late late endosome, endosome, and and the the receptor receptor is is

hydrolase/receptor hydrolase/receptor complex complex travels travels through through the the maturing maturing endosomes endosomes until until the the hydrolase hydrolase

vesicles vesicles which which bud bud from from the the TGN TGN and and travel travel to to the the early early endosomes. endosomes. The The

hydrolase hydrolase (Sly (Sly and and Fischer, Fischer, 1982), 1982), concentrating concentrating the the hydrolase hydrolase into into clathrin-coated clathrin-coated

Once Once hydrolases hydrolases reach reach the the TGN, TGN, the the mannose-6-phosphate mannose-6-phosphate receptor receptor binds binds the the modified modified

phosphotransferase phosphotransferase and and a a diesterase diesterase (Reitman (Reitman and and Kornfeld, Kornfeld, 1981; 1981; Waheed Waheed et et al., al., 1981). 1981).

where where they they acquire acquire a a mannose-6-phosphate mannose-6-phosphate ligand. ligand. This This modification modification requires requires a a

such such as as Cathepsin Cathepsin D, D, are are synthesized synthesized at at the the ER ER and and then then travel travel to to the the Golgi Golgi compartment, compartment,

recycled recycled to to the the TGN TGN (Ghosh (Ghosh etal., etal., 2003a; 2003a; Griffiths Griffiths et et al., al., 1988). 1988). Lysosomal Lysosomal hydrolases, hydrolases,

synthesized synthesized lysosomal lysosomal hydrolases, hydrolases, such such as as Cathepsin Cathepsin D, D, to to lysosomes lysosomes before before being being

peptide peptide hormones hormones and and bioactive bioactive proteins proteins (Molloy (Molloy et et al., al., 1992). 1992). The The MPRs MPRs sort sort newly newly

cleave cleave at at doublets doublets or or clusters clusters of of basic basic amino amino acids acids within within inactive inactive precursors precursors to to form form

low low pH pH of of late late secretory secretory compartments compartments before before becoming becoming autocatalytically autocatalytically activated activated to to

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction internalizing lysosomal enzymes secreted by the 1-cell fibroblasts, led to the identification of mannose-6-phosphate and the MPR (Hickman and Neufeld, 1972).

Despite the immense body of literature produced to explain sorting of itinerant membrane proteins in the endosomal system, the exact trafficking itinerary for many of these molecules remains controversial. For instance, the trafficking itinerary proposed for furin and the MPRs is different depending on cell system and reagents used for study (Hirst et al., 1998; Lin et al., 2004; Mallet and Maxfield, 1999; Molloy et al., 1998). Why would a membrane protein use multiple sorting itineraries to move through the late secretory system? Possibly itinerant membrane proteins traverse various endosomal paths depending on the presence or absence of ligand molecules, or, in the case of CI-MPR, the type of ligand. The CI-MPR directs trafficking of hydrolases from the TGN to the lysosome, but also functions as a receptor for insulin-like growth factor 2 (IGF2) at the cell surface, undergoing clathrin-mediated endocytosis from the cell surface and traveling to a pre-lysosomal compartment (Oka et al., 1985; Oka and Czech, 1986)-a function that may involve receptor dimerization (Byrd et al., 2000). Enzymes such as furin, have known functions in different organelles, and may require different sorting itineraries to reach different endosomal compartments. Additionally, many investigations into the trafficking of itinerant membrane trafficking utilize chimeric reporter constructs containing the cytosolic component of the receptor fused to the transmembrane and lumenal domains of CD4 or Tac proteins, which may or may not reflect the full-length molecule's trafficking itinery (Mallet and Maxfiend, 1999; Lin et al., 2004). However, a broad research consensus concludes that these complex trafficking events rely upon

17

18 18

heterotetrameric heterotetrameric adaptor adaptor complexes complexes (APs) AP-1, AP-2, AP-2, AP-1, (APs) AP-3 AP-3 and and AP-4. AP-4. Originally Originally

tyrosine- and and dileucine-based dileucine-based signals signals arises arises from from the the interaction interaction of of these these motifs motifs with with the the

hydrophobic hydrophobic residue) residue) and and dileucine- ([D/E]xxxL[L/1]) ([D/E]xxxL[L/1]) based based motifs. motifs. The The function function of of

The The best best characterized characterized of of the the sorting motifs motifs sorting are are the the tyrosine- where where (YXX, (YXX, is is a a bulky bulky

Tyrosine Tyrosine motifs, motifs, dileucine dileucine motifs motifs and and the the adaptor adaptor proteins proteins

cluster-based cluster-based motifs, motifs, as as well well as as the the trafficking trafficking machinery machinery that that recognizes recognizes them. them.

membrane membrane proteins. proteins. Below Below introduce introduce tyrosine, tyrosine, I I dileucine, dileucine, acidic-dileucine acidic-dileucine and and acidic acidic

characterization characterization of of several several sorting sorting motifs, motifs, which which are are found found on on the the cytosolic cytosolic domain domain of of

Lehrman Lehrman et et al., al., 1985a; 1985a; Lehrman Lehrman et et al., al., 1985b). 1985b). This This seminal seminal work work led led to to the the

CCV CCV s s and and internalization internalization of of the the protein protein from from the the cell cell surface surface (Davis (Davis et et al., al., 1987; 1987;

tyrosine tyrosine residue residue on on the the cytosolic cytosolic domain domain of of the the LDLR LDLR was was required required for for incorporation incorporation into into

(Anderson (Anderson et et al., al., 1977; 1977; Brown Brown and and Goldstein, Goldstein, 1975) 1975) and and led led to to the the discovery discovery that that a a

for for internalization internalization of of LDL LDL by by clathrin-mediated clathrin-mediated endocytosis endocytosis from from the the cell cell membrane membrane

by by the the Brown Brown and and Goldstein Goldstein laboratory. laboratory. These These studies studies identified identified the the LDLR LDLR as as essential essential

identified identified on on the the low-density-lipoprotein low-density-lipoprotein receptor receptor (LDLR) (LDLR) in in a a series series of of classical classical studies studies

The The presence presence of of sorting sorting signals signals on on the the cytosolic cytosolic domain domain of of membrane membrane proteins proteins was was first first

Sorting Sorting motifs motifs and and adaptor adaptor proteins proteins

(Bonifacino (Bonifacino and and Traub, Traub, 2003). 2003).

vesicular vesicular trafficking trafficking machinery machinery that that direct direct sorting sorting to to specific specific subcellular subcellular compartments compartments

These These sorting sorting signals signals act act as as "address "address tags," tags," which which are are recognized recognized by by components components of of the the

canonical canonical sorting sorting motifs within within motifs the the cytosolic cytosolic domains domains of of itinerant itinerant membrane membrane proteins. proteins.

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction

clathrin clathrin clathrin ~~ AP-1 AP-2 AP-3 AP-4

Figure 5. Schematic diagram of the APs. Adaptor complexes are composed of the four indicated subunits. The ~-tl-4 subunits bind to tyrosine-based motifs, and the BI-3 subunits bind to dileucine motifs. The Bsubunits of AP-1-3 bind to clathrin, but it is not known if AP-4 binds clathrin. identified as assembly polypeptides (also APs ), which could induce in vitro formation of clathrin coats (Zaremba and Keen, 1983), adaptor complexes connect clathrin to sorting signals in the cytosolic domains of several membrane proteins, including the CI- and CD-

MPRs and furin, thereby promoting their concentration into clathrin-coated pits

(Robinson, 2004). Adaptor complex-induced formation of vesicles from clathrin-coated pits requires membrane fission, which is mediated by the GTPase at the plasma membrane and a dynamin homologue, dynamin 2, at the TGN and endosomes (Cao et al.,

2000; van Dam and Stoorvogel, 2002a).

All the adaptor complexes are highly homologous, and are composed of four subunits, which form a "mickey mouse"-like structure, with a core domain and two appendage or

"ear" domains connected to the core domain by two unstructured hinge regions (Figure 5;

Heuser and Keen, 1988; Collins et al., 2002). The cQre domains bind to ARF-GTP, phosphoinositides and cargo proteins; the hinge regions contain a clathrin-box sequence and bind to clathrin and the appendage domains bind to accessory proteins. AP-1

(subunits: y, ~1, fl1 and o1), which is localized mainly at the TGN, mediates sorting of

19

20 20

unclear. unclear. The The subunit subunit is is predicted predicted a a to to play play a a structural structural role role by by stabilizing stabilizing the the tetrameric tetrameric

1998). 1998). Whether Whether or or not not the the subunit subunit binds binds to to ~4 ~4 clathrin clathrin or or dileucine dileucine motifs motifs remains remains

respectively respectively (Hirst (Hirst et et al., al., 1999; 1999; Ohno Ohno et et al., al., 1995; 1995; Ohno Ohno et et al., al., 1998; 1998; Rapoport Rapoport et et al., al.,

[D/E]XXXL[L/1] [D/E]XXXL[L/1] and and Yxx Yxx motifs motifs in in the the cytosolic cytosolic domain domain of of the the cargo cargo proteins, proteins,

al., al., 1998; 1998; Gallusser Gallusser and and Kirchhausen, Kirchhausen, 1993), 1993), whereas whereas the the and and subunits subunits ~1-3 ~1-3 bind bind to to ~-t1-4 ~-t1-4

bind bind directly directly to to clathrin clathrin via via a a clathrin clathrin box box sequence sequence on on their their subunits subunits (Dell'Angelica (Dell'Angelica ~ ~ et et

membrane membrane in in polarized polarized cells cells (Simmen (Simmen et et al., al., 2002). 2002). The The AP-1, AP-1, AP-2 AP-2 and and AP-3 AP-3 complexes complexes

to to the the TGN TGN and and endosomes, endosomes, mediates mediates the the sorting sorting of of membrane membrane proteins proteins to to basolateral basolateral

patients patients (Dell'Angelica (Dell'Angelica et et al., al., 1999). 1999). AP-4 AP-4 (subunits: (subunits: and and a4), a4), which which is is ~4, ~4, localized localized ~-t4 ~-t4 E, E,

lysosomal lysosomal organelles, organelles, including including melanosomes, melanosomes, which which leads leads to to albinism albinism in in some some HPS HPS

lead lead to to Hermansky-Pudlak Hermansky-Pudlak syndrome syndrome (HPS), (HPS), a a rare rare disorder disorder characterized characterized by by defective defective

lysosomes lysosomes and and melanosomes melanosomes (Peden (Peden et et al., al., 2004). 2004). Mutations Mutations of of the the subunit subunit of of AP-3 AP-3 ~ ~

is is localized localized to to the the TGN TGN and and endosomes endosomes and and mediates mediates sorting sorting of of membrane membrane proteins proteins to to the the

concentrated concentrated on on the the inner inner leaflet leaflet of of the the cell cell membrane. membrane. AP-3 AP-3 (subunits: (subunits: 6, 6, and and a3) a3) ~3, ~3, ~-t3 ~-t3

binds binds to to phosphatidylinositol-4,5-phosphate phosphatidylinositol-4,5-phosphate (Ptdlns(4,5)P; (Ptdlns(4,5)P; Rohde Rohde et et al., al., 2002), 2002), which which is is

prominent prominent role role in in clathrin-mediated clathrin-mediated endocytosis endocytosis of of cell-surface-receptors. cell-surface-receptors. This This complex complex

(subunits: (subunits: and and a2), a2), a, a, which which ~2, ~2, is is ~-t2 ~-t2 localized localized to to the the plasma plasma membrane, membrane, plays plays a a

surface surface from from the the TGN TGN and and endosomes endosomes (Anderson (Anderson et et al., al., 2005; 2005; Feolsch Feolsch et et al., al., 1999). 1999). AP-2 AP-2

1 1 ), ), an an epithelial-cell-specific· epithelial-cell-specific· a a isoform isoform of of AP-I, AP-I, directs directs transport transport to to the the basolateral basolateral

AP-1 AP-1 localization localization at at the the TGN TGN (Heldwein (Heldwein et et al., al., 2004). 2004). AP-1B AP-1B (subunits: (subunits: y, y, and and ~1, ~1, ~-tlB ~-tlB

Golgi Golgi membrane membrane (Wang (Wang et et al., al., 2003), 2003), and and mutations mutations that that disrupt disrupt this this interaction interaction block block

endosomes. endosomes. This This complex complex binds binds to to phosphatidylinositol-4-phosphate phosphatidylinositol-4-phosphate (Ptdlns(4)P) (Ptdlns(4)P) on on the the

membrane membrane proteins proteins in in both both anterograde anterograde and and retrograde retrograde pathways pathways between between the the TGN TGN and and

Chapter Chapter Introduction Introduction I. I. Chapter 1. Introduction

Autoregulatory Domain Arf-GTP GGA3 .•. pS3aeWLDEELL ...

Cargo Binding Clathrin Rabaptin5 CI-MPR ... V2479SFHDDSDEDLLHI Sortllln ... S819GYHDDSDEDLLE

Figure 6. Diagram of GGA3 showing domain organization and protein interactions. The VHS (Vps27, Hrs, Starn) domain binds to cargo proteins, the GAT (GGA and TOM) domain binds to ARF-GTP and Rabaptin5, the hinge segment binds to clathrin and contains the autoregulatory acidic-dileucine motif and

Ser388 , and the GAE (y-adaptin ear) domain also binds to Rabaptin5, as well as several other accessory proteins. The domain organization of GGAl and GGA2 is highly similar to that of GGA3. complex (Collins et al., 2002a). The crystal structures of the AP-I and AP-2 core domains suggest these molecules occupy active and inactive states. In the inactive state, the tyrosine-binding module of the I-t subunit is masked, and must be exposed, possibly by a phosphorylation event that results in a conformational change (Ghosh and Kornfeld,

2003b), before the adaptor complex can bind cargo. Together these adaptor complexes and coat proteins orchestrate intracellular transport of many membrane proteins in the

TGN/endosomal system.

Acidic-dileucine motifs and the GGAs

Acidic-dileucine motifs (D/ExxLL) are found on the cytosolic domains of several itinerant membrane proteins, including the CI- and CD-MPRs, sortiliq, ~-secretase

(BACE), vesicle associated membrane protein 4 (VAMP4) and sorting protein related receptor (SorLA), which all cycle between the TGN and endosomes. The function of these motifs arises from an interaction with the GGA proteins 1-3 (Figure 6; Doray et al.,

2002 Kakhlon et al., 2006; Nielsen et al., 2001; Wahle et al., 2005; Zhu et al., 2001).

21

22 22

(Figure (Figure 6; 6; Miller Miller et et al., al., 2003; 2003; Misra Misra et et al., al., 2002; 2002; Suer Suer et et al., al., 2003). 2003). The The VHS VHS (Vps26 (Vps26

structured structured domains, domains, as as well well as, as, one one unstructured unstructured "hinge" "hinge" between between the the latter latter two two domains domains

The The structures structures of of all all three three GGAs GGAs are are similar; similar; they they contain contain the the VHS, VHS, GAT GAT and and GAE GAE

control control the the cargo cargo binding binding ability ability of of the the GGAs. GGAs.

dephosphorylation dephosphorylation by by PP2A PP2A activates activates binding binding to to the the CI-MPR. CI-MPR. Thus Thus CK2 CK2 and and PP2A PP2A

autoregulatory autoregulatory domains, domains, respectively, respectively, inhibits inhibits binding binding to to the the CI-MPR, CI-MPR, whereas whereas

3 5 5 5 388 388 et et al., al., 2002b). 2002b). Phosphorylation Phosphorylation of of Ser or or Ser within within the the GGAl GGAl or or GGA3 GGA3

to to the the CI-MPR CI-MPR is is regulated regulated by by CK2 CK2 phosphorylation phosphorylation of of an an autoregulatory autoregulatory domain domain (Doray (Doray

phosphorylation phosphorylation of of the the CD-MPR CD-MPR (Stockli (Stockli et et al., al., 2004). 2004). In In addition, addition, GGAl GGAl and and 3 3 binding binding

dileucine dileucine motifs motifs enhances enhances GGA GGA binding binding (Kato (Kato et et al., al., 2002), 2002), though though this this is is not not true true for for

2001 2001 b). b). Phosphorylation Phosphorylation of of serine serine residues residues within within the the CI- MPR MPR and and sortilin sortilin acidic-

TGN, TGN, thus thus activating activating anterograde anterograde trafficking trafficking to to early early endosomes endosomes (Puertollano (Puertollano et et al., al.,

dependent dependent manner manner and and function function to to sort sort the the CI-MPR CI-MPR into into clathrin-coated clathrin-coated vesicles vesicles at at the the

GGAs GGAs are are monomeric monomeric clathrin clathrin adaptors adaptors that that bind bind to to membranes membranes in in an an ARF-GTP-

the the process . . GGAl , , but but not not GGA2, GGA2, undergoes undergoes the the same same regulatory regulatory mechanism mechanism (Doray (Doray et et al. , , 2002b) . .

of of GGA3 GGA3 binds binds to to the the 388 388 VHS VHS domain, domain, precluding precluding cargo cargo binding . . PP2A PP2A dephosphorylation dephosphorylation of of Ser rever s e s s

388

However, However, upon upon CK2 CK2 phosphorylation phosphorylation of of Ser

the the autoinhibitory autoinhibitory acidic-dileucine acidic-dileucine motif motif in in the the hinge hinge , , region region

388 388

MPR. MPR. When When Ser is is not not phosphorylated, phosphorylated, the the CI-MPR CI-MPR can can interact interact with with the the cargo-binding cargo-binding VHS VHS domain . .

388 388 Figure Figure Model Model 7. 7. of of GGA3 GGA3 activation. activation. CK2 CK2 phosphorylation phosphorylation of of Ser inhibits inhibits GGA3 GGA3 binding binding to to the the CI­

......

PP2A PP2A

T T

~ ~

GGA3 GGA3 ~ ~

CK2 CK2

Active Active Inactive Inactive

INHIBITS INHIBITS CK2 CK2 GGA3 GGA3

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction

(Vacuolar protein sorting 26), Hrs (Hepatocyte-growth-factor-receptor substrate) and

ST AM (signal-transducing adaptor molecule)) domain binds to acidic dileucine motifs on the cytosolic domains of cargo proteins and is named for its homology to these other proteins involved in endocytic trafficking. The GAT (GGA and TOM (target of MyolB)) domain is found in all three GGAs and is homologous to TOM. The GAT domain binds to Rabaptin5 (Mattera et al., 2003) and to the GTP-, but not GDP-bound forms of ARFI and ARF3-the latter interaction is required for GGAs to bind membranes, localization of GGAs to the TGN, and correct sorting of lysosomal hydrolases (Dell'Angelica et al.,

2000; Puertollano et al., 2001b). The GGA hinge regions bind to clathrin (Puertollano et al., 2001b), and the GGAI and GGA3 hinges contains the above-mentioned autoregulatory acidic-dileucine motif. The GAE (y-adaptin ear) domain carries limited homology with the AP-1-y subunit ear domain, and interacts with several accessory proteins including Rabaptin-5 (the GGA-rabaptin5 interaction is bipartite) and enthoprotin/EpsinR (Saint-Pol et al., 2004). EpsinR binds to Ptdlns(4)P at the TGN (Hirst et al., 2003), which may help to specify GGA binding to TGN membranes. The discovery of several GAE binding proteins allowed identification of a GAE binding motif

(DFGXQ>, where X is any amino acid and <1> is a bulky hydrophobic residue; Nogi et al.,

2002), which was confirmed by the crystallization of Rabaptin5 with the GAE domain

(Miller et al., 2003).

While the GGAs were originally proposed to direct sorting exclusively at the TGN

(Boman et al., 2000; Dell'Angelica et al., 2000; Hirst et al., 2000; Poussu et al., 2000;

Takatsu et al., 2000), newer evidence suggests GGAs play a significant role in the

23

24 24

of of Rabaptin5. Rabaptin5. Alternatively, Alternatively, multiple multiple pools pools of of GGA3 GGA3 may may function function for for both both anterograde anterograde

until until retrograde retrograde transport transport of of the the receptor receptor is is initiated, initiated, an an event event inhibited inhibited by by overexpression overexpression

on on vesicles vesicles or or tubules tubules destined destined for for the the early early endosomes, endosomes, and and remains remains with with the the CI-MPR CI-MPR

MPR. MPR. Together, Together, these these findings findings suggest suggest that that a a small small population population of of GGA3 GGA3 leaves leaves the the TGN TGN

to to clathrin-preventing clathrin-preventing GGA3 GGA3 from from initiating initiating vesicular vesicular transport transport of of the the endosomal endosomal CI­

endosome endosome membranes. membranes. In In addition, addition, they they found found that that Rabaptin5 Rabaptin5 precludes precludes GGA3 GGA3 binding binding

causes causes endogenous endogenous GGAl GGAl and and CI-MPR CI-MPR to to redistribute redistribute from from the the TGN TGN to to enlarged enlarged early early

normally normally detected detected only only at at the the TGN, TGN, they they showed showed that that overexpression overexpression of of Rabaptin Rabaptin 5 5

GGA-Rabaptin5 GGA-Rabaptin5 interaction interaction to to fuse fuse with with early early endosomes. endosomes. While While endogenous endogenous GGAI GGAI is is

endosome endosome fusion. fusion. The The authors authors proposed proposed that that vesicles vesicles or or tubules tubules leaving leaving the the TGN TGN use use the the

recruits recruits the the Rab5 Rab5 GEF GEF Rabex5 Rabex5 to to early early endosome endosome membranes, membranes, thereby thereby leading leading to to

Rab4/5 Rab4/5 effector effector Rabaptin5 Rabaptin5 (Mattera (Mattera et et al., al., 2003). 2003). Rabaptin5 Rabaptin5 stabilizes stabilizes Rab5-GTP Rab5-GTP and and

of of GGAs, GGAs, Mattera Mattera and and coworkers coworkers reported reported the the interaction interaction of of all all three three GGAs GGAs with with the the

mature mature secretory secretory granules granules (Kakhlon (Kakhlon et et al., al., 2006). 2006). Further Further supporting supporting the the endosomal endosomal role role

early early endosomes endosomes (Puertollano (Puertollano and and Bonifacino, Bonifacino, 2004) 2004) and and accumulation accumulation of of VAMP4 VAMP4 in in

accumulation accumulation of of the the CI-MPR CI-MPR and and internalized internalized epidermal epidermal growth growth factor factor (EGF) (EGF) within within

electron electron microscopy microscopy (Ghosh (Ghosh et et al., al., 2003b). 2003b). GGA3 GGA3 depletion depletion by by siRNA siRNA causes causes

and and Bonifacino, Bonifacino, 2004), 2004), and and endogenous endogenous GGA3 GGA3 can can be be detected detected on on the the early early endosome endosome by by

and and immature immature secretory secretory granules granules when when overexpressed overexpressed (Kakhlon (Kakhlon et et al., al., 2006; 2006; Puertollano Puertollano

function function at at multiple multiple membrane membrane compartments. compartments. GGA3 GGA3 associates associates with with early early endosomes endosomes

immature immature secretory secretory granules granules (Kakhlon (Kakhlon et et al., al., 2006). 2006). In In particular, particular, GGA3 GGA3 is is suspected suspected to to

2003) 2003) and and (Wahle (Wahle ~-secretase ~-secretase et et al., al., 2005), 2005), as as well well as as removal removal of of VAMP4 VAMP4 from from

endosomal endosomal sorting sorting of of the the CI-MPR CI-MPR (Puertollano (Puertollano and and Bonifacino, Bonifacino, 2004; 2004; Mattera Mattera et et al., al.,

Chapter Chapter 1. 1. Introduction Introduction Chapter I. Introduction and retrograde CI-MPR transport: one pool travels on vesicle bound for the endosomes and interacts with Rabaptin5 for endosome fusion, and another pool is recruited to the early endosomes by Rabaptin5 and is required for a sorting step that occurs before the CI­

MPR can initiate retrograde transport to the TGN. In Chapter 3, I present evidence that

PACS-1 and GGA3 form a complex to regulate endosome-to-TON sorting of the CI­

MPR.

Acidic cluster motifs and PACS-1

Frequently, acidic-dileucine motifs are found near sorting motifs represented by clusters of acidic residues, which often contain serine or threonine residues that can be phosphorylated by CK2 or, less frequently, protein kinase CK1 (CK1; Bonifacino and

Traub, 2003; Gu et al., 2001; Thomas 2002). Membrane proteins that contain acidic sorting motifs include processing enzymes such as furin (Jones et al., 1995), protein convertase 6B (PC6B; Xiang et al., 2000) and carboxypeptidase D (CPD; Kalinina et al.,

2002); receptors such as the CI- and CD-MPRs (Chen et al., 1997); transporters such as vesicular monoamine transporter 2 (VMAT2; Waites et al., 2001); SNAREs, including

VAMP-4 (Zeng et al., 2003); a number of pathogen-derived molecules, including the envelope glycoproteins of many herpes viruses such as varicella-zoster virus gE (VZV­ gE; Alconada et al., 1999) and human cytomegalovirus gB (HCMV gB; Norais et al.,

1996), as well as human immunodeficiency virus type 1 (HIV-1) negative factor (Nef;

Piguet et al., 2000). Perhaps the best studied of these acidic cluster motifs is the one present in the cytosolic domain of furin (Thomas 2002). The phosphorylation state of a serine residue within the furin acidic cluster controls in large part the dynamic sorting

25

26 26

identified identified P P ACS-1 ACS-1 a a (hereafter (hereafter P P ACS-1 ACS-1 ), ), through through its its preferential preferential interaction interaction with with the the

family family of of proteins: proteins: PACS-1a, PACS-1a, PACS-1b PACS-1b and and PACS-2 PACS-2 (see (see Figure Figure 4). 4). The The Thomas Thomas lab lab

Acidic Acidic cluster cluster motifs motifs derive derive their their function function by by interacting interacting with with the the members members of of the the PACS PACS

the the complex, complex, acidic acidic cluster-mediated cluster-mediated trafficking trafficking of of furin. furin.

Maxfield, Maxfield, 1999) 1999) intermediate. intermediate. Thus, Thus, the the coordinated coordinated activities activities of of CK2 CK2 and and PP2A PP2A control control

endosomes endosomes to to the the TGN TGN (Molloy (Molloy et et al., al., 1998), 1998), apparently apparently via via a a late late endosome endosome (Mallet (Mallet and and

of of protein protein phosphatase phosphatase 2A 2A (PP2A) (PP2A) allows allows transport transport of of furin furin from from sorting/recycling sorting/recycling

al., al., 1997). 1997). By By contrast, contrast, dephosphorylation dephosphorylation of of the the furin furin acidic acidic cluster cluster by by specific specific isoforms isoforms

and, and, in in neuroendocrine neuroendocrine cells, cells, removal removal of of furin furin from from immature immature secretory secretory granules granules (Dittie (Dittie et et

1995), 1995), recycling recycling of of furin furin from from early early endosomes endosomes to to the the cell cell surface surface (Molloy (Molloy et et al., al., 1998) 1998)

itinerary itinerary of of the the endoprotease, endoprotease, including including the the localization localization of of furin furin to to the the TGN TGN (Jones (Jones et et al., al.,

1 1 and and P P ACS- 2 2 proteins proteins are are 81% 81% identical identical the the at amino amino acid acid level. level.

separate separate gene gene to to PACS-1, PACS-1, and and is is 54% 54% identical identical to to PACS-1. PACS-1. The The cargo-binding cargo-binding (FBR) (FBR) regions regions of of PACS-

variants variants and and are are 100% 100% identical identical except except for for a a short short C-terminal C-terminal region. region. PACS-2 PACS-2 protein protein is is encoded encoded from from a a

the the C-terminal C-terminal region region (CTR). (CTR). (B) (B) Diagram Diagram of of human human PACS PACS proteins. proteins. PACS-1 PACS-1 and and PACS-1 PACS-1 b b are are splice splice

region region (MR), (MR), 278 278 which which contains contains the the autoregulatory autoregulatory acidic acidic cluster cluster and and Ser (described (described in in Chapter Chapter 2), 2), and and

complexes complexes and and GGA3 GGA3 (Crumpet (Crumpet al., al., 2001a; 2001a; Wan Wan et et al., al., 1998; 1998; and and described described in in Chapter Chapter 3), 3), the the middle middle

related related region region (ARR), (ARR), cargo cargo binding binding region region (FBR), (FBR), which which interacts interacts with with cargo, cargo, AP-11 AP-11 AP-3 AP-3 adaptor adaptor

Figure Figure Schematic Schematic 8. 8. diagram diagram of of PACS-1 PACS-1 proteins. proteins. (A) (A) Diagram Diagram of of PACS-1 PACS-1 showing showing the the atropin-1-

PACS-2 PACS-2

PACS-1b PACS-1b

1 1

PACS-1 PACS-1 • • IRA ® '-'. '-'. P"ftP'O P"ftP'O

963 963

B B

HIV-1 HIV-1 Nef Nef ••• ••• (41EEEEVG (41EEEEVG ••• •••

68 Furln Furln (q ...... EECPSDSEEDEGRG EECPSDSEEDEGRG ••• •••

247 CI-MPR CI-MPR ••• ••• V gSFHDDSDEDLLHI gSFHDDSDEDLLHI

Binding Binding

Cargo Cargo Binding Binding

AP-1, AP-1, AP-3 AP-3

PACS-1 PACS-1 ; ; ..! ..! IRA IRA -w -w ''' ''' ...... ' § §

binding binding

A A GGA3 GGA3

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction

P ACS-1 cargo proteins

Protein Acidic cluster sequence Other sorting motifs Proteases

Furina ... Q768EECPSDSEEDEGRG ...

PC6Bc ... D1830RDYDEDDEDD ...

CPDct ... S 1359HEFQDETDTEEET Receptors

CI-MPRa ... H2489DDSDEDLLHI Snares

VAMP4j ... E27DDSDEEED ... LLk Viral Proteins HCMVgB1 ... L KDSDEEENV .. . 897 ym VZV gEa ... F590EDSESTDTEEF .. . 0 HIV-1 Nefl ... Q61 EEEEVG ... LL Channels

PKD-2P ... D810DSEEDDDEDS ...

Nephrocystin q . . E. 116EEEESESEDSEDSGG .. . TRPV4P ... LTHKKRLTDEEFREP .. . CLC-7P . .. SKKVSWSGRDRDDEE .. . Transporters

VMAT-2r ... E593DEESESD ... Table 1. List of published PACS-1 cargo proteins. Reported PACS-1 cargo proteins are shown with their acidic cluster motifs. Serine or threonine residues phosphorylated by CK2 and important for PACS-1 binding are shown in bold. Additional tyrosine (Y), dileucine (LL) or acidic-dileucine (AC-LL) sorting motifs are indicated. The references for these findigs are: awan et al., 1998, bVoorhees et al., 1995, cxiang et al., 2000, dKalinina et al., 2002b, eLobel et al., 1989, rchen et al., 1997a, £Puertollano et al., 2001a, iNielsen et al., 2001, jVAMP4, Hinners et al., 2003, kzeng et al., 2003, 1Crump et al., 2003, molson and Grose, 1997, "Piguet et al., 2000, 0 Greenberg et al., 1998, PKottgen et al., 2005, qSchermer et al., 2005, Waites et al., 2001. phosphorylated acidic cluster on the cytosolic domain of furin (Molloy et al., 1998).

P ACS-1 connects furin to the cytosolic coat protein AP-1, and is required for the correct subcellular localization of furin to the TGN (Crumpet al., 2001). PACS-1 also binds to - acidic clusters within the cytosolic domains of several other cellular proteins (see Table

1). Interfering mutant-, siRNA- and antisense- based studies have shown that PACS-1 is required for the TGN localization of these molecules from an endosome compartment.

PACS-1 binding to HIV -1 Nef is required for the ability of this viral protein to

27

28 28

is is required required for for efficient efficient apoptosis apoptosis and and ER ER homeostasis homeostasis (Simmen (Simmen et et al., al., 2005). 2005). Together, Together,

the the PACS PACS family family members members can can cooperate cooperate to to control control protein protein sorting. sorting. In In addition, addition, PACS-2 PACS-2

1 1 and and PACS-2 PACS-2 mis-localizes mis-localizes polycystin-2 polycystin-2 to to the the plasma plasma membrane, membrane, demonstrating demonstrating that that

toPACS-2 toPACS-2 mislocalizes mislocalizes polycystin-2 polycystin-2 to to the the TGN, TGN, and and blocking blocking the the binding binding to to both both PACS-

steady-state steady-state localization localization of of polycystin-2 polycystin-2 is is at at the the ER. ER. However, However, blocking blocking binding binding

terminal terminal domain, domain, which which binds binds to to PACS-1 PACS-1 and and PACS-2 PACS-2 (Kottgen (Kottgen et et al., al., 2005). 2005). The The normal normal

(PKD-2) (PKD-2) is is regulated regulated by by the the phosphorylation phosphorylation state state of of an an acidic acidic cluster cluster in in the the carboxy­

subcellular localization localization subcellular and and function function of of the the ER-localized ER-localized TRP TRP channel channel polycystin-2 polycystin-2

and and functions functions in in Golgi-to-ER Golgi-to-ER transport transport (Kottgen (Kottgen et et al., al., 2005). 2005). For For example, example, the the

cargo cargo proteins proteins (Simmen (Simmen et et al., al., 2005). 2005). However, However, PACS-2 PACS-2 connects connects cargo cargo proteins proteins to to COPI COPI

Like Like P P ACS-1, ACS-1, P P ACS- 2 2 binds binds to to acidic acidic cluster cluster motifs motifs on on the the cytosolic cytosolic domains domains of of itinerant itinerant

function function to to regulate regulate P P ACS-1 ACS-1 FBR FBR binding binding to to cargo cargo proteins. proteins.

C-terminal C-terminal region region (CTR). (CTR). This This thesis thesis examines examines how how the the predicted predicted domains domains of of PACS-1 PACS-1

sorting sorting

motifs motifs on on many many membrane membrane cargo cargo proteins proteins that that bind bind to to the the PACS-1 PACS-1 FBR; FBR; and and the the

278 (MR), (MR), which which contains contains an an acidic acidic cluster, cluster, -S EEEEE-, EEEEE-, that that is is similar similar to to the the acidic acidic cluster cluster

1/AP-3 1/AP-3 adaptor adaptor complexes complexes (Crumpet (Crumpet al., al., 2001; 2001; Wan Wan et et al., al., 1998); 1998); the the middle middle region region

protein protein Atropin-1; Atropin-1; the the cargo cargo binding binding region region (FBR), (FBR), which which interacts interacts with with cargo cargo and and AP-

Figure Figure 8): 8): the the Atropin-1-relatea Atropin-1-relatea region region (ARR), (ARR), which which bears bears homology homology to to the the nuclear nuclear

be be rescued rescued by by PACS-1b PACS-1b (Piguet (Piguet et et al., al., 2000). 2000). PACS-1 PACS-1 is is divided divided into into four four regions regions (see (see

antisense antisense strategy strategy disrupts disrupts the the ability ability of of Nef Nef to to downregulate downregulate MHC-1, MHC-1, a a function function that that can can

(Blagoveshchenskaya (Blagoveshchenskaya et et al., al., 2002; 2002; Piguet Piguet et et al., al., 2000). 2000). Depletion Depletion of of PACS-1 PACS-1 using using an an

downregulate downregulate cell-surface cell-surface major major histocompatibility histocompatibility class-1 class-1 (MHC-1) (MHC-1) complexes complexes

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction the PACS family members link protein trafficking to control of cellular homeostasis and disease.

Tip47 and the Retromer complex

In addition, two other sorting molecules are relevant for this thesis: TIP47 and the

Retromer complex. Similar to PACS-1, TIP47 and the Retromer complex also direct retrograde transport of CI-MPR from endosomes to the TGN (Diaz and Pfeffer, 1998;

Seaman et al., 1998). The retromer complex was first identified in yeast (Seaman et al.,

1998), and is now known to localize to tubular-vesicular profiles emanating from either early endosomes or from intermediates in the maturation of early endosomes to late endosomes in mammalian cells (Arighi et al., 2004). Retromer consists of five subunits: vacuolar protein sorting (Vps)-35, Vps29, Vps26, SNX1 and SNX2. From endosomal compartments, Vps35 binds to an unknown motif on the CI-MPR, mediating recycling of

CI-MPR to the TGN (Arighi et al., 2004; Seaman, 2004). Recruitment of retromer to endosomal membranes requires SNX1 and 2, which each contain a PX domain that binds

Ptdlns(3)P (Cozier et al., 2002), and a BAR domain, which senses membrane curvature

(Peter et al., 2004). SNX1 forms multimers, which, in combination with the BAR domain, may cause membrane curvature and tubulation (Carlton et al., 2004). Like retromer, TIP47 also directs transport ofMPRs from endosomes to the TGN. TIP47links a diaromatic amino acid motif in the cytosolic domain of the CI- and CD-MPRs (FW) and HIV-gp160 (YW) to the late endosome localized GTPase Rab9, thus concentrating these molecules at the late endosomes and mediating TGN transport (Blot et al., 2003;

Carroll et al., 2001; Diaz and Pfeffer, 1998). Depletion ofTIP47 results in a reduction of

29

30 30

sorting sorting step step needs needs to to occur. occur. Perhaps Perhaps localized localized differences differences in in membrane membrane identity identity direct direct

sorting sorting proteins. proteins. Most Most likely, likely, the the cell cell utilizes utilizes different different sorting motifs motifs sorting depending depending on on which which

trafficking trafficking itinerary, itinerary, and and has has led led some some to to discount discount the the individual individual importance importance of of these these

confusion confusion in in the the literature literature regarding regarding which which sorting sorting molecule molecule is is responsible responsible for for which which

to to adaptor adaptor proteins, proteins, GGAs, GGAs, PACS-1, PACS-1, TIP47 TIP47 and and the the retromer retromer complex. complex. This This has has produced produced

presence presence of of multiple multiple sorting sorting motifs motifs on on the the cytosolic cytosolic domain domain of of the the CI-MPR, CI-MPR, which which binds binds

The The complicated complicated nature nature of of sorting sorting motifs motifs and and protein protein trafficking trafficking is is illustrated illustrated by by the the

later later endosomal endosomal compartments. compartments.

vesicle. vesicle. Together, Together, TIP47 TIP47 and and Retromer Retromer function function to to recycle recycle the the MPRs MPRs to to the the TGN TGN from from

raising raising the the intriguing intriguing possibility possibility that that TIP47 somehow somehow TIP47 senses senses the the curvature curvature of of a a budding budding

structure structure shows shows this this molecule molecule curved curved around around a a lipid lipid droplet droplet (Hickenbottom (Hickenbottom et et al., al., 2004), 2004),

endosome-to- TGN TGN transport-most transport-most likely, likely, TIP47 TIP47 functions functions in in both both roles. roles. The The TIP47 TIP47

and and Schu, Schu, 2003). 2003). However, However, a a negative negative result result does does not not prove prove TIP47 TIP47 has has no no function function in in

showing showing that that siRNA siRNA depletion depletion of of TIP47 TIP47 has has no no effect effect on on CI-MPR CI-MPR transport transport (Medigeshi (Medigeshi

2004). 2004). Some Some have have suggested suggested TIP47 TIP47 may may not not effect effect CI-MPR CI-MPR function, function, based based on on a a report report

structure structure of of TIP47 TIP47 was was solved solved bound bound to to a a neutral neutral lipid lipid droplet droplet (Hickenbottom (Hickenbottom et et al., al.,

lipid lipid droplets droplets (Miura (Miura et et al., al., 2002; 2002; Wolins Wolins et et al., al., 2001; 2001; Wolins Wolins et et al., al., 2005), 2005), and and the the

controversial. controversial. Several Several reports reports found found that that TIP4 TIP4 7 7 functions functions in in the the storage storage of of intracellular intracellular

2003). 2003). Despite Despite these these findings, findings, the the role role of of TIP47 TIP47 for for endosomal endosomal transport transport is is quite quite

mutant mutant blocks blocks gp160 gp160 transport transport to to the the TGN TGN and and reduces reduces HIV HIV virion virion production production (Blot (Blot et et al., al.,

destroyed destroyed in in lysosomes lysosomes (Diaz (Diaz and and Pfeffer, Pfeffer, 1998). 1998). Also, Also, expression expression of of a a TIP47 TIP47 interfering interfering

CI-MPR CI-MPR half-life, half-life, presumably presumably because because the the receptor receptor fails fails to to recycle recycle to to the the TGN TGN and and gets gets

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction

Groove

Figure 9. Ribbon diagram of the CK2 holoenzyme. The regulatory f3 subunits (blue and red) interact with each other and with both catalytic a subunits (yellow and grey). The catalytic core and the acidic groove of the regulatory subunit are indicated. One theory of CK2 activation is that basic compounds such as polyamines, or proteins with clusters of basic residues, such as FGF-2 interact with the acidic groove of the regulatory subunit, causing a conformational change that increases the enzymatic activity of the catalytic subunit. In Chapter 3, I describe a cluster of basic residues on PACS-1 that is required to bind and activate CK2. The ribbon diagram is from Niefind et al., 2001. different sorting proteins to the CI-MPR to direct transport. Alternatively, phosphorylation can control which sorting proteins can bind to an itinerant protein. For

instance, phosphorylation of Ser2484 on the CI-MPR cytosolic domain enhances binding to

GGAs or PACS-1 (Kato et al., 2002 and Chapter 3) and CK2 phosphorylation of serine residues within the GGA3 and PACS-1 autoregulatory domains controls their ability to bind to cargo proteins (Doray et al., 2002 and Chapter 2). A central player in these phosphorylation events is protein kinase CK2.

Protein kinase CK2

Acidic and acidic-dileucine motifs often contain a serine or threonine residue that can be phosphorylated by protein kinase CK2 (CK2). CK2 is a ubiquitous protein kinase with more than 300 putative polypeptide substrates and is a heterotetramer composed of two catalytic subunits (aa, aa', or a'a') and two regulatory~ subunits (Pinna, 2002). The

31

32 32

(Bonnet (Bonnet et et al., al., 1996), 1996), and and correlates correlates with with an an enhancement enhancement of of DNA DNA synthesis synthesis (Skjerpen (Skjerpen et et

1997). 1997). For For instance, instance, FGF-2 FGF-2 binding binding to to stimulates stimulates kinase kinase CK2~ CK2~ activity activity for for nucleolin nucleolin

an an acidic acidic groove groove on on the the regulatory regulatory subunit subunit increases increases kinase kinase ~ ~ activity activity 3-fold 3-fold (Leroy (Leroy et et al., al.,

huge huge increase increase in in kinase kinase activity. activity. However, However, binding binding of of polyamines polyamines or or substrate substrate proteins proteins to to

regulation regulation of of CK2 CK2 has has long long remained remained enigmatic. enigmatic. No No known known CK2 CK2 stimulator stimulator produces produces a a

Despite Despite being being the the first first kinase kinase activity activity observed observed (Burnett (Burnett and and Kennedy, Kennedy, 1954), 1954), the the

the the activity activity of of the the trafficking trafficking machinery. machinery.

TGN/endosomal TGN/endosomal system system by by controlling controlling the the phosphorylation phosphorylation of of cargo cargo proteins, proteins, as as well well as as

lacking. lacking. Regardless, Regardless, CK2 CK2 and and PP2A PP2A function function as as master master regulators regulators of of protein protein traffic traffic in in the the

studies studies to to determine determine the the relative relative expression expression of of these two two these enzymes enzymes in in different different tissues tissues are are

PP2A PP2A is is controlled controlled by by upstream upstream regulators regulators remains remains unknown. unknown. Additionally, Additionally, comparative comparative

in in cells cells (Heriche (Heriche et et al., al., 1997). 1997). Unfortunately, Unfortunately, whether whether or or not not the the activity activity of of CK2 CK2 and and

CK2 CK2 and and PP2A PP2A is is evidenced evidenced by by the the observation observation that that these these enzymes enzymes can can form form a a complex complex

ubiquitous ubiquitous phosphatase phosphatase found found in in all all cells cells (Sontag, (Sontag, 2001). 2001). The The dynamic dynamic interplay interplay between between

phosphorylated phosphorylated by by CK2 CK2 are are often often dephosphorylated dephosphorylated by by protein protein phosphatase phosphatase 2A, 2A, a a

subunits subunits is is lethal lethal (Padmanabha (Padmanabha et et al., al., 1990). 1990). Serine Serine or or threonine threonine residues residues that that are are

(Buchou (Buchou et et al., al., 2003). 2003). In In yeast, yeast, disruption disruption of of the the genes genes encoding encoding the the two two catalytic catalytic

1999), 1999), and and disruption disruption of of the the regulatory regulatory subunit subunit gene, gene, which which leads leads ~ ~ to to embryonic embryonic lethality lethality

the the catalytic catalytic a' a' subunit subunit gene gene in in inice, inice, which which leads leads to to aberrant aberrant spermatogenesis spermatogenesis (Xu (Xu et et al., al.,

Pinna, Pinna, 2003; 2003; Niefind Niefind et et al., al., 2001). 2001). The The importance importance of of CK2 CK2 is is illustrated illustrated by by disruption disruption of of

of of 5 5 acidic acidic residues residues surrounding surrounding the the substrate substrate (Chantalat (Chantalat SIT SIT et et al., al., 1999; 1999; Meggio Meggio and and

to to direct direct phosphorylation phosphorylation of of the the consensus consensus sequence sequence [Sff]xx[D/E/pS/pT] [Sff]xx[D/E/pS/pT] with with an an average average

regulatory regulatory subunits subunits form form a a dimer dimer ~ ~ that that interacts interacts with with the the catalytic catalytic core core of of the the subunits subunits a a

Chapter Chapter 1. 1. Introduction Introduction Chapter 1. Introduction al., 2002). Together with the CK2 holoenzyme crystal structure, biochemical data suggests polyamine binding to the ~ subunit results in a conformational change in the catalytic core that increases enzyme activity (Leroy et al., 1997; Niefind et al., 2001).

These increases in kinase activity are small, but may be significant when coupled with targeting of the kinase to substrate proteins. In Chapter 3, I present evidence supporting this hypothesis, showing that PACS-1 binds directly to the regulatory subunit of CK2, stimulates CK2 activity, and that this interaction is required for the phosphorylation of

PACS-1 itself, as well as PACS-1 binding partners.

Conclusion

While the importance of P ACS-1 for localizing acidic cluster containing membrane cargo to the TGN is well established, no information pertaining to the regulation of its sorting activity has been reported. For many cargo molecules, including furin, CI-MPR, VMAT2 and VZV -gE, phosphorylation of specific residues within their acidic clusters enhances binding to PACS-1 (Waites et al., 2001; Wan et al., 1998), whereas others, including

PC6B and HIV -1 Nef, contain non-phosphorylatable acidic clusters (Piguet et al., 2000;

Xiang et al., 2000). Together, these results suggest that binding of PACS-1 to cargo acidic clusters may be regulated by more than just the phosphorylation state of the cargo protein. Interestingly, PACS-1 itself contains an acidic cluster with a potential CK2

phosphorylation site ( ... S278EEEEE ... ). The striking similarity between the acidic cluster in PACS-1 to acidic clusters found on PACS-1 cargo molecules such as furin raises the possibility that the PACS-1 acidic cluster may control PACS-1 sorting activity by interacting with the PACS-1 cargo binding region (FBR) and thereby preventing the

33

34 34

membrane membrane proteins proteins in in the the trans-Golgi trans-Golgi network network (TGN)/endosomal (TGN)/endosomal system. system.

regulates regulates the the function function of of PACS-1 PACS-1 and and GGA3, GGA3, and and thus, thus, trafficking trafficking of of certain certain itinerant itinerant

explores explores the the hypothesis hypothesis that that protein protein kinase kinase CK2 CK2 controls controls a a phosphorylation phosphorylation cascade cascade that that

these these sorting sorting molecules molecules to to control control P P ACS-1 ACS-1 and and GGA GGA directed directed protein protein sorting. sorting. This This thesis thesis

PACS-1 PACS-1 function, function, respectively, respectively, raised raised the the possibility possibility that that this this kinase kinase might might associate associate with with

to to PACS PACS and and GGAs, GGAs, as as well well as as for for the the known known and and potential potential regulation regulation of of GGA GGA and and

Maxfield, Maxfield, 1999). 1999). The The requirement requirement of of CK2 CK2 phosphorylation phosphorylation of of cargo cargo proteins proteins for for binding binding

and and CI-MPR, CI-MPR, which which binds binds both both PACS-1 PACS-1 and and GGAs GGAs (Lin (Lin et et al., al., 2004; 2004; Mallet Mallet and and

observed observed regarding regarding the the trafficking trafficking itineraries itineraries of of furin, furin, which which binds binds P P ACS-1 ACS-1 but but not not GGAs GGAs

and and GGA GGA sorting sorting proteins proteins may may be be coordinated-and coordinated-and may may explain explain the the differences differences

acidic- and and acidic-dileucine-trafficking acidic-dileucine-trafficking motifs motifs suggests suggests that that the the sorting sorting activity activity of of PACS PACS

interaction interaction of of PACS-1 PACS-1 with with cargo cargo proteins. proteins. In In addition, addition, the the overlapping overlapping nature nature of of the the

Chapter Chapter 1. 1. Introduction Introduction Chapter 2. PACS-1 Activation

CHAPTER2

The phosphorylation state of an autoregulatory domain controls P ACS-1-directed protein traffic

1 2 3 Gregory K. Scott, Feng Gu , Colin M. Crump , Laurel Thomas, Lei Wan, Yang Xiang and Gary Thomas4

Vollum Institute, L-474, 3181 SW Sam Jackson Park Road, Portland, Oregon 97239 USA; 1McGill Cancer Center, McGill University, 3655, Promenade Sir William Osler, Montreal, Quebec, H3G 1Y6, Canada; 2 Division of Virology, Department of Pathology, University of Cambridge, Tennis Court Road, Cambridge CB2 lQP, UK; 3Department of Molecular and Cellular Physiology, Stanford Medical Center, Palo Alto, California 94305 USA

G. K. Scott and F. Gu contributed equally to this work 4Corresponding author Tel: (503) 494-6955 Fax: (503) 494-1218 e-mail: [email protected]

Published in: The EMBO Journal, December 1, 2003, Volume 22, p. 6234-44

In this chapter I performed the experiments in Figures 1B, 1F, 2B, 2D and 4. F. Gu and L. Thomas performed the cell free transport assay (Figure 3), C. Crump performed the phospho-amino acid analysis (Figure lD), L. Wan performed the 32P labeling of GST­ MR (Figure lC), and F Gu performed all other experiments (Figures IE, 2A, 2C, 5C and 5B). I also participated by writing the manuscript and responding to the referees comments with G. Thomas.

35

36 36

Words: Words: autoregulatory autoregulatory Key Key /CK2/N /CK2/N domain ef ef /P /P ACS-1 ACS-1 /phosphorylation /phosphorylation

sorting sorting machinery. machinery.

the the TGN/endosomal TGN/endosomal system system through through the the phosphorylation phosphorylation state state of of both both cargo cargo and and the the

TGN. TGN. These These results results suggest suggest that that coordinated coordinated signaling signaling events events regulate regulate transport transport within within

1 1 molecule molecule that that selectively selectively blocks blocks retrieval retrieval of of PACS-1-regulated PACS-1-regulated cargo cargo molecules molecules to to the the

278 278

this this interaction. interaction. Moreover, Moreover, the the Ser Ala Ala mutation mutation yields yields an an interfering interfering mutant mutant PACS- ___.., ___..,

278 278

interaction interaction between between PACS-1 PACS-1 and and cargo, cargo, whereas whereas a a Ser Ala Ala substitution substitution decreased decreased ___.., ___..,

278 278 278 278

PP2A. PP2A. Phosphorylation Phosphorylation of of Ser by by CK2 CK2 or or mutation mutation of of Ser Asp Asp increased increased the the ___.., ___..,

278 278 Ser adjacent adjacent to to the the acidic acidic cluster cluster is is phosphorylated phosphorylated by by CK2 CK2 and and dephosphorylated dephosphorylated by by

autoregulatory autoregulatory domain domain that that controls controls PACS-1-directed PACS-1-directed sorting. sorting. Biochemical Biochemical studies studies show show

highly highly similar similar to to acidic acidic cluster cluster sorting sorting motifs motifs on on cargo cargo molecules, molecules, acts acts as as an an

proteins proteins such such as as HIV HIV -1 -1 Nef. Nef. Here Here we we show show that that an an acidic acidic cluster cluster on on PACS-1, PACS-1, which which is is

proteins proteins such such as as furin, furin, the the cation-independent cation-independent mannose-6-phosphate mannose-6-phosphate receptor receptor and and in in viral viral

adaptor adaptor AP-1 AP-1 to to acidic acidic cluster cluster sorting sorting motifs motifs contained contained in in the the cytosolic cytosolic domain domain of of cargo cargo

trans-Golgi trans-Golgi in in the the network network (TGN)/endosomal (TGN)/endosomal system. system. PACS-1 PACS-1 connects connects the the clathrin clathrin

P P ACS-1 ACS-1 is is a a cytosolic cytosolic sorting sorting protein that that protein directs directs the the localization localization of of membrane membrane proteins proteins

Abstract Abstract

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. P ACS-1 Activation

Introduction

The control of homeostasis and disease requires that cellular or pathogen proteins are correctly modified and targeted to specific cellular compartments. Many of these modification and targeting steps rely on the communication between the dynamic and highly regulated network of late secretory pathway organelles that comprise the trans­

Golgi network (TGN)/endosomal system (Gruenberg, 2001). In addition to housing several biochemical reactions, the TGN orchestrates the routing of proteins to lysosomes, secretory granules, and, in polarized cells, to the apical and basolateral surfaces. The

TGN also receives molecules internalized from the cell surface via a series of complex and highly dynamic endosomal compartments. Precisely how the TGN/endosomal system controls the sorting and localization of proteins is incompletely understood, but numerous studies show the requirement for the orchestrated interaction of many cellular factors including various small molecules, lipids, cytosolic and membrane proteins and components of the cytoskeleton (Gu et al., 2001).

The localization of many membrane proteins within the TGN/endosomal system relies upon specific sorting motifs contained within the cytosolic domain of these proteins

(Bonifacino and Traub, 2003). One of these motifs is represented by clusters of acidic residues, often containing serine or threonine residues that can be phosphorylated by casein kinase 2 (CK2) or, less frequently, casein kinase 1 (CK1, for reviews, see

(Bonifacino and Traub, 2003; Gu et al., 2001; Thomas 2002). Membrane proteins that contain acidic sorting motifs include processing enzymes such as furin (Jones et al.,

1995), PC6B (Xiang et al., 2000) and carboxypeptidase D (CPD, Kalinina et al., 2002);

37

38 38

furin, furin, as as it it is is also also required required for for the the TGN TGN localization localization of of a a number number of of membrane membrane proteins proteins

et et al., al., 2001; 2001; Wan Wan et et al., al., 1998). 1998). PACS-1 PACS-1 is is not not exclusively exclusively dedicated dedicated to to the the localization localization of of

furin furin to to the the AP-1 AP-1 clathrin clathrin adaptor adaptor and and is is required required for for localizing localizing furin furin to to the the TGN TGN (Crump (Crump

(nhosphofurin (nhosphofurin f!Cidic f!Cidic duster duster §.orting §.orting protein-1), protein-1), which which is is a a sorting sorting connector connector that that links links

The The phosphorylated phosphorylated furin furin acidic acidic cluster cluster binds binds to to the the sorting sorting protein protein PACS-1 PACS-1

cluster-mediated cluster-mediated trafficking trafficking of of furin. furin.

1999). 1999). Thus, Thus, the the coordinated coordinated activities activities of of CK2 CK2 and and PP2A PP2A control control the the complex, complex, acidic acidic

(Molloy (Molloy et et al., al., 1998), 1998), apparently apparently via via a a late late endosome endosome intermediate intermediate (Mallet (Mallet and and Maxfield, Maxfield,

2A 2A (PP2A) (PP2A) allows allows transport transport of of furin furin from from sorting/recycling sorting/recycling endosomes endosomes to to the the TGN TGN

dephosphorylation dephosphorylation of of the the furin furin acidic acidic cluster cluster by by specific specific isoforms isoforms of of protein protein phosphatase phosphatase

of of furin furin from from immature immature secretory secretory granules granules (Dittie (Dittie et et al., al., 1997). 1997). By By contrast, contrast,

endosomes endosomes to to the the cell cell surface surface (Molloy (Molloy et et al., al., 1998) 1998) and, and, in in neuroendocrine neuroendocrine cells, cells, removal removal

localization localization of of furin furin to to the the TGN TGN (Jones (Jones et et al., al., 1995), 1995), recycling recycling of of furin furin from from early early

controls controls in in large large part part the the dynamic dynamic sorting sorting itinerary itinerary of of the the endoprotease endoprotease including including the the

domain domain of of furin furin (Thomas, (Thomas, 2002b). 2002b). The The phosphorylation phosphorylation state state of of the the furin furin acidic acidic cluster cluster

Perhaps Perhaps the the best best studied studied of of these these acidic acidic cluster cluster motifs motifs is is the the one one present present in in the the cytosolic cytosolic

as as well well as as human human immunodeficiency immunodeficiency virus virus type type 1 1 (HIV (HIV Nef Nef (Piguet (Piguet et et al., al., -1) -1) 2000). 2000).

Alconada Alconada et et al., al., 1999) 1999) and and hum·an hum·an cytomegalovirus cytomegalovirus gB gB (HCMV (HCMV gB, gB, Norais Norais et et al., al., 1996), 1996),

glycoproteins glycoproteins of of many many herpes viruses viruses herpes such such as as varicella-zoster varicella-zoster virus virus gE gE (VZV (VZV -gE, -gE,

V V AMP-4 AMP-4 (Zeng (Zeng et et al., al., 2003); 2003); a a number number of of pathogen pathogen molecules molecules including including the the envelope envelope

et et al., al., 1997); 1997); transporters transporters such such as as VMAT2 VMAT2 (Waites (Waites et et al., al., 2001); 2001); SNAREs SNAREs including including

receptors receptors such such as as the the cation-independent cation-independent mannose-6-phosphate mannose-6-phosphate receptor receptor (CI-MPR, (CI-MPR, Chen Chen

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation that contain acidic cluster sorting motifs. These include cellular proteins, such as CI-MPR

(Wan et al., 1998), PC6B (Xiang et al., 2000), and VMAT2 (Waites et al., 2001) as well as several viral proteins including HCMV gB (Crumpet al., 2003) and HIV-1 Nef (Piguet et al., 2000). PACS-1 binding to HIV -1 Nef is required for the ability of this viral protein to downregulate cell-surface major histocompatibility class-1 (MHC-1) complexes

(Blagoveshchenskaya et al., 2002; Piguet et al., 2000).

While the importance of P ACS-1 for localizing acidic cluster containing membrane cargo to the TGN is well established, no information pertaining to the regulation of its sorting activity has been reported. For many cargo molecules including furin, CI-MPR, VMAT2 and VZV -gE, phosphorylation of specific residues within their acidic clusters enhances binding to PACS-1 (Waites et al., 2001; Wan et al., 1998), whereas others including

PC6B and HIV -1 Nef contain non-phosphorylatable acidic clusters (Piguet et al., 2000;

Xiang et al., 2000). Together, these results suggest that binding of PACS-1 to cargo acidic clusters may be regulated by more than just the phosphorylation state of the cargo protein. Interestingly, P ACS-1 itself contains an acidic cluster with a potential CK2

phosphorylation site, .. S278EEEEE .. , located C-terminal to the cargo-binding domain

(named the FBR, see Fig. 1A). The striking similarity between the acidic clusters in

PACS-1 to those in cargo molecules such as furin raises the possibility that the PACS-1 acidic cluster may control PACS-1 sorting activity.

In this report we show that the P ACS-1 acidic cluster acts as an autoregulatory domain for P ACS-1-directed protein trafficking and is itself a target of CK2 phosphorylation and

39

40 40

sorting. sorting.

phosphorylation phosphorylation of of both both the the cargo cargo and and a a sorting sorting connector connector can can regulate regulate TGN/endosomal TGN/endosomal

results results provide provide new new insight insight into into how how a a coordinated coordinated signaling signaling mechanism mechanism controlling controlling the the

in in an an interfering interfering mutant mutant that that inhibits inhibits PACS-1-directed PACS-1-directed endosome-to- TGN TGN sorting. sorting. These These

278 278 to to the the TGN. TGN. Disruption Disruption of of PACS-1 PACS-1 phosphorylation phosphorylation by by a a Ser substitution substitution ~Ala ~Ala results results

P P ACS-1 ACS-1 acidic acidic cluster cluster regulates regulates the the ability ability of of P P ACS-1 ACS-1 to to bind bind to to and and sort sort cargo cargo proteins proteins

biochemical, biochemical, cellular- and and cell-free cell-free studies, studies, we we show show that that the the phosphorylation phosphorylation state state of of the the

the the cargo-binding cargo-binding region region of of PACS-1 PACS-1 in in a a phosphorylation phosphorylation dependent dependent manner. manner. Using Using

PP2A PP2A dephosphorylation. dephosphorylation. We We demonstrate demonstrate that that the the PACS-1 PACS-1 acidic acidic cluster cluster associates associates with with

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

Results

Inspection of the PACS-1 protein sequence reveals an acidic cluster, -S 278EEEEE-, C­ terminal to the cargo-binding region (FBR, residues 117-266) that is similar to the acidic cluster sorting motifs on many membrane cargo proteins that bind to the PACS-1 FBR

(Fig. IA). Interestingly, the serine residue within the PACS-1 acidic cluster forms a consensus sequence for CK2 phosphorylation. To determine if Ser278 is a major site of phosphorylation in PACS-1, cells expressing wild type PACS-1 or PACS-1 with a Ser278 32 --+ Ala substitution (PACS-1 S278A) were incubated with Pi and the immunoprecipitated

PACS-1 proteins were resolved by SDS PAGE. Quantification of the incorporated 32 radioactivity showed that PACS-1 S278A contained 50% less P than wild type PACS-1, indicating that Ser278 is a major PACS-1 phosphorylation site in vivo (Fig. 1B).

Next we conducted a senes of in vitro studies to characterize the reversible phosphorylation of PACS-1 at Ser278 . First, we showed that Ser278 could be phosphorylated by CK2 (Fig. IC). GST-PACS-1 240_479 (GST-MR, which contains the

PACS-1 acidic cluster) or GST-MRS278A was incubated with purified CK2 and [y- 32 32P]ATP. GST-MRS278A incorporated significantly less P than did GST-MR, suggesting that Ser278 within the PACS-1 acidic cluster is a substrate for CK2. Moreover, neither protein kinase A nor protein kinase C could phosphorylate GST-MR despite their ability to efficiently phosphorylate a control substrate (data not shown). Second, to unequivocally identify Ser278 as a CK2 phosphorylation site, we conducted phosphoamino acid analysis on GST-MRS278T following CK2 phosphorylation (Fig. 10). The Ser278 -­

Thr substitution was chosen because GST-MR lacks a phosphorylatable threonine

41

42 42

278 contrast, contrast, and and in in agreement agreement with with the the analysis analysis ofPACS-1 ofPACS-1 S A A (Fig. (Fig. 1B), 1B), incubation incubation of of the the

okadaic okadaic acid acid increased increased the the amount amount of of P P incorporated incorporated into into PACS-1 PACS-1 by by two-fold. two-fold. By By

32

control control (Fig. (Fig. 1F). 1F). In In agreement agreement with with our our in in vitro vitro studies, studies, incubation incubation of of the cells cells the with with

immunoprecipitated immunoprecipitated with with affinity affinity purified purified anti-PACS-1 anti-PACS-1 antibodies antibodies but but not not with with an an IgG IgG

phosphorylated phosphorylated in in vivo. vivo. Cells Cells were were incubated incubated with with Pi Pi and and endogenous endogenous PACS-1 PACS-1 was was

32

We We conducted conducted metabolic metabolic labeling labeling studies studies to to determine determine whether whether endogenous endogenous PACS-1 PACS-1 is is

phosphatase. phosphatase.

a a control control substrate substrate (data (data not not 278 278 shown), shown), suggesting suggesting a a role role for for PP2A PP2A as as the the PACS-1 PACS-1 Ser

e

failed failed to to dephosphorylate dephosphorylate P]-GST-MR P]-GST-MR despite despite its its ability ability to to efficiently efficiently dephosphorylate dephosphorylate

2

by by okadaic okadaic acid, acid, a a PP2A PP2A specific specific inhibitor. inhibitor. By By contrast, contrast, protein protein phosphatase phosphatase 1, 1, PP1, PP1,

e

P]-GST-MR P]-GST-MR was was efficiently efficiently dephosphorylated dephosphorylated by by PP2A PP2A and and this this reaction reaction was was blocked blocked

2

phophorylated phophorylated (Fig. (Fig. GST-MR 1E). 1E). Consistent Consistent with with a a potential potential role role for for PP2A PP2A at at this this step, step,

2001), 2001), we we investigated investigated whether whether PP2A PP2A can can similarly similarly dephosphorylate dephosphorylate the the CK2-

binding binding to to PACS-1 PACS-1 are are dephosphorylated dephosphorylated by by PP2A PP2A (Molloy (Molloy et et al., al., 1998; 1998; Varlamov Varlamov et et al., al.,

Third, Third, because because many many cargo cargo acidic acidic cluster cluster motifs motifs that that require require CK2 CK2 phosphorylation phosphorylation for for

278 278

These These data data strongly strongly indicate indicate that that Ser is is a a major major CK2 CK2 phosphorylation phosphorylation site site in in PACS-1. PACS-1.

278 of of only only pSer. pSer. By By contrast, contrast, analysis analysis of of GST-MRS T T revealed revealed pThr pThr in in addition addition to to pSer. pSer.

278 Phosphoamino Phosphoamino acid acid analysis analysis of of GST GST -MR -MR and and GST GST -MRS A A showed showed a a prominent prominent signal signal

278

MRS278A MRS278A and and GST-MRS T T were were incubated incubated with with recombinant recombinant CK2 CK2 and and P]ATP. P]ATP. [y-

32

phosphorylation phosphorylation at at some some other other Ser/Thr Ser/Thr residue. residue. Replicate Replicate samples samples of of GST-MR, GST-MR, GST­

must must be be due due to to phosphorylation phosphorylation at at residue residue 278 278 and and not not to to steric steric inhibition inhibition of of

278 residue. residue. Thus, Thus, the the formation formation of of pThr pThr in in GST-MRS T T following following incubation incubation with with CK2 CK2

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation cells with the CK2 inhibitor DRB decreased the amount of 32P incorporated into endogenous PACS-1 by to approximately 50% relative to control conditions. Together with our in vitro studies, these data strongly implicate CK2 and PP2A as the enzymes that

control the phosphorylation state of PACS-1 Ser278 •

The reversible phosphorylation of Ser278 raised the possibility that, similar to PACS-1 cargo proteins, the PACS-1 acidic cluster may interact with the PACS-1 FBR. To test this possibility, non-phosphorylated or CK2-phosphorylated GST-MR was incubated with

Trx-PACS-lFBR and captured using glutathione agarose (Fig. 2A). We found that GST­

PACS-1MR indeed bound to Trx-PACS-1FBR. Surprisingly, however, whereas phosphorylation of most PACS-1 cargo proteins enhanced binding to the PACS-1 FBR, the phosphorylation of GST-PACS-1MR by CK2 diminished binding to Trx-PACS-

1FBR. To test whether this reduced binding was due specifically to phosphorylation of

Ser278 , we measured the binding of the PACS-1 FBR to GST-MR constructs containing

either a Ser278 ._ Ala or a Ser278 ._ Asp substitution. Consistent with the results using

CK2-phosphorylated molecules, GST-MRS278A exhibited stronger binding to Trx-PACS-

1FBR than the GST-MRS278D.

We performed competitive binding assays to test whether GST-MR, which contains the

PACS-1 acidic cluster, competes with cargo protein aGidic clusters for binding to the

PACS-1 FBR (Fig. 2B). GST-PACS-1MR was pre-incubated with Trx-PACS-1 FBR and

then mixed with increasing concentrations of Trx-furinS773•775D, which contains the CK2 phosphomimic furin cytosolic domain that binds to the PACS-1 FBR (Crump et al.,

43

44 44

proteins proteins were were immunoprecipitated immunoprecipitated 278 from from cells cells expressing expressing PACS-1, PACS-1, PACS-1 PACS-1 S PACS- A, A,

with with

AP-I AP-I due due to to some some indirect indirect structural structural deformation. deformation. To To test test this this possibility, possibility, PACS-1 PACS-1

278 278 The The Ser Ala/ Ala/ Asp Asp substitutions substitutions ~ ~ could could potentially potentially inhibit inhibit the the interaction interaction of of PACS-1 PACS-1

ability ability of of PACS-1 PACS-1 to to bind bind 278 cargo cargo is is regulated regulated by by the the phosphorylation phosphorylation

state state oft oft Ser • •

278 the the S A A substitution substitution

inhibited inhibited PACS-1 PACS-1 binding binding to to GST-Nef GST-Nef by by nearly nearly 80%. 80%. Thus, Thus, the the

278 the the S D D substitution substitution enhanced enhanced PACS-1 PACS-1 binding binding to to GST-Nefby GST-Nefby more more than than 50% 50% whereas whereas

incubated incubated with with GST-Nef. GST-Nef. Quantification Quantification of of proteins proteins binding binding to to HIV-1 HIV-1 Nef Nef showed showed that that

1 1 278 binding. binding. 278 Cells Cells expressing expressing P P ACS-1, ACS-1, P P ACS-1 ACS-1 S A, A, or or P P ACS-1 ACS-1 S D D were were harvested harvested and and

phosphorylation phosphorylation of of the the putative putative PACS-1 PACS-1 autoregulatory autoregulatory domain domain may may regulate regulate Nef-PACS-

Because Because the the Nef Nef acidic acidic cluster cluster cannot cannot be be phosphorylated phosphorylated by by CK2, CK2, only only CK2 CK2

reporter reporter proteins proteins to to the the TGN TGN (Blagoveshchenskaya (Blagoveshchenskaya et et al., al., 2002; 2002; Piguet Piguet et et al., al., 2000). 2000).

is is required required for for binding binding to to PACS-1 PACS-1 and and for for PACS-1 PACS-1 dependent dependent sorting sorting of of HIV-1 HIV-1 Nef Nef

protein protein

HIV-1 HIV-1 Nef Nef (Fig. (Fig. 2C). 2C). We We previously previously 65 showed showed

that that the the Nef Nef acidic acidic cluster, cluster, EEEE , ,

278 278 1, 1, we we

tested tested the the ability ability of of PACS-1S A A or or PACS-1S D D to to bind bind to to the the PACS-1 PACS-1 cargo cargo

278 278 To To examine examine the the importance importance of of Ser phosphorylation phosphorylation in in the the context context of of full-length full-length PACS-

PACS-1. PACS-1.

indicate indicate that that binding binding of of the the PACS-IMR PACS-IMR to to the the PACS-1 PACS-1 FBR FBR precludes precludes cargo cargo binding binding to to

PACS-1 PACS-1 FBR FBR whereas whereas Trx Trx alone alone had had no no effect. effect. Together, Together, the the data data in in figures figures 2A 2A and and 2B 2B

furinS773.775D furinS773.775D competed competed in in a a dose-dependent manner manner dose-dependent with with GST-MR GST-MR for for binding binding to to the the

Trx-PACS-1 Trx-PACS-1 FBR FBR was was detected detected by by western western blot. blot. Using Using this this assay, assay, we we found found that that Trx­

2001) 2001) or or Trx Trx alone. alone. GST-PACS-1 GST-PACS-1 MR MR was was captured captured using using glutathione glutathione agarose agarose and and bound bound

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

1 S 278D, or PACS-1Admut, which contains an alanine substitution of E 168TELQLTF175 within the PACS-1 FBR that blocks binding to AP-1 but not cargo (Crumpet al., 2001).

Co-immunoprecipitation analysis showed that each PACS-1 construct, except PACS-

1Admut, associated with AP-1 (Fig. 20). Together, the data in figure 2 show that

phosphorylation at Ser278 terminates the autoinhibitory domain to the cargo binding domain, thereby promoting binding of PACS-1 to cargo proteins.

The inhibitory effect of the Ser278 ~ Ala substitution on the ability of PACS-1 to bind

cargo proteins suggested that expression of PACS-1 S278A in cells might interfere with

PACS-1 dependent sorting. Therefore, we examined the effect of PACS-1 S278A and

PACS-1S278D on the TGN sorting of the HIV-1 Nef reporter construct 44Nef (Fig. 3A).

44Nef is a chimera composed of the CD4 extracellular and transmembrane domains fused to cytosolic HIV -1 Nef. Using this construct, CD4 antibody uptake assays showed that

co-expression of the reporter with either PACS-1 or PACS-1 S278D had no effect on the efficient delivery of internalized 44Nef to the TGN. By contrast, co-expression of PACS-

1 S278 A blocked the sorting of internalized 44Nef to the TGN and caused the reporter to be mislocalized to a dispersed, punctate endosomal population. The interfering effect of

PACS-1S278A on the sorting of 44Nef to the TGN was indistinguishable from the

missorting of 44NefAla, which contains an EEEE65 ~ AAAA65 substitution that cannot bind to PACS-1 (Piguet et al., 2000).

Next, we used a cell-free assay to unequivocally establish the role of PACS-1, and in

particular the phosphorylation state of Ser278 , in endosome-to-TGN sorting (Fig. 3B). This

45

46 46

compared compared to to P P ACS-1 ACS-1 may may reflect reflect a a requirement requirement for for the the temporal temporal regulation regulation of of P P ACS-1 ACS-1

activity. activity. We We suspect suspect 278 that that the the less less efficient efficient rescue rescue of of 44Nef-Y 44Nef-Y sorting sorting by by PACS-1S D D

278 278 supporting supporting a a role role for for the the phosphorylation phosphorylation of of Ser as as a a key key regulator regulator of of PACS-1 PACS-1 sorting sorting

278 1S278D 1S278D but but not not PACS-1S A A rescued rescued the the endosome endosome to to TGN TGN sorting sorting of of 44Nef-Y, 44Nef-Y,

Next, Next, we we analyzed analyzed the the PACS-1 PACS-1 phosphorylation phosphorylation state state mutants mutants and and found found that that only only PACS-

importance importance of of PACS-1 PACS-1 in in the the retrieval retrieval of of membrane membrane cargo cargo from from endosomes endosomes to to the the TGN. TGN.

with with PACS-1 PACS-1 rescued rescued the the endosome-to-TGN endosome-to-TGN transport transport of of 44Nef-Y 44Nef-Y demonstrating demonstrating the the

C

by by an an increase increase in in S]-labeled S]-labeled 44Nef-Y. 44Nef-Y. By By contrast, contrast, cytosol cytosol from from AS19 AS19 cells cells replete replete

5

contain contain reduced reduced levels levels of of P P ACS-1, ACS-1, supported supported endosome-to- TGN TGN transport transport as as measured measured

from from control control cells cells (C6) (C6) but but not not cytosol cytosol from from PACS-1 PACS-1 antisense antisense cells cells (AS (AS 19), 19), which which

promote promote endosome-to- TGN TGN transport. transport. Using Using this this assay, assay, we we found found that that addition addition of of cytosol cytosol

sample sample was was incubated incubated C with with an an ATP ATP regenerating regenerating system system in in the the presence presence of of S]-PAPS S]-PAPS to to

5

278 antisense antisense cells, cells, 278 or or AS AS 19 19 cells cells expressing expressing PACS-1, PACS-1, PACS-1 PACS-1 S D D or or PACS-1 PACS-1 S Each Each A. A.

preparation preparation was was then then incubated incubated with with cytosol cytosol from from control control C6 C6 cells, cells, AS AS 19 19 PACS-1 PACS-1

in in endosomal endosomal compartments, compartments, which which lack lack the the sulfotransferase. sulfotransferase. The The quenched quenched membrane membrane

phosphoadenosine phosphoadenosine -phosphosulfate) -phosphosulfate) 5' 5' to to quench quench any any 44Nef-Y 44Nef-Y present present at at the the TGN TGN but but not not

from from these these cells cells was was incubated incubated with with the the unlabeled unlabeled sulfate sulfate donor donor PAPS PAPS (3 (3 '­

synthesized synthesized 44Nef- Y Y in in late late secretory secretory pathway pathway compartments. compartments. The The membrane membrane fraction fraction

with with cycloheximide cycloheximide to to block block protein protein synthesis synthesis and and promote promote accumulation accumulation of of the the nascently nascently

sulfation sulfation motif motif within within the the CD4 CD4 lumenal lumenal domain. domain. Cells Cells expressing expressing 44Nef- Y Y were were treated treated

A A 44Nef 44Nef mutant, mutant, 44Nef- Y, Y, was was constructed constructed containing containing the the cholecystokinin cholecystokinin tyrosine tyrosine 0-

Tyr Tyr residues residues in in the the lumenal lumenal domain domain of of cargo cargo proteins proteins to to demonstrate demonstrate sorting sorting to to the the TGN. TGN.

assay assay utilizes utilizes the the activity activity of of a a resident resident TGN- tyrosylprotein tyrosylprotein sulfotransferase sulfotransferase that that sulfates sulfates

Chapter Chapter 2. 2. P P ACS-1 ACS-1 Activation Activation Chapter 2. PACS-1 Activation phosphorylation in directing protein sorting. Nonetheless, these results demonstrate that

PACS-1 directs the endosome-to-TGN transport and that its sorting activity is regulated by the phosphorylation state of Ser278 •

The immunofluorescence and in vitro transport studies showed that phosphorylation of

PACS-1 controls the endosome-to-TGN transport of the 44Nef reporter and suggested that PACS-1 S278A may act as an interfering mutant to selectively block the sorting of

PACS-1 cargo proteins. To test this possibility we first examined the effect of PACS-

1S278D and PACS-1 S278A on the ability of HIV-1 Nef to downregulate MHC-1 molecules

(Fig. 4 ). Cells expressing HIV -1 Nef alone or together with either PACS-1 or PACS-

1S278D caused the redistribution of cell surface MHC-1 to the TGN whereas co-expression

of PACS-1S278A blocked MHC-1 downregulation. Second, we determined whether

PACS-1S278A could affect the TGN localization of CI-MPR and furin (Fig. 5A).

Expression of PACS-1 or PACS-1 S278D in A 7 cells had no effect on the paranuclear localization of either endogenous CI-MPR or co-expressed Flag-tagged furin (fur/f) both of which overlapped with the staining pattern of TGN46. By contrast, expression of

P ACS-1 S278A caused both CI-MPR and fur/f to redistribute to an endosomal population that no longer overlapped with TGN46. Finally, to establish that PACS-1S278A selectively

blocked the sorting of PACS-1 cargo, we examined the effects of PACS-1 S278A and

PACS-1S 278D on the distribution of several secretory compartment markers (Fig. 5B). In addition to their lack of effect on the localization of TGN46, which does not require

PACS-1 to localize to the TGN, we found that neither PACS-1 mutant affected the localization of AP-I or markers for early endosomes (internalized transferrin), late

47

48 48

specifically specifically blocks blocks PACS-1-directed PACS-1-directed protein protein traffic traffic in in the the TGN/endosomal TGN/endosomal system. system.

autoregulatory autoregulatory domain domain and and that that interference interference with with this this autoregulatory autoregulatory mechanism mechanism

show show that that the the sorting sorting activity activity of of PACS-1 PACS-1 is is controlled controlled by by the the phosphorylation phosphorylation state state of of an an

endosomes endosomes (LBPA) (LBPA) or or the the Golgi Golgi cisternae cisternae (mannosidase (mannosidase II). II). Together, Together, these these analyses analyses

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

Discussion

In this study, we have identified a biochemical mechanism that controls the sorting activity of PACS-1. We discovered that the phosphorylation state of an autoregulatory domain within P ACS-1 controls binding of this sorting connector to cargo proteins. CK2

phosphorylation of Ser278 within this autoregulatory domain weakens the interaction between the PACS-1 FBR and the P ACS-1 autoregulatory domain (Figs. 1 and 2), thereby enhancing binding to cargo (Fig. 2). These interactions are competitive, such that the unphosphorylated PACS-1 autoregulatory domain precludes binding of cargo proteins to the PACS-1 FBR (Fig. 2). Moreover, immunofluorescence and cell-free transport

studies showed that both PACS-1 and the phosphomimic PACS-1 mutant, PACS-1 S278D, support endosome-to-TGN sorting of cargo (Fig. 3). By contrast, the non­

phosphorylatable PACS-1 mutant, PACS-1 S278A, fails to support this sorting step and in cellular studies disrupts both the TGN localization of PACS-1 cargo and Nef-mediated downregulation of MHC-1 (Figs. 4 and 5). Together, our results demonstrate that the sorting capacity of PACS-1 is regulated by the phosphorylation state of an autoregulatory domain, revealing a fundamental mechanism used to control the regulation of protein traffic in the TGN/endosomal system.

The control of PACS-1 function by the coordinated activities of CK2 and PP2A is highly reminiscent to the role of these two enzymes in controlling the trafficking of furin. The phosphorylation state of furin's cytosolic acidic cluster sorting motif, which mediates binding to PACS-1, controls the trafficking itinerary of the endoprotease (Molloy et al.,

1999; Thomas 2002). However, whereas CK2 phosphorylation of acidic cluster sorting

49

50 50

between between the the phosphorylated phosphorylated PACS-1 PACS-1 acidic acidic cluster cluster and and the the phosphorylated phosphorylated acidic acidic clusters clusters

FBR FBR to to promote promote cargo cargo binding binding (Figure (Figure 6). 6). Alternatively, Alternatively, subtle subtle structural structural differences differences

the the PACS-1 PACS-1 autoregulatory autoregulatory domain domain triggers triggers a a conformational conformational change change that that unmasks unmasks the the

proteins proteins increases increases the the affinity affinity of of cargo cargo for for the the PACS-1 PACS-1 FBR FBR whereas whereas phosphorylation phosphorylation of of

phosphorylation phosphorylation of of embedded embedded Ser/Thr Ser/Thr residues. residues. Perhaps Perhaps phosphorylation phosphorylation of of cargo cargo

recognize recognize other other acidic acidic cluster cluster determinants determinants that that would would be be masked masked or or unmasked unmasked by by the the

the the PACS-1 PACS-1 FBR FBR may may not not contact contact the the phosphoamino phosphoamino acids acids directly directly but but may may instead instead

including including the the 14-3-3 14-3-3 and and forkhead forkhead modules modules (Durocher (Durocher et et al., al., 2000; 2000; Muslin Muslin et et al., 1996), 1996), al.,

these these studies studies suggest suggest that, that, unlike unlike that that shown shown for for many many phosphopeptide phosphopeptide binding binding modules modules

PC6B PC6B acidic acidic clusters clusters bind bind to to PACS-1 PACS-1 (Piguet (Piguet et et al., al., 2000; 2000; Xiang Xiang et et al., al., 2000). 2000). Together, Together,

more more complex complex than than a a simple simple phosphorylation phosphorylation switch switch as as the the non-phosphorylatable non-phosphorylatable Nef Nef and and

FBR FBR remains remains unknown. unknown. Moreover, Moreover, acidic acidic cluster cluster binding binding to to the the PACS-1 PACS-1 FBR FBR may may be be

a a completely completely opposite opposite manner manner the the binding binding of of these these various various acidic acidic motifs motifs to to the the PACS-1 PACS-1

phosphorylation phosphorylation of of acidic acidic cluster cluster motifs motifs within within membrane membrane cargo cargo and and PACS-1 PACS-1 influence influence in in

affinity affinity of of PACS-1 PACS-1 for for phosphorylated phosphorylated membrane membrane cargo cargo proteins. proteins. But But how how CK2 CK2

phosphorylation phosphorylation promotes promotes protein protein sorting sorting by by both both activating activating PACS-1 PACS-1 and and increasing increasing the the

domain domain versus versus membrane membrane cargo cargo acidic acidic clusters clusters suggests suggests a a simple simple model model whereby whereby CK2 CK2

CK2 CK2 phosphorylation phosphorylation on on binding binding of of the the PACS-1 PACS-1 FBR FBR to to the the PACS-1 PACS-1 autoregulatory autoregulatory

PACS-1 PACS-1 FBR FBR (Waites (Waites et et al., al., 2001; 2001; et et Wan al., al., 1998 1998 and and Fig. Fig. 2). 2). These These opposite opposite effects effects of of

278 278 Ser within within the the P P ACS-1 ACS-1 acidic acidic cluster cluster weakens weakens the the binding binding of of these these residues residues to to the the

gE gE and and VMAT-2 VMAT-2 increases increases their their binding binding to to the the PACS-1 PACS-1 FBR, FBR, CK2 CK2 phosphorylation phosphorylation of of

motifs within within motifs the the furin furin cytosolic cytosolic domain domain or or other other proteins proteins cargo including including CI-MPR, CI-MPR, VZV VZV

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation on furin or CI-MPR may result in a different set of contacts between these motifs and the cargo binding residues within the FBR.

Blocking phosphorylation at Ser278 in PACS-I has a profound effect on the trafficking of

PACS-I cargo. For example, the PACS-IS278A mutant blocked the HIV-1 Nef-mediated downregulation of cell-surface MHC-I molecules to the trans-Golgi network (Figure 4) and caused the mislocalization of furin and MPR from the TGN to dispersed endosomal

compartments (Fig. 5A). The lack of a measurable effect of PACS-I S278A on markers for the TGN and Golgi cisternae, as well as for early and late endosomal compartments (Fig.

5B), further demonstrated the selectivity of this interfering mutant for disrupting the trafficking and localization of membrane proteins that are sorted by PACS-I. The

selective disruption in protein traffic caused by PACS-IS278A is very similar to that observed in cells lacking either PACS-I (Wan et al., I998) or the AP-IA adaptor (Meyer et al., 2000), as well as in cells expressing PACS-IAdmut (Crumpet al., 200I). Because

PACS-1 forms a ternary complex with AP-1 and cargo proteins (Crumpet al., 200I), the

similar sorting defect caused by both PACS-1 S278A and PACS-IAdmut reflects the selective inhibition of the two arms of this protein complex. Moreover, as the PACS-I

S278A mutation has no measurable effect on PACS-I binding either to AP-I (Fig. 20) or

to cellular membranes (data not shown), a simple explanation for how PACS-IS278A acts as an interfering mutant may be that it competes with endogenous P ACS-1 for membrane recruitment and adaptor complexes but fails to bind to cargo.

51

52 52

compartments. compartments.

that that PACS-1 PACS-1 participates participates in in the the retrieval retrieval of of membrane membrane proteins proteins from from multiple multiple post- TON TON

phosphorylated phosphorylated furin furin from from endosomes endosomes to to the the cell cell surface surface (Thomas (Thomas 2002), 2002), it it is is possible possible

TON TON sorting, sorting, retrieval retrieval of of furin furin from from immature immature secretory secretory granules, granules, and and for for recycling recycling of of

al., al., 2000). 2000). Because Because PACS-1 PACS-1 is is required required for for multiple multiple sorting sorting steps steps including including endosome-to­

is is required required for for retrieval retrieval of of membrane membrane cargo cargo from from early early endosomes endosomes to to the the TON TON (Meyer (Meyer et et

late late endosome-like endosome-like compartment compartment (Piguet (Piguet et et al., al., 2000) 2000) whereas whereas AP-1, AP-1, a a PACS-1 PACS-1 effector, effector,

showed showed that that 44Nef 44Nef reporter reporter mutants mutants unable unable to to bind bind to to PACS-1 PACS-1 accumulate accumulate in in an an acidified acidified

retrieval retrieval specifically specifically from from early early endosomes, endosomes, late late endosomes, endosomes, or or both. both. Previous Previous studies studies

et et al., al., 1998). 1998). However, However, the the transport transport assay assay does does not not show show whether whether PACS-1 PACS-1 mediates mediates

bind bind to to PACS-1, PACS-1, have have no no effect effect on on TON TON budding budding or or retention retention (Kalinina (Kalinina et et al., al., 2002; 2002; Wan Wan

demonstrating demonstrating that that the the phosphorylation phosphorylation state state of of the the furin furin and and CPO CPO acidic acidic clusters, clusters, which which

to to direct direct endosome-to- TON TON transport transport is is in in agreement agreement with with earlier earlier cell-free cell-free assays assays

the the endosome-to- TON TON sorting sorting of of membrane membrane cargo cargo proteins. proteins. The The requirement requirement for for PACS-1 PACS-1

importance importance of of PACS-1, PACS-1, 278 and and in in particular particular the the phosphorylation phosphorylation state state of of Ser for for directing directing , ,

not. not. These These data data combined combined with with the the immunofluorescence immunofluorescence studies studies demonstrate demonstrate the the

endosome-to- TON TON transport transport of of 44Nef- 278 Y Y whereas whereas cytosol cytosol containing containing PACS-1 PACS-1 S A A could could

antisense antisense cytosol cytosol 278 replete replete with with either either PACS-1 PACS-1 or or containing containing P P ACS-1 ACS-1 S D D restored restored

transport transport of of a a tyrosine-sulfatable tyrosine-sulfatable Nef Nef reporter, reporter, 44Nef- Y Y (Fig. (Fig. 3). 3). In In addition, addition, PACS-1 PACS-1

from from control control cells, cells, but but not not from from PACS-1 PACS-1 antisense antisense cells, cells, supports supports endosome-to- TON TON

phosphorylatable phosphorylatable reporter reporter proteins proteins to to the the TON TON (Itin (Itin et et al., al., 1997). 1997). We We found found that that cytosol cytosol

vitro vitro re-sulfation re-sulfation assay assay that that quantitatively quantitatively measures measures the the sorting sorting of of tyrosine­

To To directly directly test test the the ability ability of of PACS-1 PACS-1 to to control control endosome-to- TON TON sorting, sorting, we we used used an an in in

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

Whereas the diverse roles of autoregulatory domains in regulating processes ranging

from protease activation to signal transduction is well established (Anderson et al., 2002;

Pufall and Graves, 2002), the roles of autoregulatory domains in regulating the activities

of trafficking proteins are only now beginning to emerge. Recent reports describe

autoregulatory domains in the GGA1 and GGA3 adaptors, which direct anterograde

sorting from the TGN to endosomes (Doray et al., 2002; Ghosh and Kornfeld, 2003a).

Similar to PACS-1, autoinhibition of GGA1 is controlled by the CK2-catalyzed

phosphorylation of a serine residue (Ser355 ) within a cluster of acidic residues but,

interestingly, in an opposite manner to that of PACS-1. Whereas CK2 phosphorylation of

the PACS-1 autoregulatory domain promotes cargo binding (Fig. 2), CK2

phosphorylation of the GGA1 autoregulatory domain inhibits cargo binding (Doray et al.,

2002). Perhaps CK2 phosphorylation promotes endosome-to-TGN sorting by

simultaneously activating PACS-1 and inhibiting GGAl. Conversely, activation of PP2A

would drive movement from the TGN to endosomes by simultaneously activating GGA1 and inhibiting PACS-1. Indeed, our findings that inhibition of either CK2 or PP2A decreased or increased, respectively, the phosphorylation of endogenous PACS-1 (Fig.

2), suggests that a balance in the activities of these two enzymes controls PACS-1 sorting activity. Whether GGAs and PACS-1 intimately participate in controlling protein localization is currently being investigated. Together these findings provide new insight into how the localization of membrane cargo molecules is controlled by the CK2 and

PP2A-mediated activities of PACS-1 and GGAs. Elucidating the signaling pathways that

53

54 54

trafficking trafficking in in the the TGN/endosomal TGN/endosomal system. system.

control control these these phosphorylation phosphorylation events events will will be be an an important important step step for for understanding understanding

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

Materials and Methods

Cell lines

BSC-40 epithelial cells, A 7 melanoma cells, AS 19 PACS-1 antisense cells and control

C6 cells containing empty vector were cultured as previously described (Wan et al.,

1998).

DNA constructs pGEX3X-MR (containing PACS-1 residues 257 to 449) and pET32-PACS-1 FBR

(containing PACS-1 residues 117 to 256) expressing GST- and His/thioredoxin (Trx)­ fusion proteins were previously described (Crumpet al., 2001). PACS-1 point mutants were generated by standard PCR methods and subcloned into pGEX3x to produce pGEX­

PACS-1MRS278A, pGEX-PACS-1MRS278D and pGEX-PACS-1MRS278T. pGEX­

Nef and pCMX44Nef Notl were obtained from D. Trono (Piguet et al., 1998 ; Piguet et al., 2000). pGEX3X-CK2a was obtained from D. Litchfield.

Recombinant virus

Vaccinia virus (VV) and adenovirus (A V) were constructed using standard methods

(Blagoveshchenskaya et al., 2002). VV recombinants expressing human HA-tagged

PACS-1 and FLAG-tagged furin were previously described (Crumpet al., 2001 ; Molloy

et al., 1994). VV recombiants expressing HA-tagged PACS-1S278 A and PACS-1S278D were made by replacing the mutation from pGEX-PACS-1MR plasmid into pZVneo:PACS-1ha. The AV expressing 44Nef sequence was constructed by subcloning

44Nef from pCMX44Nef Notl into pAdtet7. 44Nef-Y was generated by inserting the

55

56 56

with with PBS PBS plus plus 1% 1% NP-40 NP-40 containing containing protease protease inhibitors inhibitors (Complete, (Complete, Sigma). Sigma). PACS-1 PACS-1 was was

dichlorobenzimidazole dichlorobenzimidazole riboside riboside (ORB) (ORB) or or 20 20 nM nM okadaic okadaic acid acid (OA). (OA). The The cells cells were were lysed lysed

NEX053C) NEX053C) for for 2 2 hr hr in in the the absence absence or or presence presence of of either either 100 100 5,6- ~-tM ~-tM

free free media media for for 2 2 hours, hours, then then labeled labeled with with 0.6 0.6 mCi/ml mCi/ml [ PJ PJ sodium sodium orthophosphate orthophosphate (NEN (NEN

32

label label endogenous endogenous PACS-1, PACS-1, A7 A7 cells cells were were grown grown to to confluency, confluency, incubated incubated with with phosphate phosphate

(Berkeley (Berkeley Antibody Antibody Co.), Co.), separated separated by by SDS-PAGE SDS-PAGE and and analyzed analyzed by by autoradiography. autoradiography. To To

orthovanadate. orthovanadate. HA-tagged HA-tagged PACS-1 PACS-1 proteins proteins were were immunoprecipitated immunoprecipitated with with mAb mAb HA.11 HA.11

2

8.0) 8.0) plus plus 1 mM mM 1 CaC1 50 50 mM mM NaF, NaF, 80 80 mM mM B-glycerol B-glycerol phosphate phosphate and and , , 0.1 0.1 ~-tM ~-tM

with with 500 500 mRIPA mRIPA %NP40, %NP40, 1% 1% sodium sodium ~-tl ~-tl (1 (1 deoxycholate, deoxycholate, 150 150 NaCl, NaCl, mM mM 50 50 mM mM Tris Tris pH pH

NEX053C) NEX053C) was was then then added added for for 3 3 hrs. hrs. The The labeled labeled cells cells were were washed washed with with PBS, PBS, lysed lysed

phosphate phosphate free free media media for for hr. hr. 0.5 0.5 mCi/ml mCi/ml 1 1 [ PJ PJ sodium sodium orthophosphate orthophosphate (NEN (NEN

32

278 = = tagged tagged PACS-1 PACS-1 PACS-1S A A (m.o.i. (m.o.i. or or for for 10) 10) 4 4 hours, hours, washed washed and and incubated incubated with with

To To label label recombinant recombinant PACS-1, PACS-1, BSC-40 BSC-40 cells cells were were infected infected with with expressing expressing VV VV HA­

Metabolic Metabolic labeling labeling and and immunoprecipiations immunoprecipiations

were were purified purified using using Ni-NT Ni-NT A-agarose A-agarose following following the the manufacturers manufacturers protocol protocol (Qiagen). (Qiagen).

agarose agarose (Sigma) (Sigma) following following the the manufacturers manufacturers protocol. protocol. Thioredoxin Thioredoxin (Trx) (Trx) fusion fusion proteins proteins

to to BL21 BL21 (DE3) (DE3) pLysS pLysS (Novagen). (Novagen). GST GST fusion fusion proteins proteins were were purified purified using using glutathione glutathione

pGEX pGEX or or pET32a- Trx Trx vectors vectors encoding encoding the the various various PACS-1 PACS-1 proteins proteins were were transformed transformed in in

Protein Protein purification purification

pAdtet44Nef. pAdtet44Nef.

cholecystokinin cholecystokinin 26 26 tyrosyl tyrosyl sulfation sulfation motif motif (SAEDYEYPS) (SAEDYEYPS) after after Lys of of 44Nef 44Nef m m

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation immunoprecipitated overnight using affinity purified rabbit anti PACS-1 antibody 601

(antigen, PACS-1 KGSLGKDTTSPME433 ). The immunoprecipitates were washed, split into two, and each half separated by SDS-PAGE. One half was used for PACS-1 autoradiography and the other for control western blot with mAb anti-PACS-1 (BD

Transduction Labs). Co-immunoprecipitation of PACS-1 constructs with AP-1 were performed as previously described (Crumpet al., 2001).

In vitro phosphorylation/ dephosphorylation

1pg purified GST-PACS-IMR was incubated with 0.02 !-!1 purified bovine CK2 in 50 !-!1

reaction buffer (50 mM Tris pH 7.5, 140 mM KCl, 10 mM MnC12 and 100 1-!M ATP) and

10 !-!Ci [y-32P]ATP. The reaction mixture was incubated for 1 hour at 30°C, separated by

SDS-PAGE and analyzed by autoradiography. For the dephosphorylation assays, Sf9 extract containing over-expressed PP2A holoenzyme (A, C and Ba subunits) was prepared as described (Molloy et al., 1998). Five pg CK2 phosphorylated GST-PACS­ lMR were incubated for 30 minutes at 37°C with 5 pl PP2A extract and in assay buffer

(25 mM Tris pH 7.4, 0.2 mM MnC12, 0.2 mg/ml BSA and 1 mM DTT) in the presence or absence of 10 nM okadaic acid (Calbiochem). GST-PACS-1 MR proteins were seperated by SDS-PAGE and analyzed by autoradiography.

Phosphoamino acid analysis

CK2 phosphorylated GST-MR, GST-MRS278A and GST-MRS278T were prepared as above except that recombinant CK2a was used. 32P-labeled proteins were separated by

SDS-PAGE and either dried and exposed to X-ray film to observe protein

57 Chapter 2. PACS-1 Activation phosphorylation or transferred to PVDF membranes. The protein bands were excised, hydrolyzed in 6N HCl and analyzed by two-dimensional thin layer chromatography as previously described (Jones et al., 1995). Radioactive samples were visualized by phosphorimage analysis.

GST protein binding assays

One 11g of GST, GST-MR, GST-MRS 278 A, GST-MRS278D or their CK2 phosphorylated forms was incubated with 1 11g of Trx-PACS-1FBR in 200 111 GST binding buffer (10 mM Tris pH 7.5, 200 mM NaCl, 1% NP40) at room temperature for 1 hr. Proteins bound to glutathione agarose were washed with GST -binding buffer and analyzed by western blot using anti-Trx mAb 46-0436 (Invitrogen). Furin competition assays were conducted

as above with the addition of indicated amounts of Trx-furinS773•775D or Trx alone to the binding reaction for one hr after a one hr pre-incubation. For the GST-Nef binding

experiments, A 7 cells were infected with VV expressing PACS-1, PACS-1 S278A or

PACS-1S 278D (m.o.i. = 5) for 16 hours and lysed with GST-binding buffer. 2 ]lg of GST­

Nef were incubated with this lysate. Bound epitope-tagged PACS-1 molecules were analyzed by western blot using the anti-HA mAb HA.11.

Immunofluorescence microscopy

Furin, MPR, TGN46, AP-1, mannosidase Il, LBPA, and transferrin uptake- A7 cells grown to 80% confluency and infected with recombinant VV expressing either PACS-1,

PACS-1S 278A or PACS-1S278D alone (m.o.i. = 10), or co-infected with VV:fur/f expressing Flag-tagged furin (m.o.i. = 3) with each of the PACS-1 expressing VV

58 Chapter 2. P ACS-1 Activation recombinants (m.o.i. =7, total m.o.i. = 10). Cells were fixed with 4% paraformaldehyde and processed for immunofluorescence as previously described (Blagoveshchenskaya et al., 2002; Crumpet al., 2001). Primary antibodies to the FLAG tag (mAb Ml, Kodak,

1:300), TGN46 (Serotech, 1:30), CI-MPR (from B. Hoflack, 1:200), AP-I (mAb 100/3,

Sigma, 1:50), LBPA (mAb 6C4, from J. Gruenberg, 1: 10) mannosidase II (from K.

Moremen, 1:200) were used to localize antigens. Iron-loaded rhodamine-transferrin

(Molecular Probes) was used as described (Crump et al., 2001). Following incubation with fluorescently labeled secondary antisera, all images were captured using a 63x oil immersion objective on a Leica DM-RB microscope and processed with the Scion Image

1.62 program.

MHC-1 and TGN-46- A7 cells grown to 80% confluency were infected with VV:WT, VV expressing HIV-1 Nef (m.o.i. = 10) or co-infected with VV expressing HIV-1 Nef (m.o.i.

= 3) and either PACS-1, PACS-1S278A or PACS-1S278D (m.o.i. = 7, m.o.i. = 10 total) for

5 hr. Cells were then processed for immunofluorescence. Primary antibodies to MHC-1

(mAb w6/32; 1: 100) and TGN-46 (Serotech, 1:30) were incubated at 4 C overnight followed by incubation with fluorescently labeled species-specific secondary antibodies

(Southern Biotech).

CD4 antibody uptake- A 7 cells were infected with A V expressing 44Nef, or 44NefAla

proteins for 24 hr (m.o.i. = 5) then infected with VV expressing PACS-1, PACS-1 S278A

and PACS-1S278D (m.o.i. = 10) for an additional 4 hr. The CD4 mAb Ab-2 (Labvision) was added to the media for 1 hr uptake and the cells were then washed and incubated in

59

60 60

= =

(m.o.i (m.o.i 5) 5) for for 24 24 hr. hr. The The cells cells were were washed, washed, sedimented sedimented and and resuspended resuspended in in 1 1 ml ml of of

278 confluency confluency and and 278 infected infected with with VV VV expressing expressing PACS-1, PACS-1, PACS-1 PACS-1 S A A or or PACS-1 PACS-1 S D D

Cytosol Cytosol preparation- C6 C6 control control and and AS AS 19 19 P P ACS-1 ACS-1 antisense antisense cells cells were were grown grown to to

ml ml of of HB, HB, re-sedimented re-sedimented on on a a 50% 50% sucrose sucrose cushion cushion and and stored stored at at -70°C. -70°C.

cold cold PAPS, PAPS, followed followed by by incubation incubation for for 15 15 min min at at RT. RT. Membranes Membranes were were then then diluted diluted to to 4 4

ATP ATP (pH (pH 7.0), 7.0), 800 800 mM mM creatine creatine phosphate, phosphate, 4 4 mg/ml mg/ml creatine creatine kinase), kinase), and and 10 10 Jll Jll of of 5 5 mM mM

MgOAc, MgOAc, 60 60 mM mM KCl KCl and and supplemented supplemented with with 60 60 Jll Jll ATP ATP regenerating regenerating system system (100 (100 mM mM

2 were were diluted diluted to to 2 2 ml ml H adjusted adjusted to to 0, 0, 12.5 12.5 mM mM Hepes Hepes pH pH 7.0, 7.0, 1 1 mM mM OTT, OTT, 1.5 1.5 mM mM

sucrose sucrose cushion cushion (Beckman (Beckman TLS TLS 55, 55, 45k 45k rpm, rpm, 20 20 min). min). 500 500 !!1 !!1 of of resuspended resuspended membranes membranes

a a 22g 22g needle, needle, post-nuclear post-nuclear supernatant supernatant (PNS) (PNS) was was collected, collected, and and sedimented sedimented over over a a 50% 50%

inhibitors inhibitors (Boehringer (Boehringer Mannheim). Mannheim). The The cells cells were were passed passed repeatedly repeatedly ( ( -10 -10 times) times) through through

homogenization homogenization buffer buffer (HB; (HB; 8.5% 8.5% sucrose sucrose (w/v) (w/v) in in 3 3 mM mM imidazole) imidazole) containing containing protease protease

were were washed washed twice twice with with cold cold PBS, PBS, scraped scraped into into PBS, PBS, pelleted pelleted and and resuspended resuspended in in 4 4 ml ml

= = (m.o.i. (m.o.i. 2) 2) for for 16 16 hr, hr, and and then then treated treated with with 20 20 !!g/ml !!g/ml cycloheximide cycloheximide for for 4 4 hr. hr. The The cells cells

cultured cultured in in sulfate-free sulfate-free media media (Sigma) (Sigma) for for 24 24 hr, hr, infected infected with with AV AV expressing expressing 44Nef- Y Y

with with several several modifications modifications (Itin (Itin et et al., al., 1997). 1997). Membrane Membrane preparation- A 7 7 A cells cells were were

The The endosome-to- TGN TGN transport transport assay assay is is based based on on a a previously previously published published method method but but

In In vitro vitro transport transport assay assay

(Serotech) (Serotech) followed followed by by secondary secondary mouse-FITC mouse-FITC and and sheep- TxRd TxRd antibodies. antibodies.

paraformaldehyde, paraformaldehyde, permeabilized permeabilized with with Triton-XlOO Triton-XlOO and and stained stained with with sheep sheep anti-TGN46 anti-TGN46

the the absence absence of of antibody antibody for for an an additional additional 30 30 min. min. The The cells cells were were fixed fixed with with 4% 4%

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

cytosol buffer (100 mM KCl, 8.5% sucrose w/v, 1 mM MgC12, 20 mM Hepes (pH 7.4)).

The resuspended cells were passed through a 22g needle and the post-nuclear supernatant was clarified (Beckman TLA100.3, 45k rpm, 30 min). The cytosol layer (lower) was collected and stored at -70°C.

In vitro re-sulfation assay- A 200 Ill reaction containing cytosol (1 mg/ml), donor membrane, an ATP regenerating system and 35S-PAPS (NEN, 20uCi/assay) was incubated at 3]CC for one hr. The membranes were solubilized in IP buffer (20 mM Tris pH 7.4, 200mM NaCl, 1% NP40) and the 44Nef-Y- chimera was immunoprecipitated with anti CD4 mAb Ab-4 (Calbiochem) at 4°C. Immune complexes were collected with protein G sepharose, separated by SDS-PAGE, analyzed by autoradiography for 35S incorporation and western blotted for 44Nef-Y protein load.

61

62 62

Frontiers Frontiers of of Science Science Program. Program.

Traveling Traveling Research Research Fellowship Fellowship from from the the Wellcome Wellcome Trust. Trust. F.G. F.G. is is funded funded by by the the Human Human

supported supported by by NIH NIH grants grants DK37274, DK37274, AI49793 AI49793 and and AI48585. AI48585. C.M.C. C.M.C. is is funded funded by by a a Prize Prize

acid acid analysis analysis and and members members of of the the Thomas Thomas lab lab for for helpful helpful discussions. discussions. This This work work was was

purified purified PACS-1 PACS-1 antiserum, antiserum, D. D. Brickey Brickey (Vollum (Vollum Institute) Institute) for for help help with with phosphoamino phosphoamino

reagents reagents and and advice. advice. We We thank thank Blagoveshchenskaya Blagoveshchenskaya A. A. (Vollum (Vollum Institute) Institute) for for the the affinity affinity

(Stanford (Stanford University) University) and and D. D. Trono Trono (University (University of of Geneva) Geneva) for for their their generous generous gifts gifts of of

Geneva), Geneva), B. B. Hoflack Hoflack (Pasteur (Pasteur Institute), Institute), K. K. Moremen Moremen (University (University of of Georgia), Georgia), S. S. Pfeffer Pfeffer

We We thank thank D. D. Litchfield Litchfield (University (University of of Western Western Ontario), Ontario), J. J. Gruenberg Gruenberg (University (University of of

Acknowledgments Acknowledgments

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

Figure Legends

Figure 1. PACS-1 Ser278 is phosphorylated by CK2 and dephosphorylated by PP2A.

(A) Schematic diagram of PACS-1 showing the atrophin related region (ARR), the furin binding region (FBR) which interacts with cargo molecules and AP-I I AP-3 adaptor complexes, the middle region (MR) which contains the autoregulatory acidic cluster and

Ser278 , and the C-terminal region (CTR). The acidic cluster in the PACS-1 MR as well as acidic cluster sequences contained in membrane cargo molecules, which bind to the

PACS-1 FBR, are indicated. (B) In vivo phosphorylation of expressed PACS-1. BSC40 cells infected with VV recombinants expressing either epitope (HA)-tagged P ACS-1 or

32 PACS-1 S278A were labeled with Pi, and the immunoprecipitated PACS-1 proteins were separated by SDS-PAGE and analyzed by autoradiography (upper panel). A western blot using the anti-HA mAb HA.ll shows equal expression and loading of the two proteins

(lower panel). (C) In vitro CK2 phosphorylation of GST-MR. GST-MR or GST­

MRS278A was incubated with CK2 and [y-32P]ATP, separated by SDS-PAGE and analyzed by autoradiography. (D) PACS-1 MR is phosphorylated at amino acid 278.

32 GST-MR or GST-MRS278T was phosphorylated by CK2 with [y- P]ATP, separated by

SDS-PAGE, transferred to PVDF, acid hydrolyzed, and subjected to 20 thin layer chromatography. The position of phosphoserine (pS), phosphothreonine (pT) and phosphotyrosine (pY) standards are shown. (E) PP2A dephosphorylates GST-PACS-1

MR. In vitro CK2 phosphorylated 32P-GST-MR was incubated without (control) or with recombinant PP2A in the presence or absence of 10 nM okadaic acid (OA), separated by

SDS-PAGE and analyzed by autoradiography. (F) CK2 and PP2A regulate phosphorylation of endogenous PACS-1 in vivo. A7 cells were labeled with 32Pi, treated

63

64 64

278 278 shown shown (lower (lower panels). panels). (D) (D) Mutation Mutation of of PACS-1 PACS-1 Ser does does not not effect effect binding binding to to AP-1. AP-1.

anti-HA anti-HA mAb mAb HAll HAll (top (top panel). panel). GST-Nef GST-Nef input input and and expression expression of of PACS-1 PACS-1 proteins proteins is is

agarose. agarose. PACS-1 PACS-1 proteins proteins bound bound to to GST-Nef GST-Nef were were analyzed analyzed by by western western blot blot using using the the

lysates lysates were were incubated incubated with with GST-Nef GST-Nef and and GST-Nef GST-Nef was was captured captured using using glutathione glutathione

278 PACS-1 PACS-1 S D D were were expressed expressed in in replicate replicate plates plates of of A 7 7 A cells cells using using VV VV recombinants. recombinants. Cell Cell

regulates regulates binding binding 278 to to cargo cargo proteins. proteins. Epitope-(HA)-tagged Epitope-(HA)-tagged PACS-1, PACS-1, PACS-1 PACS-1 S A A and and

775

773

Trx-furinS

278 278 D D (Trx-furin (Trx-furin S S D) D) or or Trx Trx alone alone to to the the binding binding reaction. reaction. . (C) (C) Ser -4 -4

capture capture assays assays were were performed performed as as in in (A), (A), with with the the addition addition of of varying varying concentrations concentrations of of

MR MR acidic acidic cluster cluster competes competes with with cargo cargo proteins proteins for for binding binding to to the the PACS-1 PACS-1 FBR. FBR. GST­

278 lFBR lFBR to to CK2 CK2 phosphorylated phosphorylated GST-MR GST-MR compared compared with with GST-MRS D. D. (B) (B) The The PACS-1 PACS-1

phosphorylation phosphorylation of of GST-MR GST-MR may may explain explain the the slightly slightly greater greater binding binding of of Trx-PACS­

Bound Bound Trx-PACS-lFBR Trx-PACS-lFBR was was analyzed analyzed by by western western blot blot (upper (upper panel). panel). Incomplete Incomplete

MR MR were were incubated incubated with with Trx-PACS-lFBR Trx-PACS-lFBR and and captured captured using using glutathione glutathione agarose. agarose.

278

278 PACS-1 PACS-1 FBR. FBR. GST-MR, GST-MR, GST-MRS A, A, GST-MRS D, D, or or CK2-phosphorylated CK2-phosphorylated GST­

278 278

proteins. proteins. (A) (A) Phosphorylation Phosphorylation of of PACS-1 PACS-1 Ser inhibits inhibits PACS-1 PACS-1 MR MR binding binding to to the the

278 278 Figure Figure 2. 2. Phosphorylation Phosphorylation of of PACS-1 PACS-1 Ser promotes promotes PACS-1 PACS-1 binding binding to to cargo cargo

experiments. experiments.

phosphorylation. phosphorylation. Bar Bar graphs graphs ·represent ·represent the the mean mean SE SE of of at at least least ± ± three three separate separate

normalized normalized to to PACS-1 PACS-1 protein protein loading loading and and presented presented relative relative to to control control PACS-1 PACS-1

autoradiography autoradiography was was quantified quantified using using NIH NIH image image 1.61 1.61 software. software. P P incorporation incorporation was was

32

immunoprecipitated, immunoprecipitated, separated separated by by SDS-PAGE SDS-PAGE and and analyzed analyzed by by autoradiography. autoradiography. All All

or or not not with with either either DRB DRB or or 20 20 nM nM 100~-tM 100~-tM OA, OA, and and endogenous endogenous PACS-1 PACS-1 was was

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

Epitope-(HA)-tagged PACS-1, PACS-1S278A, PACS-1S278D or PACS-lAdmut were expressed in A 7 cells and immunoprecipitated with mAb HAll. Precipitated proteins were separated by SDS-PAGE and analyzed by western blot using mAb 100/3 (AP-1) or mAb PACS-1. All data were quantified as described in the legend to Figure 1.

Figure 3. Phosphorylated PACS-1 directs endosome-to-TGN transport. (A) PACS-1

S278A expression disrupts the TGN localization of 44Nef. A 7 cells were infected with

recombinant virus expressing 44Nef as well as PACS-1, PACS-1 S278A or PACS-1 S278D.

Localization of 44Nef was determined by CD4 antibody uptake. The cells were fixed, permeabilized and co-stained with the TGN marker anti-TGN46 followed by fluorescent secondary antisera. As a control, a mutant Nef reporter, 44NefAla, which does not bind

PACS-1, was also expressed. (B) PACS-1 directs endosome-to-TGN sorting in a cell free assay. A7 cells were infected with AV expressing 44Nef-Y after which membranes from these cells were harvested and quenched with cold PAPS. The quenched membranes were incubated in the absence (background, bkg) or presence of cytosol from C6,

(control), AS 19 (P ACS-1 antisense) or from AS 19 cells expressing PACS-1

(AS19+PACS-l), PACS-1 S278A (AS19+ S278A) or PACS-1 S278D (AS19 +S 278D) and with the sulfate donor 35S-PAPS. 44Nef-Y was immunoprecipitated and 35S incorporation was determined by autoradiography, and protein load by western blot. 35S incorporation was quantified using NIH image 1.61 software, normalized for protein load and presented relative to 44Nef-Y labeling with AS19 cytosol. Bar graph represents the mean± SE of three separate experiments.

65

66 66

278 278

phosphorylation phosphorylation of of Ser disrupts disrupts the the PACS-1 PACS-1 MR-FBR MR-FBR interaction interaction and and permits permits binding binding

278 thereby thereby preventing preventing cargo cargo binding. binding. This This conformation conformation is is mimicked mimicked by by P P ACS-1 ACS-1 S A. A. CK2 CK2

278 278 In In the the Ser nonphosphorylated nonphosphorylated state, state, the the PACS-1MR PACS-1MR is is bound bound to to the the PACS-1 PACS-1 FBR, FBR,

Figure Figure 6. 6. A A working working model model of of the the CK2/PP2A CK2/PP2A regulation regulation of of PACS-1 PACS-1 sorting sorting activity. activity.

to to fixation. fixation.

mannosidase mannosidase A A replicate replicate II. II. plate plate of of cells cells was was incubated incubated with with rhodamine-transferrin rhodamine-transferrin prior prior

278 PACS-1S fixed, fixed, were D D permeabilized permeabilized and and stained stained with with anti-y-adaptin, anti-y-adaptin, anti-LBPA, anti-LBPA, anti­

secondary secondary 278 antisera. antisera. A A cells cells infected infected (B) (B) 7 7 with with VV VV expressing expressing PACS-1, PACS-1, PACS-1 PACS-1 S A A or or

anti- TGN46 TGN46 and and either either M1 M1 (fur/flag) (fur/flag) or or anti-CI-MPR anti-CI-MPR followed followed by by fluorescently fluorescently labeled labeled

278 278 PACS-1S A A or or PACS-1S D. D. The The cells cells were were fixed, fixed, permeabilized permeabilized and and incubated incubated with with

A 7 7 A cells cells were were co-infected co-infected with with VV VV co-expressing co-expressing flag-tagged flag-tagged furin furin (fur/f) (fur/f) and and PACS-1, PACS-1,

278 Figure Figure 5. 5. Expression Expression of of PACS-1 PACS-1 S A A disrupts disrupts furin furin and and CI-MPR CI-MPR localization. localization. (A) (A)

active. active.

pattern pattern than than that that observed observed with with controls, controls, indicating indicating this this PACS-1 PACS-1 mutant mutant is is constitutively constitutively

278 experiments experiments P P ACS-1 ACS-1 S causes causes cargo cargo D D proteins proteins to to show show a a more more compact compact TGN TGN staining staining

on on MHC-I MHC-I localization localization (Blagoveshchenskaya (Blagoveshchenskaya et et al., al., 2002 2002 and and data data not not shown). shown). In In many many

fluorescently fluorescently labeled labeled secondary secondary antisera. antisera. The The expression expression of of PACS-1 PACS-1 alone alone has has no no effect effect

were were fixed, fixed, permeabilized permeabilized and and incubated incubated with with anti anti MHC-I MHC-I and and anti- TGN46 TGN46 followed followed by by

278 278 recombinants recombinants expressing expressing Nef Nef and and either either PACS-1, PACS-1, PACS-1S A A or or PACS-1S D. D. Cells Cells

downregulation. downregulation. 7 7 A A cells cells were were infected with with infected VV:WT VV:WT or or co-infected co-infected with with VV VV

278 Figure Figure 4. 4. Expression Expression of of PACS-1 PACS-1 S A A blocks blocks HIV-1 HIV-1 Nef-mediated Nef-mediated MHC-1 MHC-1

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

of cargo molecules to the FBR. This conformation is mimicked by PACS-1S278D. In addition, CK2 phosphorylation of cargo proteins increases their affinity for activated

PACS-1 and thus their association with AP-1 (Crumpet al., 2001; Teuchert et al., 1999).

Inactivation of PACS-1 sorting activity is achieved by PP2A-catalyzed

dephosphorylation of Ser278 , which promotes binding of the PACS-1 MR and FBR regions. Whether the MR and FBR domains interact intramolecularly as depicted or intermolecularly remains to be determined.

67

68 68

Figure Figure 1 1

qq~ qq~

q q q~ q~

'lt"G 'lt"G i>.,. i>.,.

~~ ~~

4'' 4'' ...... q~ q~ ii ii

'~ '~ i>.,. i>.,. vq"' vq"' ~~ ~~

" " R R

d. d.

::1 ::1

d. d.

~ ~ f/) f/)

fo!. fo!.

:E :E 50 50

(J (J

;b1 ;b1 a: a:

! !

! !

:; :;

'S 'S

f1oo f1oo

~200 ~200

'i' 'i'

E E F F

~~ ~~

k~-

_,S.~ _,S.~ G G

(+)+pHT.g (+)+pHT.g ~+q;. ~+q;. ; ;

( ( ) ) ......

GST-IIRS-T GST-IIRS-T 0 0

R R

d. d. ;~-,-~ ~ ; : :

pY pY

C) C)

en en

fo!. fo!. pT pT ~ ~

50 50

:E :E

a: a:

! !

GST-IIR GST-IIR

'S 'S

~100 ~100

c c 'i' 'i' D D

q't-G q't-G

q q q q

~' ~' .1- 'lt"{Jq"' 'lt"{Jq"' ......

I I I I

PACS-1 PACS-1 WB WB

P-Wbeling P-Wbeling

12

nef nef HIV - . . 1 1 O., , EEEEVG EEEEVG .. ..

.------. .------.

CI-MPR CI-MPR

V..,.SFHDDSOEDLLkl V..,.SFHDDSOEDLLkl 0 0

Furin Furin o,.EECPSOSEEOEGRG o,.EECPSOSEEOEGRG

Binding Binding

Cargo Cargo binding binding

AP-1 , AP-3 AP-3

::1 ::1

d. d.

~ ~

50 50

(J (J

0 0

......

! !

CD CD ~100 ~100 A A B B

Chapter Chapter 2. 2. PACS-1 PACS-1 Activation Activation Chapter 2. PACS-1 Activation

A B

-100 ~ i ! a: CD &L GST GST-PAC5-1 MR GST GST-PAC5-1 MR >< 50 a: TRX-PAC5-1FBRI --- - - ; ----1 ,.... c c 5 50 500 5 50 500 nM :I • 0 Trx-furinS-D Trx CD Protein Load 0 GST~CS-1G:: J·_------_-::.::...---~~------:._-_-_::..=-_-_--.,1 I I I I MR MR MR- MR- CK2 S278A S2780 I I I Bound I TRX-FBR ~=:=:=:=:=:=::::::::

GS~MR II ..-.· .. ·~--·

> •;: • !.,.. th u 100 ,f c :I 0 CD

_inQ.UL 0 PACS-1 I !======~

Figure 2

69 OL

8 Chapter 2. PACS-1 Activation

MHC-1 TGN46

Figure 4

71 ZL

n uuew IJ. YdBl 1.-dY 8

9tNOJ. l::ldN 9tNOJ. v Chapter 2. PACS-1 Activation

CK2

PP2A ...... T

Figure 6

73

74 74

Laurel Laurel Thomas Thomas and and I I performed performed experiments experiments in in Figures Figures 2, 2, 6A 6A and and 6B. 6B.

Figures Figures lC, lC, lH, lH, 4, 4, 5, 5, 6d 6d and and 6E. 6E. Hao Hao Fei Fei and and performed performed experiments experiments I I in in Figure Figure lG. lG.

Medigeshi Medigeshi performed performed experiments experiments in in Figures Figures 3D 3D and and 3E; 3E; I I performed performed experiments experiments in in

In In this this chapter, chapter, Hao Hao Fei Fei performed performed experiments experiments in in Figures Figures lD, lD, IE, IE, lF; lF; Guruprasad Guruprasad

Submitted Submitted for for publication publication

e-mail: e-mail: [email protected] [email protected]

Fax: Fax: (503) (503) 494-1218 494-1218

Tel: Tel: (503) (503) 494-6955 494-6955

Corresponding Corresponding author author

3

OHSU, OHSU, Portland, Portland, Oregon. Oregon.

Angeles, Angeles, California California 90095. 90095. Department Department of of Molecular Molecular Microbiology Microbiology and and Immunology, Immunology,

2

Current Current Address: Address: Department Department of of Psychiatry Psychiatry and and Biobehavioral Biobehavioral Sciences, Sciences, UCLA, UCLA, Los Los

1

USA USA

Vollum Vollum Institute, Institute, L-4 L-4 7 7 4, 4, 3181 3181 SW SW Sam Sam Jackson Jackson Park Park Road, Road, Portland, Portland, Oregon Oregon 97239 97239

MEDIGESHI AND AND GARY GARY THOMAS

2 2 3 3

GREGORY GREGORY K. K. SCOTT, SCOTT, HAO HAO FEI LAUREL LAUREL THOMAS, THOMAS, GURUPRASAD GURUPRASAD R. R. , ,

1

· · TRAFFICKING TRAFFICKING

A A PACS-1, PACS-1, GGA3 GGA3 AND AND CK2 CK2 COMPLEX COMPLEX REGULATES REGULATES CI-MPR CI-MPR

CHAPTER3 CHAPTER3

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

Abstract

The cation-independent mannose-6-phosphate receptor (CI-MPR) follows a highly regulated sorting itinerary to deliver hydrolases from the trans-Golgi network (TGN) to lysosomes. Cycling of CI-MPR between the TGN and early endosomes is mediated by

GGA3, which directs TGN export, and PACS-1, which directs endosome-to-TGN retrieval. Despite executing opposing sorting steps, GGA3 and PACS-1 bind to an overlapping CI-MPR trafficking motif and their sorting activity is controlled by the CK2 phosphorylation of their respective autoregulatory domains. But how CK2 coordinates these opposing roles is unknown. We report a CK2-activated phosphorylation cascade controlling PACS-1- and GGA3-mediated CI-MPR sorting. PACS-1links GGA3 to CK2, forming a multimeric complex required for CI-MPR sorting. PACS-1-bound CK2 stimulates GGA3 phosphorylation, releasing GGA3 from CI-MPR and early endosomes.

Bound CK2 also phosphorylates PACS-1Ser278 , promoting binding of PACS-1 to CI­

MPR to retrieve the receptor to the TGN. Our results identify a CK2-controlled cascade regulating hydrolase trafficking and sorting of itinerant proteins in the TGN/endosomal system.

Key Words: PACS-1/GGA3/CK2/CI-MPR/endosome

75

76 76

receptor. receptor.

highly highly regulated regulated and and complex complex trafficking trafficking pathway pathway followed followed by by this this multifunctional multifunctional

2004; 2004; Diaz Diaz and and Pfeffer, Pfeffer, 1998; 1998; Saint-Pol Saint-Pol et et al., al., 2004; 2004; Seaman, Seaman, 2004), 2004), supporting supporting the the

and and EpsinR EpsinR also also function function in in the the endosome-to- TGN TGN retrieval retrieval of of CI-MPR CI-MPR (Arighi (Arighi et et al., al.,

2000; 2000; Wan Wan et et al., al., 1998). 1998). In In addition, addition, sorting sorting other molecules molecules including including TIP47, TIP47, Retromer, Retromer,

retrieval, retrieval, are are required required to to localize localize CI-MPR CI-MPR to to the the TGN TGN (Crump (Crump et et al., al., 2001; 2001; Meyer Meyer et et al., al.,

Bonifacino, Bonifacino, 2004). 2004). By By contrast, contrast, PACS-1 PACS-1 and and AP-1, AP-1, which which mediate mediate endosome-to-TGN endosome-to-TGN

endosomal endosomal compartments compartments (Doray (Doray et et al., al., 2002c; 2002c; Mattera Mattera et et al., al., 2003; 2003; Puertollano Puertollano and and

clathrin-coated clathrin-coated vesicles vesicles at at the the TGN TGN and and may may also also mediate mediate CI-MPR CI-MPR trafficking trafficking between between

2000; 2000; Puertollano Puertollano et et al., al., 2001b; 2001b; Wan Wan et et al., al., 1998). 1998). The The GGAs GGAs sort sort the the CI-MPR CI-MPR into into

sort sort cathepsin cathepsin D D to to lysosomes lysosomes (Chen (Chen et et al., al., 1997a; 1997a; Ghosh et et Ghosh al., al., 2003b; 2003b; Meyer Meyer et et al., al.,

each each of of these these three three groups groups of of sorting sorting molecules molecules to to localize localize to to the the TGN TGN and and to to efficiently efficiently

cation-independent cation-independent mannose-6-phosphate mannose-6-phosphate receptor receptor (CI-MPR), (CI-MPR), requires requires motifs motifs that that bind bind to to

motifs, motifs, which which bind bind to to P P ACS ACS proteins. proteins. The The cytosolic cytosolic domain domain of of one one membrane membrane protein, protein, the the

acidic-dileucine acidic-dileucine (DxxLL) (DxxLL) based based motifs, motifs, which which bind bind to to GGAs GGAs and and acidic acidic cluster cluster based based

([D/E]xxxL[LII]) ([D/E]xxxL[LII]) based based signals, signals, which which bind bind to to the the heterotetrameric heterotetrameric adaptors adaptors (APs), (APs),

machinery machinery (Robinson, (Robinson, 2004). 2004). These These motifs motifs include include tyrosine tyrosine (YXX) (YXX) and and dileucine dileucine

cytosolic cytosolic domains, domains, which which are are recognized recognized by by components components of of the the vesicular vesicular trafficking trafficking

Golgi Golgi network network (TGN)/endosomal (TGN)/endosomal system system relies relies upon upon canonical canonical sorting sorting motifs within within motifs their their

The The localization localization and and trafficking trafficking of of itinerant itinerant membrane membrane cargo cargo proteins proteins within within the the trans­

Introduction Introduction

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

We identified PACS-1 through its binding to the protein kinase CK2 (CK2) phosphorylated acidic cluster ( ... EECPpSDpSEEDE ... ) on the furin cytosolic domain

(Fig. IA and (Wan et al., 1998). The 140 amino acid PACS-1 cargo binding region (FBR,

Fig. 1A) contains an 8-amino acid segment ETELQL TF175 that binds AP-I, and is required for correct subcellular localization of furin and CI-MPR to the TGN (Crumpet al., 2001 ). PACS-1 also binds to acidic cluster motifs on several additional itinerant cellular proteins (Thomas 2002), including proprotein convertase 6B (Xiang et al., 2000), polycystin-2 (Kottgen et al., 2005) and VAMP4 (Hinners et al., 2003), as well as the viral proteins HCMV gB (Crump et al., 2003) and HIV -1 Nef (Piguet et al., 2000). Studies using interfering mutant-, siRNA- and antisense-based methods show PACS-1 is required for the TGN localization of each of these proteins, suggesting a broad role for PACS-1 in cellular homeostasis and disease.

Similar to furin, binding of PACS-1 to the CI-MPR cytosolic domain (CI-MPRc0 ) requires the CK2 phosphorylatable acidic cluster ... DDpSDEDLLHI, located at the CI­

MPRco C-terminus (Wan et al., 1998). Interestingly, the three GGA family members (1-

3) also bind to this phosphorylated motif on the CI-MPRco but require the dileucine motif for binding, which furin lacks (Puertollano et al., 2001a). The GGAs contain three principal domains including the VHS domain, which binds to cargo proteins, the GAT domain, which binds to ARFl, a hinge segment, which ·binds clathrin and contains an autoregulatory acidic-dileucine motif (GGAl and 3 only), and the GAE domain, which binds to several accessory proteins (Fig. lB and Bonifacino, 2004). Through these interactions, the GGAs function as monomeric clathrin adaptors that link itinerant cargo

77

78 78

The The requirement requirement for for CK2 CK2 phosphorylation phosphorylation for for the the regulation regulation of of PACS-1, PACS-1, GGA1 GGA1 and and

polyamines polyamines or or substrate substrate proteins proteins can can increase increase kinase kinase activity activity 3-fold 3-fold (Litchfield, (Litchfield, 2003). 2003).

kinase kinase has has long long remained remained enigmatic, enigmatic, B B though though the the binding binding of of the the regulatory regulatory subunit subunit to to

B B regulatory regulatory subunits subunits (Meggio (Meggio and and Pinna, Pinna, 2003). 2003). The The regulation regulation of of this this basally basally active active

and and is is a a heterotetramer heterotetramer composed composed of of two two catalytic catalytic subunits subunits or or (a (a and and a, a, two two a a a', a', a' a' a') a')

CK2 CK2 is is a a ubiquitous ubiquitous protein protein kinase kinase with with more more than than 300 300 putative putative polypeptide polypeptide substrates substrates

(Doray (Doray et et al., al., 2002b). 2002b).

CK2 CK2 phosphorylation phosphorylation of of GGA1 GGA1 or or 3 3 autoregulatory autoregulatory domains domains inhibits inhibits cargo cargo binding binding

the the PACS-1 PACS-1 autoregulatory autoregulatory domain domain promotes promotes cargo cargo binding binding (Scott (Scott et et al., al., 2003), 2003), whereas whereas

autoregulatory autoregulatory domain domain inhibits inhibits binding binding to to CI-MPR. CI-MPR. Therefore, Therefore, CK2 CK2 phosphorylation phosphorylation of of

355 355

388 GGA1Ser (which (which corresponds corresponds to to GGA3Ser see see Fig. Fig. 1B) 1B) within within the the GGA1 GGA1 , ,

segment segment (Doray (Doray et et al., al., 2002b; 2002b; Ghosh Ghosh and and Kornfeld, Kornfeld, 2003a). 2003a). Phosphorylation Phosphorylation of of

by by CK2 CK2 phosphorylation phosphorylation of of an an autoregulatory autoregulatory domain domain within within the the GGA1 GGA1 and and GGA3 GGA3 hinge hinge

HIV-1 HIV-1 Nef. Nef. Similar Similar to to PACS-1, PACS-1, GGA1 GGA1 and and GGA3 GGA3 binding binding to to cargo cargo proteins proteins is is regulated regulated

cargo cargo binding binding and and is is required required for for the the endosome-to-TGN endosome-to-TGN transport transport of of furin, furin, CI-MPR CI-MPR and and

278 278 Phosphorylation Phosphorylation of of PACS-1 PACS-1 Ser within within the the PACS-1 PACS-1 autoregulatory autoregulatory domain domain activates activates

controlled controlled phosphorylation phosphorylation of of an an autoregulatory autoregulatory domain domain (Scott (Scott et et al., al., 2003). 2003).

cargo cargo binding. binding. The The sorting sorting activity activity of of PACS-1 PACS-1 is is regulated regulated by by the the CK2- and and PP2A­

The The functional functional similarities similarities shared shared by by P P ACS-1 ACS-1 and and GGAs GGAs extend extend to to regulation regulation of of their their

0 0 overlapping overlapping binding binding sites sites on on the the CI-MPRc is is not not known. known.

directly directly to to clathrin clathrin (Puertollano (Puertollano et et al., al., 2001b). 2001b). However, However, why why GGAs GGAs and and PACS-1 PACS-1 share share

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

GGA3 action led us to determine how this kinase may control the PACS-1 and GGA3- mediated trafficking of CI-MPR. We report that PACS-1 binds to GGA3 and recruits

CK2, forming a multimeric complex, which regulates PACS-1/GGA3-mediated sorting of CI-MPR between the TGN and early endosomes. Together our results describe a novel cellular mechanism for the phospho-regulation of membrane protein traffic through the

TGN/endosomal system.

79

80 80

identical identical and and 83% 83% homologous. homologous. Serial Serial mutation mutation of of non-homologous non-homologous amino amino acids acids was was

to to GGA3 GGA3 (Simmen (Simmen et et al., al., 2005). 2005). Through Through the the FBR, FBR, PACS-1 PACS-1 and and PACS-2 PACS-2 are are 75% 75%

PACS-1 PACS-1 homologue, homologue, PACS-2, PACS-2, an an ER/mitochondria ER/mitochondria trafficking trafficking protein protein that that does does not not bind bind

To To further further define define the the GGA3 GGA3 binding binding site site on on the the PACS-1 PACS-1 FBR, FBR, we we took took advantage advantage of of a a

binding binding regions. regions.

results results demonstrate demonstrate a a direct direct interaction interaction between between PACS-1 PACS-1 and and GGA3 GGA3 through through their their cargo cargo

0

which which binds binds the the CI-MPRc was was sufficient sufficient to to bind bind Trx-PACS-1FBR Trx-PACS-1FBR (Fig. (Fig. 1E). 1E). These These , ,

using using purified purified GST-GGA3 GST-GGA3 constructs constructs (Fig. (Fig. 1B) 1B) showed showed that that the the GGA3 GGA3 VHS VHS domain, domain,

CI-MPRco, CI-MPRco, was was able able to to precipitate precipitate Trx-GGA3vHs+GAT- Reciprocal Reciprocal mapping mapping experiments experiments

tagged tagged GGA3vHs+GAT GGA3vHs+GAT (Fig. (Fig. 1D). 1D). Only Only GST-PACS-1FBR• GST-PACS-1FBR• which which binds binds to to cargo cargo including including

corresponding corresponding to to predicted predicted domains domains of of PACS-1 PACS-1 (Fig. (Fig. 1A) 1A) to to capture capture Thioredoxin Thioredoxin (Trx)­

of of PACS-1, PACS-1, we we used used glutathione-S-transferase glutathione-S-transferase (GST)-tagged (GST)-tagged PACS-1 PACS-1 fusion fusion proteins proteins

determine determine if if PACS-1 PACS-1 bound bound directly directly to to GGA3 GGA3 and and to to identify identify the the GGA3 GGA3 binding binding region region

rat rat brain brain cytosol cytosol (RBC) (RBC) and and found found that that GGA3 GGA3 co-precipitated co-precipitated with with PACS-1 PACS-1 (Fig. (Fig. 1 1 C). C). To To

GGA3 GGA3 and and PACS-1 PACS-1 associate associate in in vivo. vivo. Accordingly, Accordingly, we we immunoprecipitated immunoprecipitated PACS-1 PACS-1 from from

2001a; 2001a; Scott Scott et et al., al., 2003; 2003; Wan Wan et et al., al., 1998). 1998). These These common common properties properties led led us us to to ask ask if if

phosphorylation phosphorylation of of an an autoregulatory autoregulatory domain domain (Doray (Doray et et al., al., 2002b 2002b ;Puertollano ;Puertollano et et al., al.,

cluster cluster and and the the regulation regulation of of their their binding binding to to membrane membrane cargo cargo by by the the CK2 CK2

biochemical biochemical functions. functions. These These include include binding binding to to the the CI-MPRco CI-MPRco at at a a C-terminal C-terminal acidic acidic

Despite Despite regulating regulating opposing opposing CI-MPR CI-MPR trafficking trafficking steps, steps, PACS-1 PACS-1 and and GGAs GGAs share share several several

PACS-1 PACS-1 binds binds to to GGA3 GGA3

Results Results

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking used to identify residues in the PACS-1 FBR required for binding GGA3. Using this

approach, we found that mutation of P ACS-1 FBR residues K249IY to the corresponding

PACS-2 residues (W 171 IA; hereafter PACS-1 FBR-GGAmut) disrupted GGA3 binding

(Fig. IF). Because the PACS-1 FBR also binds AP-1 and CI-MPR, we tested whether the

K 249 Y 251 ~ W A substitution interfered with binding to these molecules (Fig. 1G). Protein

binding studies showed that the K 249Y251 ~ WA substitution had no effect on GST-PACS-

1FBR binding to purified AP-1 or Trx-tagged CI-MPRco· Therefore, we introduced the

K 249Y251 ~ WA mutation into full-length PACS-1 (hereafter PACS-1GGArnu1), and compared the ability of hemagglutinin (HA)-tagged PACS-1 and HA-PACS-1GGArnut to co-immunoprecipitate co-expressed myc-GGA3 (Fig. 1H). In agreement with our in vitro binding studies, we found that myc-GGA3 co-immunoprecipitated with HA-PACS-1, but not with HA-PACS-1GGArnut· Thus, we identified a PACS-1 mutant that does not bind

GGA3 and whose binding to cargo proteins or AP-1 is unaffected.

Blocking the PACS-1/GGA3 interaction disrupts CI-MPR and GGA3 localization

We expressed P ACS-1GGArnut in cells to determine if P ACS-1 binding to GGA3 is required for the steady state localization of their mutual cargo protein: CI-MPR. In control cells or

PACS-1-expressing cells, CI-MPR demonstrated a paranuclear staining pattern that

overlapped with TGN46 (Fig. 2A). However, in PACS-1GGArnu 1-expressing cells, CI-MPR

showed a pronounced redistribution to an endosomal population that overlapped with the early endosomal marker EEAl. As a control, we asked whether PACS-1GGArnut disrupted the localization of furin, which requires PACS-1 for endosome-to-TGN retrieval (Wan et al., 1998), but lacks the canonical D/ExxLL GGA-binding motif (Fig. 2B). We found that

81 Chapter 3. Regulation of Cl-MPR Trafficking expression of PACS-1 or PACS-1GGAmut failed to affect the TGN localization of FLAG­ furin, suggesting that PACS-1GGAmut selectively disrupts the trafficking of itinerant cargo that depend on binding to both PACS-1 and GGAs. Because GGA3 distributes between the TGN and early endosomes (Puertollano and Bonifacino, 2004), we also examined the

localization of GGA3 in PACS-1GGAmu1-expressing cells (Fig. 2C). We found that expression of PACS-1GGAmut• but not PACS-1, caused a striking redistribution of GGA3 from a paranuclear localization to a dispersed endosome population that overlapped with the redistributed CI-MPR. In addition, we tested the effect of an interfering mutant

PACS-1 molecule, PACS-1Actmut• which fails to bind AP-1 and redistributes the CI-MPR and furin from the TGN (Crumpet al., 2001), on the localization of GGA3. We observed no effect of PACS-1Actmut expression on the localization of GGA3 (Fig. 2C), suggesting that the redistribution of GGA3 to endosomal compartments induced by PACS-1GGAmut expression results from the inability of PACS-1GGAmut to interact with GGA3. These findings suggest the PACS-1/GGA3 interaction is required for CI-MPR retrieval and for release of GGA3 from endosomal membranes.

PACS-1 is required for CI-MPRfunction

To better understand how PACS-1 and GGA3 might cooperate to direct trafficking of CI­

MPR, we conducted protein-protein binding assays to define the PACS-1 binding site on the CI-MPRco· Previously, we found that truncation of the last ten amino acids

( ... DDpS2484DEDLLHI) of the CI-MPRc0 , which contain a CK2 phosphorylatable acidic cluster and constitutes a DxxLL GOA-binding motif, abolished binding to the FBR region of PACS-1 (Wan et al., 1998). We used a GST-pull down strategy to determine

82 Chapter 3. Regulation of Cl-MPR Trafficking which CI-MPRco residues mediate direct binding to the PACS-1 FBR. First, we sought to determine if, similar to the interaction of PACS-1 and furin (Wan et al., 1998), as well as

the CI-MPR with GGA3 (Kato et al., 2002), phosphorylation of CI-MPR Ser2484 would enhance binding to the PACS-1 FBR (Fig. 3A). We tested the binding of Trx-PACS-IFBR to GST-CI-MPRco phosphorylated by CK2 or to GST-CI-MPRco mutants containing a

phosphomimic Ser2484-Asp or non-phosphorylatable Ser2484-Ala substitution. We found

that both pre-incubation of GST-CI-MPRco with CK2 and the Ser2484-Asp substitution enhanced binding to Trx-PACS-1FBR• indicating that like other PACS-1 cargo proteins,

CK2 phosphorylation of Ser2484 within the CI-MPR acidic cluster enhanced binding to

PACS-1. Next, we conducted an alanine scan of each of the acidic residues from Asp2482

to Asp2487 and found that alanine mutation of any of the acidic residues reduced binding

to Trx-PACS-1FBR (Fig. 3B). Finally, we found that Leu2488-Ala and Leu2489-Ala mutations had no effect on Trx-PACS-IFBR binding whereas these mutations completely blocked Trx-GGA3vHs-GAT binding, as previously reported (Fig. 3C and (Puertollano et al., 2001a). Thus, PACS-1 and GGA3 share overlapping but not identical CI-MPR binding sites.

The importance of CI-MPR Asp2485 , which is required for GGA binding and sorting of lysosomal enzymes (Chen et al, 1997a; Puertollano et al., 2001a), for binding to PACS-1,

as well as the requirement of PACS-1 for the TGN localization of CI-MPR (Simmen et

al., 2005; Wan et al., 1998), led us to determine if PACS-1 is required for CI-MPR

function. Therefore, we investigated the effect of PACS-1 depletion on the sorting of

lysosomal enzymes by CI-MPR. The sorting and maturation of cathepsin D, a ligand of

83 Chapter 3. Regulation of Cl-MPR Trafficking

CI-MPR, to lysosomes was followed in metabolically labeled cells. The intracellular (C) and extracellular (E) forms of cathepsin D were immunoprecipitated from both the cells and medium after pulse-chase in the presence of mannose-6-phosphate. We found that siRNA depletion of PACS-1 (Fig. 3D), which redistributes CI-MPR from the TGN

(Simmen et al., 2005), caused an -20% increase in secreted cathepsin D and a corresponding -20% decrease in intracellular cathepsin D compared to control cells (Fig.

3E). As a positive control, and in agreement with previous studies (Meyer et al., 2000), we found that siRNA depletion of the jt1A subunit of AP-1 caused -50% of the newly synthesized procathepsin D to be released into the culture medium. Additionally, we observed no change in the half-life of CI-MPR in PACS-1-depleted cells (data not shown), indicating that this increased secretion of cathepsin D does not result from decreased CI-MPR stability.

PACS-1 binds to and activates CK2

The overlapping PACS-1 and GGA3 binding sites on CI-MPR, as well as the requirement for binding of PACS-1 to GGA3 to control the TGN localization of CI-MPR, suggested that the interaction between PACS-1, GGA3 and CI-MPR is tightly regulated. One clue to the underlying mechanism controlling the PACS-1/GGA3-dependent sorting of CI­

MPR is the prominent role CK2 phosphorylation plays in the regulation of each protein

(Doray et al., 2002b; Scott et al., 2003). Although earlier studies demonstrated that an

AP-t-associated CK2 activity could phosphorylate GGA1 (Doray et al., 2002c), we speculated that a more direct association of CK2 with PACS-1 and GGA3 might afford greater signaling efficacy. Accordingly, we immunoprecipitated PACS-1 from RBC and

84 Chapter 3. Regulation of CI-MPR Trafficking assayed the bound material for co-precipitating CK2 activity (Fig. 4A). We observed a

~14 fold increase in PACS-1-associated CK2 activity compared to the control, which was blocked by the CK2-specific inhibitor TBB, but not the PKA inhibitor PKI. To identify the region of PACS-1 that associates with CK2, we used GST-PACS-1 segments (see

Fig. 1A) to capture CK2a from RBC (Fig. 4B). Similar to our analysis of GGA3 binding

(Fig. 1), we found that CK2a was captured solely by GST-PACS-1FBR· We more precisely identified PACS-1 FBR residues required for CK2 binding by testing a battery of GST-PACS-1FBR truncations and substitutions for their ability to capture CK2a from

RBC (Fig. 4C). We found a 18-amino acid segment of the PACS-1 FBR between L 194 and

A212 was required to capture CK2a (Fig. 4D). Next, we conducted an alanine scan of this

PACS-1 segment and found that an R 196RKRY ~ AAAAA substitution (hereafter called

PACS-1FBR-CKmut) blocked CK2a association with GST-PACS-1FBR whereas alanine substitution of adjacent 5-amino acid segments, including K 201 NRTI~AAAAA and

L 206 GYKT~AAAAA, did not. As a control, we observed no difference between the

binding of GST-PACS-1FBR or GST-PACS-1FBR-cKmut to purified AP-1, Trx-CI-MPRc0 , or

Trx-GGA3vHS+GAT (Fig. 4E). Thus, PACS-1 associates with CK2 in vivo and the PACS-1

FBR -CKmut substitution specifically blocks the CK2/P ACS-1 interaction.

To determine which CK2 subunit associates with PACS-1, we conducted a yeast-two­ hybrid analysis (Fig. 5A). We found that yeast expressing PACS-1 FBR and CK2~, but not CK2a or CK2a', supported growth under histidine selection. Moreover, co­ transformation of P ACS-1 FBR-cKmut with CK2~ failed to support cell growth, further

indicating that PACS-1 R 196RKRY is required for the interaction between the PACS-1

85

86 86

autoregulatory autoregulatory domain domain activates activates cargo cargo binding binding and and accounts accounts for for ,...50% ,...50% of of the the incorporated incorporated

278 278 We We previously previously determined that that determined CK2 CK2 phosphorylation phosphorylation of of Ser within within the the PACS-1 PACS-1

the the CK2 CK2 holoenzyme. holoenzyme.

(""'0.5 (""'0.5 fold) fold) effect effect on on CK2 CK2 activity. activity. Thus, Thus, PACS-1 PACS-1 FBR FBR binding binding stimulates stimulates the the activity activity of of

stimulated stimulated CK2 CK2 activity activity ""'2.5 ""'2.5 fold, fold, whereas whereas GST GST or or GST-PACS-1FBR-cKmut GST-PACS-1FBR-cKmut had had a a lesser lesser

scored scored as as incorporation incorporation of of P P into into a a peptide peptide substrate substrate (Fig. (Fig. 50). 50). GST-PACS-1FBR GST-PACS-1FBR

32

concentrations concentrations of of GST, GST, GST-PACS-1FBR GST-PACS-1FBR or or GST-PACS-1FBR-CKmut• GST-PACS-1FBR-CKmut• and and CK2 CK2 activity activity was was

assay. assay. Purified Purified bovine bovine CK2 CK2 holoenzyme holoenzyme was was pre-incubated pre-incubated with with increasing increasing

we we tested tested the the CK2~, CK2~, effect effect of of PACS-1 PACS-1 on on CK2 CK2 activity activity levels levels using using in in an an vitro vitro kinase kinase

196 R RKRY RKRY cluster cluster of of basic basic amino amino acids acids in in the the PACS-1 PACS-1 FBR FBR is is required required for for binding binding to to

acidic acidic residues residues in in the the regulatory regulatory subunit subunit (Bonnet (Bonnet et et ~ ~ al., al., 1996; 1996; Leroy Leroy et et al., al., 1997). 1997). As As the the

polycationic polycationic molecules molecules or or proteins proteins containing containing clusters clusters of of basic basic amino amino acids acids to to a a patch patch of of

One One characteristic characteristic property property of of CK2 CK2 is is the the 3-fold 3-fold activation activation observed observed upon upon binding binding of of

precipitated precipitated CK2. CK2.

vitro vitro protein protein capture capture studies, studies, we we found found that that HA-PACS-1, HA-PACS-1, but but not not HA-PACS-1cKmut• HA-PACS-1cKmut• co­

precipitating precipitating endogenous endogenous CK2a CK2a and and by by western western blot blot ~ ~ (Fig. (Fig. 5C). 5C). agreement agreement In with with in in the the

or or HA-PACS-1cKmut HA-PACS-1cKmut in in cells, cells, iminunoprecipitated iminunoprecipitated the the PACS-1 PACS-1 proteins proteins and and examined examined co­

substitution substitution in in the the context context of of full-length full-length PACS-1, PACS-1, we we expressed expressed full-length full-length HA-PACS-1 HA-PACS-1

1FsR 1FsR but but not not GST-PACS-1FBR-CKmut GST-PACS-1FBR-CKmut (Fig. (Fig. 5B). 5B). Finally, Finally, to to confirm confirm the the effect effect of of the the CKmut CKmut

a a protein-protein protein-protein binding binding assay, assay, and and found found that that bound bound directly directly Trx-CK2~ Trx-CK2~ to to GST-PACS-

FBR FBR and and To To determine determine CK2~. CK2~. if if the the P P ACS-1 ACS-1 FBR FBR binds binds directly directly to to we we conducted conducted CK2~ CK2~

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking phosphate on PACS-1 (Scott et al., 2003). Thus, our finding that PACS-1 bound and activated CK2 suggested that this interaction may be critical for regulating the phosphorylation state of PACS-1. To test this possibility, we metabolically labeled replicate plates of cells expressing full-length HA-PACS-1, HA-PACS-1cKmut or HA­

PACS-1 sz?sA with 32Pi, and quantified the amount of radio label incorporated into each protein (Fig. 5E). We observed -40% less 32P incorporation into HA-PACS-1cKmut

32 compared to HA-PACS-1, whereas HA-PACS-1s278A exhibited -60% less P incorporation compared to HA-PACS-1. This indicated that the PACS-1/CK2 interaction is required for efficient PACS-1 phosphorylation, but does not reduce PACS-1 phosphorylation to the level observed by Ser278 ~ Ala substitution. Therefore, to gauge

whether the CKmut substitution affects PACS-1 Ser278 phosphorylation, we examined the

32P incorporation into a PACS-1 sz?sA/CKmut double mutant. We predicted that if CK2 that is

bound to PACS-1 phosphorylates only Ser278 , then PACS-1s27sA/CKmut would exhibit equal

32 P incorporation compared to PACS-1s278A- Conversely, if CK2 bound to PACS-1

primarily phosphorylates residues other than Ser278 , then PACS-1smAICKmut would incorporate less 32P than PACS-1sz?sA· We observed no difference between the 32P

incorporation of HA-PACS-1s278A and HA-PACS-1s27sA/CKmut• suggesting that CK2 binding

to PACS-1 is required for efficient phosphorylation of Ser278 and thus the ability of

PACS-1 to bind cargo.

PACS-1-bound CK2 inactivates GGA3 to retrieve CI-MPR to the TGN

The inhibitory effects of the CKmut substitution suggested that PACS-1cKmut may interfere with the PACS-1-dependent sorting of membrane cargo. To test this possibility,

87

88 88

phosphorylation phosphorylation of of GGA3 GGA3 blocks blocks cargo cargo binding binding (Doray (Doray et et al., al., 2002b), 2002b), we we next next asked asked

redistribute redistribute with with CI-MPR CI-MPR to to an an endosome endosome population population (Fig. (Fig. 6C). 6C). Because Because CK2 CK2

state state localization localization of of GGA3. GGA3. Accordingly, Accordingly, we we found found that that PACS-1cKrnut PACS-1cKrnut caused caused GGA3 GGA3 to to

endosomes endosomes suggested suggested that, that, as as for for PACS-1GGAmut• PACS-1GGAmut• PACS-1cKmut PACS-1cKmut might might disrupt disrupt the the steady­

The The ability ability of of PACS-1cKrnut PACS-1cKrnut and and PACS-1GGArnut PACS-1GGArnut to to redistribute redistribute CI-MPR CI-MPR to to EEA1-positive EEA1-positive

in in the the PACS-1 PACS-1 autoregulatory autoregulatory domain. domain.

278 278 recruits recruits CK2 CK2 and and activates activates the the kinase kinase to to promote promote cargo cargo binding binding by by phosphorylating phosphorylating Ser

on on the the localization localization of of CI-MPR CI-MPR (Fig. (Fig. 6A). 6A). Together, Together, these these results results suggest suggest that that PACS-1 PACS-1

527801 by by PACS-1 PACS-1 CKrnut· CKrnut· Accordingly, Accordingly, we we found found that that expression expression of of PACS-1 PACS-1 cKrnut cKrnut had had no no effect effect

1527801cKrnut 1527801cKrnut double double mutant mutant would would override override the the disruption disruption of of CI-MPR CI-MPR localization localization caused caused

278 278 required required for for efficient efficient phosphorylation phosphorylation of of Ser (Fig. (Fig. 5), 5), we we predicted predicted that that the the PACS-

et et al., al., 2003). 2003). Therefore, Therefore, based based on on our our determination determination that that CK2 CK2 bound bound to to PACS-1 PACS-1 is is

endosome-to-TGN endosome-to-TGN trafficking trafficking caused caused by by depletion depletion of of PACS-1 PACS-1 in in a a cell-free cell-free assay assay (Scott (Scott

PACS-1-dependent PACS-1-dependent sorting sorting when when expressed expressed in in cells, cells, and and could could rescue rescue the the disruption disruption of of

52780 52780 We We previously previously showed showed that that the the phosphomimic phosphomimic construct construct PACS-1 had had no no effect effect on on

278 527801 phosphorylate phosphorylate Ser , , we we expressed expressed a a double double mutant, mutant, PACS-1 cKrnut• cKrnut• in in cells cells (Fig. (Fig. 6A). 6A).

PACS-1-dependent PACS-1-dependent trafficking trafficking solely solely because because this this mutant mutant cannot cannot bind bind CK2 CK2 to to

for for the the sorting sorting of of all all PACS-1 PACS-1 cargo cargo (Fig. (Fig. 6B). 6B). To To determine determine whether whether PACS-1cKrnut PACS-1cKrnut blocked blocked

furin furin to to redistribute redistribute from from the the TGN, TGN, suggesting suggesting that that PACS-1 PACS-1 binding binding to to CK2 CK2 is is required required

to to an an EEA1-positive EEA1-positive compartment compartment (Fig. (Fig. 6A). 6A). We We also also found found that that PACS-1cKrnut PACS-1cKrnut caused caused

CI-MPR CI-MPR and and furin. furin. Similar Similar to to PACS-1GGArnut• PACS-1GGArnut• PACS-1cKrnut PACS-1cKrnut caused caused CI-MPR CI-MPR to to redistribute redistribute

we we expressed expressed PACS-1cKrnut PACS-1cKrnut in in cells cells and and determined determined any any effect effect on on the the TGN TGN localization localization of of

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking whether the ability of PACS-1 to bind GGA3 may affect the efficiency of GGA3 phosphorylation by CK2. Therefore, we metabolically labeled cells expressing HA­

PACS-1 or HA-PACS-1cKmut with 32Pi and quantified the amount of immunoprecipitated,

32P-labeled, endogenous GGA3 (Fig. 6D). We found that HA-PACS-1 expression increased the amount of 32P-GGA3 whereas expression of HA-PACS-1cKmut reduced by

~45% the amount of 32P-GGA3. These results suggest that PACS-1 recruits CK2 to

GGA3, enabling CK2 to phosphorylate and inactivate the binding of GGA3 to CI-MPR.

To further test this possibility, we determined whether PACS-1 could form a ternary complex with GGA3 and CK2~ in vitro and found that GST-GGA3vHs+GAT could capture

Trx-CK2~ only in the presence of Trx-PACS-lFBR (Fig. 6E). Together, our results suggest

PACS-1 recruits CK2 to phosphorylate both PACS-1 and GGA3, thereby inactivating

GGA3 and activating PACS-1, thus causing PACS-1 to bind CI-MPR and direct its retrieval to the TGN.

89

90 90

lysosomal lysosomal enzyme enzyme sorting sorting (Chen (Chen et et al., al., 1997a). 1997a). Here Here we we refine refine the the CI-MPR CI-MPR residues residues

dependent dependent retrieval retrieval step step to to localize localize to to the the TGN TGN (Wan (Wan et et al., al., 1998), 1998), and and function function for for

Previously, Previously, we we and and others others reported reported that that CI-MPR CI-MPR requires requires an an acidic acidic cluster/PACS-1 cluster/PACS-1

from from endosomes endosomes to to the the TGN TGN as as depicted depicted in in the the model model shown shown in in Figure Figure 7. 7.

of of these these findings findings is is that that PACS-1 PACS-1 directs directs CK2 CK2 to to GGA3 GGA3 to to initiate initiate the the retrieval retrieval of of CI-MPR CI-MPR

binding binding of of PACS-1 PACS-1 and and GGA3 GGA3 (Doray (Doray et et al., al., 2002b; 2002b; Scott Scott et et al., al., 2003), 2003), one one interpretation interpretation

Considering Considering 6). 6). the the known known requirement requirement for for CK2 CK2 phosphorylation phosphorylation to to regulate regulate cargo cargo

278 278 1 1 Ser and and GGA3, GGA3, which which forms forms a a ternary ternary complex complex with with PACS-1 PACS-1 and and CK2B CK2B (Figs. (Figs. and and 5 5

stimulated stimulated CK2 CK2 activity activity (Fig. (Fig. and and was was 5), 5), required required for for the the phosphorylation phosphorylation of of both both PACS-

proteins proteins that that bind bind to to both both PACS-1 PACS-1 and and GGAs. GGAs. Furthermore, Furthermore, binding binding of of PACS-1 PACS-1 to to CK2B CK2B

of of PACS-1 PACS-1 with with GGA3 GGA3 is is specifically specifically required required for for the the trafficking trafficking of of a a subset subset of of cargo cargo

PACS-1cKmut PACS-1cKmut disrupted disrupted TGN TGN localization localization of of furin furin (Fig. (Fig. suggesting suggesting 6), 6), that that the the interaction interaction

GGA3 from the the from GGA3 TGN TGN to to an an early early endosomal endosomal compartment compartment (Figs. (Figs. 2 2 and and However, However, 6). 6). only only

Expression Expression of of PACS-1GGAmut PACS-1GGAmut or or PACS-1cKmut PACS-1cKmut caused caused the the redistribution redistribution of of the the CI-MPR CI-MPR and and

PACS-1 PACS-1 to to CK2B, CK2B, but but did did not not affect affect cargo, cargo, adaptor adaptor or or GGA3 GGA3 binding binding (Figs. (Figs. 4 4 and and 5). 5).

196

1 mutation mutation of of the the R RKRY RKRY basic basic amino amino acid acid cluster cluster (PACS-1cKmu blocked blocked binding binding of of ), ),

GGA3, GGA3, but but had had no no effect effect on on adaptor, adaptor, cargo cargo protein protein or or CK2 CK2 binding binding (Fig. (Fig. Likewise, Likewise, 1). 1).

249 249 251 251 Substitution Substitution of of PACS-1 PACS-1 residues residues K Y Y (PACS-1GGAmut) (PACS-1GGAmut) blocked blocked binding binding of of PACS-1 PACS-1 to to

PACS-1 PACS-1 FBR FBR binds binds directly directly to to the the cargo-binding cargo-binding VHS VHS domain domain of of GGA3 GGA3 (Fig. (Fig. 1). 1).

complex complex to to regulate regulate the the endosomal endosomal sorting sorting and and TGN TGN retrieval retrieval of of CI-MPR. CI-MPR. We We found found that that

The The results results presented presented here here show show that that P P ACS-1, ACS-1, GGA3 GGA3 and and CK2 CK2 form form a a multimeric multimeric

Discussion Discussion

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

required for PACS-1 binding to include phosphorylation of Ser2484 as well as the presence

of surrounding acidic residues, but not LL2489 required for GGA3 binding (Fig. 3 and

(Puertollano et al., 2001 a). Thus, PACS-1 and GGA3 bind to overlapping but distinct motifs on the CI-MPR. In addition, siRNA depletion of PACS-1 disrupted maturation and lysosomal delivery of cathepsin D, but had no effect on CI-MPR stability. These results differ from those observed with depletion of the retromer subunit Vps26 (Arighi et al.,

2004) or TIP47 (Diaz and Pfeffer, 1998), molecules that function in retrieving CI-MPR from Hrs-coated maturing endosomal intermediates or late endosomes, respectively, to the TGN and whose depletion results in a dramatic reduction of CI-MPR half-life. This suggests that PACS-1 functions upstream of or in a separate pathway from retromer and

TIP47 for sorting CI-MPR. Interestingly, the cytosolic domain of sortilin, which also sorts lysosomal cargo, binds to GGAs (Lefrancois et al., 2003; Nielsen et al., 2001) and

PACS-1 (our unpublished data), and contains a cluster of acidic residues nearly identical to that found on the CI-MPR. Thus, the mechanism described here for control of CI-MPR trafficking may be common to other acidic-dileucine containing receptors. Possibly, the interaction of PACS-1 with CK2 and GGA3 prolongs movement of CI-MPR through endosomes, representing a timing mechanism to aid ligand uncoupling before retrieval of the receptor to the TGN. Alternatively, PACS-1 and GGA3 may combine to retrieve non­ ligated CI-MPR to the TGN whereas ligated receptor would continue to the prelysosomal compartment to release cargo to lysosomes and then be retrieved to the TGN by a retromer- or TIP47-based pathway. The association of PACS-1 and GGA3 with non­ ligated receptor in early endosomes may explain why depletion of PACS-1 or AP-1 has no effect on CI-MPR stability whereas disruption of retromer or TIP47 decreases the CI-

91

92 92

P P ACS-1 ACS-1 in in the the endosome-to- TGN TGN retrieval retrieval step step of of acidic acidic cluster cluster containing containing cargo cargo

cargo cargo or or AP-1 AP-1 (Crumpet (Crumpet al., al., 2001; 2001; Scott Scott et et al., al., 2003), 2003), and and further further support support the the role role of of

Wan Wan et et al., al., 1998), 1998), expressing expressing or interfering interfering mutant mutant PACS-1 PACS-1 molecules molecules that that cannot cannot bind bind

1cKmut 1cKmut (Fig. (Fig. 6) 6) is is similar similar to to our our findings findings in in cells cells lacking lacking PACS-1 PACS-1 (Simmen (Simmen et et al., al., 2005; 2005;

The The redistribution redistribution of of CI-MPR CI-MPR we we observed observed with with expression expression of of PACS-1GGAmut PACS-1GGAmut or or PACS-

suggests suggests that that CK2 CK2 controls controls GGA3 GGA3 phosphorylation phosphorylation through through an an interaction interaction with with PACS-1. PACS-1.

expression expression of of PACS-1cKmut PACS-1cKmut disrupted disrupted the the phosphorylation phosphorylation and and localization localization of of GGA3 GGA3

finding finding that that PACS-1, PACS-1, GGA3 GGA3 and and form form a a ternary ternary complex complex CK2~ CK2~ in in vitro vitro (Fig. (Fig. 6), 6), and and that that

activity activity (Bonnet (Bonnet et et al., al., 1996; 1996; Leroy Leroy et et al., al., 1997; 1997; Leroy Leroy et et al., al., 1995). 1995). Additionally, Additionally, our our

conformational conformational change change in in the the CK2 CK2 holoenzyme holoenzyme that that correlates correlates with with an an increase increase in in CK2 CK2

or or FGF-2, FGF-2, which which are are proposed proposed to to bind bind the the acidic acidic groove groove of of causing causing a a CK2~, CK2~,

1 1 stimulates stimulates CK2 CK2 activity activity remains remains unknown, unknown, but but may may occur occur in in a a similar similar way way as as spermine spermine

CK2 CK2 to to PACS-1 PACS-1 is is required required for for activation activation of of PACS-1 PACS-1 cargo cargo binding. binding. Exactly Exactly how how PACS-

the the TGN TGN localization localization of of CI-MPR, CI-MPR, furin furin and and GGA3 GGA3 (Fig. (Fig. 6), 6), suggests suggests that that localization localization of of

holoenzyme, holoenzyme, caused caused a a 40% 40% decrease decrease in in PACS-1 PACS-1 phosphorylation phosphorylation (Fig. (Fig. 5), 5), and and disrupted disrupted

demonstration demonstration that that blocking blocking binding binding to to PACS-1 PACS-1 CK2~ CK2~ prevented prevented activation activation of of the the CK2 CK2

this this kinase kinase to to phosphorylate phosphorylate regulatory regulatory sites sites on on PACS-1 PACS-1 and and GGA3. GGA3. In In particular, particular, our our

and and activate activate CK2 CK2 in in vitro vitro and and in in vivo vivo (Figs. (Figs. 4 4 and and 5) 5) provides provides a a mechanism mechanism for for localizing localizing

196 Our Our observation observation that that the the R RKRY RKRY polybasic polybasic segment segment is is required required for for PACS-1 PACS-1 to to bind bind

2004). 2004).

MPR MPR half-life half-life (Arighi (Arighi et et al., al., 2004; 2004; Diaz Diaz and and Pfeffer, Pfeffer, 1998; 1998; Meyer Meyer et et al., al., 2000; 2000; Seaman, Seaman,

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking proteins as determined using a cell-free assay (Scott et al., 2003). Notably, the redistributed steady-state concentration of CI-MPR and GGA3 from the TGN to an

EEAI-positive compartment we observed with expression of PACS-lGGAmut or PACS­ lcKmut is reminiscent of that observed with overexpression of Rabaptin5, which shifts the localization of endogenous GGAI and CI-MPR to enlarged early endosomes (Mattera et al., 2003). However, expression of PACS-lAdmut• which does not bind AP-1, caused the redistribution of the CI-MPR from the TGN (Crumpet al., 2001), but had no effect on

GGA3 localization (Fig. 2), suggesting a temporal ordering of molecular interactions such that P ACS-1 is required downstream of GGA3 in the en do somal sorting of CI-MPR and also recruits AP-I to retrieve this itinerant receptor to the TGN (see Fig. 7). These results suggest that PACS-1 must bind GGA3 for GGA3 to release from an early endosome compartment and that PACS-1 does not utilize GGA3 as a clathrin adaptor, rather AP-I or -3 must also be present (Crumpet al., 2001). We do not know how the block of PACS-1 binding to GGA3 traps GGA3 in this endosomal compartment, but it is possible that PACS-1 is required to receive the CI-MPR from GGA3 before GGA3 can release from this compartment, or perhaps PACS-1 affects the ability of GGA3 to interact with the early endosomal membrane, possibly by directing CK2 phosphorylation.

Several reports have now identified phosphorylation sites on the GGAs (Doray et al.,

2002b; Kametaka et al., 2005; McKay and Kahn, 2004), including two CK2 sites thought

to regulate GGA3 function: Ser355 of GGAI (which corresponds to Ser388 in GGA3) and

Ser372 of GGA3. Phosphorylation of GGAI Ser355 promotes an intramolecular interaction of the GGA DxxLL autoregulatory domain with the cargo binding VHS domain (Doray

93

94 94

membrane membrane protein protein traffic traffic through through the the TGN/endosomal TGN/endosomal system. system.

cascade cascade controls controls a a novel novel cellular cellular mechanism mechanism for for regulating regulating the the dynamic dynamic movement movement of of

investigation. investigation. Nonetheless, Nonetheless, our our results results suggest suggest that that a a CK2-initiated CK2-initiated phosphorylation phosphorylation

278 278

in in addition addition to to Ser control control cargo cargo and and membrane membrane association association warrant warrant further further

388 388 Ser on on binding binding to to cargo cargo and and membranes. membranes. Whether Whether phosphorylation phosphorylation of of PACS-1 PACS-1 at at sites sites

(Figs. (Figs. 2 2 and and 6) 6) may may 272 272 represent represent the the effect effect manifold of of phosphorylation phosphorylation of of GGA3 GGA3 Ser and and

distribution distribution of of GGA3 GGA3 with with CI-MPR CI-MPR from from the the TGN TGN to to an an EEA1-positive EEA1-positive compartment compartment

interfering interfering mutants mutants that that cannot cannot bind bind GGA3 GGA3 or or CK2, CK2, respectively, respectively, shifted shifted the the steady steady state state

with with membranes membranes (Kametaka (Kametaka et et al., al., 2005). 2005). Our Our finding finding that that expression expression of of PACS-1 PACS-1

which which causes causes a a conformational conformational change change in in GGA3 GGA3 that that correlates correlates with with reduced reduced association association

368 368 required required for for EGF EGF stimulated stimulated phosphorylation phosphorylation of of GGA3 GGA3 Ser by by an an unidentified unidentified kinase, kinase,

CI-MPR CI-MPR 372 372 binding binding (Ghosh (Ghosh and and Kornfeld, Kornfeld, 2003a). 2003a). CK2 CK2 phosphorylation phosphorylation of of GGA3 GGA3 Ser is is

et et al., al., 2002b), 2002b), resulting resulting in in a a conformational conformational change change that that correlates correlates with with an an inhibition inhibition of of

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

Materials and methods

Cell lines and recombinant virus

A7 cells were cultured as previously described (Wan et al., 1998b). Viral recombinants were constructed using standard methods (Blagoveshchenskaya et al., 2002). Vaccinia virus (VV) recombinants expressing human HA-PACS-1, HA-PACS-1Admut• and HA­

PACS-1s278A were previously described (Crumpet al., 2001; Scott et al., 2003). VV recombiants expressing HA-PACS-1cKmut and HA-PACS-1GGAmut were made by replacing the mutation from pGEX-PACS-1FBR-CKmut or pGEX-PACS-1FBR-GGAmut plasmid into pZVneo PACS-1ha. VV recombinants expressing HA-PACS-1snsAtCKmut• and HA-PACS­

lsmotcKmut were made by subcloning the S278A or S278D mutations into pZVneo HA­

PACS-1cKmut· Adenovirus (A V) recombinants expressing human HA-PACS-1, HA­

PACS-1GGamut or myc-GGA3 (long form) were previously described

(Blagoveshchenskaya et al., 2002) or subcloned into pADtet7 HA-PACS-1 from pGEX­

PACS-lFBR-GGAmut or pCR3.1 GGA3 and constructed using standard methods

(Blagoveshchenskaya et al., 2002).

DNA constructs pGEX3x plasmids expressing PACS-1 segments ARR, FBR, MR, and CTR, the PACS-1

FBR truncations L\1, L\2, L\4, L\5, L\6, and pET32-PACS-1FBR expressing His/thioredoxin

(Trx)-fusion proteins were previously described (Crump et al., 2001). PACS-1 FBR

mutants ~3, K201 5A, L2065A, GGAmut and CKmut, GST-CI-MPRco mutants and pVP16

PACS-1 FBR-cKmut were generated by standard PCR methods and subcloned into pGEX3x or pVP16. pET32-CK2~ was constructed by subcloning CK2~ from pGEX3x-CK2~.

95

96 96

lysed lysed in in labeling labeling buffer buffer (PBS (PBS with with 1% 1% TX-100, TX-100, 50 50 mM mM NaF, NaF, 80 80 mM mM ~-glycerol ~-glycerol

mCi/ml mCi/ml

Pi Pi (NEN) (NEN) was was added added for for 2 2 hrs. hrs. The The labeled labeled cells cells were were washed washed with with PBS PBS and and

32

16 16 hours, hours, washed washed and and incubated incubated with with phosphate-free phosphate-free media media for for 1 1 hr hr after after which which 0.5 0.5

A7 A7 cells cells were were infected infected with with VV VV expressing expressing HA-tagged HA-tagged PACS-1 PACS-1 proteins proteins (m.o.i. (m.o.i. =3) =3) for for

Metabolic Metabolic labeling labeling

from from bovine bovine testicles testicles as as described described (Litchfield (Litchfield et et al., al., 1990). 1990).

protocol. protocol. Purified Purified porcine porcine AP-I AP-I was was provided provided by by S. S. Tooze. Tooze. Native Native CK2 CK2 was was purified purified

Pharmacia) Pharmacia) or or Ni-NTA-agarose Ni-NTA-agarose (Qiagen), (Qiagen), respectively, respectively, according according to to the the manufacturer's manufacturer's

GST- or or Trx-fusion Trx-fusion proteins proteins were were purified purified using using glutathione glutathione sepharose sepharose (Amersham­

pGEX pGEX or or pET32- Trx Trx vectors vectors were were transformed transformed into into BL21 BL21 (DE3) (DE3) pLysS pLysS cells cells (Novagen). (Novagen).

Protein Protein purification purification

3-aminotriazole 3-aminotriazole mM mM according according to to standard standard methods methods (Clontech). (Clontech).

CK2a' CK2a' or or then then pGBT9-CK2~ pGBT9-CK2~ grown grown on on media media lacking lacking histidine histidine supplemented supplemented with with 1 1

HF7c HF7c yeast yeast were were transformed transformed with with pVP16-PACS-1FBR pVP16-PACS-1FBR as as well well as as pGBT9-CK2a, pGBT9-CK2a, pGBT9-

Yeast-two-hybrid Yeast-two-hybrid

pVP16-PACS-1FBR pVP16-PACS-1FBR and and pGEX3xCI-MPRco pGEX3xCI-MPRco were were previously previously described described (Wan (Wan et et al., al., 1998). 1998).

GGA3vHs+GAT GGA3vHs+GAT was was subcloned subcloned from from pGEX3xGGA3vHs+GAT pGEX3xGGA3vHs+GAT using using standard standard techniques. techniques.

and and Hinge+GAE Hinge+GAE domains domains of of GGA3 GGA3 were were provided provided by by J. J. Bonifacino. Bonifacino. pET32-

Litchfield. Litchfield. PCR3.1GGA3 PCR3.1GGA3 as as well well as as pGEX pGEX constructs constructs expressing expressing the the VHS, VHS, VHS+GAT, VHS+GAT,

pGEX3x-CK2~, pGEX3x-CK2~, pGBT9-CK2a, pGBT9-CK2a, pGBT9-CK2a' pGBT9-CK2a' and and were were pGBT9-CK2~ pGBT9-CK2~ provided provided by by D. D.

Chapter Chapter 3. 3. Regulation Regulation of of Cl-MPR Cl-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

phosphate and 0.1 ~-tM orthovanadate). HA-PACS-1 proteins were immunoprecipitated

with mAb HA.11 (Covance), separated by SDS-PAGE and analyzed by autoradiography.

To label endogenous GGA3, A7 cells were infected with VV expressing HA-PACS-1

proteins (m.o.i. =10) for 4 hr, processed as above, and endogenous GGA3 was

immunoprecipitated from the cell lysate using mAb GGA3 (BD #612311), separated by

SDS-PAGE and GGA3 phosphorylation determined by autoradiography.

Co-immunoprecipitation

Endogenous PACS-1 was immunoprecipitated using affinity purified rabbit PACS-1

antibody 701 from RBC prepared as described (Simmen et al., 2005). The

immunoprecipitates were analyzed by western blot with mAb GGA3 (BD). For co­

immunoprecipitation of expressed proteins, HA-PACS-1 was immunoprecipitated with mAb HA.11 (Covance), and co-immunoprecipitating proteins analyzed by western blot with anti-myc mAb 9E10 (Santa Cruz), anti-CK2~ mAb (Abeam), or anti-CK2a

(Upstate).

Cathepsin sorting

A 7 cells were treated twice with siRN As specific for P ACS-1

(CUCAGUGGUCAUCGCUGUG), ~-t1A(AAGGCAUCAAGUAUCGGAAGA)ora

control siRNA as described (Simmen et al., 2005). Protein·expression was determined by

western blot using anit-PACS-1, anti-~-t1A Adaptin (provided by L. Traub), and anti­

tubulin (Sigma). Cathepsin D pulse-chase analysis was performed as described (Meyer et

al., 2000). Briefly, siRNA treated cells were labeled with 35S-Met/Cys (NEN) for 0.5 hr,

97

98 98

anti-CK2a anti-CK2a (Upstate). (Upstate).

7.2, 7.2, 250 250 mM mM KCl, KCl, 2.5 2.5 mM mM MgOAc) MgOAc) +100mM +100mM NaCl NaCl and and analyzed analyzed by by western western blot blot with with

Glutathione Glutathione beads beads were were pelleted, pelleted, washed washed with with In In vitro vitro binding binding (25 (25 buffer mM mM Hepes Hepes pH pH

RBC RBC for for 2 2 hr hr at at 4°C, 4°C, followed followed by by incubation incubation with with glutathione glutathione agarose agarose for for 30 30 min. min.

Lysate Lysate interactions. interactions. of of each each purified purified 3~-tg 3~-tg PACS-1 PACS-1 fragment fragment was was incubated incubated with with 500~-tl 500~-tl

GST GST protein protein binding binding assays assays

GST GST -PACS-1 -PACS-1 FBR-CKmut· FBR-CKmut·

using using 40 40 ng ng native native bovine bovine CK2 CK2 and and increasing increasing amounts amounts of of GST, GST, GST-PACS-1FBR GST-PACS-1FBR or or

counted. counted. Kinase Kinase assays assays to to detemine detemine the the activation activation level level of of CK2 CK2 were were performed performed as as above above

trichloroacetic trichloroacetic acid, acid, spotted spotted on on to to P81 P81 paper, paper, washed washed with with 0.75 0.75 %phosphoric %phosphoric acid, acid, and and

or or 400 400 nM nM PKI PKI (Upstate). (Upstate). Reactions Reactions were were incubated incubated for for 10 10 min min at at 30°C, 30°C, stopped stopped with with

presence presence of of 40 40 nM nM 4,5,6,7-tetrabromo-2-azabenzimidazole 4,5,6,7-tetrabromo-2-azabenzimidazole (TBB; (TBB; provided provided by by L. L. Pinna) Pinna)

(RRRDDDSDDD), (RRRDDDSDDD), 2 2

100 100 ~-tM ~-tM ATP, ATP, 15 15 rnM rnM MgC1 and and 5 5 ~-tCi ~-tCi P-ATP P-ATP y- in in the the absence absence or or

32

1 1 mM mM DTT). DTT). Kinase Kinase assays assays were were performed performed with with 200 200 CK2 CK2 substrate substrate ~-tM ~-tM

pH pH 7 7 .2, .2, 25 25 mM mM phosphate, phosphate, ~-glycerol ~-glycerol 5mM 5mM EGT EGT A, A, 1 1 mM mM sodium sodium orthovanadate orthovanadate and and

anti-PACS-1 anti-PACS-1 701, 701, washed washed twice twice with with PBS PBS and and once once with with kinase kinase buffer buffer (20 (20 rnM rnM MOPS, MOPS,

Endogenous Endogenous PACS-1 PACS-1 was was immunoprecipitated immunoprecipitated from from RBC RBC using using affinity affinity purified purified rabbit rabbit

Kinase Kinase assays assays

cathepsin cathepsin D D (DAKO), (DAKO), separated separated by by SDS-PAGE SDS-PAGE and and detected detected by by fluorography. fluorography.

Cathepsin Cathepsin D D was was immunoprecipitated immunoprecipitated from from the the media media and and cell cell extract extract using using anti­

then then chased chased with with fresh fresh medium medium containing containing excess excess methionine methionine and and 10 10 rnM rnM M6P M6P for for 4 4 hr. hr.

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

Direct interactions. 1 1-1g of Trx-CK2B or Trx-CI-MPRco was incubated with 3 1-1g of

GST, GST-PACS-1FBR• GST-PACS-1FBR-GGAmut or GST-PACS-1FBR-CKmut in GST-binding buffer (20mM Tris pH 7.5, 200 mM NaCl, 1% NP40) for 2 hr at RT, followed by

incubation with glutathione agarose for 30 min. Glutathione beads were pelleted, washed

twice with GST-binding buffer, once with mRIPA and analyzed by western blot with

mAb anti-Trx antibody (Invitrogen). GST-PACS-1 pulldown of purified AP-1 was

performed as described (Crumpet al., 2001).

Ternary complex. 3!-!g GST-GGA3vHs+GAT was preincubated with 3!-!g Trx-PACS-1FBR for

2 hr at RT, followed by the addition of 3 1-1g Trx-CK2B for 2 hr at RT, then glutathione agarose for 30 min. Glutathione beads were pelleted by centrifugation, washed with GST­ binding buffer, and analyzed by western blotting with anti-Trx mAb.

Immunofluorescence microscopy

A 7 cells grown to 80% confluency were infected with VV expressing PACS-1, PACS-

1ooAmut• PACS-1cKmut• PACS-1Admut or PACS-1s278D/CKmut (m.o.i. = 10) or transfected with

pCDNA FLAG-furin. Cells were fixed and processed for immunofluorescence as

previously described (Crumpet al., 2001). Primary antibodies to the CI-MPR (S. Pfeffer,

1:2), GGA3 (BD, 1:50), EEA1 (BD, 1:100), FLAG tag (mAb M1, Kodak, 1:300) and

TGN46 (Abeam, 1: 100) were used to localize antigens. Following incubation with

species- and subtype-specific fluorescently labeled secondary antisera (Molecular

Probes), images were captured using a 60x oil immersion objective on an Olympus Fluo-

99

100 100

analysis analysis are are provided provided in in the the respective respective figure figure legend. legend.

immunofluorescence immunofluorescence images images was was done done using using NIH NIH Image Image J. J. Values Values for for each each morphometric morphometric

set set to to the the spurious spurious signal signal intensity intensity observed observed in in the the nuclear nuclear area. area. Quantification Quantification of of

pixel pixel intensityh intensityh AreaT, AreaT, where where 0= 0= outside outside the the TGN TGN and and T= T= whole whole cell. cell. Background Background was was

stain stain (TGN46), (TGN46), according according 0 0 to to the the following following formula: formula: (Mean (Mean pixel pixel intensity) Areao/(Mean Areao/(Mean

molecules molecules for for each each construct/marker construct/marker pair pair (n (n = = 25), 25), relative relative to to the the corresponding corresponding TGN TGN

quantified quantified morphometrically morphometrically by by comparing comparing the the staining staining area area and and pixel pixel intensity intensity of of these these

with with the the scion scion image image 1.62 1.62 program. program. CI-MPR, CI-MPR, Flag-furin Flag-furin and and GGA3 GGA3 redistribution redistribution was was

program program or or a a 63x 63x oil oil immersion immersion objective objective on on a a Leica Leica DM-RB DM-RB microscope microscope and and processed processed

View View FV300 FV300 confocal confocal laser laser scanning scanning microscope microscope and and processed processed with with the the NIH NIH Image Image J J

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

Acknowledgments

We thank Q. Justmann for preliminary experiments and members of the Thomas lab, J.

Bonifacino and S. Kaech Petrie (CROET Imaging Center) for helpful discussions. We thank J. Bonifacino, D. Litchfield , S. Tooze, S. Pfeffer, L. Pinna and L. Traub for reagents. The authors declare no financial conflict of interest with the described work.

This work was supported by NIH grants AI49793 and DK37274 (to GT).

101

102 102

MPRco MPRco input, input, respectively. respectively. (H) (H) A7 A7 cells cells infected infected with with wild wild type type (WT) (WT) adenovirus adenovirus (AV) (AV)

PACS-1FBR PACS-1FBR captured captured ,..,1 ,..,1 %, %, 0.5% 0.5% and and 1% 1% of of the the Trx-GGA3vHs-GAT• Trx-GGA3vHs-GAT• y-adaptin y-adaptin and and Trx-CI­

as as GST-GGA3vHs· GST-GGA3vHs· GST-GGA3vHs-GAT GST-GGA3vHs-GAT captured captured ,..,1% ,..,1% ofTrx-PACS-1FBR ofTrx-PACS-1FBR input, input, and and GST­

PACS-1FBR PACS-1FBR band band is is shifted shifted lower lower in in (E) (E) because because Trx-PACS-1FBR Trx-PACS-1FBR migrates migrates at at the the same same size size

antibody antibody (upper (upper panels). panels). Input Input of of each each GST-protein GST-protein is is also also shown shown (lower (lower panel). panel). The The Trx­

glutathione glutathione sepharose sepharose and and analyzed analyzed by by western western blot blot using using anti- Trx Trx or or anti-y-adaptin anti-y-adaptin

incubated incubated with with the the indicated indicated Trx-fusion Trx-fusion proteins proteins or or with with purified purified AP-1, AP-1, isolated isolated with with

isoforms isoforms (Dell'Angelica (Dell'Angelica et et al., al., 2000). 2000). (D-G) (D-G) The The indicated indicated GST GST -fusion -fusion proteins proteins were were

GGA3 GGA3 doublet doublet may may represent represent differential differential phosphorylation phosphorylation or or the the GGA3 GGA3 long long and and short short

western western blot blot (bottom (bottom panel). panel). ---D.1% ---D.1% of of the GGA3 GGA3 the input input co-precipitated co-precipitated with with PACS-1. PACS-1. The The

PAGE PAGE and and western western blot blot (upper (upper panel). panel). The The immunoprecipitated immunoprecipitated PACS-1 PACS-1 is is shown shown by by

using using anti-PACS-1 anti-PACS-1 or or control control IgG IgG and and co-precipitating co-precipitating GGA3 GGA3 analyzed analyzed by by 8% 8% SDS­

and and cargo. cargo. (C) (C) Endogenous Endogenous PACS-1 PACS-1 was was immunoprecipitated immunoprecipitated from from RBC RBC (lower (lower panel) panel)

GAE GAE (y-adaptin (y-adaptin ear) ear) domain domain (Bonifacino, (Bonifacino, 2004a) 2004a) as as well well as as GST-GGA3 GST-GGA3 fusion fusion proteins proteins

segment, segment, which which 388 contains contains the the autoregulatory autoregulatory acidic-dileucine acidic-dileucine motif motif and and Ser and and the the , ,

cargo cargo proteins, proteins, the the GAT GAT (GGA (GGA and and TOM) TOM) domain, domain, which which binds binds to to ARF1, ARF1, the the hinge hinge

(B) (B) Diagram Diagram of of GGA3 GGA3 showing showing the the VHS VHS (Vps27, (Vps27, Hrs, Hrs, Starn) Starn) domain, domain, which which binds binds to to

the the C-terminal C-terminal region region (CTR) (CTR) as as well well as as GST-PACS-1 GST-PACS-1 fusion fusion proteins proteins and and PACS-1 PACS-1 cargo. cargo.

278 278 (MR), (MR), which which contains contains the the autoregulatory autoregulatory acidic acidic cluster cluster and and Ser (Scott (Scott et et al., al., 2003), 2003), and and

1/AP-3 1/AP-3 adaptor adaptor complexes complexes (Crumpet (Crumpet al., al., 2001; 2001; Wan Wan et et al., al., 19998), 19998), the the middle middle region region

related related region region (ARR), (ARR), cargo cargo binding binding region region (FBR), (FBR), which which interacts interacts with with cargo cargo and and AP-

Figure Figure PACS-1 PACS-1 binds binds 1. 1. to to GGA3. GGA3. (A) (A) Diagram Diagram of of PACS-1 PACS-1 showing showing the the atropin-1-

Figure Figure Legends Legends

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking or A V expressing Myc-GGA3, Myc-GGA3 and HA-PACS-1, or Myc-GGA3 and HA­

PACS-1GGAmut were harvested and HA-tagged proteins immunoprecipitated and co­ precipitating myc-GGA analyzed by western blot (upper panel). Lower panels show myc­

GGA3 and HA-PACS-1 expression.

Figure 2. PACS-lGGAmut disrupts CI-MPR trafficking. (A) A7 cells infected with WT vaccinia virus (VV) or VV recombinants expressing PACS-1 or PACS-lGGAmut were stained with antibodies to detect CI-MPR, TGN46 or EEA1 as indicated. Inset: colocalization of CI-MPR (green) and EEA1 (red) from the boxed area. CI-MPR staining outside the TGN area increased from 11±5% and 9±7% in the WT and PACS-1 expressing cells, respectively, to 40±10% for PACS-1GGAmut expressing cells. (B) A7 cells expressing FLAG-furin were treated as in (A) and stained with anti-FLAG and anti­

TGN46. (C) A7 cells infected with VV:WT or with VV expressing PACS-1, PACS-1Admut or PACS-1GGAmut and then co-stained with anti-GGA3 and anti-TGN46 or anti-CI-MPR.

Inset: Colocalization of GGA3 (green) and CI-MPR (red) from the boxed area. GGA3 staining outside the TGN area increased from 11±6%, 8±4% and 9±5% in the WT,

PACS-1 and PACS-1Admut expressing cells, respectively, to 38±7% for PACS-1GGAmut expressing cells. Scale Bars = 20 !lm.

Figure 3. PACS-1 is required for CI-MPR function. (A-C) GST, GST-CI-MPRco pre­ incubated or not with CK2, or GST-CI-MPRco containing the indicated mutations was incubated with Trx-PACS-1FBR or Trx-GGA3vHs+GAT• isolated with glutathione sepharose and analyzed by western blot using anti-Trx (upper panels). Input of each GST-protein is

103

104 104

GST-PACS-1FBR-CKmut GST-PACS-1FBR-CKmut was was incubated incubated with with Trx-GGA3vHs+GAT' Trx-GGA3vHs+GAT' Trx-CI-MPRco Trx-CI-MPRco or or purified purified

was was GST-~6 GST-~6 reduced reduced 60% 60% and and 75%, 75%, respectively respectively (n=3). (n=3). (E) (E) GST, GST, GST-PACS-1FBR GST-PACS-1FBR or or

of of the the input input CK2a. CK2a. Relative Relative to to GST-PACS-1FBR' GST-PACS-1FBR' the the interaction interaction ofCK2 ofCK2 with with and and GST-~2 GST-~2

GST-protein GST-protein is is also also shown shown (panel (panel B B and and D, D, lower lower panel). panel). GST-PACS-1FBR GST-PACS-1FBR captured captured ,..,3% ,..,3%

analyzed analyzed by by western western blot blot using using anti-CK2a anti-CK2a (panel (panel B B and and D, D, upper upper panel). panel). Input Input of of each each

Fig. Fig. 1A 1A and and panel panel D) D) were were incubated with with incubated RBC, RBC, captured captured with with glutathione glutathione sepharose sepharose and and

containing containing the the indicated indicated domains, domains, truncations, truncations, or or alanine alanine substitutions substitutions of of PACS-1 PACS-1 (see (see

represent represent mean mean and and SD SD of of three three independent independent experiments. experiments. (B-D) (B-D) GST-fusion GST-fusion proteins proteins

presence presence of of 40 40 TBB TBB (CK2 (CK2 ~-tM ~-tM inhibitor) inhibitor) or or 400 400 PKI PKI (PKA (PKA ~-tM ~-tM inhibitor). inhibitor). Error Error bars bars

precipitating precipitating CK2 CK2 activity activity was was measured measured with with in in an an vitro vitro kinase kinase assay assay in in the the absence absence or or

anti-PACS-1 anti-PACS-1 or or control control IgG IgG to to immunoprecipitate immunoprecipitate endogenous endogenous PACS-1 PACS-1 and and co­

Figure Figure PACS-1 PACS-1 4. 4. associates associates CK2. CK2. with with (A) (A) RBC RBC was was incubated incubated with with affinity affinity purified purified

experiments. experiments.

into into the the culture culture medium. medium. Error Error bars bars represent represent mean mean and and SD SD of of three three independent independent

total total cathepsin cathepsin D D forms forms (precurser (precurser + + intermediate intermediate + + mature) mature) in in cell cell extracts extracts or or secreted secreted

mature mature (M) (M) forms forms of of cathepsin cathepsin D D are are shown (lower (lower shown panel). panel). The The graph graph shows shows the the % % of of

anti-cathepsin anti-cathepsin D D and and analyzed analyzed by by fluorography. fluorography. Precursor Precursor (P), (P), intermediate intermediate and and (I) (I)

performed. performed. Extracellular Extracellular (E) (E) and and intracellular intracellular (C) (C) fractions fractions were were immunoprecipitated immunoprecipitated with with

cells cells were were treated treated with with the the indicated indicated siRNA siRNA and and Cathepsin Cathepsin D D pulse pulse chase chase experiments experiments

lysates lysates analyzed analyzed by by western western blot blot using using anti-PACS-1, anti-PACS-1, anti-~-t1A anti-~-t1A or or anti-tubulin. anti-tubulin. (E) (E) A7 A7

cells cells

were were treated treated with with scrambled scrambled (scr.), (scr.), PACS-1 PACS-1 or or AP-I AP-I subunit subunit siRNAs siRNAs ~-t1A ~-t1A and and cell cell

0 0 shown shown (lower (lower panel). panel). GST-CI-MPRc pulled pulled down down ,..,1% ,..,1% of of the the Trx-PACS-IFBR· Trx-PACS-IFBR· (D) (D) A7 A7

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of Cl-MPR Trafficking

AP-I, captured with glutathione sepharose and analyzed by western blot using anti-Trx or anti-y-Adaptin antibody (upper panels). Input of each GST -protein is shown (lower panel).

Figure 5. PACS-1 binding to CK2fl activates CK2. (A) Yeast transformed with the indicated Gal4 activation and DNA binding domain (Gal4ad and Gal4bd) constructs were screened for growth on His+ and His- media. (B) GST, GST-PACS-lFsR or GST-PACS­ lFBR-cKmut was incubated with Trx-CK2~, isolated with glutathione sepharose and analyzed by western blot using anti-Trx (upper panel). Input of each GST -protein is shown (lower panel). GST-PACS-IFBR captured 2.5% of the input Trx-CK2~. (C) A7 cells infected with VV:WT or VV expressing HA-PACS-1 or HA-PACS-lcKmut were lysed, immunoprecipitated with HA antibody and any co-immunoprecipitating CK2a and

CK2~ detected by western blot using subunit-specific antisera (upper panels). HA-PACS-

1 expression is shown (bottom panel). ~0.5% of the endogenous CK2a and CK2~ co­ precipitated with expressed HA-PACS-1, respectively. (D) In vitro CK2 holoenzyme activity assayed in the absence or presence of purified GST, GST-PACS-IFBR or GST­

PACS-lFBR-cKmut· Activity is normalized to a parallel sample assayed in the absence of added protein. Error bars represent mean and SD of three independent experiments. (E)

A7 cells were infected with VV:WT or VV expressing HA-PACS-1, HA-PACS-lcKmut•

32 HA-PACS-1 5278A or HA-PACS-1 5278ArcKmut and metabolically labeled with Pi. HA­ proteins were immunoprecipitated with mAb HA.ll, resolved by SDS-PAGE and analyzed by autoradiography (upper panel). HA-PACS-1 expression is shown (bottom panel). Error bars represent mean and SD of three independent experiments.

105

106 106

(upper (upper panel). panel). Input Input of of each each fusion fusion protein protein is is shown shown (lower (lower panel). panel). ""'0.1% ""'0.1% of of the the Trx-

PACS-1 PACS-1 or or both, both, isolated isolated with with glutathione glutathione sepharose sepharose and and analyzed analyzed with with FBR FBR anti- Trx Trx mAb mAb

sample. sample. (E) (E) GST-GGA3vHs+GAT GST-GGA3vHs+GAT or or GST GST alone alone was was incubated incubated with with Trx-CK2B Trx-CK2B or or Trx­

represent represent mean mean and and SD SD of of three three independent independent experiments experiments normalized normalized to to the the PACS-1 PACS-1

immunoprecipitated immunoprecipitated and and analyzed analyzed by by 12% 12% SDS-PAGE SDS-PAGE and and autoradiography. autoradiography. Error Error bars bars

HA-PACS-1cKmut• HA-PACS-1cKmut• metabolically metabolically labeled labeled with with Pi, Pi, and and endogenous endogenous GGA3 GGA3 was was

32

Bars= Bars= 20 20 !liD. !liD. A7 A7 cells cells were were (D) (D) infected infected with with WT:VV WT:VV or or VV VV expressing expressing HA-PACS-1 HA-PACS-1 or or

expressing expressing cells cells (Fig. (Fig. 2), 2), respectively, respectively, to to 36±5% 36±5% in in PACS-lcKmut PACS-lcKmut expressing expressing cells. cells. Scale Scale

outside outside the the TGN TGN area area increased increased from from ±6 ±6 % % and and 11 11 8±4 8±4 % % in in the the WT WT and and PACS-1 PACS-1

CI-MPR. CI-MPR. Inset: Inset: Colocalization Colocalization of of GGA3 GGA3 (green) (green) and and CI-MPR CI-MPR (red). (red). GGA3 GGA3 staining staining

with with VV VV expressing expressing PACS-1cKmut PACS-1cKmut then then stained stained with with anti-GGA3 anti-GGA3 and and anti- TGN46 TGN46 or or anti­

(Fig. (Fig. 2B), 2B), respectively, respectively, to to 36±5% 36±5% in in PACS-1cKmut PACS-1cKmut expressing expressing cells. cells. A7 A7 (C) (C) cells cells infected infected

the the TGN TGN area area increased increased from from 9±6% 9±6% and and 11±4% 11±4% in in the the WT WT and and PACS-1 PACS-1 expressing expressing cells cells

PACS-lcKmut PACS-lcKmut and and stained stained with with anti-FLAG anti-FLAG and and anti-TGN46. anti-TGN46. FLAG-furin FLAG-furin staining staining outside outside

expressing expressing cells. cells. A7 A7 cells cells transfected transfected (B) (B) with with FLAG-furin, FLAG-furin, infected infected with with VV VV expressing expressing

2780 2780 compared compared with with 39±9% 39±9% for for PACS-1cKmut PACS-1cKmut expressing expressing cells cells and and 11±7% 11±7% in in PACS-lcKmutJs

was was 13±6% 13±6% and and 10±5% 10±5% in in the the WT WT and and PACS-1 PACS-1 expressing expressing cells cells (Fig. (Fig. 2A), 2A), respectively, respectively,

localization localization of of CI-MPR CI-MPR (green)" (green)" and and EEA1 EEA1 (red). (red). CI-MPR CI-MPR staining staining outside outside the the TGN TGN area area

1cKmutJs2780, 1cKmutJs2780, then then stained stained with with anti-CI-MPR, anti-CI-MPR, anti- TGN46 TGN46 or or anti-EEAl. anti-EEAl. Inset: Inset: co­

phosphorylation. phosphorylation. (A) (A) A 7 7 A cells cells infected infected with with VV VV expressing expressing P P ACS-1cKmut ACS-1cKmut or or P P ACS-

Figure Figure 6. 6. PACS-lcKmut PACS-lcKmut redistributes redistributes CI-MPR, CI-MPR, furin furin and and GGA3 GGA3 and and controls controls GGA3 GGA3

Chapter Chapter 3. 3. Regulation Regulation of of Cl-MPR Cl-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

CK2~ input was captured m the GST-GGA3vHs-GAT/Trx-PACS-1FsR/CK2~ ternary complex.

Figure 7. Working model of PACS-1/GGA3/CK2 controlled CI-MPR trafficking.

CI-MPR is phosphorylated upon TGN exit (Meresse and Hoflack, 1993), promoting binding to GGA3 which traffics with CI-MPR to endosomes (Puertollano et al., 2001a).

PACS-1 is recruited to the early endosomal CI-MPR/GGA3 complex by the binding of the PACS-1 FBR to the GGA VHS domain (Figs. 1 and 2). PACS-1 then recruits and activates CK2 (Figs. 4 and 5), which catalyzes a phosphorylation cascade to regulate retrieval of CI-MPR from the early endosome. The bound CK2 phosphorylates the GGA3

autoregulatory domain at Ser388 to release GGA3 from CI-MPR. CK2 may also phosphorylate GGA3 at additional sites to promote release of GGA3 from the early endosome membrane (Figs. 2 and 6 and (Kametaka et al., 2005). CK2 bound to the

PACS-1 FBR then phosphorylates Ser278 on the PACS-1 autoregulatory domain to promote binding of PACS-1 to the CI-MPRco (Figs. 3 and 6). Whether CK2 that is bound to PACS-1 controls phosphorylation of the CI-MPR or other cargo molecules is not known. PACS-1 bound to CI-MPR then recruits AP-1 to recycle CI-MPR to the TGN.

This model only depicts the switch in CI-MPR trafficking at the endosome that is regulated by the interaction between P ACS-1, GGA3 and CK2 and does not depict sorting molecules that contribute to other CI-MPR sorting· steps.

Supplementary Figure 1. siRNA depletion of PACS-1 does not effect CI-MPR half­ life. (A) A 7 cells were treated with the indicated siRNAs for 72 hours and analyzed by

107

108 108

by by separated SDS-PAGE SDS-PAGE and and western western blotted blotted with with anti-CI-MPR anti-CI-MPR and and tubulin tubulin antibodies. antibodies.

After After cyclohexamide cyclohexamide treatment, treatment, the the cells cells were were scraped scraped into into 0.5 0.5 ml ml boiling boiling SDS SDS buffer, buffer,

for for 72 72 hours, hours, then then treated treated with with 20 20 !!g/ml !!g/ml cyclohexamide cyclohexamide for for the the indicated indicated time time points. points.

western western blot. blot. (B) (B) A7 A7 cells cells were were treated treated with with scrambled scrambled (Scr), (Scr), vps26, vps26, or or PACS-1 PACS-1 siRNAs siRNAs

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

A 8 PACS-1

CTR

Cargo Binding C~MPR - ·V24,.SFHOOSDEDLL .. Furln ... Q,..EECPSDSEEDEGRG ... HIV· 1 !WI ... 0,1EEEEVG ... GST·PACS..1ARR- GST·GGA3yHS - GST·PACS.1 FBR - GS~GGA3yH~T------i...... GST·GGA3hlnge+GAE GST·PACS.1MR ·----·...... GST·PACS.1CTR

c D .... ~~ .... ~~ .....~ .... ()~ E L~ ~ cf~ cf~ vq ve.; ~~ n:,$~~0:> ~qtf ~qtf ~~tf ~"f ~ ~"f ~-<.. f.lf G o-f::1 o-t::J o-f::1 o-f::1 ~ ~G~G~ IGGA3 o-f::1 o-t::1 o-f::1 6-t::J wel l we i ITrx-GGA3vHs+GAT we Trx·PACS-1FBR I -IPAcs-1 i _.d IP: ~ ('./.... ,~ v Protein qtf Load Load -=1 ~ F -"I L3 PACS-1 ... "-EI!LSS. . .

PACS-2 ... A, 118EI LSS .. . PACS.1GGAmut ···"-EI LSS .. . H .------., IP HA: ~.s- G I 1Myc-GGA3 ~~ 1/J~ 1/Jq;P 1/J~ ~======~ ~ q.... ('./.... ~ e.;.... ~ ('./~~ ~v ~v ~v ~v I we I - -1Myc-GGA3 ~(l ~~q ~~~ ~~q WBi i:l ===~ I IHA-PACS-1

wa j - jTrx ·:=1==~ Expreu: .:/:' rf' v('.f.... vq~.s- GST-GGA3 Protein VHS+GAT ProteinLoad ~ ~G ~tf ~tf~(}' Load ~· ~~~--~ ~~ ~,: ~,: = GST

Figure 1

109

110 110

Figure Figure 2 2

g g

z z

-.:1-

CD CD

CJ CJ

CJ CJ

M M

c c

PACS-1 PACS-1 WT WT PACS-1GGAmut PACS-1GGAmut PACS-1 PACS-1 Admut Admut PACS-1GGAmut PACS-1GGAmut

......

CJ CJ

z z

-.:1-

CD CD

LL. LL.

...J ...J

~ ~

.§ .§

c c

8 8 PACS-1GGAmut PACS-1GGAmut WT WT PACS-1 PACS-1

g g

z z

-.:1-

CD CD

0 0

~ ~

a. a.

a: a:

A A PACS-1GGAmut PACS-1GGAmut PACS-1 PACS-1 WT WT GGAmut GGAmut PACS-1 PACS-1

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

A D

wa I:=:======! ~.... _____JI Trx-PAC5-1 FBR

·= 1~.... ____---..J

B GST-CI-MPRco E 1Trx-PAC5-1 FBR

Protein ., La.d r===··---~~~~~ljil~~~~ E .2 60 c -i 40 i c GST-CI-MPRco i 20 0 :! 0 ~ C E C E C E ~ F!

M

GST-CI-MPRco

Figure 3

111

112 112

Figure Figure 4 4

-- i-1 i-1 ·=[ ·=[

- - lcK2a lcK2a I I

ws [ [

~r:, ~r:, ~r:, ~r:, ~r:, ~r:, ~r:, ~r:, ~r:, ~r:, ~r:, ~r:, ~r:, ~r:,

~r:, ~r:,

~r:, ~r:,

~r:, ~r:, ~..,· ~..,·

~ ~ t\' (( • ~ ~ ((•.;> ((•.;> t>'J- t\'~ t\'~ t\' ~ ~ t\ t\ ((Jf-~~ ((Jf-~~ ((- t> t> t(!l t(!l

,._v ,._v ...... ,._v ,._v t. t. s s

(b~ (b~ ~,,. ~,,. t!f t!f .. .. '!f '!f .. .. D D

*-~ *-~

~:tf-~l,ut ~:tf-~l,ut K201SA K201SA l201SA l201SA

1

210 210

HRRKRY HRRKRY KNRTI KNRTI LGYKT LGYKT

L~SA L~SA ...... ~ ~ ~~~~~ ~~~~~ ......

201

K

5A 5A

PAC$-1FBR-<:Kmut PAC$-1FBR-<:Kmut :::::::::::::::::::: ::::::::::::::::::::

!16 !16 192 192 ......

!1 5 5 I I -="1 -="1

173 173 ......

.. .. )"Adaptln )"Adaptln

!1 4 4 1M 1M ......

......

I I --1 --1

Trx-ci-MPRco Trx-ci-MPRco

WB WB ~ ~ ~ ~

42 42

212 212 I · -~ -~

Trx-GGA3vHS+GAT Trx-GGA3vHS+GAT

M M ~ ~

E E

I I PACS-1FBR PACS-1FBR ~ - = = - ~ ~ """"=:= ' ' - J J

117 117 266 266

c c

~,.v ~,.v

~,.v ~,.v

~ ~ r.:~"' r.:~"' q q

...... ~v ~v

~ ~

~~ ~~ IP: IP: r.:~" r.:~" ~~ ~~ ~~ ~~

0 0

0 0

~ ~

1 1

• • C'll C'll

u u

> >

~ ~ -- lcK2a lcK2a

.S: .S: 3 3

~ ~

Go~ Go~ Go~~: Go~~: (>~~~ (>~~~ G-~~!l~ G-~~!l~ ~ ~ G G

4 4

r."' r."'

,._Rt' ,._Rt' R._c; R._c; ._c,'il ._c,'il

cJ!f'o cJ!f'o

c c

.- vr:~ vr:~

:\~~ :\~~

;e.~ ;e.~

'!'d''

,.. ,..

~~ ~~ :\ :\

A A 8 8

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

A B c Gal4ad PACS-1FBR

PACS-1FBR

PACS-1FBR

-His +His

D E

T ~ +---.::~.::::-.:::-.:~ GST·PACS-1 FBR-CKmut ?~--r·· ·· - GST

100 200 300 400 ng GST·protein added Express:

Figure 5

113

114 114

Figure Figure 6 6

~ ~ ~r ~r

~

~v ~v ~v ~v c'il c'il

~ ~ C:l..., C:l..., C:l..., C:l..., ~~ ~~ Express : :

-- j HA HA ws j j

Ly_aate : :

WB I --- I GGA3 GGA3 GST GST

TrX·PACS.1 TrX·PACS.1 FBR FBR

Load Load Trx-CK213 Trx-CK213

Protein Protein

IPGGA3 : : GST GST -GGA3VHS+GAT -GGA3VHS+GAT

l:t l:t

a. a.

= --

q q

· ~ F ::::,,., ::::,,., w• l l

.. ..

c.:J c.:J

~ ~

E E D D

~ ~

z z

~ ~

u. u.

:; :;

.5 .5

PACS-1 PACS-1 PACS-1 PACS-1 PACS-1 PACS-1 c c CKmut CKmut CKmut CKmut B B CKmut CKmut

~ ~

z z

~ ~

0 0

~ ~

c.. c..

a: a:

PA PA CS-1 CS-1 PACS-1 PACS-1 S278DICKmut S278DICKmut CKmut CKmut PACS-1CKmut PACS-1CKmut A A

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 3. Regulation of CI-MPR Trafficking

I \

PACS-1

' TGN

Figure 7

115

116 116

Supplementary Supplementary Figure Figure 1 1

i1n i1n

---.---"---" · - · ---

Cf..MPR · ·

0 0 2 2 4 4

A A

8 8

A A

Chapter Chapter 3. 3. Regulation Regulation of of CI-MPR CI-MPR Trafficking Trafficking Chapter 4. Discussion

CHAPTER 4. DISCUSSION

Summary

The results presented in this dissertation show that PACS-1, GGA3, and CK2 form a

multimeric complex to regulate the endosomal sorting and TGN retrieval of cargo

proteins with acidic- and acidic-dileucine trafficking motifs. We discovered that the

PACS-1 FBR binds directly to both GGA3 and CK2. CK2 binds to P ACS-1 FBR to

control the phosphorylation state of Ser278 within an autoregulatory domain on PACS-1,

and to control the phosphorylation of GGA3. Blocking this phosphorylation or blocking

the PACS-1/CK2 interaction interfered with the endosome-to-TGN retrieval of acidic

cluster containing proteins, whereas blocking the PACS-1/GGA3 interaction only

interfered with the endosome-to-TGN transport of proteins that contain both acidic

cluster and acidic-dileucine motifs. These results suggest that the interaction of PACS-1

with GGA3 is specifically required for the trafficking of a subset of cargo proteins that

bind to both PACS-1 and GGAs. Considering the known requirement for CK2

phosphorylation to regulate cargo binding of GGA3 (Doray et al., 2002b), one

interpretation of these findings is that PACS-1 directs CK2 to GGA3 to initiate a

phosphorylation "switch" that activates PACS-1 and inactivates GGA3, thereby driving

retrieval of CI-MPR from endosomes to the TGN (Figure 1). Taken together, this work

has broad implications on our understanding of PACS-1 function and allows the proposal

of several new areas of investigation.

117

118 118

and and CI-MPR, CI-MPR, whereas whereas the the interaction interaction of of PACS-1 PACS-1 with with GGA3 GGA3 is is required required for for endosome-

Additionally, Additionally, the the interaction interaction of of P P ACS-1 ACS-1 with with CK2 CK2 is is required required for for TGN TGN retrieval retrieval of of furin furin

retrieval retrieval of of furin, furin, CI-MPR CI-MPR and and HIV-1 HIV-1 Nef Nef to to the the TGN TGN from from an an endosomal endosomal compartment. compartment.

2 7 8 8 The The studies studies presented presented here here show show that that phosphorylation phosphorylation of of PACS-1 PACS-1 Ser is is required required for for

Implications Implications for for PACS-1 PACS-1 cargo cargo binding binding

Implications Implications for for future future studies: studies:

bound bound to to CI-MPR CI-MPR then then recruits recruits AP-1 AP-1 to to recycle recycle CI-MPR CI-MPR to to the the TGN. TGN.

bound bound to to PACS-1 PACS-1 controls controls phosphorylation phosphorylation of of the the CI-MPR CI-MPR or or other other cargo cargo molecules molecules is is not not known. known. PACS-1 PACS-1

PACS-1 PACS-1 autoregulatory autoregulatory domain domain to to promote promote binding binding of of PACS-1 PACS-1 to to the the CI-MPRcn· CI-MPRcn· Whether Whether CK2 CK2 that that is is

278 278 membrane membrane (Kametaka (Kametaka et et al., al., 2005). 2005). CK2 CK2 bound bound to to the the PACS-1 PACS-1 FBR FBR then then phosphorylates phosphorylates Ser on on the the

also also phosphorylate phosphorylate GGA3 GGA3 at at additional additional sites sites to to promote promote release release of of GGA3 GGA3 from from the the early early endosome endosome

388 388 CK2 CK2 phosphorylates phosphorylates the the GGA3 GGA3 autoregulatory autoregulatory domain domain at at Ser to to release release GGA3 GGA3 from from CI-MPR. CI-MPR. CK2 CK2 may may

catalyzes catalyzes a a phosphorylation phosphorylation cascade cascade to to regulate regulate retrieval retrieval of of CI-MPR CI-MPR from from the the early early endosome. endosome. The The bound bound

membranes membranes (discussed (discussed in in Chapter Chapter 4 4 and and Appendix Appendix C). C). PACS-1 PACS-1 then then recruits recruits and and activates activates CK2, CK2, which which

FBR FBR to to the the GGA GGA VHS VHS domain domain and and by by an an interaction interaction with with Ptdlns(3)P Ptdlns(3)P (PI3P) (PI3P) on on early early endosomal endosomal

2003). 2003). PACS-1 PACS-1 is is recruited recruited to to the the early early endosomal endosomal CI-MPR/GGA3 CI-MPR/GGA3 complex complex by by the the binding binding of of the the PACS-1 PACS-1

of of the the CI-MPR CI-MPR because because an an interaction interaction with with Rabaptin5 Rabaptin5 blocks blocks GGA3 GGA3 binding binding to to clathrin clathrin (Mattera (Mattera et et al. , ,

with with CI-MPR CI-MPR to to endosomes endosomes (Puertollano (Puertollano et et al, al, 2001a). 2001a). GGA3 GGA3 is is inactivated inactivated for for endosome-to-TGN endosome-to-TGN retrieval retrieval

phosphorylated phosphorylated upon upon TGN TGN exit exit (Meresse (Meresse and and Hoflack, Hoflack, 1993), 1993), promoting promoting binding binding to to GGA3 GGA3 which which traffics traffics

Figure Figure Working Working 1. 1. model model of of PACS-1/GGA3/CK2 PACS-1/GGA3/CK2 controlled controlled CI-MPR CI-MPR trafficking. trafficking. CI-MPR CI-MPR is is

/ / '-... '-...

T GN GN

I I

\ \

Chapter Chapter 4. 4. Discussion Discussion Chapter 4. Discussion to-TGN retrieval of CI-MPR, but not furin. However, there are many other PACS-1 cargo proteins (see Chapter 1, Table 1) for which the importance of these interactions remains unknown. Of particular interest are membrane proteins that contain both acidic cluster and acidic-dileucine motifs, such as sortilin and B-secretase (BACE), which both bind to

GGAs (Nielsen et al., 2001; Wahle et al., 2005) and contain potential PACS-1-binding acidic clusters. Future studies of P ACS-1 regulation could ascertain if expression in cells

of the interfering PACS-1 molecules developed for this dissertation-PACS-1s278A,

PACS-1cKmut and PACS-1aoAmu1-affect the endosome-to-TON retrieval of these proteins.

Implications for PACS-1 regulation

Whereas CK2 phosphorylation of acidic cluster sorting motifs within the furin cytosolic domain or other cargo proteins, including CI-MPR, VZV gE and VMAT-2, increases

their binding to the PACS-1 FBR, CK2 phosphorylation of Ser278 within the PACS-1 acidic cluster weakens the binding of these residues to the PACS-1 FBR (Waites et al.,

2001; Wan et al., 1998 and Chapter 2, Figure 2). How CK2 phosphorylation of acidic cluster motifs within membrane cargo and PACS-1 influence in a completely opposite manner the binding of these various acidic motifs to the P ACS-1 FBR remains unknown.

Moreover, acidic cluster binding to the PACS-1 FBR may be more complex than a simple phosphorylation switch, as the non-phosphorylatable Nef and PC6B acidic clusters bind to PACS-1 (Piguet et al., 2000; Xiang et al., 2000). Together, these studies suggest there may be two acidic-cluster-binding modules on P ACS-1: one for phosphorylated acidic clusters, and one for unphosphorylated acidic clusters. The residues surrounding cargo acidic clusters may dictate which binding module of PACS-1

119

120 120

process process required required for for activation activation of of PACS-1 PACS-1 and and targeting targeting of of PACS-1 PACS-1 cargo cargo proteins proteins to to the the

278 278 and and that that CK2 CK2 phosphorylation phosphorylation of of Ser induces induces a a transition transition to to a a monomeric monomeric state-a state-a

itinerant itinerant membrane membrane proteins. proteins. I I hypothesize hypothesize that that inactive inactive PACS-1 PACS-1 is is an an oligomer oligomer in in cells cells

P P ACS-1 ACS-1 complex complex may may be be required required to to regulate regulate the the P P ACS-1 ACS-1 directed directed TGN TGN localization localization of of

proteins proteins may may indeed indeed be be an an inter-molecular inter-molecular event, event, and and that that the the formation formation of of an an oligomeric oligomeric

complex complex in in vivo. vivo. These These results results indicate indicate that that the the regulation regulation of of PACS-1 PACS-1 binding binding to to cargo cargo

preliminary preliminary evidence evidence (Appendix (Appendix C, C, Figure Figure 1) 1) shows shows that that PACS-1 PACS-1 molecules molecules can can form form a a

of of PACS-1 PACS-1 directly directly interact interact in in vitro vitro in in a a phosphorylation-dependent phosphorylation-dependent manner, manner, and and my my

autoregulation autoregulation of of PACS-1 PACS-1 is is an an intra- or or inter-molecular inter-molecular event. event. The The FBR FBR and and MR MR regions regions

Despite Despite our our identification identification of of the the PACS-1 PACS-1 autoregulatory autoregulatory domain, domain, we we do do not not yet yet know know if if

clusters. clusters.

determination determination of of the the PACS-1 PACS-1 FBR FBR with with phosphorylated phosphorylated and and non-phosphorylated non-phosphorylated acidic acidic

phosphorylated phosphorylated acidic acidic clusters. clusters. More More informative informative studies studies will will come come from from the the structural structural

phosphorylated phosphorylated acidic acidic clusters clusters bind bind a a different different region region of of the the PACS-1 PACS-1 FBR FBR than than non­

investigated investigated using using limited limited proteolysis proteolysis of of PACS-1/cargo PACS-1/cargo complexes complexes to to determine determine if if

change change that that unmasks unmasks the the FBR FBR to to promote promote cargo cargo binding. binding. These These possibilities possibilities could could be be

whereas whereas phosphorylation phosphorylation of of the the PACS-1 PACS-1 autoregulatory autoregulatory domain domain triggers triggers a a conformational conformational

phosphorylation phosphorylation of of cargo cargo proteins proteins increases increases the the affinity affinity of of cargo cargo for for the the PACS-1 PACS-1 FBR FBR

unmasked unmasked by by the the phosphorylation phosphorylation of of embedded embedded Ser/Thr Ser/Thr residues. residues. Perhaps Perhaps

may may instead instead recognize recognize other other acidic acidic cluster cluster determinants determinants that that would would be be masked masked or or

Alternatively, Alternatively, the the PACS-1 PACS-1 FBR FBR may may not not contact contact the the phosphoamino phosphoamino acids acids directly directly but but

is is utilized, utilized, and and the the PACS-1 PACS-1 autoregulatory autoregulatory domain domain would would block block binding binding to to both both modules. modules.

Chapter Chapter 4. 4. Discussion Discussion Chapter 4. Discussion

TGN. Experiments to test this hypothesis should determine the oligomeric state of P ACS-

1 in vitro and in vivo, and the role of Ser278 in formation of the PACS-1 oligomer. Gel filtration and laser light scattering (LLS) of purified full-length PACS-1 would reveal if the P ACS-1 oligomer forms from a direct interaction, and, if so, the size of the P ACS-1

complex compared to known markers, the ratio of oligomeric states, and the true size and

molecular weight of the eluted protein. Using these methods, testing the oligomeric state

of full-length PACS-1 containing a Ser278 ~ Ala or Ser278 ~ Asp substitution would

determine if Ser278 is critical for PACS-1 oligomerization in vitro. In addition, repeating

my preliminary findings with full-length PACS-1 proteins containing these substitutions,

would determine if Ser278 is required for oligomerization in vivo. It is possible that

phosphorylation of PACS-1 will have no detectable effect on the ability of PACS-1 to

form oligomers. This would indicate that oligmerization of PACS-1 is probably not

important for the regulation of cargo binding, but instead may be critical to concentrating

cargo proteins into nascent vesicles.

Implications for CK2 binding and activation

Our observation that the R196RKRY polybasic segment is required for PACS-1 to bind

and activate CK2 in vitro and in vivo (Chapter 3, Figures 4 and 5) provides a mechanism

for localizing this kinase to phosphorylate regulatory sites on PACS-1 and GGA3.

Furthermore, our metabolic labeling studies (Chapter 3·, Figure 6) showed that PACS- 32 15278AICKmut exhibited equal P incorporation compared to PACS-1 5278A, providing evidence

that CK2 that is bound to PACS-1 phosphorylates Ser278 • However, we have not yet

determined which residues on GGA3 are affected by the PACS-1/CK2 interaction. There

121 Chapter 4. Discussion

are two consensus CK2 sites on GGA3 thought to regulate GGA3 function: Ser372 and

Ser388 • CK2 phosphorylation of GGA3 Ser372 is required for EGF-stimulated

phosphorylation of GGA3 Ser368 by an unidentified kinase, which causes a conformational change in GGA3 that correlates with reduced association with

membranes (Kametaka et al., 2005). GGA3 Ser388 lies within the GGA3 autoregulatory domain, and CK2 phosphorylation of this residue induces a conformational change that correlates with an inhibition of CI-MPR binding (Doray et al., 2002b; Ghosh and

Kornfeld, 2003a). One method to determine if phosphorylation of these residues is controlled by PACS-1/CK2 is to construct phospho-specific antibodies to these two sites and use them for western blotting of cell lysate made from cells expressing HA-PACS-1 or HA-PACS-1cKmut· Alternatively, these studies could be done by quantitative phospho­ analysis using mass spectrometry of immunoprecipitated endogenous GGA3 from cells expressing HA-PACS-1 or HA-PACS-1cKmut·

In addition to interacting with CK2a, several reports have shown that CK2B can interact with and modulate the activity of a number of other protein kinases, including A-Raf

(Boldyreff and Issinger, 1997), c-Mos (Chen et al., 1997b), the Src family tyrosine kinase

Lyn (Lehner et al., 2004), p90rsk ( S6 kinase; Kusk et al., 1999), check point kinase (Chk)-1 (Guerra et al., 2003) and Chk2 (Bj"rling-Poulsen et al., 2005). These kinases have functions ranging from control of cell-cycle progression (Chk1, Chk2 and c­

Mos; Matsuoka et al., 1998; Mutter et al., 1988; Walworth et al., 1993) to cell proliferation (A-Raf; Metz et al., 1995) to viral pathogenesis (Lyn; Tomkowicz et al.,

2006), raising the possibility that PACS-1 anchored CK2B may serve other functions

122 Chapter 4. Discussion besides regulation of endosomal trafficking, or that PACS-1 may localize these other kinases to sites of en do somal function. An interaction between P ACS-1 and these other kinases could be investigated by expressing full length HA-PACS-1 or HA-PACS-1cKmut in cells, immunoprecipitating the HA-proteins and western blotting for these kinases.

Additional experiments would involve direct protein-protein binding studies to show that

CK2~ is required for the interaction, such as formation of a PACS-1/CK2~/kinase ternary complex. Any finding that a CK2~ binding protein uses this interaction to recruit more than one kinase would be completely novel, and could shed light on PACS-1 and CK2~ biology.

Implications for GGA binding

A number of sorting proteins are known to direct endosome-to-TGN retrieval of the CI­

MPR, leading one to ask why the PACS-1/GGA3 complex is required for this sorting step. One possibility involves Rabaptin5. Mattera and coworkers showed that when

Rabaptin5 bound to GGA3, binding of GGA3 to clathrin was reduced-thereby preventing GGA3 from initiating vesicular transport of the endosomal CI-MPR (Mattera et al., 2003). PACS-1 could replace GGA3, and bring AP-1/clathrin to the endosomal CI­

MPR to direct TGN retrieval. This additional sorting step may represent a timing mechanism to prevent immediate retrieval of the CI-MPR before hydrolase disassociation

Alternatively, perhaps the binding requirements on the cytosolic domain of the CI-MPR differ depending on the ligand-bound state of the receptor, determining the need for a

PACS-1/GGA3 directed sorting event, or a sorting event directed by another molecule.

This theory could be tested using reporter constructs that contain the CI-MPR cytosolic

123

124 124

Ptdlns(3)P. Ptdlns(3)P.

as as furin furin or or HIV HIV -1 -1 Nef Nef PACS-1 PACS-1 would would be be recruited recruited by by the the acidic acidic cluster cluster motif motif and and

motif, motif, Ptdlns(3)P Ptdlns(3)P and and GGA3, GGA3, whereas for for whereas cargo cargo that that only only have have acidic acidic cluster cluster motifs, motifs, such such

such such as as the the CI-MPR, CI-MPR, PACS-1 PACS-1 could could be be recruited recruited by by the the acidic acidic cluster/acidic-dileucine cluster/acidic-dileucine

depending depending on on the the particular particular cargo cargo protein: protein: for for cargoes cargoes that that have have acidic-dileucine acidic-dileucine motifs motifs

endosomal endosomal membrane. membrane. Perhaps Perhaps the the "coincidence" "coincidence" detection detection system system for for PACS-1 PACS-1 differs differs

recruited recruited to to membranes membranes through through an an interaction interaction with with an an activated activated GTPase GTPase on on the the

catalyzes catalyzes Ptdlns(3)P Ptdlns(3)P production, production, affects affects the the localization localization of of PACS-1. PACS-1. PACS-1 PACS-1 may may also also be be

steps. steps. An An alternative alternative strategy strategy is is to to determine determine if if siRNA siRNA depletion depletion of of PBK, PBK, the the kinase kinase that that

required required for for the the subcellular subcellular localization localization of of PACS-1, PACS-1, and and for for PACS-1 PACS-1 dependent dependent sorting sorting

does does not not bind bind Ptdlns(3)P. Ptdlns(3)P. This This mutant mutant could could be be used used to to determine determine if if Ptdlns(3)P Ptdlns(3)P is is

first first map map the the Ptdlns(3 Ptdlns(3 )P )P binding binding site site on on P P ACS-1 ACS-1 and and then then create create a a mutant mutant P P ACS-1 ACS-1 that that

PACS-1 PACS-1 is is recruited recruited to to endosomal endosomal membranes membranes by by an an interaction interaction with with Ptdlns(3)P Ptdlns(3)P must must

other other known known phospohlipid phospohlipid binding binding module. module. Therefore, Therefore, future future studies studies to to determine determine if if

FYVE FYVE domains. domains. But, But, P P ACS-1 ACS-1 does does not not contain contain either either of of these these predicted predicted domains, domains, or or any any

2). 2). Ptdlns(3)P Ptdlns(3)P is is concentrated concentrated on on early early endosomal endosomal membranes membranes and and interacts interacts with with PX PX and and

that that an an interaction interaction of of PACS-1 PACS-1 with with Ptdls(3)P Ptdls(3)P may may also also play play a a role role (Appendix (Appendix C, C, Figure Figure

PACS-1 PACS-1 to to early early endosomal endosomal membranes. membranes. However, However, my my preliminary preliminary evidence evidence indicates indicates

Our Our finding finding that that PACS-1 PACS-1 binds binds to to GGA3 GGA3 may may represent represent a a mechanism mechanism for for recruiting recruiting

an an anti-GFP anti-GFP antibody, antibody, which which would would mimic mimic the the ligated-state ligated-state of of the the receptor. receptor.

followed followed using using GFP, GFP, which which would would mimic mimic the the non-ligated non-ligated state state of of the the receptor, receptor, or or by by using using

and and transmembrane transmembrane domains domains fused fused to to GFP. GFP. The The endosomal endosomal path path of of the the reporter reporter could could be be

Chapter Chapter 4. 4. Discussion Discussion Chapter 4. Discussion

Implications for PACS-2

The similarities in PACS-2 amino acid sequence compared to PACS-1, especially in the

FBR and MR regions, indicate that, like PACS-1, PACS-2 may also be regulated by CK2

phosphorylation of an autoregulatory domain. PACS-2 contains an acidic cluster in the

MR region ( ... S199EEEYE ... ) that is similar to the PACS-1 autoregulatory domain and

also to acidic clusters in known PACS-2 cargo proteins. In addition, the basic cluster of

amino acids on PACS-1 ( ... R196RKR ... ) that is required for CK2 binding is also present on PACS-2. Preliminary data from metabolically labeled cells indicates that PACS-2 is a

phosphoprotein, and yeast-two-hybrid analysis indicates that the PACS-2 FBR and CK2~

interact (unpublished results). However, CK2 does not co-immunoprecipitate with expressed full-length HA-PACS-2 (unpublished results), indicating that PACS-2 may

interact with CK2, but that this interaction is regulated differently than for PACS-1 or is a

weaker interaction that can be detected in yeast, but not by co-immunoprecipitaion from

mammalian cells. These preliminary results suggest that PACS-2 Ser199 may be

phosphorylated by CK2 to act as an autoregulatory domain for PACS-2 cargo binding.

Future studies should determine if Ser199 of PACS-2 is required for PACS-2

phosphorylation, if phosphorylation of PACS-2 Ser199 affects binding of the PACS-2

autoregulatory domain with the PACS-2 cargo binding region, and if CK2 binding to

PACS-2 is required for phosphorylation of this, or other PACS-2 residues. These studies

could address whether the phosphorylation state of the PACS-2 acidic cluster regulates

the ability of PACS-2 to interact with and control the ER localization of PKD-2.

Interestingly, the PACS-2 acidic cluster contains a tyrosine residue, Tyr203 , that is

125

126 126

encoding encoding the the lysosomal lysosomal hydrolase hydrolase beta-hexosaminidase beta-hexosaminidase A A (Abe (Abe et et al., al., 1985), 1985), resulting resulting in in

ganglioside ganglioside in in the the peripheral peripheral and and central central nervous nervous systems, systems, due due to to defects defects in in the the gene gene

retardation. retardation. Patients Patients with with Tay-Sachs Tay-Sachs disease disease develop develop inclusion inclusion bodies bodies filled filled with with GM2-

disrupted disrupted trafficking trafficking of of hydrolases hydrolases and and suffer suffer numerous numerous defects, defects, including including mental mental

al., al., 1971 1971 ). ). Patients Patients with with 1-cell 1-cell disease disease exhibit exhibit buildup buildup of of lipids lipids in in the the lysosome lysosome due due to to

into into extracellular extracellular fluids, fluids, swelling swelling of of lysosomes lysosomes and and severe severe neuronal neuronal defects defects (Wiesmann (Wiesmann et et

in in hydrolase hydrolase activity. activity. 1-cell 1-cell disease disease is is characterized characterized by by enhanced enhanced secretion secretion of of hydrolases hydrolases

1-Cell 1-Cell and and Tay-Sachs Tay-Sachs disease, disease, which which are are congenital disorders disorders congenital stemming stemming from from a a reduction reduction

of of severe severe neuronal neuronal defects defects in in patients patients suffering suffering from from lysosomal lysosomal storage storage disorders, disorders, such such as as

neurons, neurons, correct correct sorting sorting of of lysosomal lysosomal hydrolases hydrolases is is critical, critical, as as evidenced evidenced by by manifestation manifestation

PACS-1 PACS-1 is is an an essential essential cellular cellular component component for for directing directing hydrolases hydrolases to to the the lysosome. lysosome. In In

secretion secretion of of the the lysosomal lysosomal hydrolase hydrolase Cathepsin Cathepsin from from cultured cultured cell cell D D lines, lines, indicates indicates that that

the the sorting sorting of of the the CI-MPR, CI-MPR, as as well well as as our our finding finding that that PACS-1 PACS-1 depletion depletion increases increases

Additionally, Additionally, our our studies studies of of the the interplay interplay between between PACS-1, PACS-1, GGA3 GGA3 and and CK2 CK2 to to control control

fusion fusion of of immature immature secretory secretory granules granules within within neuroendocrine neuroendocrine cells cells (Hinners (Hinners et et al., al., 2003). 2003).

protein protein that that binds binds to to P P ACS-1 ACS-1 and and may may be be important important for for the the maturation maturation and and homotypic homotypic

1 1 cargo cargo proteins proteins have have known known functions functions in in neurons. neurons. For For instance, instance, V V AMP-4 AMP-4 is is a a snare

PACS-1 PACS-1 is is highly highly expressed expressed in in neuronal neuronal tissue tissue (Simmen (Simmen et et al., al., 2005), 2005), and and several several PACS-

Implications Implications for for neuronal neuronal funCtion funCtion

an an layer layer extra of of regulation regulation to to PACS-2 PACS-2 function. function.

203 203

199 phosphorylation phosphorylation of of Tyr increases increases the the ability ability of of CK2 CK2 to to phosphorylate phosphorylate Ser and and adding adding , ,

predicted predicted to to be be phosphorylated phosphorylated by by Src Src family family kinases kinases (Scansite (Scansite ), ), suggesting suggesting that that

Chapter Chapter 4. 4. Discussion Discussion Chapter 4. Discussion deterioration of mental and physical abilities, severe brain damage, enlargement of the head, convulsions, blindness, deafness, and, finally, death. Based on our findings that

PACS-1 is required for sorting of hydro lases, it is possible that targeted disruption of the

PACS-1 gene in mice may yield increased hydrolase secretion into the extracellular space, a defect similar to that observed in patients with 1-cell or Tay-Sachs disease.

Conclusion

Studies performed for this dissertation used biochemical-, cellular-, and cell-free­ methods to investigate how trafficking of membrane proteins in the TGN and endosomal systems is regulated. By investigating how regulation of PACS-1 affects endosomes-to­

TGN retrieval of membrane proteins, these studies shed light on the molecular interactions required for efficient transport within the secretory system. However, the long-term goal is to identify and understand all of the molecular interactions with sorting signals on the cytosolic tails of membrane proteins required for directed transport in the secretory system.

127

128 128

347-349. 347-349.

factor factor essential essential for for transport transport vesicle vesicle budding budding from from the the ER. ER. Nature, Nature, 365(6444), 365(6444),

Barlowe, Barlowe, C C and and Schekman, Schekman, R. R. (1993) (1993) SEC12 SEC12 encodes encodes a a guanine-nucleotide-exchange guanine-nucleotide-exchange

reticulum. reticulum. Cell, Cell, 77(6), 77(6), 895-907. 895-907.

formed formed by by Sec Sec proteins proteins that that drive drive vesicle vesicle budding budding from from the the endoplasmic endoplasmic

Ravazzola, Ravazzola, M, M, Amherdt, Amherdt, M M and and Schekman, Schekman, R. R. (1994) (1994) COPII: COPII: a a membrane membrane coat coat

Barlowe, Barlowe, C, C, Orci, Orci, L, L, Yeung, Yeung, T, T, Hosobuchi, Hosobuchi, M, M, Hamamoto, Hamamoto, S, S, Salama, Salama, N, N, Rexach, Rexach, MF, MF,

the the coupled coupled incorporation incorporation ofN-acetylglucosamine. ofN-acetylglucosamine. Cell, Cell, 39(2) 39(2) Pt Pt 1, 1, 405-416. 405-416.

transport transport of of protein protein between between successive successive compartments compartments of of the the Golgi Golgi measured measured by by

Balch, Balch, WE, WE, Dunphy, Dunphy, WG, WG, Braell, Braell, W A A W and and Rothman, Rothman, JE. JE. (1984) (1984) Reconstitution Reconstitution of of the the

receptor. receptor. J J Cell Cell Bioi, Bioi, 165, 165, 123-133. 123-133.

mammalian mammalian retromer retromer in in sorting sorting of of the the cation-independent cation-independent mannose mannose 6-phosphate 6-phosphate

Arighi, Arighi, CN, CN, Hartnell, Hartnell, LM, LM, Aguilar, Aguilar, RC, RC, Haft, Haft, CR CR and and Bonifacino, Bonifacino, JS. JS. (2004) (2004) Role Role of of the the

fibroblasts. fibroblasts. Cell, Cell, 10(3), 10(3), 351-364. 351-364.

vesicle vesicle in in the the uptake uptake of of receptor-bound receptor-bound low low density density lipoprotein lipoprotein in in human human

Anderson, Anderson, RG, RG, Brown, Brown, MS MS and and Goldstein, Goldstein, JL. JL. (1977) (1977) Role Role of of the the coated coated endocytic endocytic

and and internal internal propeptide propeptide cleavage. cleavage. Ernbo Ernbo 16, 16, 1508-1518. 1508-1518. J, J,

the the furin furin endoprotease endoprotease is is a a multiple-step multiple-step process: process: requirements requirements for for acidification acidification

Anderson, Anderson, ED, ED, VanSlyke, VanSlyke, JK, JK, Thulin, Thulin, CD, CD, Jean, Jean, F F and and Thomas, Thomas, G. G. (1997) (1997) Activation Activation of of

Bioi Bioi Chern, Chern, J J 268, 268, 24887-24891. 24887-24891.

gp160-dependent gp160-dependent membrane membrane fusion fusion by by a a furin-directed furin-directed alpha alpha !-antitrypsin !-antitrypsin variant. variant.

Anderson, Anderson, ED, ED, Thomas, Thomas, L, L, Hayflick, Hayflick, JS JS and and Thomas, Thomas, G. G. (1993) (1993) Inhibition Inhibition ofHIV-1 ofHIV-1

12879-12890. 12879-12890.

intramolecular intramolecular chaperone chaperone is is required required for for enzyme enzyme activation. activation. J J Bioi Bioi Chern, Chern, 277, 277,

ordered ordered and and compartment-specfific compartment-specfific autoproteolytic autoproteolytic removal removal of of the the furin furin

Anderson, Anderson, ED, ED, Molloy, Molloy, SS, SS, Jean, Jean, F, F, Fei, Fei, H, H, Shimamura, Shimamura, Sand Sand Thomas, Thomas, G. G. (2002) (2002) The The

595-605. 595-605.

signal signal recognition recognition on on the the endocytic endocytic and and secretory secretory pathways. pathways. J J Cell Cell Bioi, Bioi, 170(4}, 170(4},

Mellman, Mellman, (2005) (2005) I. I. Transcytosis Transcytosis of of NgCAM NgCAM in in epithelial epithelial cells cells reflects reflects differential differential

Anderson, Anderson, E, E, Maday, Maday, S, S, Sfakianos, Sfakianos, J, J, Hull, Hull, M, M, Winckler, Winckler, B, B, Sheff, Sheff, D, D, Feolsch, Feolsch, Hand Hand

its its trans-Golgi trans-Golgi network network localization. localization. J J Viral, Viral, Vol. Vol. 73, 73, pp. pp. 377-387. 377-387.

simplex simplex virus virus glycoprotein glycoprotein gE: gE: characterization characterization of of the the sorting sorting signals signals required required for for

Alconada, Alconada, Bauer, Bauer, A, A, U, U, Sodeik, Sodeik, B B and and Hoflack, Hoflack, B. B. (1999) (1999) Intracellular Intracellular traffic traffic of of herpes herpes

Vol. Vol. 15, 15, J, J, pp. pp. 6096-6110. 6096-6110.

zoster zoster virus virus glycoprotein glycoprotein I, I, a a protein protein localized localized in in the the trans-Golgi trans-Golgi network. network. Ernbo Ernbo

kinase kinase II II phosphorylation phosphorylation site site regulate regulate the the intracellular intracellular trafficking trafficking of of the the varicella­

Alconada, Alconada, A, A, Bauer, Bauer, U U and and Hoflack, Hoflack, B. B. (1996) (1996) A A tyrosine-based tyrosine-based motif motif and and a a casein casein

Golgi Golgi network. network. Bioi Bioi Cliern, Cliern, J J Vol. Vol. 273, 273, pp. pp. 13430-13436. 13430-13436.

accelerates accelerates the the maturation maturation of of gi gi and and determines determines its its accumulation accumulation in in the the trans­

transport transport of of the the glycoproteins glycoproteins gE gE and and gi gi of of the the varicella-zoster varicella-zoster virus. virus. gE gE

Alconada, Alconada, A, A, Bauer, Bauer, U, U, Baudoux, Baudoux, L, L, Piette, Piette, J J and and Hoflack, Hoflack, B. B. (1998) (1998) Intracellular Intracellular

ganglioside ganglioside studies. studies. Acta Acta Neuropathol Neuropathol (Berl), (Berl), 66(3). 66(3).

and and peripheral peripheral nerves nerves from from a a patent patent with with Tay-Sachs Tay-Sachs disease. disease. Morphological Morphological and and

Abe, Abe, T, T, Ogawa, Ogawa, K, K, Fuziwara, Fuziwara, H, H, Urayama, Urayama, K K and and Nagashima, Nagashima, (1985) (1985) K. K. Spinal Spinal ganglia ganglia

References References References References References

Baukrowitz, T, Tucker, SJ, Schulte, U, Benndorf, K, Ruppersberg, JP and Fakler, B. (1999) Inward rectification in KATP channels: a pH switch in the pore. Embo J, 18, 847-853. Behnia, R and Munro, S. (2005) Organelle identity and the signposts for membrane traffic. Nature, 438(7068), 597-604. Beitia Ortiz de Zarate, I, Kaelin, K and Rozenberg, F. (2004) Effects of mutations in the cytoplasmic domain of herpes simplex virus type 1 glycoprotein B on intracellular transport and infectivity. J Viral, Vol. 78, pp. 1540-1551. Bergeron, E, Basak, A, Decroly, E and Seidah, NG. (2003) Processing of alpha4 integrin by the proprotein convertases: histidine at position P6 regulates cleavage. Biochem J, 373,475-484. Bhattacharjya, S, Xu, P, Xiang, H, Chretien, M, Seidah, NG and Ni, F. (2001) pH­ induced conformational transitions of a molten-globule-like state of the inhibitory prodomain of furin: implications for zymogen activation. Protein Sci, 10, 934- 942. Bissonnette, L, Charest, G, Longpre, JM, Lavigne, P and Leduc, R. (2004) Identification of furin pro-region determinants involved in folding and activation. Biochem J, 379,757-763. Bj'rling-Poulsen, M, Siehler, S, Wiesmeuller, L, Meek, D, Niefind, K and Issinger, OG. (2005) The 'regulatory' beta-subunit of protein kinase CK2 negatively influences p53-mediated allosteric effects on Chk2 activation. Oncogene, 24, 6194-6200. Blagoveshchenskaya, AD, Thomas, L, Feliciangeli, SF, Hung, CHand Thomas, G. (2002) HIV-1 Nef downregulates MHC-1 by a PACS-1- and PI3K-regulated ARF6 endocytic pathway. Cell, 111, 853-866. Blot, G, Janvier, K, Le Panse, S, Benarous, Rand Berlioz-Torrent, C. (2003) Targeting of the human immunodeficiency virus type 1 envelope to the trans-Golgi network through binding to TIP47 is required for env incorporation into virions and infectivity. J Viral, 77(12), 6931-6945. Boldyreff, Band lssinger, OG. (1997) A-Rafkinase is a new interacting partner of protein kinase CK2 beta subunit. FEES lett, 403, 197-199. Boll, W, Ohno, H, Songyang, Z, Rapoport, I, Cantley, LC, Bonifacino, JS and Kirchhausen, T. ( 1996) Sequence requirements for the recognition of tyrosine­ based endocytic signals by clathrin AP-2 complexes. Embo J, Vol. 15, pp. 5789- 5795. Boman, AL, Zhang, C, Zhu, X and Kahn, RA. (2000) A family of ADP-ribosylation factor effectors that can alter membrane transport through the trans-Golgi. Mol Bioi Cell, 11, 1241-1255. Bonifacino, JS. (2004a) The GGA proteins: adaptors on the move. Nat Rev Mol Cell Bioi, 5, 23-32. Bonifacino, JS and Dell'Angelica, EC. (1999) Molecular bases for the recognition of tyrosine-based sorting signals. J Cell Biol, Vol. 145, pp. 923-926. Bonifacino, JS and Glick, BS. (2004) The mechanisms of vesicle budding and fusion. Cell, Vol. 116, pp. 153-166. Bonifacino, JS and Traub, LM. (2003) Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu Rev Biochem, 72, 395-447.

129

130 130

subunit subunit reveals reveals its its zinc zinc finger-mediated finger-mediated dimerization. dimerization. 18, 18, EMBO EMBO 2930-2940. 2930-2940. J, J,

Dideberg, Dideberg, (1999) (1999) Crystal Crystal structure structure 0. 0. of of the the protein protein human kinase kinase CK2 CK2 regulatory regulatory

Chantalat, Chantalat, L, L, Leroy, Leroy, D, D, Filhol, Filhol, Nueda, Nueda, A, A, Benitez, Benitez, 0, 0, MJ, MJ, Chambaz, Chambaz, EM, EM, Cochet, Cochet, C C and and

Chern, Chern, 271(36), 271(36), 21767-21774. 21767-21774.

mammalian mammalian cells. cells. ARF6 ARF6 is is uniquely uniquely localized localized to to the the plasma plasma membrane. membrane. J J Biol Biol

Mellman, Mellman, I I and and Kahn, Kahn, RA. RA. ( ( 1996) 1996) Intracellular Intracellular distribution distribution of of ARF ARF proteins proteins in in

Cavenagh, Cavenagh, MM, MM, Whitney, Whitney, JA, JA, Carroll, Carroll, K, K, Zhang, Zhang, C, C, Boman, Boman, AL, AL, Rosenwald, Rosenwald, AG, AG,

1373-1376. 1373-1376.

Rab9 Rab9 GTPase GTPase in in facilitating facilitating receptor receptor recruitment recruitment by by TIP47. TIP47. Science., Science., 292(5520), 292(5520),

Carroll, Carroll, KS, KS, Hanna, Hanna, J, J, Simon, Simon, I, I, Krise, Krise, J, J, Barbero, Barbero, P P and and Pfeffer, Pfeffer, SR. SR. (2001) (2001) Role Role of of

membranes membranes and and 3-phosphoinositides. 3-phosphoinositides. Curr Curr Biol, Biol, 14(20), 14(20), 1791-1800. 1791-1800.

endosome-to- TGN TGN transport transport through through coincidence coincidence sensing sensing of of high- curvature curvature

J, J, McMahon, McMahon, HT HT and and Cullen, Cullen, PJ. PJ. (2004) (2004) Sorting Sorting nexin-1 nexin-1 mediates mediates tubular tubular

Carlton, Carlton, J, J, Bujny, Bujny, M, M, Peter, Peter, BJ, BJ, Oorschot, Oorschot, VM, VM, Rutherford, Rutherford, A, A, Mellor, Mellor, H, H, Klumperman, Klumperman,

Neurosci, Neurosci, Vol. Vol. 13, 13, pp. pp. 2515-2539. 2515-2539.

ultrastructural ultrastructural characterization characterization of of viral viral replication, replication, transport, transport, and and pathogenesis. pathogenesis. J J

( ( 1993) 1993) Pseudorabies Pseudorabies virus virus infection infection of of the the rat rat central central nervous nervous system: system:

Card, Card, JP, JP, Rinaman, Rinaman, L, L, Lynn, Lynn, RB, RB, Lee, Lee, BH, BH, Meade, Meade, RP, RP, Miselis, Miselis, RR RR and and Enquist, Enquist, LW. LW.

Sci, Sci, 113, 113, 1993-2002. 1993-2002.

structure structure and and function function in in mammalian mammalian cells cells expressing expressing a a mutant mutant dynamin. dynamin. J J Cell Cell

Cao, Cao, H, H, Thompson, Thompson, HM, HM, Krueger, Krueger, EW EW and and McNiven, McNiven, MA. MA. (2000) (2000) Disruption Disruption of of Golgi Golgi

type type 1 1 in in viral viral entry entry and and cell cell fusion. fusion. J J Viral, Viral, Vol. Vol. 62, 62, pp. pp. 2596-2604. 2596-2604.

Cai, Cai, WH, WH, Gu, Gu, B B and and Person, Person, S. S. (1988) (1988) Role Role of of glycoprotein glycoprotein B B of of herpes herpes simplex simplex virus virus

Biol Biol Chern, Chern, 275(25), 275(25), 18647-18656. 18647-18656.

Dimerization Dimerization of of the the insulin-like insulin-like growth growth factor factor II/mannose II/mannose 6-phosphate 6-phosphate receptor. receptor. J J

Byrd, Byrd, JC, JC, Park, Park, JH, JH, Schaffer, Schaffer, BS, BS, Garmroudi, Garmroudi, F F and and MacDonald, MacDonald, RG. RG. (2000) (2000)

Chern, Chern, 211(2), 211(2), 969-980. 969-980.

Burnett, Burnett, G G and and Kennedy, Kennedy, EP. EP. (1954) (1954) The The enzymatic enzymatic phosphorylation phosphorylation of of proteins. proteins. J J Biol Biol

specific specific binding binding to to RING RING FYVE FYVE domains. domains. Mol Mol Cell, Cell, 2(1), 2(1), 157-162. 157-162.

Burd, Burd, CG CG and and Emr, Emr, SD. SD. (1998) (1998) Phosphatidylinositol(3)-phosphate Phosphatidylinositol(3)-phosphate signaling signaling mediated mediated by by

lethality. lethality. Mol Mol Cell Cell Biol, Biol, 23, 23, 908-915. 908-915.

kinase kinase CK2 CK2 in in mice mice leads leads to to a a cell-autonomous cell-autonomous defect defect and and early early embryonic embryonic

OG OG and and Boldyreff, Boldyreff, B. B. (2003) (2003) Disruption Disruption of of the the regulatory regulatory beta beta subunit subunit of of protein protein

Buchou, Buchou, T, T, Vernet, Vernet, M, M, Blond, Blond, Jensen, Jensen, HH, HH, Pointu, Pointu, 0, 0, H, H, Olsen, Olsen, BB, BB, Cochet, Cochet, C, C, Issinger, Issinger,

lipoprotein lipoprotein receptor receptor in in human human fibroblasts. fibroblasts. Cell, Cell, 6(3), 6(3), 307-316. 307-316.

Brown, Brown, MS MS and and Goldstein, Goldstein, JL. JL. ( ( 197 197 5) 5) Regulation Regulation of of the the activity activity of of the the low low density density

protein protein endocytosis endocytosis in in tlie tlie herpesvirus herpesvirus life life J J cycle. cycle. Clin Clin Viral, Viral, Vol. Vol. 17, 17, pp. pp. 69-82. 69-82.

Brideau, Brideau, AD, AD, Enquist, Enquist, LW LW and and Tirabassi, Tirabassi, RS. RS. (2000b) (2000b) The The role role of of virion virion membrane membrane

the the Us9 Us9 cytoplasmic cytoplasmic tail. tail. Viral, Viral, Vol. Vol. 74, 74, pp. pp. 4549-4561. 4549-4561. J J

by by infection pseudorabies pseudorabies virus virus is is dependent dependent on on an an acidic acidic internalization internalization motif motif in in

Brideau, Brideau, AD, AD, Eldridge, Eldridge, MG MG and and Enquist, Enquist, LW. LW. (2000a) (2000a) Directional Directional transneuronal transneuronal

24787. 24787.

directly directly stimulates stimulates CK2 CK2 activity activity toward toward nucleolin. nucleolin. J J Biol Biol Chern, Chern, 271, 271, 24781-

( ( 1996) 1996) Fibroblast Fibroblast growth growth factor- 2 2 binds binds to to the the regulatory regulatory beta beta subunit subunit of of CK2 CK2 and and

Bonnet, Bonnet, H, H, Filhol, Filhol, Truchet, Truchet, I, I, Brethenou, Brethenou, 0, 0, P, P, Cochet, Cochet, C, C, Amalric, Amalric, F F and and Bouche, Bouche, G. G. References References References

Cheever, ML, Sato, TK, de Beer, T, Kutateladze, TG, Emr, SD and Overduin, M. (2001) Phox domain interaction with Ptdlns(3)P targets the Vam7 t-SNARE to vacuole membranes. Nat Cell Bioi, 3(7), 613-618. Chen, HJ, Yuan, J and Lobel, P. (1997a) Systematic mutational analysis of the cation­ independent mannose 6-phosphate/insulin-like growth factor II receptor cytoplasmic domain. An acidic cluster containing a key aspartate is important for function in lysosomal enzyme sorting. J Bioi Chern, 272, 7003-7012. Chen, M, Li, D, Krebs, EG and Cooper, JA. (1997b) The casein kinase II beta subunit binds to Mos and inhibits Mos activity. Mol Cell Biol, 17, 1904-1912. Christoforidis S, McBride HM, Burgoyne RD, Zerial M. (1999) The Rab5 effector EEAI is a core component of endosome docking. Nature, 397(6720), 621-5. Collins, BM, McCoy, AJ, Kent, HM, Evans, PR and Owen, DJ. (2002) Molecular architecture and functional model of the endocytic AP2 complex. Cell, 109(4), 523-535. Collins, KL, Chen, BK, Kalams, SA, Walker, BD and Baltimore, D. (1998) HIV-1 Nef protein protects infected primary cells against killing by cytotoxic T lymphocytes. Nature, 391(6665), 397-401. Comellas-Bigler, M, Maskos, K, Huber, R, Oyama, H, Oda, K and Bode, W. (2004) 1.2 A crystal structure of the serine carboxyl proteinase pro-kumamolisin; structure of an intact pro-subtilase. Structure, 12, 1313-1323. Cozier, GE, Carlton, J, McGregor, AH, Gleeson, PA, Teasdale, RD, Mellor, Hand Cullen, PJ. (2002) The phox homology (PX) domain-dependent, 3- phosphoinositide-mediated association of sorting nexin-1 with an early sorting endosomal compartment is required for its ability to regulate epidermal growth factor receptor degradation. J Biol Chern, 277(50), 48730-48736. Crump, CM, Hung, CH, Thomas, L, Wan, Land Thomas, G. (2003) Role ofPACS-1 in trafficking of human cytomegalovirus glycoprotein B and virus production. J Virol, 77,11105-11113. Crump, CM, Xiang, Y, Thomas, L, Gu, F, Austin, C, Tooze, SA and Thomas, G. (2001) PACS-1 binding to adaptors is required for acidic cluster motif-mediated protein traffic. Ernbo J, 20, 2191-2201. Davis, CG, van Driel, IR, Russell, DW, Brown, MS and Goldstein, JL. ( 1987) The low density lipoprotein receptor. Identification of amino acids in cytoplasmic domain required for rapid endocytosis. J Biol Chern, 262(9), 4075-4082. Davison, AJ and Scott, JE. (1986) The complete DNA sequence of varicella-zoster virus. J Gen Virol, Vol. 67, pp. 1759-1816. Degnin, C, Jean, F, Thomas, G and Christian, JL. (2004) Cleavages within the prodomain direct intracellular trafficking and degradation of mature bone morphogenetic protein-4. Mol Biol Cell, 15, 5012-5020. Dell'Angelica, EC, Klumperman, J, Stoorvogel, Wand Bonifacino, JS. (1998) Association of the AP-3 adaptor complex with clathrin. Science, 280(5362), 431- 434. Dell'Angelica, EC, Puertollano, R, Mullins, C, Aguilar, RC, Vargas, JD, Hartnell, LM and Bonifacino, JS. (2000) GGAs: a family of ADP ribosylation factor-binding proteins related to adaptors and associated with the Golgi complex. J Cell Biol, 149, 81-94.

131

132 132

(2002) (2002) A A tyrosine-based tyrosine-based motif motif in in cytoplasmic cytoplasmic the tail tail of of pseudorabies pseudorabies virus virus

Favoreel, Favoreel, HW, HW, Van Van Minnebruggen, Minnebruggen, G, G, Nauwynck, Nauwynck, HJ, HJ, Enquist, Enquist, LW LW and and Pensaert, Pensaert, MB. MB.

herpes herpes simplex simplex virus virus infection. infection. J J Viral, Viral, Vol. Vol. 73, 73, pp. pp. 4I10-4119. 4I10-4119.

Elliott, Elliott, G G and and O'Hare, O'Hare, P. P. (1999) (1999) Live-cell Live-cell analysis analysis of of a a green green fluorescent fluorescent protein-tagged protein-tagged

varicella-zoster varicella-zoster virus virus envelope envelope glycoprotein. glycoprotein. J J Viral, Viral, Vol. Vol. 56, 56, pp. pp. 333-336. 333-336.

Cross-reactivity Cross-reactivity between between herpes herpes simplex simplex virus virus glycoprotein glycoprotein B B and and a a 63,000-dalton 63,000-dalton

Edson, Edson, CM, CM, Hosler, Hosler, BA, BA, Respess, Respess, RA, RA, Waters, Waters, DJ DJ and and Thorley-Lawson, Thorley-Lawson, DA. DA. (1985) (1985)

confocal confocal microscopy. microscopy. Virology, Virology, Vol. Vol. 210, 210, pp. pp. 429-440. 429-440.

varicella-zoster varicella-zoster virus virus gH:gL gH:gL glycoprotein glycoprotein complex: complex: analysis analysis by by laser laser scanning scanning

Duus, Duus, KM, KM, Hatfield, Hatfield, C C and and Grose, Grose, C. C. (1995) (1995) Cell Cell surface surface expression expression and and fusion fusion by by the the

Vol. Vol. 70, 70, pp. pp. 8961-8971. 8961-8971.

(VZV) (VZV) gL gL on on trafficking trafficking patterns patterns and and fusogenic fusogenic properties properties of of VZV VZV J J gH. gH. Viral, Viral,

Duus, Duus, KM KM and and Grose, Grose, C. C. ( ( 1996) 1996) Multiple Multiple regulatory regulatory effects effects of of varicella-zoster varicella-zoster virus virus

mechanisms. mechanisms. Mol Mol Cell, Cell, 1169-1182. 1169-1182. 6, 6,

binding binding specificity specificity and and implications implications for for phospho-dependent phospho-dependent signaling signaling

SJ SJ and and Yaffe, Yaffe, MB. MB. (2000) (2000) The The molecular molecular basis basis of of FHA FHA domain:phosphopeptide domain:phosphopeptide

Durocher, Durocher, D, D, Taylor, Taylor, lA, lA, Sarbassova, Sarbassova, D, D, Haire, Haire, LF, LF, Westcott, Westcott, SL, SL, Jackson, Jackson, SP, SP, Smerdon, Smerdon,

22034. 22034.

protein protein disulfide disulfide isomerase isomerase and and expression secretion. secretion. J J Bioi Bioi Chern, Chern, 265, 265, 22029-

The The stress stress response response in in Chinese Chinese hamster hamster ovary ovary cells. cells. Regulation Regulation of of ERp72 ERp72 and and

Domer, Domer, AJ, AJ, Wasley, Wasley, LC, LC, Raney, Raney, P, P, Haugejorden, Haugejorden, S, S, Green, Green, M M and and Kaufman, Kaufman, RJ. RJ. (1990) (1990)

1700-1703. 1700-1703.

GGAs GGAs and and AP-I AP-I in in packaging packaging MPRs MPRs at at the the trans-Golgi trans-Golgi network. network. Science, Science, 297, 297,

Doray, Doray, B, B, Ghosh, Ghosh, P, P, Griffith, Griffith, J, J, Geuze, Geuze, and and HJ Kornfeld, Kornfeld, S. S. (2002c) (2002c) Cooperation Cooperation of of

motif. motif. Proc Proc Natl Natl Acad Acad Sci Sci USA, USA, 8072-8077. 8072-8077. 99, 99,

binding binding site site of of GGAI/3 GGAI/3 VHS VHS domains domains by by an an internal internal acidic acidic cluster-dileucine cluster-dileucine

Doray, Doray, B, B, Bruns, Bruns, K, K, Ghosh, Ghosh, P P and and Kornfeld, Kornfeld, SA. SA. (2002b) (2002b) Autoinhibition Autoinhibition of of the the ligand­

277,pp. 277,pp. I8477-I8482. I8477-I8482.

dependent dependent mannose mannose 6-phosphate 6-phosphate receptor receptor with with GGA GGA proteins. proteins. J J Bioi Bioi Chern, Chern, Vol. Vol.

Doray, Doray, B, B, Bruns, Bruns, K, K, Ghosh, Ghosh, P P and and Kornfeld, Kornfeld, S. S. (2002a) (2002a) Interaction Interaction of of the the cation­

360(6402), 360(6402), 350-352. 350-352.

membrane-catalysed membrane-catalysed exchange exchange of of guanine guanine nucleotide nucleotide onto onto ARF ARF protein. protein. Nature, Nature,

Donaldson, Donaldson, JG, JG, Finazzi, Finazzi, D D and and Klausner, Klausner, RD. RD. (I992) (I992) Brefeldin Brefeldin A A inhibits inhibits Golgi Golgi

4870. 4870.

complex complex is is modulated modulated by by casein casein kinase kinase II II phosphorylation. phosphorylation. Ernbo Ernbo 16, 16, 4859- J, J,

immature immature secretory secretory granules granules from from neuroendocrine neuroendocrine cells cells with with the the AP-I AP-I adaptor adaptor

Dittie, Dittie, AS, AS, L, L, Thomas, Thomas, Thomas, G G and and Tooze, Tooze, SA. SA. (1997) (1997) Interaction Interaction of of furin furin in in

16(3), 16(3), 465-72. 465-72. J, J, . .

displacement displacement factor factor that that releases releases endosomal endosomal Rab Rab GTPases GTPases from from Rab-GDI. Rab-GDI. EMBO EMBO

Dirac-Svejstrup Dirac-Svejstrup AB, AB, Sumizawa Sumizawa T, T, Pfeffer Pfeffer SR. SR. (1997) (1997) Identification Identification of of a a GDI GDI

receptor receptor trafficking. trafficking. Cell, Cell, Vol. Vol. 93, 93, pp. pp. 433-443. 433-443.

Diaz, Diaz, E E and and Pfeffer, Pfeffer, SR. SR. (1998) (1998) TIP47: TIP47: a a cargo cargo selection selection device device for for mannose mannose 6-phosphate 6-phosphate

21. 21.

due due to to mutations mutations in in the the beta beta 3A 3A subunit subunit of of the the AP-3 AP-3 adaptor. adaptor. Mol Mol Cell, Cell, 3(1), 3(1), II-

(1999) (1999) Altered Altered trafficking trafficking of of lysosomal lysosomal proteins proteins in in Hermansky-Pudlak Hermansky-Pudlak syndrome syndrome

Dell'Angelica, Dell'Angelica, EC, EC, Shotelersuk, Shotelersuk, V, V, Aguilar, Aguilar, RC, RC, Gahl, Gahl, W W A, A, Bonifacino, Bonifacino, JS JS and and Cell, Cell, B. B. References References References

glycoprotein B is important for both antibody-induced internalization of viral glycoproteins and efficient cell-to-cell spread. J Viral, Vol. 76, pp. 6845-6851. Feng, Y, Press, Band Wandinger-Ness, A. (1995) Rab 7: an important regulator of late endocytic membrane traffic. J Cell Biol, 131(6) Pt 1, 1435-1452. Feolsch, H, Ohno, H, Bonifacino, JS and Mellman, I. (1999) A novel clathrin adaptor complex mediates basolateral targeting in polarized epithelial cells. Cell, 99(2}, 189-198. Fish, KN, Soderberg-Naucler, C and Nelson, JA. (1998) Steady-state plasma membrane expression of human cytomegalovirus gB is determined by the phosphorylation state of Ser900. J Viral, Vol. 72, pp. 6657-6664. Ford, MG, Pearse, BM, Higgins, MK, Vallis, Y, Owen, DJ, Gibson, A, Hopkins, CR, Evans, PR and McMahon, HT. (200 1) Simultaneous binding of Ptdins(4,5)P2 and clathrin by AP180 in the nucleation of clathrin lattices on membranes. Science, 291(5506}, 1051-1055. Forghani, B, Ni, L and Grose, C. ( 1994) Neutralization epitope of the varicella-zoster virus gH:gL glycoprotein complex. Virology, Vol. 199, pp. 458-462. Friend DS, Farquhar MG. (1967) Functions of coated vesicles during protein absorption in the rat vas deferens. J Cell Biol, 35(2}, 357-76. Gallusser, A and Kirchhausen, T. (1993) The beta 1 and beta 2 subunits of the AP complexes are the clathrin coat assembly components. Embo J, 12(13}, 5237- 5244. Gershon, AA, Sherman, DL, Zhu, Z, Gabel, CA, Ambron, RT and Gershon, MD. (1994) Intracellular transport of newly synthesized varicella-zoster virus: final envelopment in the trans-Golgi network. J Viral, Vol. 68, pp. 6372-6390. Ghosh, P, Dahms, NM and Kornfeld, S. (2003a) Mannose 6-phosphate receptors: new twists in the tale. Nat Rev Mol Cell Biol, Vol. 4, pp. 202-212. Ghosh, P, Griffith, J, Geuze, HJ and Kornfeld, S. (2003b) Mammalian GGAs act together to sort mannose 6-phosphate receptors. J Cell Biol, 163, 755-766. Ghosh, P and Kornfeld, S. (2003a) Phosphorylation-induced conformational changes regulate GGAs 1 and 3 function at the trans-Golgi network. J Biol Chern, 278, 14543-14549. Ghosh P, Kornfeld S. (2003b) AP-1 binding to sorting signals and release from clathrin­ coated vesicles is regulated by phosphorylation. J Cell Biol., 160(5}, 699-708. Goldberg, J. (1998) Structural basis for activation of ARF GTPase: mechanisms of guanine nucleotide exchange and GTP-myristoyl switching. Cell, 95(2}, 237-248. Gonzalez-Noriega A, Grubb JH, Talkad V, Sly WS. (1980) Chloroquine inhibits lysosomal enzyme pinocytosis and enhances lysosomal enzyme secretion by impairing receptor recycling. J Cell Biol, 85(3}, 839-52. Gorvel, JP, Chavrier, P, Zerial, M and Gruenberg, J. (1991) rab5 controls early endosome fusion in vitro. Cell, 64(5}, 915-925. Greenberg, M, DeTulleo, L, Rapoport, I, Skowronski, J and Kirchhausen, T. (1998) A dileucine motif in HIV -1 Nef is essential for sorting into clathrin-coated pits and for downregulation of CD4. Curr Biol, 8(22}, 1239-1242. Griffiths, G, Hoflack, B, Simons, K, Mellman, I and Kornfeld, S. (1988) The mannose 6- phosphate receptor and the biogenesis of lysosomes. Cell, 52, 329-341.

133

134 134

proteinase proteinase furin furin explains explains its its stringent stringent specificity. specificity. Nat Nat Struct Struct Bioi, Bioi, 10, 10, 520-526. 520-526.

and and Than, Than, ME. ME. (2003) (2003) The The crystal crystal structure structure of of the the proprotein proprotein processing processing

Henrich, Henrich, S, S, Cameron, Cameron, A, A, Bourenkov, Bourenkov, GP, GP, Kiefersauer, Kiefersauer, R, R, Huber, Huber, R, R, Lindberg, Lindberg, I, I, Bode, Bode, W W

360(6402), 360(6402), 352-354. 352-354.

enzyme enzyme that that catalyses catalyses exchange exchange of of guanine guanine nucleotide nucleotide bound bound to to Nature, Nature, ARF. ARF.

Helms, Helms, JB JB and and Rothman, Rothman, JE. JE. (1992) (1992) Inhibition Inhibition by by brefeldin brefeldin A A of of a a Golgi Golgi membrane membrane

101(39), 101(39), 14108-14113. 14108-14113.

Crystal Crystal structure structure of of clathrin clathrin the adaptor adaptor protein protein 1 1 Proc Proc core. core. Natl Natl Acad Acad Sci Sci U U SA, SA,

Heldwein, Heldwein, EE, EE, Macia, Macia, E, E, Wang, Wang, J, J, Yin, Yin, HL, HL, Kirchhausen, Kirchhausen, T T and and Harrison, Harrison, SC. SC. (2004) (2004)

to to Golgi. Golgi. the J J Viral, Viral, Vol. Vol. 74, 74, pp. pp. 9421-9430. 9421-9430.

that that mediate mediate transport transport of of varicella-zoster varicella-zoster virus virus gB gB from from reticulum reticulum endoplasmic the

Heineman, Heineman, TC, TC, Krudwig, Krudwig, Nand Nand Hall, Hall, SL. SL. (2000) (2000) Cytoplasmic Cytoplasmic domain domain signal signal sequences sequences

domain domain in in gB gB transport transport and and viral viral J J egress. egress. Viral, Viral, Vol. Vol. 76, 76, pp. pp. 591-599. 591-599.

Heineman, Heineman, TC TC and and Hall, Hall, SL. SL. (2002) (2002) Role Role of of the the varicella-zoster varicella-zoster virus virus gB gB cytoplasmic cytoplasmic

42-49. 42-49.

mediated mediated by by motifs motifs YXXphi in its its in cytoplasmic cytoplasmic domain. domain. Virology, Virology, Vol. Vol. 285, 285, pp. pp.

Heineman, Heineman, TC TC and and Hall, Hall, SL. SL. (200 (200 1) 1) VZV VZV gB gB endocytosis endocytosis and and Golgi Golgi localization localization are are

Biochem Biochem Soc Soc Trans, Trans, 33(Pt) 33(Pt) 6, 6, 1285-1289. 1285-1289.

Haucke, Haucke, V. V. (2005) (2005) Phosphoinositide Phosphoinositide regulation regulation of of clathrin-mediated clathrin-mediated endocytosis. endocytosis.

bind bind to to phosphatidylinositol-4,5-bisphosphate. phosphatidylinositol-4,5-bisphosphate. Nature, Nature, 371(6493), 371(6493), 168-170. 168-170.

Harlan, Harlan, JE, JE, Hajduk, Hajduk, PJ, PJ, Yoon, Yoon, HS HS and and Fesik, Fesik, SW. SW. (1994) (1994) Pleckstrin Pleckstrin homology homology domains domains

4942. 4942.

Chkl Chkl by by the the beta-subunit beta-subunit regulatory of of protein protein kinase kinase Oncogene, Oncogene, CK2. CK2. 22, 22, 4933-

Guerra, Guerra, B, B, lssinger, lssinger, OG OG and and Wang, Wang, JY. JY. (2003) (2003) Modulation Modulation of of human human checkpoint checkpoint kinase kinase

Sci, Sci, 58, 58, 1067-1084. 1067-1084.

Gu, Gu, F, F, Crump, Crump, CM CM and and Thomas, Thomas, G. G. (2001) (2001) Trans-Golgi Trans-Golgi network network sorting. sorting. Cell Cell Mol Mol Life Life

Rev Rev Mol Mol Cell Cell Bioi, Bioi, 317-323. 317-323. 5(4), 5(4),

Gruenberg, Gruenberg, J J and and Stenmark, Stenmark, H. H. (2004) (2004) The The biogenesis biogenesis of of multi multi vesicular vesicular endosomes. endosomes. Nat Nat

Bioi, Bioi, Vol. Vol. 15, 15, pp. pp. 382-388. 382-388.

Gruenberg, Gruenberg, J. J. (2003) (2003) Lipids Lipids in in endocytic endocytic membrane membrane transport transport and and sorting. sorting. Curr Curr Opin Opin Cell Cell

Bioi, Bioi, 2, 2, 721-730. 721-730.

Gruenberg, Gruenberg, J. J. (2001) (2001) The The endocytic endocytic pathway: pathway: a a mosaic mosaic of of domains. domains. Nat Nat Mol Mol Rev Cell Cell

virus virus in in cultured cultured human human melanoma melanoma J J cells. cells. Gen Gen Viral, Viral, Vol. Vol. 43, 43, pp. pp. 15-27. 15-27.

Grose, Grose, C, C, Perrotta, Perrotta, DM, DM, Brunell, Brunell, PA PA and and Smith, Smith, GC. GC. (1979) (1979) Cell-free Cell-free varicella-zoster varicella-zoster

63, 63, pp. pp. 3912-3918. 3912-3918.

glycoprotein glycoprotein gpl gpl by by mammalian mammalian casein casein kinase kinase II II and and casein casein kinase kinase J J Viral, Viral, Vol. Vol. I. I.

Grose, Grose, C, C, Jackson, Jackson, Wand Wand Traugh, Traugh, JA. JA. (1989) (1989) Phosphorylation Phosphorylation of of varicella-zoster varicella-zoster virus virus

Pathogenic Pathogenic Viruses. Viruses. Klu·wer Klu·wer Academic Academic Press, Press, New New York, York, N.Y., N.Y., pp. pp. 195-223. 195-223.

In In Holzenburg, Holzenburg, A.a.B., A.a.B., E. E. Structure-Function Structure-Function (ed.), (ed.), Relationships Relationships of of Human Human

Grose, Grose, C. C. (2002) (2002) The The predominant predominant varicella-zoster varicella-zoster virus virus gE gE and and gl gl glycoprotein glycoprotein complex. complex.

59-80. 59-80.

phosphorylation, phosphorylation, and and intracellular intracellular trafficking. trafficking. Annu Annu Rev Rev Microbial, Microbial, Vol. Vol. 44, 44, pp. pp.

Grose, Grose, C. C. (1990) (1990) Glycoproteins Glycoproteins encoded encoded by by varicella-zoster varicella-zoster virus: virus: biosynthesis, biosynthesis,

membrane. membrane. J J Cell Cell Bioi, Bioi, 101(3), 101(3), 949-964. 949-964.

membrane membrane proteins proteins from from the the trans trans cisterna cisterna of of the the Golgi Golgi complex complex to to the the plasma plasma

Griffiths, Griffiths, G, G, Pfeiffer, Pfeiffer, S, S, Simons, Simons, K K and and Matlin, Matlin, (1985) (1985) Exit Exit of of K. K. newly newly synthesized synthesized References References References

Heriche, JK, Lebrin, F, Rabilloud, T, Leroy, D, Chambaz, EM and Goldberg, Y. (1997) Regulation of protein phosphatase 2A by direct interaction with casein kinase 2alpha. Science, 276(5314), 952-955. Heuser, JE and Keen, J. (1988) Deep-etch visualization of proteins involved in clathrin assembly. J Cell Bioi, 107(3), 877-886. Hickenbottom, SJ, Kimmel, AR, Londos, C and Hurley, JH. (2004) Structure of a lipid droplet protein; the PAT family member TIP47. Structure (Cambridge, Mass. : 2001), 12(7), 1199-1207. Hickman S, Neufeld EF. (1972) A hypothesis forI-cell disease: defective hydrolases that do not enter lysosomes. Biochem Biophys Res Commun. 49(4):992-9 Hinners, I, Wendler, F, Fei, H, Thomas, L, Thomas, G and Tooze, SA. (2003) AP-I recruitment to VAMP4 is modulated by phosphorylation-dependent binding of PACS-1. EMBO Rep, 4, 1182-1189. Hirst, J, Bright, NA, Rous, Band Robinson, MS. (1999) Characterization of a fourth adaptor-related protein complex. Mol Biol Cell, 10(8), 2787-2802. Hirst, J, Futter, CE and Hopkins, CR. (1998) The kinetics of mannose 6-phosphate receptor trafficking in the endocytic pathway in HEp-2 cells: the receptor enters and rapidly leaves multivesicular endosomes without accumulating in a prelysosomal compartment. Mol Biol Cell, 9(4), 809-816. Hirst, J, Lui, WW, Bright, NA, Totty, N, Seaman, MN and Robinson, MS. (2000) A family of proteins with gamma-adaptin and VHS domains that facilitate trafficking between the trans-Golgi network and the vacuole/lysosome. J Cell Biol, 149, 67-80. Hirst, J, Motley, A, Harasaki, K, Peak Chew, SY and Robinson, MS. (2003) EpsinR: an ENTH domain-containing protein that interacts with AP-1. Mol Bioi Cell, 14(2), 625-641. Horiuchi, H, Lippae, R, McBride, HM, Rubino, M, Woodman, P, Stenmark, H, Rybin, V, Wilm, M, Ashman, K, Mann, M and Zerial, M. (1997) A novel Rab5 GDP/GTP exchange factor complexed to Rabaptin-5 links nucleotide exchange to effector recruitment and function. Cell, 90(6), 1149-1159. Inouye M, Fu X, Shinde U. (2001) Substrate-induced activation of a trapped IMC­ mediated protein folding intermediate. Nat Struct Bioi. 2001, (4), 321-5. Itin, C, Rancano, C, Nakajima, Y and Pfeffer, SR. (1997) A novel assay reveals a role for soluble N-ethylmaleimide-sensitive fusion attachment protein in mannose 6- phosphate receptor transport from endosomes to the trans Golgi network. J Bioi Chem, 272,27737-27744. Itoh, T, Koshiba, S, Kigawa, T, Kikuchi, A, Yokoyama, Sand Takenawa, T. (2001) Role of the ENTH domain in phosphatidylinositol-4,5-bisphosphate binding and endocytosis. Science, 291(5506), 1047-1051. Jain, SC, Shinde, U, Li, Y, Inouye, M and Berman, HM. (1998) The crystal structure of an autoprocessed Ser221Cys-subtilisin E-propeptide complex at 2.0 A resolution. J Mol Bioi, 284, 137-144. Jean, F, Stella, K, Thomas, L, Liu, G, Xiang, Y, Reason, AJ and Thomas, G. (1998) alphal-Antitrypsin Portland, a bioengineered serpin highly selective for furin: application as an antipathogenic agent. Proc Natl Acad Sci US A, 95, 7293-7298.

135

136 136

24, 24, 705-716. 705-716.

PACS PACS proteins proteins represents represents a a novel novel mechanism mechanism of of ion ion channel channel regulation. regulation. Embo Embo J, J,

Sandford, Sandford, R, R, Kim, Kim, E, E, Thomas, Thomas, G G and and Walz, Walz, G. G. (2005) (2005) Trafficking Trafficking of of TRPP2 TRPP2 by by

Schermer, Schermer, B, B, Kramer-Zucker, Kramer-Zucker, A, A, Hopker, Hopker, K, K, Simmen, Simmen, KC, KC, Tschucke, Tschucke, CC, CC,

Kottgen, Kottgen, M, M, Benzing, Benzing, T, T, Simmen, Simmen, T, T, Tauber, Tauber, R, R, Buchholz, Buchholz, B, B, Feliciangeli, Feliciangeli, S, S, Huber, Huber, TB, TB,

reticulum. reticulum. Curr Curr Opin Opin Cell Cell Biol, Biol, 16(4), 16(4), 343-9. 343-9.

Kleizen Kleizen B, B, Braakman Braakman I. I. (2004) (2004) Protein Protein folding folding and and quality quality control control in in the the endoplasmic endoplasmic

15, 15, 705-732. 705-732.

Kirchhausen, Kirchhausen, T. T. (1999) (1999) Adaptors Adaptors for for clathrin-mediated clathrin-mediated traffic. traffic. Annu Annu Rev Rev Cell Cell Dev Dev Biol, Biol,

76,pp. 76,pp. 10980-10993. 10980-10993.

traffics traffics to to the the trans-Golgi trans-Golgi or or network recycles recycles to to the the cell cell membrane. membrane. J J Virol, Virol, Vol. Vol.

virus virus ORF47 ORF47 protein protein serine serine kinase kinase determines determines whether whether endocytosed endocytosed viral viral gE gE

Kenyon, Kenyon, TK, TK, Cohen, Cohen, 11 11 and and Grose, Grose, C. C. (2002) (2002) Phosphorylation Phosphorylation by by the the varicella-zoster varicella-zoster

virus. virus. Virology, Virology, Vol. Vol. 152, 152, pp. pp. 181-191. 181-191.

and and structure structure of of the the gene gene encoding encoding gpll, gpll, a a major major glycoprotein glycoprotein of of varicella-zoster varicella-zoster

Keller, Keller, PM, PM, Davison, Davison, AJ, AJ, Lowe, Lowe, RS, RS, Bennett, Bennett, CD CD and and Ellis, Ellis, RW. RW. (1986) (1986) Identification Identification

16(2):303-12. 16(2):303-12.

dissociation dissociation factor-dependent factor-dependent and reassociation reassociation of of clathrin clathrin baskets. baskets. Cell, Cell,

JH, JH, Keen Willingham Willingham MC, MC, Pastan Pastan IH. IH. (1979) (1979) Clathrin-coated Clathrin-coated vesicles: vesicles: isolation, isolation,

association association of of the the COPI COPI coat. coat. Traffic, Traffic, 3(7), 3(7), 483-495. 483-495.

ribosylation ribosylation factors, factors, is is localized localized to to the the cis-Golgi cis-Golgi and and involved involved in in membrane membrane

Nakayama, Nakayama, K. K. (2002) (2002) GBF1, GBF1, a a guanine guanine nucleotide nucleotide exchange exchange factor factor for for ADP­

Kawamoto, Kawamoto, K, K, Yoshida, Yoshida, Y, Y, Tamaki, Tamaki, H, H, Torii, Torii, S, S, Shinotsuka, Shinotsuka, C, C, Yamashina, Yamashina, Sand Sand

electrostatic electrostatic mechanism. mechanism. Nat Nat Struct Struct Bioi, Bioi, 9, 9, 532-536. 532-536.

Phosphoregulation Phosphoregulation of of sorting sorting signal- VHS VHS domain domain interactions interactions by by a a direct direct

Kato, Kato, Y, Y, Misra, Misra, S, S, Puertollano, Puertollano, R, R, Hurley, Hurley, JH JH and and Bonifacino, Bonifacino, JS. JS. (2002) (2002)

202-220. 202-220.

special special reference reference to to the the mechanism mechanism of of membrane membrane movements. movements. J J Cell Cell Biol, Biol, 42(1), 42(1),

the the coated coated vesicle vesicle isolated isolated from from the the nerve nerve endings endings of of the the guinea guinea pig pig brain, brain, with with

Kanaseki, Kanaseki, T T and and Kadota, Kadota, K. K. (1969) (1969) The The "vesicle "vesicle in in a a basket". basket". A A morphological morphological study study of of

membranes. membranes. Mol Mol Cell Cell Biol, Biol, 25, 25, 7988-8000. 7988-8000.

phosphorylation phosphorylation of of the the GGA3 GGA3 adaptor adaptor protein protein regulates regulates its its recruitment recruitment to to

Kametaka, Kametaka, S, S, Mattera, Mattera, Rand Rand Bonifacino, Bonifacino, JS. JS. (2005) (2005) Epidermal Epidermal growth growth factor-dependent factor-dependent

101-111. 101-111.

cytoplasmic cytoplasmic domain: domain: Implications Implications in in intracellular intracellular trafficking. trafficking. J J Cell Cell Biochem, Biochem, 85, 85,

Kalinina, Kalinina, E, E, Varlamov, Varlamov, 0 0 and and Fricker, Fricker, LD. LD. (2002) (2002) Analysis Analysis of of the the carboxypeptidase carboxypeptidase D D

for for maturation maturation of of neuroendocrine neuroendocrine secretory secretory granules. granules. EMBO EMBO 25(8), 25(8), 1590-602. 1590-602. J, J,

Kakhlon Kakhlon 0, 0, Sakya Sakya P, P, Larijani Larijani B, B, Watson Watson R, R, Tooze Tooze SA. SA. (2006) (2006) GGA GGA function function is is required required

glycoprotein glycoprotein trafficking trafficking and and virion virion envelopment. envelopment. Virol, Virol, Vol. Vol. 62, 62, pp. pp. 2701-2711. 2701-2711. J J

Jones, Jones, F F and and Grose, Grose, C. C. (1988) (1988) Role Role of of cytoplasmic cytoplasmic vacuoles in in vacuoles varicella-zoster varicella-zoster virus virus

of of a a casein casein kinase kinase II II site site in in its its cytoplasmic cytoplasmic tail. tail. Embo Embo 14, 14, 5869-5883. 5869-5883. J, J,

(1995) (1995) Intracellular Intracellular trafficking trafficking offurin offurin is is modulated modulated by by the the phosphorylation phosphorylation state state

Jones, Jones, BG, BG, Thomas, Thomas, L, L, Molloy, Molloy, SS, SS, Thulin, Thulin, CD, CD, Fry, Fry, MD, MD, Walsh, Walsh, KA KA and and Thomas, Thomas, G. G.

phenomena phenomena in in blood blood 02 02 and and C02 C02 transport. transport. Acta Acta Physiol Physiol Scand, Scand, 182, 182, 215-227. 215-227.

Jensen, Jensen, FB. FB. (2004) (2004) Red Red blood blood cell cell pH, pH, the the Bohr Bohr effect, effect, and and other other oxygenation-linked oxygenation-linked References References References

Krantz, DE, Waites, C, Oorschot, V, Liu, Y, Wilson, Rl, Tan, PK, Klumperman, J and Edwards, RH. (2000) A phosphorylation site regulates sorting of the vesicular acetylcholine transporter to dense core vesicles. J Cell Bioi, 149, 379-396. Krysan, DJ, Rockwell, NC and Fuller, RS. (1999) Quantitative characterization of furin specificity. Energetics of substrate discrimination using an internally consistent set of hexapeptidyl methylcoumarinarnides. J Biol Chem, 274, 23229-23234. Kusk, M, Ahmed, R, Thomsen, B, Bendixen, C, Issinger, OG and Boldyreff, B. (1999) Interactions of protein kinase CK2beta subunit within the holoenzyme and with other proteins. Mol Cell Biochem, 191, 51-58. Lefrancois, S, Zeng, J, Hassan, AJ, Canuel, M and Morales, CR. (2003) The lysosomal trafficking of sphingolipid activator proteins (SAPs) is mediated by sortilin. EMBO J, 22,6430-6437. Lehner, B, Semple, 11, Brown, SE, Counsell, D, Campbell, RD and Sanderson, CM. (2004) Analysis of a high-throughput yeast two-hybrid system and its use to predict the function of intracellular proteins encoded within the human MHC class III region. Genomics, 83, 153-167. Lehrman, MA, Goldstein, JL, Brown, MS, Russell, DW and Schneider, WJ. (1985a) Internalization-defective LDL receptors produced by genes with nonsense and frameshift mutations that truncate the cytoplasmic domain. Cell, 41(3), 735-743. Lehrman, MA, Schneider, WJ, Seudhof, TC, Brown, MS, Goldstein, JL and Russell, DW. (1985b) Mutation in LDL receptor: Alu-Alu recombination deletes exons encoding transmembrane and cytoplasmic domains. Science, 227(4683), 140-146. Leroy, D, Herichae, JK, Filhol, 0, Chambaz, EM and Cochet, C. (1997) Binding of polyamines to an autonomous domain of the regulatory subunit of protein kinase CK2 induces a conformational change in the holoenzyme. A proposed role for the kinase stimulation. J Bioi Chem, 272, 20820-20827. Leroy, D, Schmid, N, Behr, JP, Filhol, 0, Pares, S, Garin, J, Bourgarit, JJ, Chambaz, EM and Cochet, C. (1995) Direct identification of a polyamine binding domain on the regulatory subunit of the protein kinase casein kinase 2 by photoaffinity labeling. J Bioi Chem, 270, 17400-17406. Lin, SX, Mallet, WG, Huang, AY and Maxfield, FR. (2004) Endocytosed cation­ independent mannose 6-phosphate receptor traffics via the endocytic recycling compartment en route to the trans-Golgi network and a subpopulation of late endosomes. Mol Biol Cell, 15(2), 721-733. Lippincott-Schwartz, J, Yuan, LC, Bonifacino, JS and Klausner, RD. (1989) Rapid redistribution of Golgi proteins into the ER in cells treated with brefeldin A: evidence for membrane cycling from Golgi to ER. Cell, 56(5), 801-813. Litchfield, DW. (2003) Protein kinase CK2: structure, regulation and role in cellular decisions of life and death. Biochem J, 369, 1-15. · Litchfield, DW, Lozeman, FJ, Piening, C, Sommercorn, J, Takio, K, Walsh, KA and Krebs, EG. (1990) Subunit structure of casein kinase II from bovine testis. Demonstration that the alpha and alpha' subunits are distinct polypeptides. J Biol Chem, 265, 7638-7644. Litwin, V, Jackson, W and Grose, C. (1992) Receptor properties of two varicella-zoster virus glycoproteins, gpl and gpiV, homologous to herpes simplex virus gE and gl. In J Viral, Vol. 66, pp. 3643-3651.

137

138 138

of of MPR46. MPR46. Traffic, Traffic, 4, 4, 802-811. 802-811.

Medigeshi, Medigeshi, GRand GRand Schu, Schu, P. P. (2003) (2003) Characterization Characterization of of the the in in vitro vitro retrograde retrograde transport transport

proteins. proteins. Nature, Nature, 407(6801), 407(6801), 153-9. 153-9.

JE. JE. Compartmental Compartmental specificity specificity of of cellular cellular membrane membrane fusion fusion encoded encoded in in SNARE SNARE

McNew McNew JA, JA, Parlati Parlati F, F, Fukuda Fukuda R, R, Johnston Johnston RJ, RJ, Paz Paz K, K, Paumet Paumet F, F, Sollner Sollner TH, TH, Rothman Rothman

subcellular subcellular localization localization of of GGAl. GGAl. Traffic, Traffic, 5, 5, 102-116. 102-116.

McKay, McKay, MM MM and and Kahn, Kahn, RA. RA. (2004) (2004) Multiple Multiple phosphorylation phosphorylation events events regulate regulate the the

88. 88.

interaction interaction of of the the GGAs GGAs with with the the Rabaptin-5-Rabex-5 Rabaptin-5-Rabex-5 complex. complex. EMBO EMBO 22, 22, 78- J, J,

Mattera, Mattera, R, R, Arighi, Arighi, CN, CN, Lodge, Lodge, R, R, Zerial, Zerial, M M and and Bonifacino, Bonifacino, JS. JS. (2003) (2003) Divalent Divalent

by by the the Chk2 Chk2 protein protein kinase. kinase. Science, Science, 282(5395), 282(5395), 1893-1897. 1893-1897.

Matsuoka, Matsuoka, S, S, Huang, Huang, M M and and Elledge, Elledge, SJ. SJ. (1998) (1998) Linkage Linkage of of ATM ATM to to cell cell cycle cycle regulation regulation

p25A, p25A, a a ras ras p21-like p21-like GTP-binding GTP-binding protein. protein. Mol Mol Cell Cell Bioi. Bioi. 10(8), 10(8), 4116-22. 4116-22.

cloning cloning and and characterization characterization of of a a novel novel type type of of regulatory regulatory protein protein (GDI) (GDI) for for smg smg

Matsui Matsui Y, Y, Kikuchi Kikuchi A, A, Araki Araki S, S, RataY, RataY, Kondo Kondo J, J, Teranishi Teranishi Y, Y, Takai Takai Y. Y. (1990) (1990) Molecular Molecular

127(6) 127(6) Pt Pt 1, 1, 1575-1588. 1575-1588.

small small GTP-binding GTP-binding protein protein rab6 rab6 functions functions in in intra-Golgi intra-Golgi transport. transport. J J Cell Cell Bioi, Bioi,

Martinez, Martinez, Schmidt, Schmidt, 0, 0, A, A, Salamaero, Salamaero, J, J, Hoflack, Hoflack, B, B, Roa, Roa, M M and and Goud, Goud, B. B. (1994) (1994) The The

1(7), 1(7), 525-532. 525-532.

Marsh, Marsh, M M and and Pelchen-Matthews, Pelchen-Matthews, A. A. (2000) (2000) Endocytosis Endocytosis in in viral viral replication. replication. Traffic, Traffic,

Marsh, Marsh, M M and and Helenius, Helenius, A. A. (2006) (2006) Virus Virus entry: entry: open open sesame. sesame. Cell, Cell, 124(4), 124(4), 729-740. 729-740.

the the 3' 3' end end of of gene gene 30. 30. Med Med Viral, Viral, J J Vol. Vol. 70 70 Suppl1, Suppl1, pp. pp. S64-70. S64-70.

the the authentic authentic varicella-zoster varicella-zoster virus virus gB gB (gene (gene 31) 31) initiating initiating methionine methionine overlapping overlapping

Maresova, Maresova, L, L, Pasieka, Pasieka, T, T, Wagenaar, Wagenaar, T, T, Jackson, Jackson, Wand Wand Grose, Grose, C. C. (2003) (2003) Identification Identification of of

278-85. 278-85.

Mancias Mancias JD, JD, Goldberg Goldberg J. J. (2005) (2005) Exiting Exiting the the endoplasmic endoplasmic reticulum. reticulum. Traffic. Traffic. 2005 2005 6(4), 6(4),

E E conformation conformation and and trafficking. trafficking. J J Viral, Viral, Vol. Vol. 71, 71, pp. pp. 8279-8288. 8279-8288.

glycoprotein glycoprotein I I in in varicella-zoster varicella-zoster virus virus replication replication and and its its effects effects on on glycoprotein glycoprotein

Mallory, Mallory, S, S, Sommer, Sommer, M M Arvin, Arvin, and AM. AM. (1997) (1997) Mutational Mutational analysis analysis of of the the role role of of

endosomal endosomal pathways. pathways. Cell Cell Bioi, Bioi, J J 146, 146, 345-359. 345-359.

transported transported with with the the plasma plasma membrane membrane in in the the trans-Golgi trans-Golgi network network via via distinct distinct

Mallet, Mallet, WG WG and and Maxfield, Maxfield, FR. FR. (1999) (1999) Chimeric Chimeric forms forms of of furin furin and and TGN38 TGN38 are are

653-664. 653-664.

involves involves two two SNARE SNARE and and complexes a a Rab6 Rab6 isoform. isoform. J J Cell Cell Bioi, Bioi, Vol. Vol. 156, 156, pp. pp.

Goud, Goud, B B and and Johannes, Johannes, L. L. (2002) (2002) Early/recycling Early/recycling endosomes-to- TGN TGN transport transport

Mallard, Mallard, F, F, Tang, Tang, BL, BL, Galli, Galli, T, T, Tenza, Tenza, D, D, Saint-Pol, Saint-Pol, A, A, Yue, Yue, X, X, Antony, Antony, C, C, Hong, Hong, W, W,

the the study study of of shiga shiga toxin toxin B-fragment B-fragment transport. transport. J J Cell Cell Bioi, Bioi, Vol. Vol. 143, 143, pp. pp. 973-990. 973-990.

pathway pathway from from early/recycling early/recycling endosomes endosomes to to the the Golgi apparatus revealed revealed through through

Mallard, Mallard, F, F, Antony, Antony, C, C, Tenza, Tenza, D, D, Salamero, Salamero, J, J, Goud, Goud, Band Band Johannes, Johannes, L. L. (1998) (1998) Direct Direct

12(2), 12(2), 677-682. 677-682. J, J,

functions functions in in transport transport between between late late endosomes endosomes and the the and trans Golgi Golgi trans network. network. Embo Embo

Lombardi, Lombardi, D, D, T, T, Soldati, Riederer, Riederer, MA, MA, Goda, Goda, Y, Y, Zerial, Zerial, M M and and Pfeffer, Pfeffer, SR. SR. (1993) (1993) Rab9 Rab9

alter alter lysosomal lysosomal enzyme enzyme sorting sorting and and endocytosis. endocytosis. Cell, Cell, 57(5), 57(5), 787-796. 787-796.

cytoplasmic cytoplasmic domain domain of of the the 275 275 kd kd mannose mannose 6-phosphate 6-phosphate receptor receptor differentially differentially

Lobel, Lobel, P, P, Fujimoto, Fujimoto, K, K, Ye, Ye, RD, RD, Griffiths, Griffiths, G G and and Kornfeld, Kornfeld, S. S. (1989) (1989) Mutations Mutations in in the the References References References

Meggio, F and Pinna, LA. (2003) One-thousand-and-one substrates of protein kinase CK2? FASEB J, 17,349-368. Meresse, Sand Hoflack, B. (1993) Phosphorylation of the cation-independent mannose 6-phosphate receptor is closely associated with its exit from the trans-Golgi network. J Cell Bioi, 120,67-75. Metz, T, Harris, AW, Adams, JM and Walter. (1995) Absence ofp53 allows direct immortalization of hematopoietic cells by the myc and raf oncogenes. Cell, 82(1), 29-36. Meyer, C, Zizioli, D, Lausmann, S, Eskelinen, EL, Hamann, J, Saftig, P, von Figura, K and Schu, P. (2000) mu1A-adaptin-deficient mice: lethality, loss of AP-1 binding and rerouting of mannose 6-phosphate receptors. Ernbo J, 19, 2193-2203. Miller, GJ, Mattera, R, Bonifacino, JS and Hurley, JH. (2003) Recognition of accessory protein motifs by the gamma-adaptin ear domain of GGA3. Nat Struct Bioi, 10(8), 599-606. Misra, S, Puertollano, R, Kato, Y, Bonifacino, JS and Hurley, JH. (2002) Structural basis for acidic-cluster-dileucine sorting-signal recognition by VHS domains. Nature, 415, 933-937. Miura, S, Gan, JW, Brzostowski, J, Parisi, MJ, Schultz, CJ, Londos, C, Oliver, Band Kimmel, AR. (2002) Functional conservation for lipid storage droplet association among Perilipin, ADRP, and TIP47 (PAT)-related proteins in mammals, Drosophila, and Dictyostelium. J Bioi Chern, 277(35), 32253-32257. Molloy, SS, Anderson, ED, Jean, F and Thomas, G. (1999) Bi-cycling the furin pathway: from TGN localization to pathogen activation and embryogenesis. Trends Cell Biol, 9, 28-35. Molloy, SS, Bresnahan, PA, Leppla, SH, Klimpel, KR and Thomas, G. (1992) Human furin is a calcium-dependent serine endoprotease that recognizes the sequence Arg-X-X-Arg and efficiently cleaves anthrax toxin protective antigen. J Biol Chern, 267, 16396-16402. Molloy, SS, Thomas, L, Kamibayashi, C, Mumby, MC and Thomas, G. (1998) Regulation of endosome sorting by a specific PP2A isoform. J Cell Bioi, 142, 1399-1411. Molloy, SS, Thomas, L, VanSlyke, JK, Stenberg, PE and Thomas, G. (1994) Intracellular trafficking and activation of the furin proprotein convertase: localization to the TGN and recycling from the cell surface. Ernbo J, 13, 18-33. Montalvo, EA, Parmley, RT and Grose, C. ( 1985) Structural analysis of the varicella­ zoster virus gp98-gp62 complex: posttranslational addition of N-linked and 0- linked oligosaccharide moieties. J Viral, Vol. 53, pp. 761-770. Muslin, AJ, Tanner, JW, Allen, PM and Shaw, AS. (1996) Interaction of 14-3-3 with signaling proteins is mediated by the recognition of phosphoserine. Cell, 84, 889- 897. Mutter, GL, Grills, GS and Wolgemuth, OJ. (1988) Evidence for the involvement of the proto-oncogene c-mos in mammalian meiotic maturation and possibly very early embryogenesis. Ernbo J, 7(3), 683-689. Nebenfuhr A, Ritzenthaler C, Robinson DG. (2002) Brefeldin A: deciphering an enigmatic inhibitor of secretion. Plant Physiol. 130(3), 1102-8.

139

140 140

complex complex to to membranes. membranes. J J Biol Biol Chern, Chern, 280(22), 280(22), 21661-21666. 21661-21666.

Franco, Franco, M. M. (2005) (2005) The The small small G-protein G-protein ARF6GTP ARF6GTP the the recruits AP-2 AP-2 adaptor adaptor

Paleotti, Paleotti, Macia, Macia, 0, 0, E, E, Luton, Luton, F, F, Klein, Klein, S, S, Partisani, Partisani, M, M, Chardin, Chardin, P, P, Kirchhausen, Kirchhausen, T T and and

189(4200), 189(4200), 347-358. 347-358.

Palade, Palade, G. G. ( ( 197 197 5) 5) Intracellular Intracellular aspects aspects of of the the process process of of protein protein synthesis. synthesis. Science, Science,

Saccharomyces Saccharomyces cerevisiae. cerevisiae. Mol Mol Cell Cell Biol, Biol, 10(8), 10(8), 4089-4099. 4089-4099.

and and disruption disruption of of the the yeast yeast CKA2 CKA2 gene: gene: casein casein kinase kinase II II is is essential essential for for viability viability in in

Padmanabha, Padmanabha, R, R, Chen-Wu, Chen-Wu, JL, JL, Hanna, Hanna, DE DE and and Glover, Glover, CV. CV. (1990) (1990) Isolation, Isolation, sequencing, sequencing,

varicella-zoster varicella-zoster virus virus gE:gl gE:gl Fe receptor. receptor. Fe J J Viral, Viral, Vol. Vol. 72, 72, pp. pp. 1542-1551. 1542-1551.

Olson, Olson, JK JK and and Grose, Grose, C. C. ( ( 1998) 1998) Complex Complex formation formation facilitates facilitates endocytosis endocytosis of of the the

cytoplasmic cytoplasmic J J tail. tail. Viral, Viral, Vol. Vol. 71, 71, pp. pp. 4042-4054. 4042-4054.

receptor receptor glycoprotein glycoprotein gE: gE: internalization internalization mediated mediated by by a a YXXL YXXL motif motif in in the the

Olson, Olson, JK JK and and Grose, Grose, C. C. ( ( 1997) 1997) Endocytosis Endocytosis and and recycling recycling of of varicella-zoster varicella-zoster virus virus Fe Fe

receptor receptor recycling recycling process. process. J J Biol Biol Chern, Chern, 260(16), 260(16), 9435-9442. 9435-9442.

stimulates stimulates 1251-insulin-like 1251-insulin-like growth growth factor factor II II degradation degradation by by modulating modulating the the IGF-II IGF-II

growth growth factor factor II II Receptor Receptor internalization internalization and and recycling recycling in in rat rat adipocytes. adipocytes. Insulin Insulin

Oka, Oka, Y, Y, Rozek, Rozek, LM LM and and Czech, Czech, MP. MP. (1985) (1985) Direct Direct demonstration demonstration of of rapid rapid insulin-like insulin-like

9093. 9093.

internalized internalized and and recycles recycles in in the the absence absence of of ligand. ligand. J J Biol Biol Chern, Chern, 261(20), 261(20), 9090-

Oka, Oka, Y Y and and Czech, Czech, MP. MP. (1986) (1986) The The type type II II insulin-like insulin-like growth growth factor factor receptor receptor is is

1875. 1875.

based based sorting sorting signals signals with with clathrin-associated clathrin-associated proteins. proteins. Science, Science, 269(5232), 269(5232), 1872-

Gallusser, Gallusser, A, A, Kirchhausen, Kirchhausen, T T and and Bonifacino, Bonifacino, JS. JS. ( ( 1995) 1995) Interaction Interaction of of tyrosine­

Ohno, Ohno, H, H, Stewart, Stewart, J, J, Fournier, Fournier, MC, MC, Bosshart, Bosshart, H, H, Rhee, Rhee, I, I, Miyatake, Miyatake, S, S, Saito, Saito, T, T,

tyrosine-based tyrosine-based sorting sorting signals. signals. J J Biol Biol Chern, Chern, 273(40), 273(40), 25915-25921. 25915-25921.

medium medium subunits subunits of of adaptor adaptor recognize recognize complexes distinct distinct but but overlapping overlapping sets sets of of

Ohno, Ohno, H, H, Aguilar, Aguilar, RC, RC, Yeh, Yeh, D, D, Taura, Taura, D, D, Saito, Saito, T T and and Bonifacino, Bonifacino, JS. JS. (1998) (1998) The The

21(1), 21(1), 205-215. 205-215.

groups groups required required for for post-translational post-translational events events in in the the yeast yeast secretory secretory pathway. pathway. Cell, Cell,

Novick, Novick, P, P, Field, Field, C C and and Schekman, Schekman, R. R. (1980) (1980) Identification Identification of of 23 23 complementation complementation

glycoprotein glycoprotein J J gB. gB. Viral, Viral, Vol. Vol. 70, 70, pp. pp. 5716-5719. 5716-5719.

Marcus, Marcus, F. F. ( ( 1996) 1996) Evidence Evidence for for a a phosphorylation phosphorylation site site in in cytomegalovirus cytomegalovirus

Norais, Norais, N, N, Hall, Hall, JA, JA, Gross, Gross, L, L, Tang, Tang, D, D, Kaur, Kaur, S, S, Chamberlain, Chamberlain, SH, SH, Burke, Burke, RL RL and and

9(7), 9(7), 527-531. 527-531.

accessory accessory protein protein recruitment recruitment by by the the gamma-adaptin gamma-adaptin ear ear domain. domain. Nat Nat Struct Struct Biol, Biol,

R, R, Takatsu, Takatsu, H, H, Nakayama, Nakayama, K K and and Wakatsuki, Wakatsuki, S. S. (2002) (2002) Structural Structural basis basis for for the the

Nogi, Nogi, T, T, Shiba, Shiba, Y, Y, Kawasaki, Kawasaki, M, M, Shiba, Shiba, T, T, Matsugaki, Matsugaki, N, N, Igarashi, Igarashi, N, N, Suzuki, Suzuki, M, M, Kato, Kato,

protein. protein. EMBO EMBO 20, 20, 2180-2190. 2180-2190. J, J,

Golgi-endosome Golgi-endosome transport transport and and binds binds the the VHS VHS domain domain of of GGA2 GGA2 the sorting sorting

Pohlmann, Pohlmann, R R and and Petersen, Petersen, CM. CM. (200 (200 1) 1) The The sortilin sortilin cytoplasmic cytoplasmic tail tail conveys conveys

Nielsen, Nielsen, MS, MS, Madsen, Madsen, P, P, EI, EI, Christensen, Nykjaer, Nykjaer, A, A, Gliemann, Gliemann, J, J, Kasper, Kasper, D, D,

20, 20, 5320-5331. 5320-5331. J, J,

protein protein kinase kinase CK2: CK2: insights insights into into basic basic properties properties of of the the CK2 CK2 holoenzyme. holoenzyme. EMBO EMBO

Niefind, Niefind, K, K, Guerra, Guerra, B, B, Ermakowa, Ermakowa, I I and and Issinger, Issinger, OG. OG. (2001) (2001) Crystal Crystal structure structure of of human human

vacuolar vacuolar fusion fusion mediated mediated by by t- and and v-SNAREs. v-SNAREs. Nature, Nature, 387(6629), 387(6629), 199-202. 199-202.

Nichols, Nichols, BJ, BJ, Ungermann, Ungermann, C, C, Pelham, Pelham, HR, HR, Wickner, Wickner, WT WT and and Haas, Haas, (1997) (1997) A. A. Homotypic Homotypic References References References

Pasieka, TJ, Maresova, Land Grose, C. (2003) A functional YNKI motif in the short cytoplasmic tail of varicella-zoster virus glycoprotein gH mediates clathrin­ dependent and antibody-independent endocytosis. J Viral, Vol. 77, pp. 4191- 4204. Pasieka, TJ, Maresova, L, Shiraki, K and Grose, C. (2004) Regulation of Varicella-Zoster Virus-Induced Cell-to-Cell Fusion by the Endocytosis-Competent Glycoproteins gH and gE. J Viral, Vol. 78, pp. 2884-2896. Pearse, BM. (1975). coated vesicles from pig brain: purification and biochemical characterization. J Mol Bio. 97, 93-98 Peden, AA, Oorschot, V, Hesser, BA, Austin, CD, Scheller, RH and Klumperman, J. (2004) Localization of the AP-3 adaptor complex defines a novel endosomal exit site for lysosomal membrane proteins. J Cell Bioi, 164(7), 1065-1076. Peter, BJ, Kent, HM, Mills, IG, Vallis, Y, Butler, PJ, Evans, PR and McMahon, HT. (2004) BAR domains as sensors of membrane curvature: the amphiphysin BAR structure. Science, 303(5657), 495-499. Pfeffer, Sand Aivazian, D. (2004) Targeting Rab GTPases to distinct membrane compartments. Nat Rev Mol Cell Biol, 5(11), 886-896. Piguet, V, Chen, YL, Mangasarian, A, Foti, M, Carpentier, JL and Trono, D. (1998) Mechanism of Nef-induced CD4 endocytosis: Nef connects CD4 with the mu chain of adaptor complexes. Ernbo J, 17, 2472-2481. Piguet, V, Wan, L, Borel, C, Mangasarian, A, Demaurex, N, Thomas, G and Trono, D. (2000) HIV -1 Nef protein binds to the cellular protein PACS-1 to downregulate class I major histocompatibility complexes. Nat Cell Biol, 2, 163-167. Pinna, LA. (2002) Protein kinase CK2: a challenge to canons. J Cell Sci, 115, 3873-3878. Plutner, H, Cox, AD, Pind, S, Khosravi-Far, R, Bourne, JR, Schwaninger, R, Der, CJ and Balch, WE. ( 1991) Rab 1 bregulates vesicular transport between the endoplasmic reticulum and successive Golgi compartments. J Cell Biol, 115(1), 31-43. Poussu, A, Lobi, 0 and Lehto, VP. (2000) Year, a novel Golgi-associated protein with VHS and gamma-adaptin "ear" domains. J Bioi Chern, 275,7176-7183. Puertollano, R, Aguilar, RC, Gorshkova, I, Crouch, RJ and Bonifacino, JS. (2001a) Sorting of mannose 6-phosphate receptors mediated by the GGAs. Science, 292, 1712-1716. Puertollano, R, Randazzo, PA, Presley, JF, Hartnell, LM and Bonifacino, JS. (2001b) The GGAs promote ARF-dependent recruitment of clathrin to the TGN. Cell, 105, 93- 102. Puertollano, Rand Bonifacino, JS. (2004) Interactions of GGA3 with the ubiquitin sorting machinery. Nat Cell Bioi, 6, 244-251. Pufall, MA and Graves, BJ. (2002) Autoinhibitory Domains: Modular Effectors of Cellular Regulation. Annu Rev Cell Dev Bioi. Radhakrishna, Hand Donaldson, JG. (1997) ADP-ribosylation factor 6 regulates a novel plasma membrane recycling pathway. J Cell Biol, 139(1), 49-61. Raiborg, C, Rusten, TE and Stenmark, H. (2003) Protein sorting into multivesicular endosomes. Curr Opin Cell Bioi, 15(4), 446-455. Randazzo PA, Kahn RA. (1994) GTP hydrolysis by ADP-ribosylation factor is dependent on both an ADP-ribosylation factor GTPase-activating protein and acid phospholipids. J Biol Chern, 269(14), 10758-63.

141

142 142

Nef Nef protein. protein. Nat Nat Med, Med, 2(3), 2(3), 338-342. 338-342.

of of major major histocompatibility histocompatibility complex complex class class I I molecules molecules is is induced induced by by the the HIV HIV -1 -1

Schwartz, Schwartz, Maraechal, Maraechal, 0, 0, V, V, Le Le Gall, Gall, S, S, Lemonnier, Lemonnier, F F and and Heard, Heard, JM. JM. (1996) (1996) Endocytosis Endocytosis

4415-4424. 4415-4424.

2 2 induces induces PACS-1 PACS-1 binding binding of of nephrocystin nephrocystin and and targeting targeting to to cilia. cilia. Ernbo Ernbo 24(24), 24(24), J, J,

H, H, Blaukat, Blaukat, A, A, Walz, Walz, G G and and Benzing, Benzing, T. T. (2005) (2005) Phosphorylation Phosphorylation by by casein casein kinase kinase

Keottgen, Keottgen, M, M, Hackl, Hackl, M, M, Zschiedrich, Zschiedrich, S, S, Huber, Huber, TB, TB, Kramer-Zucker, Kramer-Zucker, A, A, Zentgraf, Zentgraf,

Schermer, Schermer, B, B, Heopker, Heopker, K, K, Omran, Omran, H, H, Ghenoiu, Ghenoiu, C, C, Fliegauf, Fliegauf, M, M, Fekete, Fekete, A, A, Horvath, Horvath, J, J,

Virology, Virology, Vol. Vol. 249, 249, pp. pp. 21-31. 21-31.

zoster zoster virus virus Fe Fe receptor receptor gE: gE: loss loss of of a a major major B B cell cell epitope epitope in in the the ectodomain. ectodomain.

Santos, Santos, RA, RA, Padilla, Padilla, JA, JA, Hatfield, Hatfield, C C and and Grose, Grose, C. C. (1998) (1998) Antigenic Antigenic variation variation of of varicella varicella

used used by by ricin, ricin, cholera cholera toxin toxin and and Shiga Shiga toxin. toxin. FEBS FEBS Lett, Lett, Vol. Vol. 529, 529, pp. pp. 49-53. 49-53.

Sandvig, Sandvig, K K and and van van Deurs, Deurs, B. B. (2002) (2002) Transport Transport of of protein protein toxins toxins into into cells: cells: pathways pathways

Cell, Cell, 6, 6, 525-538. 525-538.

epsinR epsinR is is required required for for retrograde retrograde sorting sorting on on early early membranes. membranes. endosomal Dev Dev

Antony, Antony, C, C, McMahon, McMahon, HT, HT, Lamaze, Lamaze, C C and and Johannes, Johannes, L. L. (2004) (2004) Clathrin Clathrin adaptor adaptor

Saint-Pol, Saint-Pol, A, A, Yaelamos, Yaelamos, B, B, Amessou, Amessou, M, M, Mills, Mills, IG, IG, Dugast, Dugast, M, M, Tenza, Tenza, D, D, Schu, Schu, P, P,

Proc Proc Natl Natl Acad Acad Sci Sci US US A, A, 99, 99, 16946-16950. 16946-16950.

histidine histidine residue residue as as control control element element for for ligand ligand release release HLA-DR HLA-DR from molecules. molecules.

Rotzschke, Rotzschke, Lau, Lau, 0, 0, JM, JM, Hofstatter, Hofstatter, M, M, Falk, Falk, K K and and JL. JL. Strominger, (2002) (2002) A A pH-sensitive pH-sensitive

Aedes Aedes Aegypti. Aegypti. J J L. L. Cell Cell Bioi, Bioi, 20, 20, 313-332. 313-332.

Roth, Roth, TF TF and and Porter, Porter, KR. KR. (1964) (1964) Yolk Yolk Protein Protein Uptake Uptake in in the the Oocyte Oocyte of of the the Mosquito Mosquito

84, 84, pp. pp. 699-730. 699-730.

Roth, Roth, MG. MG. (2004) (2004) Phosphoinositides Phosphoinositides in in constitutive constitutive membrane membrane traffic. traffic. Physiol Physiol Rev, Rev, Vol. Vol.

Biol, Biol, 158(2), 158(2), 209-214. 209-214.

binding binding site site within within mu2-adaptin mu2-adaptin regulates regulates clathrin-mediated clathrin-mediated endocytosis. endocytosis. J J Cell Cell

Rohde, Rohde, G, G, Wenzel, Wenzel, D D and and Haucke, Haucke, V. V. (2002) (2002) A A phosphatidylinositol phosphatidylinositol (4,5)-bisphosphate (4,5)-bisphosphate

and and furin furin reveal reveal secrets secrets of of precursor precursor processing. processing. Trends Trends Biochern Biochern Sci, Sci, 29, 29, 80-87. 80-87.

Rockwell, Rockwell, NC NC and and Thorner, Thorner, JW. JW. (2004) (2004) The The kindest kindest cuts cuts of of all: all: crystal crystal structures structures of of Kex2 Kex2

kex2/furin kex2/furin proteases. proteases. Chern Chern Rev, Rev, 102, 102, 4525-4548. 4525-4548.

Rockwell, Rockwell, NC, NC, Krysan, Krysan, DJ, DJ, Komiyama, Komiyama, T T and and Fuller, Fuller, RS. RS. (2002) (2002) Precursor Precursor processing processing by by

174. 174.

Robinson, Robinson, MS. MS. (2004) (2004) Adaptable Adaptable adaptors adaptors coated coated for vesicles. vesicles. Trends Trends Cell Cell Bioi, Bioi, 14, 14, 167-

of of progression progression from from early early to to late late endosomes. endosomes. Cell., Cell., 122(5), 122(5), 735-749. 735-749.

Rink, Rink, J, J, Ghigo, Ghigo, E, E, Kalaidzidis, Kalaidzidis, Y Y and and Zerial, Zerial, M. M. (2005) (2005) Rab Rab conversion conversion as as a a mechanism mechanism

endopeptidases. endopeptidases. processing J J Bioi Bioi Chern, Chern, 268, 268, 4267-4275. 4267-4275.

Processing Processing of of proopiomelanocortin proopiomelanocortin by by insulin insulin secretory secretory granule granule proinsulin proinsulin

Rhodes, Rhodes, CJ, CJ, BA, BA, Thome, Lincoln, Lincoln, B, B, Nielsen, Nielsen, E, E, Hutton, Hutton, JC JC and and Thomas, Thomas, G. G. (1993) (1993)

J J Bioi Bioi Chern, Chern, 256(9), 256(9), 4275-81. 4275-81.

phosphorylation phosphorylation of of the the high high mannose mannose oligosaccharide oligosaccharide units units of of lysosomal lysosomal enzymes. enzymes.

acetylglucosamine-1-phosphotransferase. acetylglucosamine-1-phosphotransferase. Proposed Proposed enzyme enzyme for for the the

Reitman Reitman ML, ML, S. S. Kornfeld (1981) (1981) UDP-N-acetylglucosamine:glycoprotein UDP-N-acetylglucosamine:glycoprotein N­

differently differently from from the the tyrosine-based tyrosine-based motif-binding motif-binding site. site. Ernbo Ernbo 17(8), 17(8), 2148-2155. 2148-2155. J, J,

based based sorting sorting signals signals bind bind to to the the beta beta chain chain of of AP-1 AP-1 at at a a site site distinct distinct and and regulated regulated

Rapoport, Rapoport, I, I, Chen, Chen, YC, YC, Cupers, Cupers, P, P, Shoelson, Shoelson, SE SE and and Kirchhausen, Kirchhausen, T. T. (1998) (1998) Dileucine­ References References References

Schwede, T, Kopp, J, Guex, Nand Peitsch, MC. (2003) SWISS-MODEL: An automated protein homology-modeling server. Nucleic Acids Res, 31, 3381-3385. Scott, GK, Gu, F, Crump, CM, Thomas, L, Wan, L, Xiang, Y and Thomas, G. (2003) The phosphorylation state of an autoregulatory domain controls PACS-1-directed protein traffic. EMBO J, 22, 6234-6244. Seaman, MN. (2004) Cargo-selective endosomal sorting for retrieval to the Golgi requires retromer. J Cell Biol, 165, 111-122. Seaman, MN, McCaffery, JM and Emr, SD. (1998) A membrane coat complex essential for endosome-to-Golgi retrograde transport in yeast. J Cell Bioi, 142(3), 665-681. Serafini, T, Orci, L, Amherdt, M, Brunner, M, Kahn, RA and Rothman, JE. (1991) ADP­ ribosylation factor is a subunit of the coat of Golgi-derived COP-coated vesicles: a novel role for a GTP-binding protein. Cell, 67(2), 239-253. Simmen, T, Asian, JE, Blagoveshchenskaya, AD, Thomas, L, Wan, L, Xiang, Y, Feliciangeli, SF, Hung, CH, Crump, CM and Thomas, G. (2005) PACS-2 controls endoplasmic reticulum-mitochondria communication and Bid-mediated apoptosis. EMBOJ, 24,717-729. Simmen, T, Heoning, S, Icking, A, Tikkanen, Rand Hunziker, W. (2002) AP-4 binds basolateral signals and participates in basolateral sorting in epithelial MOCK cells. Nat Cell Biol, 4(2), 154-159. Simonsen, A, Lippae, R, Christoforidis, S, Gaullier, JM, Brech, A, Callaghan, J, Toh, BH, Murphy, C, Zerial, M and Stenmark, H. (1998) EEA1links PI(3)K function to Rab5 regulation of endosome fusion. Nature, 394(6692), 494-498. Skjerpen, CS, Nilsen, T, Wesche, J and Olsnes, S. (2002) Binding ofFGF-1 variants to protein kinase CK2 correlates with mitogenicity. EMBO J, 21, 4058-4069. Sly, W. S., and Fischer, H. D. (1982). The phosphomannosyl recognition system for intracellular and intercellular transport of lysosomal enzymes. J. Cell. Biochern, 18, 67-85. Sontag, E. (2001) Protein phosphatase 2A: the Trojan Horse of cellular signaling. Cell Signal, 13(1), 7-16. Stamnes MA, Rothman JE. (1993) The binding of AP-I clathrin adaptor particles to Golgi membranes requires ADP-ribosylation factor, a small GTP-binding protein. Cell, 73(5), 999-1005. Steiner, DF. (1998) The proprotein convertases. Curr Opin Chern Bioi, 2, 31-39. Stockli, J, Heoning, Sand Rohrer, J. (2004) The acidic cluster of the CK2 site of the cation-dependent mannose 6-phosphate receptor (CD-MPR) but not its phosphorylation is required for GGA1 and AP-1 binding. J Biol Chern, 279(22), 23542-23549. Stoorvogel, W, Strous, GJ, Geuze, HJ, Oorschot, V and Schwartz, AL. (1991) Late endosomes derive from early endosomes by matmation. Cell, 65(3), 417-427. Subbian, E, Yabuta, Y and Shinde, UP. (2005) Folding pathway mediated by an intramolecular chaperone: intrinsically unstructured propeptide modulates stochastic activation of subtilisin. J Mol Bioi, 347, 367-383. Suer, S, Misra, S, Saidi, LF and Hurley, JH. (2003) Structure of the GAT domain of human GGA1: a amino-terminal domain fold in an endosomal trafficking adaptor. Proc Natl Acad Sci US A, 100(8), 4451-4456.

143

144 144

pathway. pathway. Cell, Cell, 70(5), 70(5), 729-740. 729-740.

small small GTP-binding GTP-binding protein protein rab4 rab4 controls controls an an early early sorting sorting event event on on the the endocytic endocytic

van van der der Sluijs, Sluijs, P, P, Hull, Hull, M, M, Webster, Webster, P, P, Maale, Maale, P, P, Goud, Goud, Band Band Mellman, Mellman, I. I. (1992) (1992) The The

chemistry., chemistry., 277(50), 277(50), 48876-48883. 48876-48883.

phosphatidylinositol phosphatidylinositol 3-kinase-dependent 3-kinase-dependent pathways. pathways. The The Journal Journal of of biological biological

Endocytosed Endocytosed transferrin transferrin receptors receptors recycle recycle via via distinct distinct dynamin dynamin and and

van van Dam, Dam, EM, EM, Ten Ten Broeke, Broeke, T, T, Jansen, Jansen, K, K, Spijkers, Spijkers, P P and and Stoorvogel, Stoorvogel, W. W. (2002) (2002)

cell., cell., 13(1), 13(1), 169-182. 169-182.

recycling recycling by by endosome-derived endosome-derived clathrin-coated clathrin-coated vesicles. vesicles. Molecular Molecular biology biology of of the the

van van Dam, Dam, EM EM and and Stoorvogel, Stoorvogel, W. W. (2002) (2002) Dynamin-dependent Dynamin-dependent transferrin transferrin receptor receptor

Vol. Vol. 3, 3, pp. pp. 634-641. 634-641.

Trowbridge, Trowbridge, IS. IS. (1991) (1991) Endocytosis Endocytosis and and signals signals for for internalization. internalization. Curr Curr Opin Opin Cell Cell Bioi, Bioi,

Related Related cDNAs cDNAs from from a a Rat Rat Brain Brain Library. Library. PNAS PNAS 84, 84, 8210-8214. 8210-8214.

Superfamily Superfamily Isolated Isolated by by an an Oligonucleotide Oligonucleotide Strategy: Strategy: Molecular Molecular Cloning Cloning of of YPT­

Touchot Touchot N, N, Chardin Chardin P, P, and and Tavitian Tavitian 1987) 1987) A. A. Four Four ( ( Additional Additional Members Members of of the the ras ras Gene Gene

60(1), 60(1), 98-101. 98-101.

three three months months old old infant. infant. Clinical Clinical and and ultrastructural ultrastructural studies. studies. Acta Acta Paediatr Paediatr Scand, Scand,

Tondeur Tondeur M, M, Vamos-Hurwitz Vamos-Hurwitz E, E, Cremer Cremer N, N, Loeb Loeb H. H. (1971) (1971) Mucopolysaccharidosis Mucopolysaccharidosis in in a a

envelopes. envelopes. Eur Eur J J Cell Cell Biol, Biol, Vol. Vol. 60, 60, pp. pp. 163-178. 163-178.

human human cytomegalovirus cytomegalovirus particles particles utilize utilize early early endosomal endosomal cisternae cisternae for for their their

Tooze, Tooze, J, J, Hollinshead, Hollinshead, M, M, Reis, Reis, Radsak, Radsak, B, K K and and Kern, Kern, H. H. (1993) (1993) Progeny Progeny vaccinia vaccinia and and

HIV-1 HIV-1 gp120 gp120 in in human human macrophages. macrophages. Blood, Blood, in in press. press.

Src Src kinase kinase Lyn Lyn is is required required for for CCR5 CCR5 signaling signaling in in response response to to MIP-1 MIP-1 {beta} {beta} and and R5 R5

Tomkowicz, Tomkowicz, B, B, Lee, Lee, C, C, Ravyn, Ravyn, V, V, Cheung, Cheung, R, R, Ptasznik, Ptasznik, A A and and Collman, Collman, R. R. (2006) (2006) The The

endoplasmic endoplasmic reticulum reticulum to to the the Golgi Golgi complex. complex. J J Cell Cell Biol, Biol, 119(4), 119(4), 749-761. 749-761.

mutants mutants of of rab rab 1 1 and and rab2 rab2 are are potent potent inhibitors inhibitors of of vesicular vesicular transport transport from from the the

Tisdale, Tisdale, EJ, EJ, Bourne, Bourne, JR, JR, Khosravi-Far, Khosravi-Far, R, R, Der, Der, CJ CJ and and Balch, Balch, WE. WE. (1992) (1992) GTP-binding GTP-binding

pseudorabies pseudorabies virus virus life life cycle. cycle. J J Viral, Viral, Vol. Vol. 72, 72, pp. pp. 4571-4579. 4571-4579.

Tirabassi, Tirabassi, RS RS and and Enquist, Enquist, LW. LW. (1998) (1998) Role Role of of envelope envelope protein protein gE gE endocytosis endocytosis in in the the

disease. disease. Nat Nat Rev Rev Mol Mol Cell Cell Bioi, Bioi, 3, 3, 753-766. 753-766.

Thomas, Thomas, G. G. (2002) (2002) Furin Furin at at the the cutting cutting edge: edge: from from protein protein traffic traffic to to embryogenesis embryogenesis and and

8199-8207. 8199-8207.

sorting sorting signals signals with with AP-1 AP-1 Golgi-specific Golgi-specific assembly assembly proteins. proteins. J J Biol Biol Chern, Chern, 274, 274,

Sorting Sorting of of furin furin at at the the trans-Golgi trans-Golgi network. network. Interaction Interaction of of the the cytoplasmic cytoplasmic tail tail

Teuchert, Teuchert, M, M, Schafer, Schafer, W, W, Berghofer, Berghofer, S, S, Hoflack, Hoflack, B, B, Klenk, Klenk, HD HD and and Garten, Garten, W. W. (1999) (1999)

hormone hormone convertase convertase 1 1 pro-domain pro-domain from from Mus Mus musculus. musculus. J J Mol Mol Biol, Biol, 320, 320, 801-812. 801-812.

Tangrea, Tangrea, MA, MA, Bryan, Bryan, PN, PN, Sari, Sari, Nand Nand Orban, Orban, J. J. (2002) (2002) Solution Solution structure structure of of the the pro­

Biochemistry, Biochemistry, 40, 40, 5488-5495. 5488-5495.

Stability Stability and and global global fold fold of of the the mouse mouse prohormone prohormone convertase convertase 1 1 pro-domain. pro-domain.

Tangrea, Tangrea, MA, MA, Alexander, Alexander, P, P, Bryan, Bryan, PN, PN, Eisenstein, Eisenstein, E, E, Toedt, Toedt, J J and and Orban, Orban, J. J. (2001) (2001)

synergin. synergin. BioChem BioChem Biophys Biophys Res Res Comm, Comm, 271,719-725. 271,719-725.

conserved conserved in in gamma-adaptin gamma-adaptin and and GGA GGA proteins proteins that that interact interact with with gamma­

Takatsu, Takatsu, H, H, Yoshino, Yoshino, K K and and Nakayama, Nakayama, K. K. (2000) (2000) Adaptor Adaptor gamma gamma ear ear homology homology domain domain

395(6700), 395(6700), 347-353. 347-353.

SNARE SNARE complex complex involved involved in in synaptic synaptic exocytosis exocytosis at at 2.4 2.4 A A resolution. resolution. Nature, Nature,

Sutton, Sutton, RB, RB, Fasshauer, Fasshauer, D, D, Jahn, Jahn, Rand Rand Brunger, Brunger, AT. AT. (1998) (1998) Crystal Crystal structure structure of of a a References References References

VanDer Sluijs, P, Hull, M, Zahraoui, A, Tavitian, A, Goud, Band Mellman, I. (1991) The small GTP-binding protein rab4 is associated with early endosomes. Proc Natl A cad Sci US A, 88(14), 6313-6317. Varlamov, 0, Kalinina, E, Che, FY and Fricker, LD. (2001) Protein phosphatase 2A binds to the cytoplasmic tail of carboxypeptidase D and regulates post-trans-Golgi network trafficking. J Cell Sci, 114, 311-322. Volpicelli-Daley, LA, Li, Y, Zhang, CJ and Kahn, RA. (2005) Isoform-selective effects of the depletion of ADP-ribosylation factors 1-5 on membrane traffic. Mol Biol Cell, 16(10), 4495-4508. Voorhees, P, Deignan, E, van Donselaar, E, Humphrey, J, Marks, MS, Peters, PJ and Bonifacino, JS. (1995) An acidic sequence within the cytoplasmic domain of furin functions as a determinant of trans-Golgi network localization and internalization from the cell surface. Embo J, 14(20), 4961-4975. Waheed A, Hasilik A, von Figura K. (1981) Processing of the phosphorylated recognition marker in lysosomal enzymes. Characterization and partial purification of a microsomal alpha-N-acetylglucosaminyl phosphodiesterase. J Biol Chern, 256(11), 5717-21. Wahle, T, Prager, K, Raffler, N, Haass, C, Famulok, M and Walter, J. (2005) GGA proteins regulate retrograde transport of BACE1 from endosomes to the trans­ Golgi network. Mol Cell Neurosci, 29, 453-461. Waites, CL, Mehta, A, Tan, PK, Thomas, G, Edwards, RH and Krantz, DE. (2001) An acidic motif retains vesicular monoamine transporter 2 on large dense core vesicles. J Cell Biol, 152, 1159-1168. Walworth, N, Davey, Sand Beach, D. (1993) Fission yeast chk1 protein kinase links the rad checkpoint pathway to cdc2. Nature, 363(6427), 368-371. Wan, L, Molloy, SS, Thomas, L, Liu, G, Xiang, Y, Rybak, SL and Thomas, G. (1998) P ACS-1 defines a novel gene family of cytosolic sorting proteins required for trans-Golgi network localization. Cell, 94, 205-216. Wang, YJ, Wang, J, Sun, HQ, Martinez, M, Sun, YX, Macia, E, Kirchhausen, T, Albanesi, JP, Roth, MG and Yin, HL. (2003) Phosphatidylinositol4 phosphate regulates targeting of clathrin adaptor AP-1 complexes to the Golgi. Cell, 114(3), 299-310. Wang, Z, Gershon, MD, Lungu, 0, Panagiotidis, CA, Zhu, Z, Hao, Y and Gershon, AA. (1998) Intracellular transport of varicella-zoster glycoproteins. J Inject Dis, Vol. 178 Suppl 1, pp. S7-12. Wang, ZH, Gershon, MD, Lungu, 0, Zhu, Z and Gershon, AA. (2000) Trafficking of varicella-zoster virus glycoprotein gi: T(338)-dependent retention in the trans­ Golgi network, secretion, and mannose 6-phosphate-inhibitable uptake of the ectodomain. J Virol, Vol. 74, pp. 6600-6613. Wang, ZH, Gershon, MD, Lungu, 0, Zhu, Z, Mallory, S, Arvin, AM and Gershon, AA. (200 1) Essential role played by the C-terminal domain of glycoprotein I in envelopment of varicella-zoster virus in the trans-Golgi network: interactions of glycoproteins with tegument. J Virol, Vol. 75, pp. 323-340. Waters, MG, Serafini, T and Rothman, JE. (1991) 'Coatomer': a cytosolic protein complex containing subunits of non-clathrin-coated Golgi transport vesicles. Nature, 349(6306), 248-251.

145

146 146

Biol, Biol, 2(2), 2(2), 107-17. 107-17.

Zerial Zerial M, M, McBride McBride H. H. (2001) (2001) Rab Rab proteins proteins as as membrane membrane organizers. organizers. Nat Nat Rev Rev Mol Mol Cell Cell

trans-Golgi trans-Golgi network. network. J J Biol Biol Chern, Chern, 278(25), 278(25), 23046-23054. 23046-23054.

extenSion extenSion of of V V AMP4 AMP4 contains contains a a dominant dominant autonomous autonomous targeting targeting signal signal for for the the

and and VampS VampS is is responsible responsible for for their correct correct their subcellular subcellular targeting: targeting: theN-terminal theN-terminal

Zeng, Zeng, Q, Q, Tran, Tran, TT, TT, Tan, Tan, HX HX and and Hong, Hong, W. W. (2003) (2003) The The cytoplasmic cytoplasmic domain domain ofVamp4 ofVamp4

reassembly reassembly of of unique unique clathrin clathrin coats. coats. J J Cell Cell Biol, Biol, 97(5) 97(5) Pt Pt 1, 1, 1339-1347. 1339-1347.

Zaremba, Zaremba, S S and and Keen, Keen, JH. JH. (1983) (1983) Assembly Assembly polypeptides polypeptides from from coated coated vesicles vesicles mediate mediate

Biophys Biophys Bioeng, Bioeng, 13, 13, 145-165. 145-165.

Zamyatnin, Zamyatnin, AA. AA. ( ( 1984) 1984) Amino Amino acid, acid, peptide, peptide, and and protein protein volume volume in in solution. solution. Annu Annu Rev Rev

Acad Acad Sci Sci US US A, A, 91(21), 91(21), 9975-9979. 9975-9979.

mice mice with with biochemical biochemical and and pathologic pathologic features features of of Tay-Sachs Tay-Sachs disease. disease. Proc Proc Natl Natl

Suzuki, Suzuki, K K and and Proia, Proia, RL. RL. ( ( 1994) 1994) Targeted Targeted disruption disruption of of the the Hexa Hexa gene gene results results in in

Yamanaka, Yamanaka, S, S, Johnson, Johnson, MD, MD, Grinberg, Grinberg, A, A, Westphal, Westphal, H, H, Crawley, Crawley, JN, JN, Taniike, Taniike, M, M,

a a macromolecular macromolecular complex. complex. Proc Proc Natl Natl Acad Acad Sci Sci US US A, A, 97(6), 97(6), 2567-2572. 2567-2572.

A-inhibited A-inhibited guanine guanine nucleotide-exchange nucleotide-exchange proteins proteins for for ADP-ribosylation ADP-ribosylation factors factors in in

Moss, Moss, J J and and Vaughan, Vaughan, M. M. (2000) (2000) Identification Identification and and localization localization of of two two brefeldin brefeldin

Yamaji, Yamaji, R, R, Adamik, Adamik, R, R, Takeda, Takeda, K, K, Togawa, Togawa, A, A, Pacheco-Rodriguez, Pacheco-Rodriguez, G, G, Ferrans, Ferrans, VJ, VJ,

lacking lacking the the casein casein kinase kinase II II alpha' alpha' catalytic catalytic subunit. subunit. Nat Nat Genet, Genet, 23, 23, 118-121. 118-121.

Xu, Xu, X, X, Toselli, Toselli, PA, PA, Russell, Russell, LD LD and and Seldin, Seldin, DC. DC. (1999) (1999) Globozoospermia Globozoospermia in in mice mice

network/endosomal network/endosomal compartments. compartments. Mol Mol Biol Biol Cell, Cell, 11, 11, 1257-1273. 1257-1273.

contains contains two two acidic acidic clusters clusters that that direct direct sorting sorting to to distinct distinct trans-Golgi trans-Golgi

Xiang, Xiang, Y, Y, Molloy, Molloy, SS, SS, Thomas, Thomas, Land Land Thomas, Thomas, G. G. (2000) (2000) The The PC6B PC6B cytoplasmic cytoplasmic domain domain

Biol Biol Chern, Chern, 276(7), 276(7), 5101-5108. 5101-5108.

Wolins, Wolins, NE, NE, Rubin, Rubin, Band Band Brasaemle, Brasaemle, DL. DL. (2001) (2001) TIP47 TIP47 associates associates with with lipid lipid droplets. droplets. J J

280(19), 280(19), 19146-19155. 19146-19155.

(2005) (2005) S3-12, S3-12, Adipophilin, Adipophilin, and and TIP47 TIP47 package package lipid lipid in in adipocytes. adipocytes. Biol Biol Chern, Chern, J J

Wolins, Wolins, NE, NE, Quaynor, Quaynor, BK, BK, Skinner, Skinner, JR, JR, Schoenfish, Schoenfish, MJ, MJ, Tzekov, Tzekov, A A and and Bickel, Bickel, PE. PE.

domain domain of of furin furin in in lysosomal lysosomal targeting. targeting. J J Cell Cell Biol, Biol, 139, 139, 1735-1745. 1735-1745.

determinant determinant of of protein protein fate fate in in post-Golgi post-Golgi compartments: compartments: role role of of the the luminal luminal

Wo1ins, Wo1ins, N, N, Bosshart, Bosshart, H, H, Kuster, Kuster, Hand Hand Bonifacino, Bonifacino, JS. JS. (1997) (1997) Aggregation Aggregation as as a a

1207-1220. 1207-1220.

transport transport from from early early endosomes endosomes to to the the trans-Golgi trans-Golgi network. network. Cell Cell Biol, Biol, 151(6), 151(6), J J

regulates regulates the the compartmentalization compartmentalization of of early early endosomes endosomes required required for for efficient efficient

Wilcke, Wilcke, M, M, Johannes, Johannes, L, L, Galli, Galli, T, T, Mayau, Mayau, V, V, Goud, Goud, Band Band Salamero, Salamero, J. J. (2000) (2000) Rab11 Rab11

lysosomal lysosomal enzymes enzymes into into ·extracellular ·extracellular fluids. fluids. N N Engl Engl Med, Med, 285(19), 285(19), J J 1090-1091. 1090-1091.

Wiesmann, Wiesmann, U, U, Vassella, Vassella, F F and and Herschkowitz, Herschkowitz, N. N. (1971) (1971) "1-cell" "1-cell" disease: disease: leakage leakage of of

residues residues in in Na+/H+ Na+/H+ exchangers. exchangers. Biochern Biochern 357, 357, 1-10. 1-10. J, J,

Wiebe, Wiebe, CA, CA, Dibattista, Dibattista, ER ER and and Fliegel, Fliegel, L. L. (200 (200 1) 1) Functional Functional role role of of polar polar amino amino acid acid

proteins proteins involved involved in in endosome endosome function. function. Cell, Cell, 83(5), 83(5), 703-713. 703-713.

Whitney, Whitney, JA, JA, Gomez, Gomez, M, M, Sheff, Sheff, D, D, Kreis, Kreis, TE TE and and Mellman, Mellman, (1995) (1995) Cytoplasmic Cytoplasmic I. I. coat coat

fusion. fusion. Cell, Cell, 92(6), 92(6), 759-772. 759-772.

TH TH and and Rothman, Rothman, JE. JE. (1998) (1998) SNAREpins: SNAREpins: minimal minimal machinery machinery for for membrane membrane

Weber, Weber, T, T, Zemelman, Zemelman, BV, BV, McNew, McNew, JA, JA, Westermann, Westermann, B, B, Gmachl, Gmachl, M, M, Parlati, Parlati, F, F, Seollner, Seollner, References References References

Zhou, A, Paquet, L and Mains, RE. (1995) Structural elements that direct specific processing of different mammalian subtilisin-like prohormone convertases. J Bioi Chern, 270, 21509-21516. Zhou, A, Webb, G, Zhu, X and Steiner, DF. (1999) Proteolytic processing in the secretory pathway. J Bioi Chern, 274, 20745-20748. Zhou, Y and Lindberg, I. ( 1993) Purification and characterization of the prohormone convertase PC1(PC3). J Bioi Chern, 268, 5615-5623. Zhu, Y, Doray, B, Poussu, A, Lehto, VP and Kornfeld, S. (2001) Binding ofGGA2 to the lysosomal enzyme sorting motif of the mannose 6-phosphate receptor. Science, 292, 1716-1718.

147

148 148

pathways" pathways" and and contributed contributed Figure Figure 4. 4.

Gary Gary Thomas Thomas and and myself myself wrote wrote the the section section entitled entitled "6.0. "6.0. Summary Summary of of trafficking trafficking

will will be be published published in in the the Fall Fall of of 2006 2006 by by Horizon Horizon press press (UK). (UK). Guruprasad Guruprasad Medigeshi, Medigeshi,

This This Appendix Appendix is is a a chapter chapter for for a a book book on on herpesviruses herpesviruses editied editied by by R.Sandri-Goldin R.Sandri-Goldin that that

[email protected] [email protected]

Iowa Iowa City City IA IA 52242 52242

200 200 Hawkins Hawkins Drive Drive

University University of of Iowa Iowa Hospital/2501 Hospital/2501 JCP JCP

Charles Charles Grose Grose

Corresponding Corresponding author: author:

Horizon Horizon Press, Press, England. England.

Title Title of of Book: Book: Alphaherpesviruses: Alphaherpesviruses: Pathogenesis Pathogenesis and and Molecular Molecular Biology Biology

Running Running title: title: Glycoprotein Glycoprotein trafficking trafficking and and egress egress of of varicella varicella virus virus

(GM, (GM, GKS, GKS, GT) GT)

LM), LM), and and the the Vollum Vollum Institute, Institute, Oregon Oregon Health Health Sciences Sciences University, University, Portland, Portland, Oregon Oregon

Department Department of of Pediatrics Pediatrics Microbiology, Microbiology, University University of of & & Iowa, Iowa, Iowa Iowa City, City, Iowa Iowa (CG, (CG,

Gary Gary Thomas. Thomas. · ·

Charles Charles Grose, Grose, Lucie Lucie Maresova, Maresova, Guruprasad Guruprasad Medigeshi, Medigeshi, Gregory Gregory K. K. Scott, Scott, and and

VIRION VIRION ENVELOPMENT ENVELOPMENT AND AND EGRESS EGRESS

ENDOCYTOSIS ENDOCYTOSIS OF OF VARICELLA-ZOSTER VARICELLA-ZOSTER VIRUS VIRUS GL GL YCOPROTEINS: YCOPROTEINS:

APPENDIX APPENDIX A A

Appendix Appendix A. A. VZV VZV Review Review Appendix A. VZV review

Abstract

Endocytosis from the infected cell surface is a property of the four major glycoproteins of varicella-zoster virus (VZV), designated gE, gl, gB and gH. Each of these glycoproteins has a functional endocytosis motif in its cytosolic domain. Three have tyrosine based motifs, while gl has a dileucine motif. The YAGL motif of gE is located adjacent to an acidic cluster, which also contains serine and threonine residues variably phosphorylated by both a viral kinase (ORF 47 kinase) and casein kinase II. The acidic cluster interacts with a connector protein called prosphofurin acidic cluster sorting protein 1 (PACS-1) after clathrin mediated internalization. Although the function of endocytosis has been elusive, recent research suggests that the internalized VZV glycoproteins traffic to the site of virion assembly in the trans-Golgi network and are subsequently incorporated into the envelopes of nascent virions. In turn, the enveloped virions reside within vacuoles, which travel toward and fuse with the plasma membrane. A recombinant VZV genome containing agE gene lacking only its endocytosis motif cannot replicate. Taken together, the above results indicate the importance of VZV glycoprotein endocytosis in the life cycle of this alpha herpesvirus.

149

150 150

deenvelopment-reenvelopment deenvelopment-reenvelopment model model of of herpesvirus herpesvirus assembly assembly and and egress egress is is discussed. discussed.

endocytosis endocytosis is is reviewed. reviewed. Also, Also, the the relationship relationship of of endocytosis endocytosis to to the the

site site of of assembly. assembly. For For the the above above reasons, reasons, the the subject subject of of herpesviral herpesviral glycoprotein glycoprotein

the the closely closely related related alpha alpha herpesviruses herpesviruses appear appear to to use use the the same same pathways pathways for for transit transit to to the the

are are incorporated incorporated into into nascent nascent virions. virions. In In contrast, contrast, not not all all homologous homologous glycoproteins glycoproteins from from

from from the the cell cell membrane membrane are are delivered delivered to to sites sites of of assembly assembly in in the the cytoplasm, cytoplasm, where where they they

differences differences relates relates to to trafficking trafficking pathways. pathways. In In the the case case of of VZV, VZV, glycoproteins glycoproteins internalized internalized

HSV HSV and and PRV, PRV, there there are are also also unanticipated unanticipated differences. differences. One One of of these these remarkable remarkable

glycoproteins glycoproteins share share many many characteristics characteristics with with their their alphaherpesvirus alphaherpesvirus homologs, homologs, such such as as

Scott, Scott, 1986; 1986; Grose, Grose, 1990; 1990; Grose Grose et et al., al., 2004). 2004). As As discussed discussed below, below, while while the the VZV VZV

endocytosis endocytosis motifs motifs are are highly highly conserved conserved among among all all sequenced sequenced VZV VZV strains strains (Davison (Davison and and

Varicella-zoster Varicella-zoster virus virus (VZV) (VZV) has has four four major major glycoproteins glycoproteins gE, gE, gi, gi, gH gH and and gB. gB. Their Their

demonstrated demonstrated for for numerous numerous herpesvirus herpesvirus glycoproteins. glycoproteins.

membrane membrane by by a a process process similar similar to to receptor-mediated receptor-mediated endocytosis endocytosis has has now now been been

as as tyrosine tyrosine motifs motifs or or dileucine dileucine motifs motifs (Trowbridge, (Trowbridge, 1991 1991 ). ). Endocytosis Endocytosis from from the the plasma plasma

be be dependent dependent on on internalization internalization signals signals in in the the cytosolic cytosolic domain, domain, which which have have been been defined defined

Both Both clustering clustering in in clathrin-coated clathrin-coated pits pits and and internalization internalization of of receptors receptors have have been been shown shown to to

coated coated pits pits and and are are often often recyCled recyCled through through the the endosomes endosomes back back to to the the cell cell membrane. membrane.

typically typically undergo undergo endocytosis endocytosis from from the the cell cell membrane membrane through through interactions interactions with with clathrin­

the the cell cell through through specific specific interactions interactions at at the the plasma plasma membrane. membrane. Cell Cell surface surface receptors receptors

Endocytosis Endocytosis is is an an important important process process by by which which proteins proteins are are continually continually internalized internalized within within

Introduction Introduction

Appendix Appendix VZV VZV Review Review A A Appendix A. VZV review

1. Glycoprotein gE

1.1 Endocytosis of VZV gE

Unlike other human herpesviruses, the predominant viral glycoprotein present on the envelope of the mature VZV virion is gE (Montalvo et al., 1985). VZV gE is a type I transmembrane protein of 623 amino acids. Of these, 544 residues are found in the ectodomain, 17 in the transmembrane domain, and 62 in the C- terminal cytosolic domain

(Fig. 1; Grose, 1990). The gE protein traffics from the endoplasmic reticulum (ER) through the Golgi, where it is extensively processed, to the outer cell membrane. The extensive posttranslational modifications produce a mature gE glycoprotein of 98 kDa

(Montalvo et al., 1985). Both the ectodomain and endodomain of gE have important functions. Based on the fact that a single point mutation in the VZV -MSP gE ectodomain changes VZV MSP egress pattern from a typical "viral highways" phenotype to a diffuse pattern similar to that observed in HSV infected cells (Santos et al., 1998), the ectodomain is critical for determining virus-cell interactions of the mature virion.

VZV gE was the first viral glycoprotein shown to undergo endocytosis in transfected cells (Olson and Grose, 1997). This process is mediated by a Y AGL sequence (aa 582-

585) located in the cytosolic domain of the protein (Fig. 1; Olson and Grose, 1997). This sequence fits the consensus tyrosine based endocytosis motif known to mediate endocytosis of numerous cellular transmembrane proteins (Bonifacino and Dell' Angelica,

1999). The tetrapeptide of the tyrosine-based motif is recognized by the alpha-2 subunit of AP-2, a clathrin-associated complex localized to the plasma membrane (Boll et al.,

151

152 152

is is also also linked linked to to the the mechanisms mechanisms of of fusion fusion in in infected infected cells. cells.

to to the the plasma plasma membrane membrane and and causes causes an an increased increased syncytial syncytial formation. formation. Thus, Thus, endocytosis endocytosis

example, example, in in cells cells infected infected with with a a VZV VZV ORF47-null ORF47-null mutant, mutant, internalized internalized VZV VZV gE gE recycles recycles

increasing increasing virus virus assembly assembly or or cell-to-cell cell-to-cell spread, spread, respectively respectively (Kenyon (Kenyon et et al., al., 2002). 2002). For For

casein casein kinase kinase targets targets endocytosed endocytosed gE gE to to either either II II the the TGN TGN or or cell cell surface, surface, thereby thereby

the the gE gE acidic acidic cluster cluster by by either either the the VZV VZV ORF ORF 47 47 protein protein serine serine kinase kinase or or the the cellular cellular

In In addition, addition, differential differential phosphorylation phosphorylation of of the the serine serine and and threonine threonine residues residues adjacent adjacent to to

1989). 1989).

is is phosphorylated phosphorylated on on serine serine and and threonine threonine residues residues of of its its cytosolic cytosolic domain domain (Grose (Grose et et al., al.,

within within this this acidic acidic cluster cluster motif motif mediates mediates PACS-1 PACS-1 interaction interaction (Fish (Fish et et al., al., 1998). 1998). VZV VZV gE gE

tegument tegument assembly assembly and and virion virion envelopment envelopment (Crumpet (Crumpet al., al., 2001b). 2001b). Phosphorylation Phosphorylation

protein protein 1 1 (P (P ACS-1 ACS-1 ), ), and and directs directs VZV VZV gE gE from from endosomes endosomes to to the the TGN, TGN, a a proposed proposed site site of of

acidic acidic cluster cluster of of gE gE interacts interacts with with a a connector connector protein, protein, phosphofurin phosphofurin acidic acidic cluster cluster sorting sorting

cluster cluster of of acidic acidic amino amino acids acids in in the the gE gE cytosolic cytosolic domain domain (Fig.1; (Fig.1; Grose Grose et et al., al., 1989). 1989). The The

network network (TGN) (TGN) post-endocytosis post-endocytosis (Alconada (Alconada et et al., al., 1996). 1996). TGN TGN recycling recycling is is mediated mediated by by a a

been been demonstrated, demonstrated, but but there there is is also also a a pathway pathway for for gE gE to to recycle recycle to to the the trans-Golgi trans-Golgi

1997). 1997). Endocytic Endocytic recycling recycling of of gE gE back back to to the the plasma plasma membrane membrane post-endocytosis post-endocytosis has has

endocytosis endocytosis of of gE gE mimicked mimicked internalization internalization of of the the transferrin transferrin receptor receptor (Olson (Olson and and Grose, Grose,

endocytosis endocytosis assay assay is is shown shown in in Fig. Fig. 2. 2. In In addition, addition, colocalization colocalization studies studies showed showed that that

dependent dependent on on clathrin-coated clathrin-coated vesicle vesicle formation formation within within the the cells. cells. An An example example of of the the VZV VZV

between between the the membrane membrane protein protein and and clathrin. clathrin. Endocytosis Endocytosis of of gE gE was was shown shown to to be be

1996). 1996). AP-2 AP-2 facilitates facilitates the the formation formation of of clathrin-coated clathrin-coated vesicles vesicles by by acting acting as as the the adaptor adaptor

Appendix Appendix VZV VZV Review Review A. A. Appendix A. VZV review

1.2 Endocytosis of alphaherpesvirus gE homologs

Similar to gE of YZY, pseudorabies virus (PrY) gE and herpes simplex type 1 (HSY-1) gE undergo endocytosis (Alconada et al., 1999). It has been demonstrated that PrY gE cytosolic domain is required forgE internalization from the plasma membrane (Tirabassi and Enquist, 1998). HSY-1 gE cycles between TGN and the cell surface. This TGN localization is determined by a tyrosine-based motif and an acidic stretch of amino acids in the gE cytosolic domain that are homologous to the YZY gE sites (Alconada et al.,

1999). Given the high degree of conservation of the different C-terminal sorting signals in all of the alphaherpesvirus gE homologs, it would seem likely that these molecules traffic inside the cell following identical signal-mediated transport processes. Yet, studies described below will show that this assumption appears not to be true.

2. VZV Glycoprotein gl

2.1 Endocytosis ojVZV g1

YZY gl is a type I transmembrane glycoprotein of 354 amino acids, 59 of which are cytosolic (Grose, 2002). Similar to gE, YZY gl also contains trafficking motifs in its cytosolic domain that mediate similar functions; however, the motifs are different (Fig.

1). While a Y AGL tyrosine motif mediates gE endocytosis, a di-leucine motif ML at amino acids 328-329 mediates gl endocytosis (Olson and -Grose, 1998). And instead of an acidic cluster for TGN targeting, gl has a threonine at position 338 that when mutated disrupts gl TGN targeting (Wang et al., 2000). YZY gE and gl form a complex in infected cells or when cotransfected. This non-covalent complex forms a biologically

153

154 154

3.1 3.1 Endocytosis Endocytosis ofVZV ofVZV gB gB

3. 3. VZV VZV Glycoprotein Glycoprotein B B

the the PrV PrV gl gl protein. protein.

internalization internalization of of the the VZV VZV gE gE protein, protein, while while the the PrV PrV gE gE protein protein directs directs endocytosis endocytosis of of

functionally functionally different different roles roles in in endocytosis, endocytosis, as as the the VZV VZV gl gl protein protein increases increases the the rate rate of of

plasma plasma membrane membrane on on its its own. own. Thus, Thus, the the PrV PrV and and VZV VZV gl gl proteins proteins seem seem to to have have

1998). 1998). In In contrast contrast to to VZV, VZV, however, however, the the PRV PRV gl gl protein protein cannot cannot be be internalized internalized from from the the

complex complex has has been been shown shown not not only only in in VZV, VZV, but but also also PrV PrV and and HSV. HSV. (Alconada (Alconada et et al., al.,

Complex Complex formation formation and and subsequent subsequent endocytosis endocytosis between between gE gE and and gl gl and and endocytosis endocytosis as as a a

2.2 2.2 Endocytosis Endocytosis of of alphaherpesvirus alphaherpesvirus gl gl homologs homologs

(Mallory (Mallory et et al., al., 1997). 1997).

spreads spreads very very poorly poorly in in cell cell culture culture reinforces reinforces the the importance importance of of the the VZV VZV gE:gl gE:gl complex complex

trafficking trafficking of of the the entire entire cell cell surface surface gE:gl gE:gl complex. complex. The The fact fact that that a a VZV VZV gl gl null null mutant mutant

facilitating facilitating the the endocytosis endocytosis of of the the major major constituent constituent gE gE and and thereby thereby modulating modulating the the

Further, Further, this this result result suggests suggests that that VZV VZV gl gl behaves behaves as as an an accessory accessory component component by by

suggests suggests that that the the gl gl motif motif may may be be more more efficient efficient than than that that of of gE gE (Olson (Olson and and Grose, Grose, 1998). 1998).

gl gl is is also also able able to to direct direct internalization internalization of of a a gE gE endocytosis endocytosis deficient deficient mutant, mutant, which which

over over that that of of gE gE or or gl gl alone alone and and (Olson Grose, Grose, 1998). 1998). Complex Complex formation formation between between gE gE and and

of of gE, gE, complex complex formation formation between gE:gl gE:gl between increases increases the the efficiency efficiency of of gE:gl gE:gl endocytosis endocytosis

active active human human Fe Fe receptor receptor (Litwin (Litwin et et al., al., 1992). 1992). Although Although gl gl internalize internalize can in in the the absence absence

Appendix Appendix VZV VZV Review Review A. A. Appendix A. VZV review

VZV gB is the second most abundant VZV glycoprotein and also the most conserved among the herpesvirus glycoproteins. VZV gB shares a higher degree of homology

(49%) with gB ofHSV-1 than that found between any other two VZV- HSV homologous glycoproteins (which range from 24 to 27%; Edson et al., 1985). The alphaherpesvirus gB homo logs are required for virus replication, attachment to and penetration of the host membrane, and fusion (Cai et al., 1988). VZV gB is a type 1 membrane protein consisting of a large ectodomain, a hydrophobic transmembrane region, and a cytosolic domain (Davison and Scott, 1986). The mature 140 kDa form of gB is proteolytically cleaved into a disulfide linked heterodimer consisting of 66 and 68 kDa components

(Keller et al., 1986). The length of the signal sequence has been recently corrected to include 71 amino acids, thereby giving gB a length of 931 amino acids (Maresova et al.,

2003 ). Since the gB protein cytosolic domain is predicted to contain 125 amino acids, it has the longest cytosolic domain of any VZV encoded membrane protein (Fig. 1; Elliott and O'Hare, 1999). VZV gB accumulates in the Golgi of infected cells (Wang et al.,

1998), and the cytosolic domain of gB contains specific sequences that are required for both its ER to Golgi transport and post-Golgi transport (Heineman and Hall, 2002).

The VZV gB protein contains three consensus internalization motifs within its cytosolic domain: two tyrosine (YMTL at aa 818-821 and YSRV at aa 857-860) and one di-leucine

(LL at aa 841-842). The gB protein containing the mutation Y857 failed to be internalized, while gB mutated in Y818 was endocytosed but did not subsequently accumulate in the Golgi (Heineman and Hall, 2001 ). The LL motif within the cytosolic domain is not required for either VZV gB internalization or Golgi localization. Therefore

155

156 156

while while recycling recycling from from the the endosomes endosomes to to the the plasma plasma membrane membrane was was enhanced. enhanced.

retrograde retrograde gB gB trafficking trafficking from from early early or or recycling recycling endosomes endosomes to to the the TGN TGN was was impaired impaired

replacement replacement did did not not hinder hinder the the process process of of gB gB endocytosis. endocytosis. However, However, the the subsequent subsequent

endosomes endosomes (Beitia (Beitia Ortiz Ortiz de de Zarate Zarate et et al., al., 2004). 2004). Analysis Analysis of of the the LL LL motif motif showed showed that that its its

disruption disruption of of this this signal signal totally abolishes abolishes totally gB gB internalization internalization from from the the cell cell surface surface to to

depends depends principally principally on on the the membrane-distal membrane-distal YTQV YTQV motif, motif, since since either either removal removal or or

based based motif, motif, arranged arranged in in a a similar similar order order in in C-terminus. C-terminus. Endocytosis Endocytosis of of HSV HSV -1 -1 gB gB

VZV VZV gB, gB, the the homologous homologous gB gB proteins proteins contain contain two two tyrosine tyrosine motifs motifs and and one one di-leucine di-leucine

A A similar similar triad triad of of endocytosis endocytosis motifs motifs have have been been identified identified in in HSV HSV -1 -1 and and PRY PRY gB. gB. As As for for

3.2 3.2 Endocytosis Endocytosis of of alphaherpesvirus alphaherpesvirus gB gB homologs homologs

gB gB protein protein (Heineman (Heineman et et al., al., 2000). 2000).

required required by by a a sequence-dependent sequence-dependent mechanism mechanism for for efficient efficient ER-to-Golgi ER-to-Golgi targeting targeting of of the the

proximal proximal tyrosine tyrosine motif motif (YMTL) (YMTL) is is within within a a nine-amino nine-amino acid acid region region (YMTL (YMTL VSAAE) VSAAE)

shown shown to to contain contain specific specific ER-to-Golgi ER-to-Golgi transport transport signals. signals. The The transmembrane transmembrane domain domain

In In addition addition to to the the post-Golgi post-Golgi transport transport signals, signals, the the cytosolic cytosolic domain domain of of VZV VZV gB gB has has been been

motifs motifs is is removed, removed, the the others others may may subsume subsume some some of of the the lost lost functions. functions.

localize localize to to the the Golgi Golgi (Heineman (Heineman and and Hall, Hall, 2002). 2002). Thus, Thus, when when one one of of the the internalization internalization

the the YSRV YSRV endocytosis endocytosis motif, motif, is is internalized internalized from from the the plasma plasma membrane membrane but but fails fails to to

form form of of gB gB lacking lacking the the C-terminal C-terminal 36 36 amino amino acids acids of of its its cytosolic cytosolic domain, domain, despite despite lacking lacking

Hall, Hall, 2001). 2001). However, However, a a VZV VZV recombinant recombinant virus virus (VZV (VZV gB-36) gB-36) that that expresses expresses a a truncated truncated

the the membrane-distal membrane-distal YSRV YSRV motif motif is is most most responsible responsible for for gB gB endocytosis endocytosis (Heineman (Heineman and and

Appendix Appendix VZV VZV A. A. Review Review Appendix A. VZV review

The PRY gB homolog is internalized from the cell surface and colocalizes precisely with the endocytosed PRY gE:gl complex (Tirabassi and Enquist, 1998). A mutated PrY gB

form lacking the membrane-distal tyrosine and the di-leucine motifs remains primarily

membrane associated because endocytosis is abolished (Tirabassi and Enquist, 1998).

Furthermore, mutation of the one tyrosine Y902 residue in the tyrosine motif (YQRL)

inhibits functioning of gB during antibody induced gB internalization in PRY infected

monocytes (Favoreel et al., 2002). This same tyrosine mutation also diminishes efficient

PrY cell-to-cell spread. However, mutating the dileucine motif in the gB domain has no

effect on antibody triggered endocytosis but does promote an increased cell-to-cell spread

phenotype with formation of larger syncytia, presumably through increased recycling of

gB back to the cell surface (Favoreel et al., 2002).

4. VZV Glycoprotein H

4.1 Endocytosis ofVZV gH

YZY gH is the third most abundant glycoprotein and the second most conserved. The gH

glycoprotein of YZY is a major fusogen. Complete maturation of VZV gH in Golgi and

its expression at the cell surface requires coexpression of gL (Forghani et al., 1994).

When cotransfected with gE or gl, in the absence of gL, VZV gH is capable of exiting the

ER in its immature form (Duus and Grose, 1996). However, unlike coexpression with gL,

gH + gE or gH + gl does not result in complete gH maturation or subsequent syncytium

formation. Within a transfection system, coexpression of VZV gH and gL is sufficient to

mediate polykaryocytosis (Duus et al., 1995). While the requirement for gH and gL

157

158 158

amino amino acids, acids, respectively). respectively). The The longer longer domains domains provide provide the the proper proper context context for for a a

in in length length (18 (18 amino amino acids) acids) than than predicted predicted in in the the original original sequence sequence analyses analyses (12 (12 and and 16 16

motif. motif. The The VZV VZV gH gH and and simian simian varicella varicella virus virus gH gH cytosolic cytosolic domains domains were were likely likely longer longer

endocytosis endocytosis motif, motif, while while all all other other alphaherpesvirus alphaherpesvirus gH gH homologs homologs contained contained a a potential potential

homologs homologs revealed revealed two two important important findings findings (Table (Table 1). 1). HSV-1 HSV-1 and and 2 2 gE gE proteins proteins lacked lacked an an

Alignment Alignment analysis analysis of of the the VZV VZV gH gH cytosolic cytosolic domain domain to to other other alphaherpes alphaherpes virus virus gH gH

4. 4. 2. 2. Endocytosis Endocytosis of of alphaherpesvirus alphaherpesvirus gH gH homologs. homologs.

short short cytosolic cytosolic domain domain (Fig. (Fig. 1; 1; Pasieka Pasieka et et al., al., 2003). 2003).

endocytosis endocytosis of of VZV VZV glycoprotein glycoprotein gH gH is is mediated mediated by by a a tyrosine tyrosine based based YNKI YNKI motif motif in in its its

When When the the tyrosine tyrosine was was replaced replaced with with an an alanine, alanine, endocytosis endocytosis of of gH gH was was blocked. blocked. Thus, Thus,

discovered discovered if if the the cytosolic cytosolic domain domain was was realigned realigned to to include include 18 18 amino amino acids acids (Table (Table 1 1 ). ).

putative putative tyrosine-based tyrosine-based YNKI YNKI endocytosis endocytosis motif motif (aa (aa 835-838) 835-838) in in proper proper context context was was

further further inspection inspection of of the the gH gH cytosolic cytosolic domains domains of of all all alphaherpes alphaherpes viruses, viruses, however, however, a a

the the original original sequencing, sequencing, the the cytosolic cytosolic domain domain was was assigned assigned only only 12 12 residues. residues. Upon Upon

unexpected unexpected because because all all herpesvirus herpesvirus gH gH homologs homologs have have very very short short endodomains. endodomains. Also, Also, in in

system, system, gH gH is is capable capable of of endocytosis endocytosis independent independent of of gE, gE, gl, gl, or or gB. gB. This This observation observation was was

infected infected cells. cells. Further, Further, when when expressed expressed alone alone with with its its chaperone chaperone gL gL in in a a transfected transfected

Like Like the the three three previously previously described described VZV VZV glycoproteins, glycoproteins, VZV VZV gH gH is is internalized internalized in in

requires requires the the quartet quartet of of gH, gH, gL, gL, gB gB and and gD. gD.

association association is is conserved conserved among among herpesvirus herpesvirus gH gH homologues, homologues, HSV HSV cell-to-cell cell-to-cell fusion fusion

Appendix Appendix VZV VZV A. A. Review Review Appendix A. VZV review functional endocytosis motif with at least 5 intervening ammo acids between the transmembrane domain and the tyrosine residue.

5.0. Incorporation of endocytosed VZV glycoproteins into virion envelopes

Since endocytosis can target viral glycoproteins to the TGN, the proposed site of viral assembly, one attractive hypothesis is that endocytosis is a mechanism for delivering viral glycoproteins to the site of final envelopment (Brideau et al., 2000b). The deenvelopment-reenvelopment model for acquisition of the final viral envelope has been proposed for VZV (Jones and Grose, 1988). An analogous mechanism has been postulated to be involved in the envelopment of other herpesviruses (Card et al., 1993).

The model predicts that capsids obtain a primary envelope as they pass through the inner nuclear membrane. As they exit the outer nuclear membrane, they undergo de­ envelopment. Subsequently capsids released into the cytoplasm are enclosed by membranes of a post-Golgi compartment, such as the TGN. As previously reported, VZV apparently obtains its final envelope from these trans-Golgi network vesicles (Gershon et al., 1994 ). The glycoproteins of VZV are targeted to the TGN and, late in infection, all appear to become concentrated within this organelle (Olson and Grose, 1997). Thus, for the assembly of VZV a high degree of organization is required to localize all the viral envelope components to the final compartment. TGN sorting implies that TGN targeting signals must be present in the sequences of at least some VZV glycoproteins.

In a recently reported study, the role of viral glycoprotein endocytosis within the VZV life cycle was further assessed (Maresova et al., 2004). VZV differs from other

159

160 160

incorporation incorporation into into virions virions (Fig. (Fig. 3). 3). After After several several washes, washes, the the infected infected monolayer monolayer was was

hr hr to to allow allow for for endocytosis endocytosis of of the the surface surface glycoproteins glycoproteins and and their their subsequent subsequent

cleavable cleavable Sulfo-NHS-SS-biotin, Sulfo-NHS-SS-biotin, the the infected infected monolayer monolayer was was incubated incubated for for an an additional5 additional5

infected infected cells cells :2 :2 ratio) ratio) and and incubated incubated (1 (1 for for 24 24 hr hr at at 37C. 37C. After After surface surface biotinylation biotinylation with with

incorporated incorporated into into the the virion virion particles, particles, an an uninfected uninfected monolayer monolayer was was inoculated inoculated with with

To To determine determine the the extent extent to to which which VZV VZV glycoproteins glycoproteins retrieved retrieved from from the the cell cell surface surface were were

infection infection advances advances over over the the next next 24 24 hr hr time time period. period.

efficiently efficiently during during the the first first 24 24 hr hr after after infection, infection, but but endocytosis endocytosis is is markedly markedly decreased decreased as as

endocytosis endocytosis timepoint. timepoint. Under Under the the above above conditions, conditions, viral viral glycoproteins glycoproteins are are internalized internalized

becomes becomes inaccessible inaccessible to to extracellular extracellular glutathione glutathione cleavage cleavage buffer buffer added added at at the the end end of of the the

of of a a surface surface protein protein based based on on the the proportion proportion of of a a disulfide-linked disulfide-linked biotinylated biotinylated protein protein that that

followed followed by by a a glutathione glutathione cleavage cleavage assay. assay. This This assay assay measures measures the the extent extent of of endocytosis endocytosis

VZV VZV infected infected cells. cells. The The methodology methodology included included biotinylation biotinylation of of cell cell surface surface glycoproteins glycoproteins

subsequently subsequently analyzed analyzed the the post-endocytosis post-endocytosis trafficking trafficking pathways pathways of of glycoproteins glycoproteins in in

demonstration demonstration of of the the apparent apparent importance importance of of endocytosis endocytosis in in the the VZV VZV life life cycle, cycle, we we

the the gE gE cytosolic cytosolic domain, domain, the the virus virus was was able able to to replicate. replicate. Because Because of of this this remarkable remarkable

2004). 2004). This This mutated mutated virus virus did did not not replicate. replicate. When When other other mutations mutations were were introduced introduced into into

genome genome containing containing gE gE lacking-its lacking-its endocytosis endocytosis motif motif but but otherwise otherwise intact intact (Moffat (Moffat et et al., al.,

motif motif within within gE gE itself itself was was firmly firmly documented documented by by production production of of a a recombinant recombinant VZV VZV

protein protein for for viral viral growth growth in in cultured cultured cells. cells. Furthermore, Furthermore, the the essential essential nature nature of of the the YAGL YAGL

percentage percentage of of total total viral viral glycoprotein glycoprotein production production in in an an infected infected cell) cell) but but also also an an essential essential

alphaherpesviruses alphaherpesviruses in in that that gE gE is is not not only only the the major major glycoprotein glycoprotein (as (as measured measured by by

Appendix Appendix A. A. VZV VZV Review Review Appendix A. VZV review harvested and sonically disrupted in order to break apart the infected cells. The released cell free virus was purified by ultracentrifugation in two sequential potassium-tartrate density gradients. The particulate virion band was removed and solubilized in a buffer for immunoprecipitation. Precipitations were performed with monoclonal antibodies specific for each of the four VZV glycoproteins. After the samples were separated by

polyacrylamide gel electrophoresis, individual biotinylated glycoproteins were detected

by Western blotting with Streptavidin-horse radish peroxidase staining (Fig. 3). The results demonstrated that the four glycoproteins retrieved from the cell surface were incorporated into virus particles isolated from infected cells by density gradient

sedimentation (Fig. 3). Furthermore, additional glycoprotein complexes were present on

the virion envelope, for example, the gE:gi complex and a higher molecular mass gE.

Interestingly, the recently described gE:gH complex was also found in the virion

envelope (Pasieka et al., 2004). This result supported a mechanism of gE:gH complex

formation as a means by which gH was shuttled to the TGN after internalization.

To confirm and expand the above observations, the virions were also examined directly

by transmission electron microscopy (TEM). To this end, an aliquot of the gradient­

purified virion fraction was placed on a copper formvar grid and incubated at 24C with

ultra-small gold beads (0.8 nm) conjugated to anti-biotin antibody. Silver enhancement

was performed in order to allow visualization of the ultra-small beads. In the next step,

the sample was negatively stained with 1% ammonium molibdate and viewed by TEM.

The biotin label was easily detected in the virion fraction (Maresova et al., 2004). When

the particles with biotinylated glycoproteins on their envelope were counted, the

161

162 162

compartments compartments (Fig. (Fig. 4). 4).

cell cell surface surface via via a a series series of of complex complex and and highly highly dynamic dynamic early/sorting early/sorting and and late late endosomal endosomal

2001b; 2001b; Robinson, Robinson, 2004b). 2004b). In In addition, addition, the the TGN TGN receives receives molecules molecules internalized internalized from from the the

endosomes, endosomes, lysosomes lysosomes and and plasma plasma membrane membrane (Bonifacino (Bonifacino and and Glick, Glick, 2004; 2004; Gu Gu et et al., al.,

segregating segregating them them into into nascent nascent vesicles vesicles bound bound for for specific specific target target organelles organelles including including the the

station station for for membrane membrane proteins proteins and and lipids lipids moving moving through through the the biosynthetic biosynthetic pathway pathway by by

the the boundary boundary of of the the biosynthetic biosynthetic and and endocytic endocytic pathways, pathways, the the TGN TGN acts acts as as a a sorting sorting

pathway pathway organelles organelles that that comprise comprise the the TGN/ TGN/ endosomal endosomal system. system. Strategically Strategically located located at at

between between the the cell cell surface surface and and a a dynamic dynamic and and highly highly regulated regulated network network of of late late secretory secretory

compartments. compartments. Many Many of of these these modification modification and and targeting targeting steps steps rely rely on on the the communication communication

that that viral viral proteins proteins be be correctly correctly modified modified and and targeted targeted to to specific specific intracellular intracellular

As As is is apparent apparent from from the the previous previous sections, sections, the the replication replication and and egress egress of of viruses viruses require require

6.0. 6.0. Summary Summary of of trafficking trafficking pathways pathways

glycoproteins glycoproteins are are transported transported to to the the site site of of envelopment envelopment in in the the cytoplasm. cytoplasm.

Thus, Thus, in in the the process process of of VZV VZV assembly, assembly, endocytosis endocytosis is is one one of of the the pathways pathways by by which which viral viral

visualization visualization experiment experiment indicated indicated that that a a majority majority of of enveloped enveloped virions virions were were biotinylated. biotinylated.

their their envelopes envelopes (Grose (Grose et et al., al., 1979). 1979). When When considered considered in in this this regard, regard, the the TEM TEM

expected expected after after two two successive successive gradient gradient sedimentations, sedimentations, during during which which many many particles particles lose lose

viral viral particles. particles. This This value value corresponded corresponded to to the the percentage percentage of of intact intact enveloped enveloped virions virions

positively positively labeled labeled virions virions represented represented approximately approximately 27% 27% of of the the total total number number of of counted counted

Appendix Appendix VZV VZV A. A. Review Review Appendix A. VZV review

Membrane proteins endocytosed from the cell surface may traverse various endosomal paths depending on the protein and its function. For example, transferrin receptors constitutively recycle between the plasma membrane and recycling endosomes via early endosomes (van Dam and Stoorvogel, 2002b), whereas growth factor receptors, such as the epidermal growth factor receptor (EGFR), are segregated into the sorting compartment of early endosomes and are delivered to lysosomes via the late endosome/ multivesicular body (MVB) pathway for degradation (Gruenberg and Stenmark, 2004b;

Raiborg et al., 2003). In addition, the two mannose 6-phosphate receptors (cation­ dependent and cation-independent MPRs), recycle between the TON, plasma membrane and endosomal compartments as they sort newly synthesized lysosomal hydrolases to lysosomes (Ghosh et al., 2003a). These complex protein trafficking events require the orchestrated interaction of lipid and protein components of the vesicular trafficking machinery, the cytoskeleton and multiple regulatory factors (Bonifacino and Traub,

2003b; Gruenberg, 2003; Roth, 2004).

The localization of many membrane proteins within the TGN/endosomal system relies upon canonical sorting motifs within their cytosolic domains, the best characterized of which are the tyrosine, dileucine and acidic cluster- based motifs. These sorting signals

11 11 act as address tags , which are recognized by components of the vesicular trafficking machinery that direct sorting to specific subcellular eompartments (Bonifacino and

Traub, 2003b). The four major VZV envelope glycoproteins have retained through evolution one or more types of these sorting signals, thus mimicking cellular membrane proteins to reach endosomes and the TON. Together with the findings that gE and gl

163

164 164

fission, fission, which which is is mediated mediated by by the the GTPase GTPase dynamin dynamin at at the the plasma plasma membrane membrane and and a a

complex complex induced induced formation formation of of vesicles vesicles from from clathrin-coated clathrin-coated pits pits requires requires membrane membrane

is is predicted predicted to to play play a a structural structural role role by by stabilizing stabilizing the the tetrameric tetrameric complex. complex. Adaptor Adaptor

YXXL YXXL motifs motifs in in the the cytosolic cytosolic domain domain of of the the cargo cargo proteins, proteins, respectively. respectively. a a The The subunit subunit

subunits subunits bind bind clathrin clathrin whereas whereas the the and and !-!1-4 !-!1-4 subunits subunits ~1-4 ~1-4 bind bind to to [D/E]XXXL[L/1] [D/E]XXXL[L/1] and and

sorting sorting of of membrane membrane proteins proteins to to basolateral basolateral membrane membrane in in polarized polarized cells. cells. The The y/a/6 y/a/6

(subunits: (subunits: !-!4 !-!4 and and is is which ~4, ~4, a4), a4), localized localized £, £, to to the the TGN TGN and and endosomes, endosomes, mediates mediates the the

mediates mediates sorting sorting of of membrane membrane proteins proteins to to the the lysosomes lysosomes and and melanosomes. melanosomes. AP-4 AP-4

receptors. receptors. AP-3 AP-3 (subunits: (subunits: 6, 6, !-!3 !-!3 and and ~3, ~3, is is localized localized a3) a3) to to the the TGN TGN and and endosomes endosomes and and

plasma plasma membrane, membrane, plays plays a a prominent prominent role role in in clathrin-mediated clathrin-mediated endocytosis endocytosis of of cell cell surface surface

the the TGN TGN and and endosomes. endosomes. AP-2 AP-2 (subunits: (subunits: 1-12 1-12 and and a, a, which which ~2, ~2, is is a2), a2), localized localized to to the the

epithelial epithelial cell cell specific specific isoform isoform of of AP-1, AP-1, directs directs transport transport to to the the basolateral basolateral surface surface from from

pathways pathways between between the the TGN TGN and and endosomes. endosomes. AP-1B AP-1B (subunits: (subunits: y, y, 1-11B 1-11B and and a1), a1), an an ~1, ~1,

at at the the TGN, TGN, mediates mediates sorting sorting of of membrane membrane proteins proteins in in both both anterograde anterograde and and retrograde retrograde

clathrin-coated clathrin-coated pits pits (Fig. (Fig. 4). 4). AP-1 AP-1 (subunits: (subunits: y, y, 1-11 1-11 and and a1), a1), which which ~1, ~1, is is localized localized mainly mainly

cytosolic cytosolic domains domains of of membrane membrane proteins proteins thereby thereby promoting promoting their their concentration concentration into into

Adaptor Adaptor complexes complexes connect connect the the vesicular vesicular coat coat protein protein clathrin clathrin to to sorting sorting signals signals in in the the

heterotetrameric heterotetrameric adaptor adaptor complexes complexes AP-1, AP-2, AP-2, AP-1, AP-3 AP-3 and and AP-4 AP-4 (Robinson, (Robinson, 2004b). 2004b).

The The function function of of tyrosine-based tyrosine-based signals signals arises arises from from the the interaction interaction of of these these motifs motifs with with the the

glycoproteins glycoproteins to to sites sites of of virus virus assembly. assembly.

results results strongly strongly demonstrate demonstrate the the importance importance of of sorting sorting motifs motifs for for the the trafficking trafficking of of VZV VZV

may may mediate mediate the the endocytosis endocytosis of of other other VZV VZV glycoproteins glycoproteins (Wang (Wang et et al., al., 1998), 1998), these these

Appendix Appendix A. A. VZV VZV Review Review Appendix A. VZV review dynamin homologue, dynamin 2, at the TGN (Cao et al., 2000b ). Together these adaptor complexes and coat proteins orchestrate intracellular transport of membrane proteins in the TGN/endosomal system (Collins et al., 2002b; Robinson, 2004b).

A number of cellular and viral membrane proteins containing acidic cluster sorting motifs

have been identified including furin, a proprotein convertase that cleaves proteins in the

secretory pathway (Thomas, 2002b), the MPRs (Ghosh et al., 2003a), as well as the

herpesvirus glycoproteins VZV gE (Alconada et al., 1999), HCMV gB (Norais et al.,

1996), HSV gB, gE (Alconada et al., 1999; Beitia Ortiz de Zarate et al., 2004) and the

PrV glycoprotein Us9 (Brideau et al., 2000a). Acidic cluster motifs often contain a serine

or threonine residue that can be phosphorylated by casein kinase II, a ubiquitous,

heterotetrameric serine/ threonine kinase involved in a plethora of phosphorylation events

including the regulation of protein sorting (Meggio and Pinna, 2003b ). Phosphofurin

acidic cluster sorting protein-! (PACS-1) connects phosphorylated acidic cluster

containing proteins to AP-I and directs the deli very of membrane proteins from

endosomes to the TGN (Fig. 4). This function of PACS-1 is required for the sorting of

several integral membrane proteins such as furin, the MPRs and HCMV gB (Crump et

al., 2003b; Scott et al., 2003b; Wan et al., 1998b). In addition, PACS-1 binds to an acidic

cluster (that contains a phosphorylation site for casein kinase II) within the cytosolic

domain of VZV gE (Wan et al., 1998b) and may mediate delivery of VZV gE to the

TGN, though this function has not yet been proven. Considering the importance for the

TGN localization of VZV glycoproteins in the final envelopment of VZV virions, PACS-

165

166 166

to to be be essential essential for for the the incorporation incorporation of of gp gp 160 160 into into HIV HIV virions, virions, however however no no VZV VZV

transport transport of of these these proteins proteins (Diaz (Diaz and and Pfeffer, Pfeffer, 1998). 1998). This This trafficking trafficking step step has has been been shown shown

like like the the CD-MPR CD-MPR (FW) (FW) and and HIV-gp160 HIV-gp160 (YW), (YW), mediating mediating the the late late endosome endosome to to TGN TGN

TIP4 TIP4 7 7 binds binds to to a a diaromatic diaromatic amino amino acid acid motif motif in in the the cytosolic cytosolic domain domain of of cargo cargo proteins proteins

transport transport of of membrane membrane proteins proteins such such as as MPRs, MPRs, from from endosomes endosomes to to the the TGN TGN (Fig. (Fig. 4). 4).

Two Two additional additional sorting sorting molecules, molecules, TIP4 TIP4 7 7 and and the the retromer retromer complex, complex, may may also also direct direct

containing containing vesicles vesicles from from the the TGN TGN to to endosomes. endosomes.

binding binding motif motif of of the the neuronal neuronal SorLA SorLA receptor), receptor), implicating implicating GGAs GGAs in in the the sorting sorting of of VZV VZV

potential potential GGA GGA binding binding site site (ESDVML; (ESDVML; not not canonical, canonical, but but highly highly similar similar to to the the GGA GGA

kinase kinase II II (Doray (Doray et et al., al., 2002a). 2002a). Interestingly, Interestingly, the the cytosolic cytosolic domain domain of of VZV VZV gl gl contains contains a a

dileucine dileucine motifs motifs contain contain a a serine/threonine serine/threonine residue residue that that can can be be phosphorylated phosphorylated by by casein casein

(Bonifacino, (Bonifacino, 2004b; 2004b; Puertollano Puertollano et et al., al., 2001b). 2001b). Like Like acidic acidic cluster cluster motifs, motifs, many many acidic­

the the TGN TGN and and activates activates anterograde anterograde sorting sorting of of the the MPRs MPRs to to the the early early endosomes endosomes

several several endogenous endogenous membrane membrane proteins, proteins, including including the the MPRs, MPRs, into into clathrin-coated clathrin-coated buds buds at at

proteins proteins with with acidic-dileucine acidic-dileucine motifs motifs directly directly to to clathrin. clathrin. This This function function concentrates concentrates

GGAs GGAs are are localized localized to to the the TGN TGN where where they they cooperate cooperate with with AP-I AP-I to to link link membrane membrane

ear ear homology homology domain, domain, ARF-binding ARF-binding protein protein 1-3, 1-3, GGAs; GGAs; Fig. Fig. 4; 4; Bonifacino, Bonifacino, 2004b 2004b ). ). The The

family family of of monomeric monomeric adaptors adaptors consisting consisting of of GGA-1, GGA-1, -2 -2 and and -3 -3 (Golgi-localized, (Golgi-localized, y-adaptin y-adaptin

A A newer newer class class of of sorting sorting motifs, motifs, the the acidic-dileucine acidic-dileucine (DxxLL) (DxxLL) motifs, motifs, are are recognized recognized by by a a

PACS-1 PACS-1 does does for for HCMV HCMV (Crump (Crump et et al., al., 2003b 2003b ). ).

1 1 may may play play a a critical critical role role for for the the formation formation of of VZV VZV virions virions that that bud bud from from the the TGN, TGN, as as

Appendix Appendix VZV VZV Review Review A. A. Appendix A. VZV review glycoprotein contains a TIP47 binding motif. The mammalian retromer complex, which consists of five subunits (vps35, vps29, vps26, SNX1 and SNX2), was recently shown to localize to the tubular-vesicular profiles that emanate from either early endosomes or from intermediates in the maturation of early endosomes to late endosomes. From these endosomal compartments, retromer mediates the recycling of CI-MPR to the TGN

(Seaman, 2004b). The cargo recognition motif for retromer is unknown and proposed to be conformational in nature.

The deenvelopment-reenvelopment model for acquisition of the final viral envelope proposed for herpesviruses suggests that mature viral glycoproteins must traffic to the

TGN or to endosomal structures before being incorporated into the viral envelope

(Gershon et al., 1994; Tooze et al., 1993). This scenario requires, at least in case of VZV, endocytosis of mature viral glycoproteins from the plasma membrane via a clathrin/ AP-

2/dynamin dependent process and delivery of these proteins to early endosomes.

Endocytosed viral glycoproteins can reach the site of assembly, the TGN, either directly from early endosomes or indirectly from early endosomes via late endosomes. These retrograde transport pathways have been shown to be utilized not only by cellular and viral proteins like the MPRs, furin and HCMV gB, but also by bacterial toxins like Shiga toxin, which is internalized in clathrin-coated vesicles and traverses the early endosome­ to-TON pathway before reaching the ER (Mallard et al., 1998; Mallard et al., 2002;

Sandvig and van Deurs, 2002). The final event in VZV assembly and egress is exocytosis at the cell surface (Fig. 5).

167

168 168

in in the the text text are are annotated. annotated.

domain domain of of gH gH has has been been recently recently realigned realigned also also (Pasieka (Pasieka et et al., al., 2003). 2003). Domains Domains discussed discussed

descriptions descriptions (Maresova (Maresova et et al., al., 2003). 2003). Both Both sets sets of of numbers numbers are are given. given. The The cytosolic cytosolic

the the enumeration enumeration of of amino amino acids acids in in the the cytosolic cytosolic domain domain differs differs from from the the earlier earlier

Scott, Scott, 1986; 1986; Grose Grose et et al., al., 2004). 2004). The The amino amino terminal terminal of of gB gB has has been been recently recently realigned, realigned, so so

gH, gH, gl gl and and gB. gB. The The sequences sequences are are based based on on published published VZV VZV sequences sequences (Davison (Davison and and

Figure Figure 1. 1. Amino Amino acid acid sequences sequences of of the the cytosolic cytosolic domains domains of of VZV VZV glycoproteins glycoproteins gE, gE,

Figure Figure Legends Legends

37274, 37274, AI AI 48585 48585 and and AI AI 49793. 49793.

years. years. Research Research described described in in this this chapter chapter was was supported supported by by NIH NIH grants grants AI AI 22795, 22795, DK DK

The The authors authors thank thank all all colleagues colleagues whose whose names names appear appear on on our our cited cited articles articles from from previous previous

Acknowledgments Acknowledgments

of of this this alpha alpha herpesvirus herpesvirus (Moffat (Moffat et et al., al., 2004; 2004; Maresova Maresova et et al., al., 2004). 2004).

gE gE gene, gene, cannot cannot replicate replicate emphasizes emphasizes the the pivotal pivotal role role of of gE gE endocytosis endocytosis in in the the life life cycle cycle

VZV VZV genome genome containing containing only only a· a· single single mutation, mutation, namely, namely, the the endocytosis endocytosis motif motif within within the the

2002; 2002; Kenyon Kenyon et et al., al., 2002; 2002; Wang Wang et et al., al., 2001). 2001). In In particular, particular, the the fact fact that that a a recombinant recombinant

demonstrates demonstrates the the importance importance of of these these events events for for virus virus maturation maturation (Heineman (Heineman and and Hall, Hall,

trafficking trafficking defects defects or or mutant mutant VZV VZV serine serine protein protein kinases kinases with with phosphorylation phosphorylation defects defects

The The failure failure in in viral viral assembly assembly in in cells cells expressing expressing either either mutant mutant VZV VZV glycoproteins glycoproteins with with

Appendix Appendix A. A. VZV VZV Review Review Appendix A. VZV review

Figure 2. Endocytosis assay. Endocytosis of the transfected VZV gE was gauged by a confocal microscopy assay. The assay was photographed at the following timepoints:

0 min (A), 5 min (B), 10 min (C), 15 min (D), 30 min (E) and 60 min (F). The characteristic profile of endocytosis includes multiple vesicles in the cytoplasm; see panels D, E and F. Endocytosis is more pronounced in assays of transfected cells than in

VZV infected cells.

Figure 3. Identification of biotinylated VZV glycoproteins on infected cells and purified virions. (A) Cultured cells were infected and processed for the surface biotinylation assay as described in the text. The VZV glycoproteins were precipitated with monoclonal antibodies as designated at the bottom of each lane: gH (lanes 1, 9, 10 and 11); gB (lanes 2, 3 and 8); gE (lanes 5, 6 and 7) and gl (lane 4). Precipitated samples were resolved in an 8% gel under non-reducing conditions prior to Western blotting with

Streptavidin-horse radish peroxidase. Closed circles indicate locations of some glycoproteins; in lane 4, closed circles also indicate the location of gE coprecipitated by antibody to gl. Lanes 1-6 and 7-11 represent two separate gels. The corresponding molecular mass markers (kilodaltons) are indicated on the right. (B) Virion band after ultracentrifugation in the second density gradient. The band was subsequently solubilized for immunoprecipitation (see panel C). (C). Biotinylated VZV gl in the virion band. As described in the text, biotinylated gl was immunoprecipitated from the virion band and stained by Western blotting with Streptavidin-horse radish peroxidase. Similar experiments for VZV gE, gH and gB are illustrated in the reference by Maresova et al.

(2004).

169

170 170

the the alphaherpesvirus alphaherpesvirus gH gH homo homo logs. logs. Only Only the the VZV VZV gH gH endocytosis endocytosis motif motif has has been been proven proven

Note Note at at bottom bottom of of Table: Table: Underlined Underlined sequences sequences indicate indicate potential potential endocytosis endocytosis motifs motifs in in

Table Table 1. 1. Endocytosis Endocytosis motifs motifs in in herpesvirus herpesvirus gH gH homologs. homologs.

(arrowhead). (arrowhead).

micrograph micrograph also also shows shows one one virion virion in in the the final final stage stage of of egress egress at at the the cell cell surface surface

micrograph micrograph shows shows a a cytosolic cytosolic vacuole vacuole with with four four enveloped enveloped virions virions (arrow). (arrow). The The

Figure Figure 5. 5. Egress Egress and and exocytosis exocytosis of of virions virions from from a a cytosolic cytosolic vacuole. vacuole. This This electron electron

plasma plasma membrane, membrane, exposing exposing the the virions virions on on the the surface surface of of the the cell. cell. See See figure figure also. also. 5 5

vesicular vesicular organelles organelles (vacuoles) (vacuoles) containing containing several several virions; virions; these these vacuoles vacuoles fuse fuse with with the the

with with viral viral glycoproteins. glycoproteins. In In turn, turn, individual individual TON-derived TON-derived vesicles vesicles appear appear to to form form multi­

capsids capsids (hexagons) (hexagons) bud bud into into the the TGN, TGN, forming forming a a viral viral envelope envelope of of membranes membranes enriched enriched

mediated mediated by by GGA GGA proteins proteins and and AP-1 AP-1 or or from from the the TGN TGN to to late late endosomes endosomes by by AP-3. AP-3. VZV VZV

TIP47 TIP47 may may also also occur. occur. Anterograde Anterograde transport transport from from the the TGN TGN to to early early endosomes endosomes is is

intermediate intermediate endosomes endosomes (IE) (IE) via via the the retromer retromer complex complex or or from from late late endosomes endosomes (LE) (LE) via via

(EE) (EE) via via P P ACS-1 ACS-1 and and AP-1. AP-1. In In addition, addition, transport transport through through sorting sorting pathways pathways from from

transport transport from from the the early early endos6mes endos6mes (EE) (EE) to to the the TGN TGN may may occur occur from from early early endosomes endosomes

envelopment envelopment occurs. occurs. As As reported reported for for HCMV HCMV gB gB (Crump (Crump et et al., al., 2003), 2003), retrograde retrograde

(triangles) (triangles) may may follow follow several several late late secretory secretory trafficking trafficking pathways pathways to to the the TGN, TGN, where where viral viral

Figure Figure 4. 4. Endosomal Endosomal trafficking trafficking of of the the VZV VZV glycoproteins. glycoproteins. VZV VZV glycoproteins glycoproteins

Appendix Appendix VZV VZV A. A. Review Review Appendix A. VZV review to be functional. See reference by Pasieka et al (2003) for greater dedomain and accession numbers. S=simian; F=feline; B=bovine; and E=equine herpesvirus

171

172 172

Figure Figure 1 1

E--+1 E--+1 Old Old alignment alignment * *

G G E E

0 0 I I 4. 4. Cyclin Cyclin dependent dependent kinase kinase site site

s s

p p

3. 3. & & CK CK I I II II Sites Sites

T T

Q Q

2. 2. Trans-Golgi Trans-Golgi N N 0 0

T T

T T 1. 1. Endocytosis Endocytosis

E E A A

N N p p

s s 598YI~E 598YI~E

p p

v v 0 0

E E K K

I I

3 3

I I

N N E E

E E

J19~L J19~L

.s .s

___. ___. E E s s F F A A (868)* (868)*

v v E E G G G G 911 911 F F 128 128 M M A A

v v F F N N .S .S G G A A I I 593 593

p p

0 0 0 0 A A 0 0 0 0 I I T T

s s v v E E I I M M A A p p

F F 0 0 G G G G E E N N Q Q

0 0 K K G G E E L L E E p p

s s

0 0 F F T T A A T T

p p 860)* 860)*

v v I I H H R R 338 338 L L A A R R (857-

2 2

E E G G

Y.. Y.. 923 923 N N I I p p

Q Q

l l R R 585 585

A A G G

K K R R Q Q

.s .s 1 1

~ ~

1 1 s s

L L I I E E

Q Q yr~ yr~

582r 582r

s s E E G G G G E E

.s .s

J4J J4J M M

K K R R G G

y y

4 4 e e

I I T T T T R R fr~ fr~ y y

821)*R 821)*R

v v M M T T T T K K (818- R R

s s T T y_ y_ 141 141 L L H H K K N N 881 881

y y

M M R R s s I I L L T T Q Q p p

1 1

lrMA I lrMA L L

v v N N 0 0

N N p p y y

L L

818 818

v v K K

L L

y y p p

v v : : 1 1 T T

A A R R L L N N p p

1 1

s s s s

R R K K G G 623 623 y y p p n5 n5 y y

K K A A M M F F I I T T

D D v v A A

E E L L

p p p p

Y.. Y..

570 570

s s E E R R H K K H R R JS4 JS4

~ ~ s s 2 2 842)* 842)* R R L L T T K K

~7r ~7r

T T (841-

K K R R K K

Q Q

t t ~ ~

1,85 1,85

s s E E L L I I

s s K K K K N N R R

A A 914 914

v v K K G G L L R R

c c v v s s R R A A R R

R R M M K K L L T T

y y

v v R R K K M M R R K K

s s 561 561 K K w w 187 187 y y K--+ K--+ N N 296 296 824 824

gE gE gH gH gl gl gB gB

Appendix Appendix A. A. VZV VZV Review Review Appendix A. VZV review

Figure 2

173

174 174

3 3 Figure Figure

5h 5h timepoin1 timepoin1

*' *' '+ '+ GSH GSH

...... 46 46

gl gl +-

band band

Virion Virion

...... 97 97

gE gE ...-

...... 220 220

- , _ C C kDa kDa

1 2 2 1

H B B B B H Antibody Antibody E E E E I I E B H H H H H H B E

46 46 ......

97 97 ......

220 220 ......

. . - - -

_._---. _._---. --' .,..___------~ ..-

A A

1 2 3 3 2 1 11 11 10 10 7 8 9 9 8 7 kDa kDa 4 5 6 6 5 4

Review Review VZV VZV A. A. Appendix Appendix Appendix A. VZV review

AP-3

TIP47

Released Virion

Figure 4

175 9LI Appendix A. VZV review

Table 1. Endocytosis motifs in herpesvirus gH homologs

Virus Tail length Motif in cytosolic tail

HSV-1 14 KVLRTSVPFFWRRE (None predicted)

HSV-2 14 RVVRTCVPFLWRRE (None predicted)

vzv 18 WMLCGNSRLREYNKIPLT (Realigned)

svv 18 WMLCGSPRNIEYTAVPL V (Realigned)

PRY 19 KMLCSFSSEGYSRLINARS

FHV-1 17 KMLCSFTPDVRYTLLNN

BHV-1 19 KMLCSSVPLARGYSSVPVF

BHV-5 19 KMLCSSVPIARGYSAVPAF

EHV-1 19 KMLCGGVTNDGYKLLLSYE

EHV-4 19 KMLCGGVINNDYSLLLNSE

177

178 178

manuscript. manuscript. the the writing in in assisted assisted

I I and and 5A, 5A, Figure Figure in in experiments experiments labeling labeling metabolic metabolic the the performed performed I I appendix appendix this this In In

thomas~:@ohsu.edu thomas~:@ohsu.edu

Email: Email: 503-494-1218; 503-494-1218; fax. fax. 503-494-6955; 503-494-6955; tel. tel. 97239; 97239; OR OR Portland, Portland, Road, Road, Park Park Jackson Jackson

Sam Sam SW SW

3181 3181 OHSU, OHSU, Institute, Institute,

Vollum Vollum Thomas, Thomas, Gary Gary Dr. Dr. to: to: correspondence correspondence Address Address

4

activation activation Furin Furin Title: Title: Running Running

1Z3 1Z3 V6T V6T

Canada Canada BC, BC, Vancouver, Vancouver, Columbia, Columbia, British British of of University University Immunology, Immunology, and and Microbiology Microbiology

of of

Department Department and and 06560, 06560, France France Valbonne, Valbonne, Cellulaire, Cellulaire, et et Moleculaire Moleculaire Pharmacologie Pharmacologie

3

de de

Institut Institut USA, USA, 97239, 97239, OR OR Portland, Portland, University, University, Science Science Health Health & & Oregon Oregon

2

Biology, Biology, Molecular Molecular and and Biochemistry Biochemistry of of 'Department 'Department and and Institute, Institute, Vollum Vollum the the From From

Thomas Gary Gary and and

4 4

Shinde

Ujwal Ujwal Jean

Franc;;ois Franc;;ois Molloy, Molloy, S. S. Sean Sean Hung, Hung, , ,

Chien-Hui Chien-Hui

Subbian , ,

1 1 3

1

Ezhilkani Ezhilkani

Scott, Scott, K. K. Gregory Gregory Thomas, Thomas, Laurel Laurel Feliciangeli F. F. Sylvain Sylvain , ,

2

ACTIVATION ACTIVATION ENZYME ENZYME REGULATES REGULATES THAT THAT PROPEPTIDE PROPEPTIDE

FURIN FURIN THE THE IN IN SENSOR SENSOR PH PH A A OF OF IDENTIFICATION IDENTIFICATION

APPENDIXB APPENDIXB

Activation Activation Furin Furin B. B. Appendix Appendix Appendix B. Furin Activation

Abstract

The folding and activation of furin occurs through two pH- and compartment-specific autoproteolytic steps. In the ER, profurin folds under the guidance of its prodomain and undergoes an autoproteolytic excision at the consensus furin site Arg-Thr-Lys-Arg,07 ~, generating an enzymatically masked furin•propeptide complex competent for transport to late secretory compartments. In the mildly acidic environment of the TGN/endosomal

system, the bound propeptide is cleaved at the internal site His69-Arg-Gly-Val-Thr-Lys­

Arg75 ~, unmasking active furin capable of cleaving substrates in trans. Here using cellular, biochemical, and modeling studies we demonstrate that the conserved His69 is a pH sensor that regulates the compartment-specific cleavages of the propeptide. In the ER,

unprotonated His69 stabilizes a solvent-accessible hydrophobic pocket necessary for

autoproteolytic excision at Arg 107 . Profurin molecules unable to form the hydrophobic

pocket, and hence, the furin•propeptide complex, are restricted to the ER by a PACS-2-

and COPI-dependent mechanism. Once exposed to the acidic pH of the late secretory

pathway, protonated His69 disrupts the hydrophobic pocket, resulting in exposure and

cleavage of the internal cleavage site at Arg75 to unmask the enzyme. Together, our data

explain the pH-regulated activation of furin, and how this His-dependent regulatory

mechanism is a model for other proteins.

179

180 180

positively positively charged charged residues residues at at P6 P6 or or possibly possibly adjacent adjacent amino amino acids, acids, demonstrating demonstrating the the

at at acidic acidic pH pH the the absence absence of of a a P2 P2 or or P4 P4 Arg Arg can can be be compensated compensated for for by by the the presence presence of of

the the P2 P2 Arg Arg has has a a modulatory modulatory role role (Krysan (Krysan et et al., al., 1999; 1999; Rockwell Rockwell et et al., al., 2002). 2002). However, However,

and and P4 P4 Arg Arg residues residues are are required required for for the the efficient efficient processing processing of of furin furin substrates substrates whereas whereas

consensus consensus site site -Arg-X-Lys/Arg-Arg-~ -Arg-X-Lys/Arg-Arg-~ (Thomas (Thomas 2002). 2002). Kinetic Kinetic studies studies show show that that the the P1 P1

furin furin cleavage cleavage sites. sites. Furin Furin efficiently efficiently cleaves cleaves a a number number of of proprotein proprotein substrates substrates at at the the

changes changes in in the the conformation conformation of of furin furin substrates substrates as as well well as as the the utilization utilization of of pH-sensitive pH-sensitive

compartment-specific compartment-specific processing processing by by furin furin is is mediated mediated in in part part by by the the pH-dependent pH-dependent

(TGN)/endosomal (TGN)/endosomal system system is is compartment- and and hence, hence, pH-specific pH-specific (2,6). (2,6). This This

substrates substrates by by the the ubiquitously ubiquitously expressed expressed PC PC furin furin in in the the trans-Golgi trans-Golgi network network

1999; 1999; Zhou Zhou and and Lindberg, Lindberg, 1993), 1993), whereas whereas the the proteolytic proteolytic activation activation of of proprotein proprotein

requires requires the the acidic acidic pH pH of of maturing maturing secretory secretory granules granules (Rhodes (Rhodes et et al., al., 1993; 1993; Zhou Zhou et et al., al.,

proteolytic proteolytic maturation maturation of of prohormones prohormones by by the the neuroendocrine-specific neuroendocrine-specific PC1/3 PC1/3 and and PC2 PC2

posttranslational posttranslational modifications modifications to to gain gain full full bioactivity bioactivity (Steiner, (Steiner, 1998; 1998; Thomas Thomas 2002). 2002). The The

bioactive bioactive proteins proteins as as well well as as hormonal hormonal processing processing intermediates intermediates that that require require additional additional

and and prohormones prohormones at at doublets doublets or or clusters clusters of of basic basic amino amino acids acids thus thus generating generating mature mature

(PCs). (PCs). The The PCs, PCs, a a family family of of calcium-dependent calcium-dependent serine serine endoproteases, endoproteases, cleave cleave proproteins proproteins

including including the the processing processing of of piohormones piohormones and and proproteins proproteins by by proprotein proprotein convertases convertases

regulation regulation of of protein protein traffic traffic to to the the control control of of protein protein conformation conformation and and enzyme enzyme activities, activities,

secretory and and secretory endocytic endocytic pathways pathways has has essential essential and and manifold manifold roles roles ranging ranging from from the the

The The pH pH gradient gradient formed formed by by the the various various membranous membranous compartments compartments comprising comprising the the

Introduction Introduction

Appendix Appendix B. B. Furin Furin Activation Activation Appendix B. Furin Activation relevance of pH for furin-dependant processing (Bergeron et al., 2003; Degnin et al.,

2004; Henrich et al., 2003; Rockwell et al., 2002; Rockwell and Thorner, 2004).

The pH-dependent processing of furin substrates by selective cleavage site utilization is exemplified by the autoproteolytic cleavages of its cognate prodomain. During transit from the pH neutral ER to the acidic TGN/endosomal system, the ordered and compartment-specific furin prodomain processing guides the folding of the inactive proenzyme to the mature, active endoprotease. Similar to the evolutionarily related bacterial subtilisins, the 83-amino acid furin prodomain is necessary to correctly fold the catalytic domain in the ER (Anderson et al., 2002; Zhou et al., 1995). The folded catalytic

domain then rapidly (t 112 < 10 min) excises the prodomain at the canonical P1/P4 Arg furin cleavage site -Arg-Thr-Lys-Arg 107 ~, generating a transport competent furin•propeptide complex. Inhibition of this excision step blocks transport of profurin molecules from the ER, suggesting that components of the cellular trafficking machinery detect formation of the furin•propeptide complex before directing their transit to late secretory pathway compartments (Anderson et al., 2002). However, the machinery that localizes profurin to the ER is unknown. We identified P ACS-1, which is a cytosolic sorting protein that connects the CK2-phosphorylated furin cytosolic domain to AP-I, thereby localizing the endoprotease to the TGN (Crumpet al., 2001; Wan et al., 1998).

Recently, we discovered PACS-2, which localizes membrane cargo to the ER by connecting them to COPI (Kottgen et al., 2005). But whether PACS-2 binds to furin or mediates ER trafficking of profurin is unknown.

181

182 182

sensor sensor controlling controlling furin furin activation. activation. Protonation Protonation of of the the histidine histidine imidazole imidazole ring, ring, which which has has

enzyme enzyme activation activation suggests suggests a a role role for for one one or or more more histidine histidine residues residues to to serve serve as as a a pH pH

The The requirement requirement for for exposure exposure of of the the furin•propeptide furin•propeptide complex complex to to pH pH 6 6 to to complete complete

a a pH pH sensor. sensor.

and and activation activation of of the the endoprotease endoprotease and and that that this this activation activation process process could could be be controlled controlled by by

compartment-specific compartment-specific cleavages cleavages of of the the furin furin propeptide propeptide are are necessary necessary to to guide guide the the folding folding

in in the the ER ER (Anderson (Anderson et et al., al., 2002). 2002). Together, Together, these these studies studies suggest suggest that that the the ordered, ordered,

fails fails to to yield yield mature, mature, active active furin furin but but instead instead causes causes the the accumulation accumulation of of inactive profurin profurin inactive

Surprisingly, Surprisingly, mutation mutation of of the the P1/P6 P1/P6 Arg Arg cleavage cleavage site site to to a a canonical canonical P1/P4 P1/P4 Arg Arg furin furin site site

of of the the two two prodomain prodomain cleavage cleavage sites sites (Anderson (Anderson et et al., al., 2002; 2002; Anderson Anderson et et al., al., 1997). 1997).

optimally optimally at at pH pH 6.0, 6.0, the the pH pH of of the the TGN, TGN, demonstrating demonstrating the the differential differential pH pH requirements requirements

2005). 2005). In In vitro vitro studies studies of of furin furin show show that that the the internal internal propeptide propeptide cleavage cleavage occurs occurs

bacterial bacterial and and human human subtilisin-like subtilisin-like proteases proteases (Anderson (Anderson et et al., al., 2002; 2002; Subbian Subbian et et al., al.,

Anderson Anderson et et al., al., 1997). 1997). This This second-site second-site cleavage cleavage is is rate-limiting rate-limiting for for activation activation of of

and and unmasking unmasking active active furin furin capable capable of of cleaving cleaving substrates substrates in in trans trans (Anderson (Anderson et et al., al., 2002; 2002;

Gly-Val-Thr-Lys-Arg75~ Gly-Val-Thr-Lys-Arg75~ internal internal cleavage cleavage site, site, thus thus releasing releasing the the propeptide propeptide fragments fragments

112 associated associated propeptide propeptide undergoes undergoes a a second, second, slow slow cleavage cleavage (t 90 90 min) min) at at the the His-Arg­ -

acidic acidic TGN/endosomal TGN/endosomal system system (Anderson (Anderson et et al., al., 1997). 1997). There, There, the the non-covalently non-covalently

enzyme enzyme requires requires trafficking trafficking of of the the furin•propeptide furin•propeptide complex complex from from the the ER ER to to the the mildly mildly

14 14 nM nM (Anderson (Anderson et et al., al., 1997)). 1997)). Release Release of of the the autoinhibitory autoinhibitory propeptide propeptide from from the the

5 5

0 = = towards towards substrates substrates in in trans trans because because the the bound bound propeptide propeptide is is a a potent potent furin furin inhibitor inhibitor (K .

Despite Despite formation formation of of the the catalytic catalytic center, center, the the furin•propeptide furin•propeptide complex complex remains remains inactive inactive

Appendix Appendix Furin Furin Activation Activation B. B. Appendix B. Furin Activation a pKa of 6.0, has profound effects on histidine chemistry under physiological conditions

(Zamyatnin, 1984). While no pH sensor has been described for processing enzymes, such a role for histidine is well established for generating allosteric changes, including control

and the pH­ of 0 2/C02 exchange by hemoglobin, gating of electrogenic molecules, dependent conformational changes within class II MHC molecules that promote ligand exchange (Baukrowitz et al., 1999; Jensen, 2004; Rotzschke et al., 2002; Wiebe et al.,

2001).

Using mutants that mimic the protonation state of histidine and through molecular

modeling analysis we report the role of His69 in the folding and activation of furin. Our

results demonstrate that the protonation state of His69, which is located in a solvent­ accessible hydrophobic pocket, plays a critical role in regulating the secondary propeptide cleavage. Mutations that interfere with the His69 block propeptide excision, resulting in ER accumulation of profurin by a mechanism that requires the cytosolic sorting protein PACS-2 and COPI. Following propeptide excision, the furin•propeptide complex traffics to the mildly acidic TGN/endosomal system where protonation of His69 disrupts the solvent-accessible hydrophobic pocket to expose the Pl/P6 Arg internal cleavage site His-Arg-Gly-Val-Thr-Lys-Arg 75 ~, leading to release of the inhibitory propeptide and furin activation.

Experimental Procedures

Antibodies and reagents-Reagents were from Sigma except where stated. Antibodies against PACS-2 (Simmen et al., 2005), FLAG (M1 and M2; Sigma), HA (HA.11;

183

184 184

immunoprecipitated immunoprecipitated with with mAb mAb M1 M1 (100 (100 !lg/ml), !lg/ml), captured captured with with protein protein A A sepharose, sepharose, and and

2 deoxycholate, deoxycholate, 1% 1% NP-40) NP-40) containing containing 1 mM mM 1 CaC1 FLAG-tagged FLAG-tagged furin furin constructs constructs were were • •

indicated indicated time time points points in in mRIPA mRIPA buffer buffer (150 (150 mM mM NaCl, NaCl, 50 50 mM mM Tris, Tris, pH pH 8.0, 8.0, 1% 1%

MEM MEM containing containing an an excess excess of of cold cold arginine arginine and and leucine leucine for for 20 20 min, min, harvested harvested at at the the

Arg/Leu-MEM Arg/Leu-MEM (Gibco) (Gibco) for for 30 30 min. min. The The cells cells were were then then incubated incubated at at 37°C 37°C with with complete complete

(m.o.i.=5) (m.o.i.=5) for for 3 3 hours hours (h), (h), labeled labeled with with eH]-arginine eH]-arginine and and [ H]-leucine H]-leucine (100 (100 !lCi !lCi each) each) in in

3

40 40 cells cells grown grown in in 35mm 35mm dishes dishes were were infected infected with with the the indicated indicated VV VV recombinants recombinants

Pulse-chase Pulse-chase analysis-Pulse-chase analysis-Pulse-chase analysis analysis was was performed performed as as described described [5]. [5]. Briefly, Briefly, BSC-

constructed constructed using using previously previously described described methods methods (Anderson (Anderson et et al., al., 1997) 1997) . .

subcloned subcloned into into pZVneo pZVneo fur/f/ha fur/f/ha and and fur/f/halltc-k. fur/f/halltc-k. Vaccinia Vaccinia virus virus recombinants recombinants were were

H69K:fur/f/ha, H69K:fur/f/ha, and and H69K:fur/f/halltc-k H69K:fur/f/halltc-k were were generated generated using using standard standard PCR PCR methods methods and and

expressing expressing H66L:fur/f/ha, H66L:fur/f/ha, H66L:fur/f/halltc-k, H66L:fur/f/halltc-k, H69L:fur/f/ha, H69L:fur/f/ha, H69L:fur/f/halltc-k, H69L:fur/f/halltc-k,

as as previously previously described described (Anderson (Anderson et et al., al., 2002; 2002; Anderson Anderson et et al., al., 1997). 1997). VV VV recombinants recombinants

viruses viruses (VV) (VV) expressing expressing fur/f/ha, fur/f/ha, fur/f/halltc-k, fur/f/halltc-k, and and R75A:fur/f/halltc-k R75A:fur/f/halltc-k were were generated generated

!lglml !lglml gentamycin gentamycin as as described described (Anderson (Anderson et et al., al., 2002; 2002; Anderson Anderson et et al., al., 1997). 1997). Vaccinia Vaccinia

in in minimal minimal essential essential medium medium (MEM; (MEM; Cellgro) Cellgro) containing containing 10% 10% fetal fetal bovine bovine serum serum and and 25 25

Cell Cell culture, culture, DNA DNA constructs, constructs, and and virus virus construction-A construction-A 7 7 and and BSC-40 BSC-40 cells cells were were cultured cultured

described described or or provided provided as as indicated. indicated.

(Molecular (Molecular Probes) Probes) and and HRP-conjugated HRP-conjugated secondary secondary antibodies antibodies (Southern (Southern Biotech) Biotech) were were

furin furin (PA-062, (PA-062, ABR), ABR), as as well well as as Alexa Alexa (546 (546 and and 488)-conjugated 488)-conjugated secondary secondary antibodies antibodies

Covance) Covance) (Abeam), (Abeam), a-tubulin a-tubulin (Calbiochem), (Calbiochem), TGN46 TGN46 ~-COP ~-COP (Serotec), (Serotec), POI POI Sitia), Sitia), (R. (R.

Appendix Appendix Furin Furin Activation Activation B. B. Appendix B. Furin Activation bound proteins were then separated by 15% Tris-Glycine SDS-PAGE and detected by autoradiography as described (Anderson et al., 1997).

Metabolic labeling-A 7 cells were infected with VV expressing the indicated furin constructs (m.o.i. =3) for 12h, washed and incubated with phosphate-free MEM for 1h

after which 0.5 mCi/ml 32Pi (NEN) was added for 2h. The labeled cells were washed with

PBS and lysed in mRIPA with 50 mM NaF, 0.1 !J,M orthovanadate, 10 !J,M Pepstatin-A,

10 !J,M leupeptin, 1 !J,M E64, 50 !J,g/ml aprotinin, 500 !J,M PMSF and 1 mM CaC1 2•

FLAG-tagged furin proteins were immunoprecipitated with mAb M2, separated by SDS­

PAGE, transferred to nitrocellulose and analyzed by autoradiography and western blot.

Furin activity assays-To assay 11 tc-k constructs, high-speed cellular membrane

preparations from BSC-40 cells infected with the indicated VV recombinants (m.o.i.=2) for 14h were prepared as described (Anderson et al., 1997). The membrane samples were

incubated in activation buffer (10 mM Bis-Tris, 5 mM CaC12, 1 mM 2-mercaptoethanol,

500 !J,M PMSF, 10 JiM Pepstatin-A, 20 JiM E64, 50 Jlg/ml aprotinin, pH 6.0 or 7.5 as indicated) at 30°C either for 3h (at pH 6.0 and 7.5), or at pH 7.5 for 1h in the presence of

trypsin (0.83 nM) followed by a 15 min incubation with soybean trypsin inhibitor (2.5

!J,M). Fluorometric assays of furin activity were performed with Abz­

RVKRGLAY(N02)D-OH furin substrate (Bachem) using a FluoroMax-2

spectrofluorometer equipped with a 96-well plate reader (Anderson et al., 1997). To

assay Fur/f/ha constructs, membrane preparations from BSC-40 cells expressing the

indicated constructs were prepared and furin activity was assayed in 100 mM HEPES, pH

185

186 186

pH pH 6.0 6.0 or or 7.5 7.5 for for 3h 3h at at 30°C, 30°C, separated separated by by 15% 15% Tris-Tricine Tris-Tricine SDS-PAGE, SDS-PAGE, transferred transferred to to

To To detect detect the the propeptide, propeptide, crude crude membrane membrane extracts extracts were were incubated incubated in in activation activation buffer buffer at at

8% 8% Tris-Glycine Tris-Glycine SDS-PAGE, SDS-PAGE, transferred transferred to to nitrocellulose, nitrocellulose, and and analyzed analyzed by by western western blot. blot.

constructs constructs (m.o.i=2) (m.o.i=2) for for 14h, 14h, and and harvested harvested in in mRIPA. mRIPA. The The samples samples were were separated separated by by

/mmunoblotting-BSC-40 /mmunoblotting-BSC-40 cells cells were were infected infected with with VV VV expressing expressing the the indicated indicated furin furin

respective respective Km Km values. values.

inhibition inhibition for for any any of of the the fluorogenic fluorogenic peptides peptides at at concentrations concentrations 10-fold 10-fold greater greater than than their their

using using a a computer-assisted computer-assisted algorithm algorithm (Enzfitter). (Enzfitter). Control Control studies studies showed showed no no substrate substrate

and and an an emission emission wavelength wavelength set set at at 425 425 nm. nm. The The values values of of Km Km and and V V were were determined determined max max

with with a a 96-well 96-well plate plate reader reader (Instrument (Instrument SA) SA) using using an an excitation excitation wavelength wavelength set set at at 320 320 nm nm

Fluorescence Fluorescence measurements measurements were were made made with with a a FluoroMax-2 FluoroMax-2 spectrofluorometer spectrofluorometer equipped equipped

were were performed performed in in duplicate duplicate and and the the average average values values are are reported reported (relative (relative error, error, <11% <11% ). ).

fluorogenic fluorogenic peptide peptide substrate substrate (corrected (corrected for for peptide peptide content) content) for for up up to to 30 30 min. min. All All assays assays

determination determination of of kinetic kinetic constants constants were were conducted conducted with with increasing increasing concentrations concentrations of of

2 bis-Tris/100 bis-Tris/100 mM mM sodium sodium acetate acetate (pH (pH 6.0 6.0 or or 7.5) 7.5) with with 1 1 CaC1 Incubations Incubations mM mM for for the the • •

Briefly, Briefly, each each fluorogenic fluorogenic substrate substrate was was incubated incubated with with purified, soluble soluble purified, furin furin in in 100 100 mM mM

substrate substrate was was prepared, prepared, characterized, characterized, and and assayed assayed as as described described (Anderson (Anderson et et al., al., 2002). 2002).

Fluorometric Fluorometric assays assays of of internally internally quenched quenched peptide peptide substrates-Each substrates-Each fluorogenic fluorogenic peptide peptide

(Anderson (Anderson et et al., al., 2002). 2002).

2 2 2 7.5, 7.5, 1 mM mM 1 CaC1 using using the the Abz-RVKRGLAY(N0 )D-OH )D-OH peptide peptide as as described described

Appendix Appendix B. B. Furin Furin Activation Activation Appendix B. Furin Activation nitrocellulose for 30 min at 36V and analyzed by western blot with mAb HA.11 as described (Anderson et al., 2002).

Immunofluorescence-BSC-40 cells were grown to 50-80% confluency on glass coverslips. After infection with the indicated VV recombinants (m.o.i.=5, 5h), cells were fixed with 4% paraformaldehyde and immunofluorescence analysis performed as described (Molloy et al., 1994 ). For the siRNA experiments, A 7 cells were transfected with control (scr.), PACS-2 (24) or ~-COP (CAACUCCAGAUGGGAGACU) siRNA as described (Simmen et al., 2005). After 48h, the cells were infected with recombinant VV for an additional 4 hr. The cells were fixed, permeabilized, and incubated with the indicated primary antisera followed by incubation with species- and subtype-specific fluorescently labeled secondary antisera. Images were then captured using a Zeiss axioplan 2 microscope with a 63X immersion objective and processed with the NIH image 1.62 program.

Sequence analysis and homology modeling-Multiple sequence alignments of the mammalian PC sequences obtained from the Expasy server were aligned with ClustalW using default parameters. The alignments were then optimized manually using GeneDoc and the model of the furin propeptide was built using the alignment interface of

SwissModel, which predicts structures reliably with· a root mean square deviation

(RMSD) <2A for sequences with 50-60% identity (Schwede et al., 2003) and with the solution structure of the PC1 propeptide (1KN6) as a template. The modeled structure was minimized in the SwissPDB Viewer package using 10,000 steps of steepest descent

187 Appendix B. Furin Activation with the Gromos96 43B 1 parameter set in vacuo and with a dielectric constant of 1. The model was further validated and manually checked for bad conformations and clashes by

Whatcheck and ANOLEA software packages, and minimization procedures were repeated as necessary. The minimized model has an RMSD of 1A from that of the propeptide ofPC1 (PDB ID:1KN6).

The furin propeptide was docked onto the crystal structure of the mouse furin catalytic domain ((Henrich et al., 2003) PDB ID:IP8J) using the homologous bacterial protease­ propeptide (PDB ID:1SCJ) complex (Jain et al., 1998) as template. The x-ray structure of the bacterial homologue depicts a side-on interaction between the propeptide and protease domains that appears to be conserved throughout the subtilase family. Using this as a template the propeptide was docked onto the x-ray structure of furin. Side-chain clashes and deformations were then manually corrected using more favorable rotamers using Insightll. The docked structure was subsequently energy- minimized with

CHARMm22 as the force-field, initially using 10,000 steps of steepest descent followed by 10,000 steps of the Newton Rahpson's algorithm in the CHARMm module of

Insightll.

Results

Analysis of the furin propeptide revealed two histidine residues adjacent to the internal

cleavage site and which are either strictly (His69) or partially (His66) conserved within all

PC family members (Fig. 1a). To ascertain whether one or both of these histidine residues may be spatially arranged to affect the pH-dependent activation of furin, we undertook a

188 Appendix B. Furin Activation structural analysis of the propeptide•furin complex using homology modeling (Schwede et al., 2003). The propeptide of furin was modeled using the solution structure of mouse

PC1 propeptide (Tangrea et al., 2001), and docked onto the catalytic domain of furin using information from the structures of the propeptide•subtilisin E complex and prokumamolysin, a serine carboxyl protease containing a subtilisin-like fold (Fig. 1 band c; Comellas-Bigler et al., 2004; Jain et al., 1998). The correctness and accuracy of structures predicted using homology modeling is determined by the quality of the sequence alignment and the identity of the template, which as evident from Figure 1a, is high. The models were then refined and validated using approaches described earlier

(Subbian et al., 2004). The internal cleavage site maps onto a loop between strands ~3 and a3 and is part of a distinct hydrophobic pocket on the surface of the propeptide abutting the catalytic domain (Fig. 1c and d). Although the cleavage site lies in a surface

loop, close examination revealed that the conserved P7 His69 is buried at the center of a

well-formed hydrophobic pocket. This pocket is lined by non-polar residues, Gly53 , Leu55.

and aromatic residues, Phe54 , Phe67, and Trp68 (Fig. 1d). By contrast, the P9 His66 mapped to the interface between the propeptide and the mature enzyme. In the homologous bacterial subtilisins the interface between the propeptide and mature domains is dynamic with a relatively high average B factor (Jain et al., 1998) and increasing these dynamics can decrease rates of autoprocessing (Inouye et al., 2001). Further, studies have established that modulating the propeptide binding to this interface by varying solvent conditions prolongs its release and hence the activation of the mature protease suggesting that this interface would be solvent-accessible (Subbian et al., 2005). Therefore, our

modeling analysis predicted that protonation of the His69 located in a hydrophobic pocket

189

190 190

107 107 constructs constructs The The 2a). 2a). (Fig. (Fig. Arg at at propeptide propeptide the the of of excision excision autoproteolytic autoproteolytic following following

furin furin mature mature recognizes recognizes only only therefore therefore and and theN-terminus theN-terminus at at tag tag FLAG FLAG the the of of exposure exposure

requires requires Ml Ml mAb mAb Alternatively, Alternatively, furin. furin. mature mature and and profurin profurin detects detects which which M2, M2, mAb mAb

anti-FLAG anti-FLAG the the by by recognized recognized is is epitope epitope FLAG FLAG The The domain. domain. catalytic catalytic the the of of terminus terminus

N­ and and

propeptide propeptide the the of of

C-terminus C-terminus the the between between 107 epitope epitope FLAG FLAG a a inserted inserted we we Arg , ,

at at excision excision propeptide propeptide 75 75 monitor monitor To To 2002). 2002). al., al., et et (Anderson (Anderson Arg at at cleavage cleavage propeptide propeptide

internal internal second second the the

undergoing undergoing from from blocked blocked are are but but complex, complex, furin•propeptide furin•propeptide

107 107 a a form form to to Arg at at excision excision propeptide propeptide first first the the undergo undergo to to able able are are they they where where

ER ER the the of of environment environment pH pH neutral neutral the the to to reporters reporters furin furin the the restricts restricts motif motif KDEL KDEL The The

constructs). constructs). .Mc-k .Mc-k as as to to referred referred 2a, 2a, (Fig. (Fig. motif motif localization localization ER ER (KDEL) (KDEL) Asp-Glu-Leu Asp-Glu-Leu

-Lys­ lumenal lumenal the the by by replaced replaced were were domains domains cytosolic cytosolic and and transmembrane transmembrane the the which which in in

constructs constructs profurin profurin ER-localized ER-localized using using variant variant each each assayed assayed We We 2002). 2002). al., al., et et (Anderson (Anderson

complex complex furin•propeptide furin•propeptide the the of of export export ER ER or or excision excision propeptide propeptide not not but but activation activation

profurin profurin blocks blocks which which site, site,

cleavage cleavage internal internal the the of of position position PI PI the the at at substitution substitution

75

-Ala -Ala Arg an an contains contains that that construct construct profurin profurin a a expressed expressed we we control, control, a a As As ld). ld). (Fig. (Fig.

pocket pocket hydrophobic hydrophobic propeptide propeptide the the of of formation formation block block would would predicted predicted analysis analysis modeling modeling

the the which which residue residue histidine histidine 69 protonated protonated constitutively constitutively a a mimics mimics that that -Lys -Lys His variant variant

profurin profurin

a a tested tested also also We We

69

activation. activation. undergo undergo 66 to to substitution substitution Leu Leu His or or Leu Leu His - -

a a containing containing profurin mutants mutants profurin of of ability ability the the measured measured we we vitro vitro in in step step activation activation

profurin profurin pH-dependent pH-dependent the the

for for residues residues histidine histidine two two the the of of importance importance the the test test To To

66 His accessible accessible solvent solvent • •

the the

of of protonation protonation unlike unlike propeptide propeptide the the of of structure structure the the on on affects affects dramatic dramatic have have could could

Activation Activation Furin Furin B. B. Appendix Appendix Appendix B. Furin Activation also contain an HA epitope tag in the propeptide to monitor the fate of this domain.

Insertion of these epitope tags has no effect on the activation, activity, or the trafficking offurin (Anderson et al., 1997; Molloy et al., 1994).

Western blot analysis of extracts from cells expressing each reporter construct revealed a prominent doublet of profurin (mAb M2 positive) and mature furin (mAbs M2 and M1 positive, Fig. 2b). Ratiometric comparison of the mAb M2-crossreactive bands showed

that the Arg75 --Ala or His66--Leu substitutions had no measurable effect on propeptide

excision relative to the control (65% mature furin each). However, the His69--Leu and

His69--Lys substitutions reduced the efficiency of propeptide excision (30% and 20%

mature furin, respectively), suggesting that His69 may be essential for folding, stability or activation of the mature enzyme. The presence of mature furin in each sample enabled us to test the ability of each ER-localized reporter to be activated in vitro following pre­ incubation at pH 7.5 or 6.0 (Fig. 2c). In accordance with our previous studies (Anderson et al., 2002; Anderson et al., 1997), fur/f/ha8tc-k, which contains the native propeptide sequence (see Fig. 2a), showed no detectable furin activity above a control sample when assayed at pH 7.5 whereas pre-incubation at pH 6.0 triggered a robust increase in furin activity. This increased activity was coupled with the cleavage of the furin propeptide

(Fig. 2d) and was blocked by the furin-specific inhibitor a 1-PDX (Ki = 0.6 nM (Anderson et al., 1993; Jean et al., 1998) and data not shown), demonstrating the pH-dependent autoproteolytic cleavage of the furin propeptide to unmask the active furin endoprotease.

In addition, pretreatment of fur/f/haMc-k at pH 7.5 with trypsin to digest the bound

inhibitory propeptide also activated furin, whereas the R75A:fur/f/ha8tc-k construct,

191

192 192

of of efficiency efficiency the the in in differences differences marked marked showed showed profurin constructs constructs profurin the the of of assays assays

69

activity activity enzyme enzyme and and blot blot Western Western cells. cells. in in substitutions substitutions (H69K:fur/f/ha) (H69K:fur/f/ha) Lys Lys His -

69 or or (H69L:fur/f/ha) (H69L:fur/f/ha) Leu Leu His the the containing containing mutants mutants furin furin or or 2a) 2a) Fig. Fig. see see (fur/f/ha, (fur/f/ha, -

furin furin epitope-tagged epitope-tagged full-length full-length expressed expressed we we possibility, possibility, this this test test To To compartments. compartments.

pathway pathway secretory secretory late late in in furin furin full-length full-length of of activation activation pH-dependent pH-dependent the the in in role role essential essential

69 69 an an has has His that that suggested suggested constructs constructs reporter reporter profurin profurin ER-localized ER-localized of of analysis analysis The The

ER. ER. the the in in endoprotease endoprotease the the of of stabilization stabilization

69 and and folding folding correct correct affects affects substitution substitution Lys Lys His protonated protonated constitutively constitutively the the -

that that suggest suggest results results our our ), ), 2b 2b (Fig. (Fig. expressing expressing cells cells in in furin furin processed processed H69K:fur/f/ha~tc-k H69K:fur/f/ha~tc-k

of of formation formation inefficient inefficient extremely extremely the the with with Together Together 2c). 2c). (Fig. (Fig. trypsinolysis trypsinolysis or or pH pH acidic acidic

by by activated activated be be to to failed failed contrast, contrast, By By d). d). and and 2c 2c (Fig. (Fig. environment environment H69K:fur/f/ha~tc-k H69K:fur/f/ha~tc-k

acidic acidic an an to to unresponsive unresponsive but but folded folded correctly correctly was was H69L:fur/f/ha.Mc-k H69L:fur/f/ha.Mc-k that that demonstrating demonstrating

step, step, activation activation trypsin-mediated trypsin-mediated the the on on effect effect no no had had but but cleavage cleavage propeptide propeptide

and and activation activation furin furin trigger trigger to to pH pH acid acid of of ability ability the the blocked blocked completely completely subsite subsite P7 P7

69 the the at at substitution substitution -Leu -Leu His the the However, However, d). d). and and 2c 2c (Fig. (Fig. activation activation profurin profurin induced induced

66 66 pH­ the the in in role role essential essential an an play play not not does does His suggesting suggesting furin, furin, of of unmasking unmasking mediated mediated

trypsin­ the the on on or or release release propeptide propeptide and and activation activation pH-triggered pH-triggered the the on on effect effect no no had had

66 substitution substitution -Leu -Leu His the the that that found found we we sequence, sequence, propeptide propeptide native native the the Like Like pH. pH. acid acid

to to complex complex furin•propeptide furin•propeptide the the of of sensitivity sensitivity blocked blocked but but domain domain catalytic catalytic the the of of folding folding

75 the the on on effect effect no no had had substitution substitution Ala Ala Arg the the that that demonstrates demonstrates This This propeptide. propeptide. the the of of -

trypsinolysis trypsinolysis by by activated activated be be could could but but 6.0 6.0 pH pH at at pre-incubation pre-incubation by by activated activated be be to to failed failed

2002), 2002), al., al., et et (Anderson (Anderson site site internal internal the the at at cleavage cleavage propeptide propeptide undergo undergo cannot cannot which which

Activation Activation Furin Furin B. B. Appendix Appendix Appendix B. Furin Activation propeptide excision and enzyme activation (Fig. 3a). Analysis of fur/f/ha revealed a prominent doublet of equal intensity composed of profurin (mAb M2 positive) and mature furin (mAb M2 and M1 positive, Fig. 3a), which correlated with a robust increase in furin enzyme activity (Fig. 3b). H69K:fur/f/ha exhibited dramatically reduced propeptide excision and, correspondingly, enzyme activity near background levels. The near absence of mAb M1-positive mature furin in cells expressing H69K:fur/f/ha did not appear to result from instability of the mature domain as pulse-chase analysis or treatment of cells with proteosome or lysosomal hydrolase inhibitors failed to result in the generation of increased amounts of mature furin (data not shown). Consistent with the corresponding ~tc-k construct (Fig. 2), H69L:fur/f/ha underwent propeptide excision at

Arg 107 ~ but did not produce active enzyme (Fig. 3a and 3b).

The block of propeptide excision in cells expressing H69K:fur/f/ha and the lack of active furin in cells expressing H69L:fur/f/ha despite correct propeptide excision, raised the

possibility that the His69 mutations altered trafficking of these furin variants.

Immunofluorescence microscopy analysis demonstrated that both fur/f/ha and

H69L:fur/f/ha were co-localized with the TGN marker TGN46 (Fig. 4a). By contrast,

H69K:fur/f/ha remained at the ER, similar to profurin and other furin mutants unable to undergo propeptide excision (Anderson et al., 2002; Anderson et al., 1997). Our finding that the steady-state localization of H69L:fur/f/ha was at the TGN (Fig. 4a), but that this construct was enzymatically inactive (Fig. 3b ), suggested that the inhibitory propeptide remained associated with furin. To test this possibility, we incubated cells expressing fur/f/ha or H69L:fur/f/ha with eH]Arg and [3H]Leu to label the propeptide and then

193

194 194

are are molecules molecules these these whether whether examined examined we we Therefore, Therefore, 2005). 2005). al., al., et et Simmen Simmen 2005; 2005; al., al.,

et et (Kottgen (Kottgen ER ER the the domain-to domain-to cytosolic cytosolic furin furin the the on on present present that as as motifs-such motifs-such cluster cluster

acidic acidic phosphorylated phosphorylated containing containing proteins proteins membrane membrane localize localize to to COPI COPI with with combines combines

which which PACS-2, PACS-2, is is protein protein sorting sorting ER ER profurin profurin candidate candidate One One ER. ER. the the to to profurin profurin restricts restricts

that that machinery machinery sorting sorting the the identify identify to to us us enable enable would would construct construct furin furin this this that that suggested suggested

4), 4), (Fig. (Fig. ER ER the the to to restricted restricted is is and and 3) 3) (Fig. (Fig. excision excision propeptide propeptide autoproteolytic autoproteolytic efficient efficient

undergo undergo to to fails fails (13,25,33), (13,25,33), profurin profurin to to similar similar H69K:fur/f/ha, H69K:fur/f/ha, that that determination determination Our Our

system. system. TGN/endosomal TGN/endosomal the the within within furin furin

mature mature of of itinerary itinerary

trafficking trafficking regulated regulated highly highly the the on on effect effect obvious obvious no no had had mutation mutation

69

-Leu -Leu His the the that that demonstrating demonstrating region region paranuclear paranuclear the the to to Ml Ml mAb mAb internalized internalized

H69L:fur/f/ha H69L:fur/f/ha and and fur/f/ha fur/f/ha that that found found We We 4c). 4c). (Fig. (Fig. microscopy microscopy immunofluorescence immunofluorescence

for for processed processed then then and and antibody antibody the the of of internalization internalization furin-dependent furin-dependent allow allow to to

M1 M1 mAb mAb with with incubated incubated were were Cells Cells uptake. uptake. Ml Ml mAb mAb by by surface surface cell cell the the from from internalize internalize

to to H69L:fur/f/ha H69L:fur/f/ha of of ability ability the the investigated investigated we we control, control, a a As As 3). 3). (Fig. (Fig. H69L:fur/f/ha H69L:fur/f/ha

expressing expressing cells cells from from extracts extracts in in activity activity furin furin of of absence absence the the with with correlated correlated cells cells

BSC-40 BSC-40 in in furin furin mature mature 69 from from dissociate dissociate to to propeptide propeptide mutant mutant -Leu -Leu His the the for for inability inability

The The experiment. experiment. this this of of

course course hr hr 4 4 the the during during furin furin mature mature from from dissociate dissociate to to failed failed

69 propeptide propeptide mutant mutant -Leu -Leu

His the the contrast, contrast, By By 1997). 1997). al., al., et et (Anderson (Anderson studies studies earlier earlier

112 112 with with agreement agreement in in min) min) 105 105 = = (t furin furin from from slowly slowly released released propeptide propeptide native native the the that that

showed showed analysis analysis This This 4b). 4b). (Fig. (Fig. fluorography fluorography by by followed followed SDS-PAGE SDS-PAGE by by resolved resolved were were

molecules molecules propeptide propeptide co-immunoprecipitated co-immunoprecipitated and and Ml Ml mAb mAb with with immunoprecipitated immunoprecipitated

were were

proteins proteins furin furin Mature Mature times. times. chase chase increasing increasing at at cells cells the the harvested harvested

Activation Activation Furin Furin B. B. Appendix Appendix Appendix B. Furin Activation required to localize H69K:fur/f/ha to the ER. First, we used metabolic labeling studies with 32P; to show that, like furin, H69K:fur/f/ha is phosphorylated in vivo (Fig. 5a and reference 35). Second, protein-protein binding studies showed PACS-2 bound selectively to the phosphorylated furin cytosolic domain (Fig. 5b ). Third, we depleted cells of PACS-

2 and the ~-COP subunit of COPI to determine whether these proteins are required for the ER localization of H69K:fur/f/ha. Treatment of A7 cells with PACS-2 or ~-COP siRNA caused a marked reduction in their respective protein levels after 48 hr without causing cell toxicity (Fig. 5c and data not shown). In addition, depletion of either PACS2 or COPI caused H69K:fur/f/ha to redistribute from the ER to the Golgi/TGN without affecting the subcellular localization of the lumenal ER chaperone protein disulfide isomerase (PDI) under the experimental conditions used (Fig. 5d). Our finding is consistent with other studies reporting that PDI is localized to the ER by a retention­ based mechanism in addition to the canonical COPI-dependent retrieval based mechanism (Domer et al., 1990). These results suggest that PACS-2 combines with COPI to mediate the ER localization of profurin and that propeptide excision releases the furin•propeptide complex from PACS-2, allowing the mature enzyme to traffic to the

TGN/endosomal system. Moreover, these data support our model that protonation of

possibly by preventing correct His69 disrupts the hydrophobic pocket in the propeptide,

folding of the enzyme and excision of the propeptide at Arg107 •

is Our results suggest that one role for protonation of His69 in the TGN/endosomal system

to disrupt the propeptide structure, thereby promoting cleavage of the internal propeptide

of a His residue cleavage site at Arg 75 • However, recent studies suggest that protonation

195

196 196

this this

However, However, 4). 4). (Fig. (Fig. complex complex furin•propeptide furin•propeptide the the of of trafficking trafficking endosomal endosomal

the the or or

localization localization 107 107 TGN TGN the the on on nor nor 2), 2), (Fig. (Fig. Arg at at excision excision propeptide propeptide on on effect effect no no

69

had had

substitution substitution ~Leu ~Leu His non-polar non-polar a a that that show show to to assays assays activation activation furin furin cell-free cell-free and and

cellular cellular used used We We furin. furin. of of activation activation autoproteolytic autoproteolytic compartment-specific compartment-specific and and multi-step multi-step

the the

guides guides that that sensor sensor pH pH 69 69 a a as as prodomain prodomain furin furin the the in in His of of identification identification the the report report We We

Discussion Discussion

75 75

enzyme. enzyme. active active the the yield yield to to Arg at at cleavage cleavage of of efficiency efficiency the the increases increases and and site site cleavage cleavage

internal internal the the expose expose to to propeptide propeptide 69 69 the the disrupts disrupts it it role- dual dual a a has has His protonated protonated that that

and and

system system TGN/endosomal TGN/endosomal acidic acidic mildly mildly the the to to ER ER the the from from complex complex furin•propeptide furin•propeptide

the the

of of transport transport following following activation activation enzyme enzyme 69 69 allows allows that that sensor sensor pH pH a a is is His that that

suggest suggest data data our our Together, Together, 6.0. 6.0. pH pH and and 7.5 7.5 pH pH both both at at Km Km low low a a had had residue residue P7 P7 protonated protonated

constitutively constitutively a a mimics mimics which which PS-2:H69K, PS-2:H69K, contrast, contrast, By By pH. pH. of of irrespective irrespective efficiency efficiency

cleavage cleavage low low and and Km Km high high markedly markedly a a exhibited exhibited PS-2:H69L PS-2:H69L PS-2, PS-2, Unlike Unlike efficiency. efficiency.

cleavage cleavage increased increased and and Km Km lower lower 3.6-fold 3.6-fold a a with with 6.0 6.0 pH pH at at cleavage cleavage for for preference preference

a a

revealed revealed substrate substrate PS-2 PS-2 the the However, However, respectively). respectively). = = 1.62]1M, 1.62]1M, and and l.99J1M l.99J1M (Km (Km pH pH

acidic acidic and and neutral neutral both both at at Km Km low low a a exhibited exhibited substrate substrate PS-1 PS-1 The The substitutions. substitutions. 2:H69K) 2:H69K)

69

69

(PS-

~Lys ~Lys His or or

(PS-2:H69L) (PS-2:H69L) 69 69 ~Leu ~Leu His 75 the the or or (PS-2), (PS-2), His containing containing Arg at at site site i i

cleavage cleavage internal internal 107 107 propeptide propeptide the the 1), 1), Table Table (PS-1, (PS-1, ~ ~ Arg at at site site excision excision propeptide propeptide native native

the the

either either with with designed designed were were substrates substrates peptide peptide The The substrates. substrates. peptide peptide fluorogenic fluorogenic

quenched quenched internally internally using using analysis analysis

kinetic kinetic a a conducted conducted we we cleavage, cleavage, propeptide propeptide internal internal

69 69

the the of of

efficiency efficiency the the increases increases His of of protonation protonation whether whether test test to to Therefore, Therefore, 2004). 2004). al., al.,

et et Degnin Degnin 2003; 2003; al., al.,

et et (Bergeron (Bergeron proteolysis proteolysis enhances enhances sites sites cleavage cleavage furin furin to to proximal proximal

Activation Activation Furin Furin B. B. Appendix Appendix Appendix B. Furin Activation substitution blocked the acid pH-dependent cleavage of the furin propeptide at the

internal Arg75 site and the release of the propeptide from the furin•propeptide complex

(Figs. 2 and 4). By contrast, a His 69 ~ Lys substitution, which mimics constitutively protonated histidine blocked propeptide excision at Arg 107 , trapping the profurin molecule in the ER by a mechanism requiring the sorting protein PACS-2 and COPI (Figs. 2, 4 and

5).

Our experimental studies and modeling analysis together demonstrate a possible

mechanism for the His69 protonation-dependent furin activation. In the neutral pH environment of the ER, unprotonated His69 is buried in a solvent-accessible hydrophobic

pocket, stabilized by nonpolar amino acids, including Gly 53 , Leu55 , Phe54, Phe67 and Trp68 •

This hydrophobic pocket may guide the correct folding of the catalytic domain while protecting the internal propeptide cleavage site. Once folded, the catalytic domain

autoproteolytically excises the propeptide at Arg107 to form a transport-competent

furin•propeptide complex that transits to the mildly acidic TGN/endosomal system.

Profurin molecules unable to efficiently fold and undergo autoproteolysis remain in the

ER by a PACS-2- and COPI-dependent mechanism (Fig. 5). Upon exposure to the mildly

acidic TGN/endosomal system, protonation of His69 disrupts hydrophobic interactions,

thereby resulting in the partial unfolding of the hydrophobic pocket. This puckering

exposes the internal cleavage site, triggering cleavage at Arg75 to release the propeptide

and unmask the catalytic center for substrate cleavage in trans. Thus, the His 69 ~Leu

mutation would stabilize the solvent-accessible hydrophobic pocket, permitting

propeptide excision at Arg 107 and export of the furin•propeptide complex to the

197 Appendix B. Furin Activation

TGN/endosomal system. However, this non-protonatable mimic prevents the pH­

dependent cleavage of the propeptide at the internal site (Arg75 ) and subsequent enzyme

activation. Similarly, blocking internal propeptide cleavage by a PI Arg75 -Ala mutation has no measurable effect on furin folding, propeptide excision, or the pH-dependent puckering of the solvent-accessible hydrophobic pocket, but blocks internal propeptide cleavage and enzyme activation (Fig. 2 and (Anderson et al., 2002)). Hence, trypsinization of the propeptide in vitro is sufficient to recover active enzyme. By

contrast, the His69-Lys mutation, which mimics constitutively protonated His, prevents stabilization of the hydrophobic pocket, blocking correct folding of the propeptide and

propeptide excision at Arg 107 , leading to the accumulation of the inactive profurin in the

ER (Fig. 4). Similarly, a Val72-Arg mutation, which converts the Pl/P6 Arg internal propeptide cleavage site to a consensus Pl/P4 Arg site, blocks profurin folding and ER export by also destabilizing the solvent-accessible hydrophobic pocket (Anderson et al.,

2002).

NMR solution structures of the furin and PCI/3 propeptides suggest the molecular basis for the pH-dependent activation of the PCs. At neutral pH, the PCl/3 propeptide consists of four ~-sheets and two a-helices in a ~-a-~-~-a-~ arrangement, with the internal cleavage site located in an extended loop between the ~ 3 and a 2 segments (Tangrea et al.,

2002). Tangrea et al., proposed that His66 , which is present in furin but not PCI, serves as furin's pH sensor promoting dissociation of the pro- and catalytic-domains, whereas

His69 , which is conserved in all PCs (Fig. la), would point away from the putative binding surface and therefore would not contribute to the pH dependent activation of

198 Appendix B. Furin Activation furin. In addition, a separate study found that the furin prodomain was in a molten­ globule state at neutral pH with a measurable core and at acidic conditions undergoes unfolding largely in its C-terminal half that includes the internal cleavage site

(Bhattacharjya et al., 2001). Our results suggest four key differences underlying the

mechanism of profurin activation compared to these studies. First, we found that His69 but

our not His66 has an overriding role as the pH sensor controlling furin activation. Second,

modeling studies indicate that unprotonated His69 is buried in a solvent-accessible

hydrophobic pocket that guides the folding of the catalytic domain. This role for

unprotonated His69 in the ER explains why the His69 ___,.Lys mutation blocks propeptide

excision of profurin, leading to restriction of the misfolded proenzyme to the ER. Third,

following transport of the furin•propeptide complex to the mildly acidic TGN/endosomal

system, protonation of His69 disrupts the hydrophobic interactions, thereby exposing the

internal cleavage site to the catalytic center. Fourth, protonation of His69 has an additional

role in increasing the efficiency of propeptide cleavage (Table 1).

The utility of a protonatable His residue to regulate compartment-specificity of furin

cleavage is not restricted to the furin propeptide but is also used to order the furin­

dependent cleavages of pro-BMP-4 and pro-a4 integrin in a compartment-specific

manner (Bergeron et al., 2003; Degnin et al., 2004 ), underscoring the broad utility of the

His pKa at physiological pH. In addition, in vitro activation of PC 1, which contains the

evolutionarily conserved His residue corresponding to furin's His69, also requires an

acidic pH for activation (our unpublished results). However, a recent study demonstrates

furin to cleave that a His69___,.Ala mutation had no effect on the ability of over-expressed

199

200 200

proteins. proteins.

furin, furin, and and which which may may also also control control the the activation activation of of other other PCs PCs and and secretory secretory pathway pathway

69 the the His -based -based pH pH sensor sensor to to promote promote the the stepwise-, stepwise-, compartment-specific compartment-specific activation activation of of

our our studies studies identify identify new new components components of of the the cellular cellular sorting sorting machinery machinery that that cooperate cooperate with with

binding binding site site is is masked, masked, perhaps perhaps by by furin furin dimerization dimerization (Wolins (Wolins et et al., al., 1997). 1997). Regardless, Regardless,

Alternatively, Alternatively, ER ER export export of of the the furin•propeptide furin•propeptide complex complex may may occur occur if if the the PACS-2 PACS-2

(Molloy (Molloy et et al., al., 1998) 1998) may may be be key key for for allowing allowing export export ER of of the the furin•propeptide furin•propeptide complex. complex.

1995)). 1995)). Thus, Thus, dephosphorylation dephosphorylation of of the the furin furin cytosolic cytosolic domain domain by by a a furin furin phosphatase phosphatase

like like furin furin and and profurin, profurin, H69K:fur/f/ha H69K:fur/f/ha is is phosphorylated phosphorylated in in vivo vivo (Fig. (Fig. 4 4 and and (Jones (Jones et et al., al.,

we we report report that that PACS-2 PACS-2 also also binds binds to to the the CK2-phosphoryated CK2-phosphoryated furin furin cytosolic cytosolic domain domain and, and,

polycystin-2 polycystin-2 cytosolic cytosolic domain domain to to COPI COPI (Kottgen (Kottgen et et al., al., 2005; 2005; Simmen Simmen et et al., al., 2005). 2005). Here, Here,

channel channel polycystin-2 polycystin-2 to to the the ER ER by by linking linking the the CK2 CK2 phosphorylated phosphorylated acidic acidic cluster cluster in in the the

profurin profurin in in the the ER. ER. We We recently recently identified identified PACS-2 PACS-2 and and reported reported that that it it localizes localizes the the ion ion

COPI COPI (Fig. (Fig. 5) 5) identifies identifies components components of of the the cellular cellular trafficking trafficking machinery machinery that that maintain maintain

Our Our demonstration demonstration that that localization localization of of H69K:fur/f/ha H69K:fur/f/ha to to the the ER ER requires requires PACS-2 PACS-2 and and

Degnin Degnin et et al., al., 2004). 2004).

detect detect furin furin activity, activity, or or perhaps perhaps differences differences in in the the cell cell lines lines used used (Bergeron (Bergeron et et al., al., 2003; 2003;

activation activation due due to to stronger stronger hydrophobic hydrophobic interactions, interactions, differences differences in in the the assays assays used used to to

der der Waals Waals volume volume of of Leu, Leu, which which may may result result in in a a more more prominent prominent effect effect on on cleavage cleavage and and

69 69 between between the the His -Leu -Leu and and His -Ala -Ala substitutions substitutions may may be be attributed attributed to to a a larger larger Van Van

pro-von pro-von Willebrand Willebrand factor factor in in 293 293 cells cells (Bissonnette (Bissonnette et et al., al., 2004). 2004). This This discrepancy discrepancy

Appendix Appendix B. B. Furin Furin Activation Activation Appendix B. Furin Activation

Acknowledgments

The authors thank E. Anderson for his effort in the early stages of this project, J. Larson for helpful discussions and R. Sitia for the PDI antiserum. This work was supported by

NIH grants DK37274 and AI49793 (GT).

201

202 202

N-terminus N-terminus is is exposed exposed upon upon propeptide propeptide excision. excision. mAb mAb M2 M2 recognizes recognizes either either the the blocked blocked

tag tag (horizontal (horizontal bars) bars) was was inserted inserted at at theN-terminus theN-terminus of of mature mature furin furin such such that that the the FLAG FLAG

proteins proteins (Kottgen (Kottgen et et al., al., 2005; 2005; Simmen Simmen et et al., al., 2005; 2005; Wan Wan et et al., al., 1998). 1998). A A FLAG FLAG epitope epitope

domain, domain, which which is is phosphorylated phosphorylated by by CK2 CK2 (circled (circled P) P) to to promote promote binding binding to to PACS PACS

segment), segment), the the transmembrane transmembrane domain domain (TMD, (TMD, dark dark gray gray segment), segment), and and the the cytosolic cytosolic

excision and and excision internal internal cleavage cleavage sites sites (black (black bars), bars), the the catalytic catalytic domain domain (light (light gray gray

study. study. Shown Shown is is full-length full-length profurin profurin containing containing the the N-terminal N-terminal prodomain prodomain with with the the

activation activation in in vitro. vitro. (A) (A) Schematic Schematic representation representation of of the the furin furin constructs constructs used used in in this this

69 69

Figure Figure 2. 2. His controls controls the the pH-sensitive pH-sensitive furin furin propeptide propeptide cleavage cleavage and and enzyme enzyme

53 54 55

67

68 68 pocket pocket formed formed by by Gly Phe Leu Phe and and Trp hydrophobic hydrophobic residues residues (yellow). (yellow). , , , , , , , ,

69 69 of of the the secondary secondary cleavage cleavage site site illustrates illustrates His (blue) (blue) buried buried in in the the solvent-accessible solvent-accessible

69 69 propeptide propeptide cleavage cleavage site site (red) (red) and and His (blue) (blue) are are highlighted. highlighted. (D) (D) Surface Surface representation representation

propeptide propeptide (yellow) (yellow) is is docked docked onto onto the the active active site site of of furin furin (green). (green). The The internal internal

highlighted. highlighted. (C) (C) Surface Surface representation representation of of the the propeptide-furin propeptide-furin complex. complex. The The modeled modeled

66 66 69 69 structure structure obtained obtained 75 75 by by homology homology modeling. modeling. His and and His (blue) (blue) and and Arg (red) (red) are are

25 25 begins begins at at Gln (Anderson (Anderson et et al., al., 1997). 1997). (B) (B) Ribbon Ribbon representation representation of of the the furin furin propeptide propeptide

depicted. depicted. Propeptide Propeptide residues residues are are numbered numbered in in reference reference to to the the furin furin propeptide, propeptide, which which

highlight, highlight, >80% >80% similarity, similarity, light light gray-highlight, gray-highlight, >50% >50% similarity) similarity) between between PCs PCs is is

furin furin propeptide propeptide and and sequence sequence conservation conservation (black-highlight, (black-highlight, 100% 100% similarity; similarity; dark dark gray­

Alignment Alignment between between propeptides propeptides of of the the PC PC family. family. Predicted Predicted secondary secondary structure structure of of the the

Figure Figure Homology Homology 1. 1. modeling modeling of of the the furin furin propeptide. propeptide. (A) (A) Multiple Multiple Sequence Sequence

Figure Figure Legends Legends

Appendix Appendix B. B. Furin Furin Activation Activation Appendix B. Furin Activation

(profurin) or N-terminally exposed (mature furin) FLAG tag whereas mAb Ml recognizes specifically the N-terminally exposed FLAG tag (mature furin). An HA epitope tag (vertical bars), which is recognized by mAb HA.ll, was inserted at the N­ terminus of the prodomain. The sequence of the prodomain is shown at the top with the signal peptidase cleavage site as well as the propeptide excision and internal cleavage sites highlighted by vertical arrows. The Pl/P4 Arg residues of the excision site and the

Pl/P6 Arg residues of the internal cleavage site are in bold font. ER-localized, lumenally­ restricted furin constructs (designated .Mc-k) were generated by replacing the TMD and cytosolic domains with the Lys-Asp-Glu-Leu (KDEL) ER localization signal. (B) Cell extracts from BSC-40 cells expressing a control viral vector (WT) or the indicated -~tc-k

ER-localized furin constructs were separated by SDS-PAGE and analyzed by western blot using mAbs Ml or M2. Open arrow, profurin. Filled arrow, mature furin. (C)

Membrane preparations from cells used in (B) were tested for furin activity using the

Abz-Arg-Val-Lys-Arg-Gly-Leu-Ala-Tyr(N02)-Asp-OH substrate, after incubation at pH

6.0 or 7.5 for 3h, or at pH 7.5 for lh in the presence of trypsin followed by soybean trypsin inhibitor to block residual trypsin activity. Error bars represent the mean and SEM of three independent experiments. (D) Membranes preparations from (C) were analyzed by 15% Tris-Tricine SDS-PAGE followed by western blot using mAb HA.ll. Mr values of the excised propeptide and the cleaved N-terminal propeptide fragment are indicated.

Open arrowhead, intact propeptide. Filled arrowhead, cleaved propeptide.

Figure 3. The protonation state of His69 controls propeptide excision and enzyme activation in vivo. (A) Cell extracts from BSC-40 cells expressing a control viral vector

203

204 204

expressing expressing fur/f/ha fur/f/ha or or H69K:fur/f/ha H69K:fur/f/ha were were metabolically metabolically labeled labeled with with Pi, Pi, lysed, lysed,

32

Figure Figure 5. 5. PACS-2 PACS-2 and and COPI COPI localize localize H69K:fur/f/ha H69K:fur/f/ha to to the the ER. ER. (A) (A) A7 A7 cells cells

fluorescently fluorescently labeled labeled secondary secondary antibody. antibody.

medium medium (30 (30 for for one one hr hr and and internalized internalized ]lglml) ]lglml) mAb mAb M1 M1 was was detected detected with with a a

expressing expressing fur/f/ha fur/f/ha or or H69L:fur/f/ha. H69L:fur/f/ha. Cells Cells were were incubated incubated with with mAb mAb M 1 1 M in in the the culture culture

and and quantified quantified by by densitometry. densitometry. (C) (C) Immunofluorescence Immunofluorescence microscopy microscopy of of BSC-40 BSC-40 cells cells

co-precipitating co-precipitating propeptide propeptide molecules molecules (open (open arrowhead) arrowhead) were were detected detected by by fluorography fluorography

were were immunoprecipitated immunoprecipitated with with mAb mAb M1, M1, separated separated by by 15% 15% Tris-Tricine Tris-Tricine SDS-PAGE SDS-PAGE and and

37°C 37°C for for the the indicated indicated times. times. Cell Cell extracts extracts were were prepared, prepared, and and mature mature furin furin molecules molecules

100 100 !!Ci !!Ci each each of of [ H]Arg H]Arg and and [ H]Leu, H]Leu, then then chased chased with with excess excess unlabeled unlabeled Arg Arg and and Leu Leu at at

3 3

BSC-40 BSC-40 cells cells expressing expressing fur/f/ha fur/f/ha or or H69L:fur/f/ha H69L:fur/f/ha were were pulse-labeled pulse-labeled for for 30 30 min min with with

then then visualized visualized with with species-specific species-specific fluorescently fluorescently labeled labeled secondary secondary antibodies. antibodies. (B) (B)

or or H69K:fur/f/ha. H69K:fur/f/ha. Cells Cells were were fixed fixed and and stained stained with with anti-furin anti-furin PAI--062 PAI--062 and and anti-TGN46, anti-TGN46,

(A) (A) Immunofluorescence Immunofluorescence microscopy microscopy of of BSC-40 BSC-40 cells cells expressing expressing fur/f/ha, fur/f/ha, H69L:fur/f/ha H69L:fur/f/ha

69 69 Figure Figure 4. 4. The The protonation protonation state state of of His affects affects the the subcellular subcellular localization localization of of furin. furin.

the the mean mean and and SEM SEM of of three three independent independent experiments. experiments.

Arg-Val-Lys-Arg-Gly-Leu-Ala::Tyr(N02)-Asp-OH Arg-Val-Lys-Arg-Gly-Leu-Ala::Tyr(N02)-Asp-OH substrate substrate peptide. peptide. Error Error bars bars represent represent

preparations preparations of of cells cells used used in in (A) (A) were were tested tested for for furin furin activity activity at at pH pH 7.5 7.5 using using the the Abz­

Profurin Profurin (open (open arrow) arrow) and and mature mature furin furin (filled (filled arrow) arrow) are are indicated. indicated. (B) (B) Crude Crude membrane membrane

were were separated separated by by SDS-PAGE SDS-PAGE and and analyzed analyzed by by western western blot blot with with mAbs mAbs Ml Ml and and M2. M2.

(WT) (WT) or or full-length full-length epitope-tagged epitope-tagged furin furin molecules molecules containing containing the the indicated indicated mutations mutations

Appendix Appendix B. B. Furin Furin Activation Activation Appendix B. Furin Activation immunoprecipitated with mAb M2, separated by SDS-PAGE and analyzed by autoradiography (upper panel) and western blot using anti-furin PAI-062 (lower panel).

domain, was (B) GST or GST-Furi11c0 , which contains the 56-amino acid furin cytosolic pre-incubated or not with CK2, then incubated with thioredoxin (Trx)-tagged PACS-2

FBR, which encodes the cargo binding region of PACS-2 (Kottgen et al., 2005; Simmen et al., 2005), separated by SDS-PAGE and analyzed by western blot using anti-Trx mAb.

(C) A7 cells were treated with control (scr.) or siRNAs specific for PACS-2 or ~-COP for

48 hr, lysed, separated by SDS-PAGE and analyzed by western blot using anti-PACS-2

and anti-~-COP antibodies. The blots were also incubated with anti-tubulin mAb to control for protein loading. (D) A 7 cells were treated with the indicated siRNAs for 48 hr

and then infected with virus expressing H69K:fur/f/ha for an additional 4 hr. The cells

were then processed for immunofluorescence microscopy and stained with mAb HA.ll

and anti-POI followed by subtype-specific fluorescently labeled secondary antibodies.

205

206 206

1 1 Figure Figure

·•·-:•. ·•·-:•. ~~'t ~~'t ~<' ~<'

, , ...... J. J. . . ~~

c c D D B B

PALEVEAIR-QQVEA PALEVEAIR-QQVEA PC7 PC7 E E

PCl PCl

PC2 PC2

PC4 PC4

PACE4 PACE4

PCS PCS

in in Fur Fur

BTLEQ BTLEQ EE SLEGD SLEGD PC7 PC7

------K ------K

GP GP -----

PCl PCl

DK---­ . H91HK----~GE ~

------E ------E PC2 PC2

----Q, ----Q, PRAVGWAPV~A PRAVGWAPV~A PC4 PC4

----G ----G PACE4 PACE4 ------PPP ------PPP

----G ----G

PCS PCS

-l\1li.WI'Nil-l, -l\1li.WI'Nil-l, _ _ , __ __ ------

---- V ----G.PA ------QGQ- in in Fur Fur

25 25

A A a1 a1

Activation Activation Furin Furin B. B. Appendix Appendix Appendix B. Furin Activation

A c signal sequence Internal propeptide exciston propeptide site excision site

oia2sG ... YYH66FWH69RGVTKR !sSISPHRPRHSRLQREPQVQWLEQQVAKRRTKR1oto ...... - - ... ------

..1---L.IM~.._j ___,______,1___,1 pro-furlf/ha

mA'"tt Al·· p r::::::IJ ""lni.------,------,I_....J-,1 furlflha

mAbM1 I

I.__.LJIB __ l.______.______,fK oEL furlf/ha ~tc-k

8 D

Figure 2

207 80Z

£ aJn6t:l

0 -~., C"C:-·'""' Q3::J g --· '

.... .___I- _____. -I w~ ~ IG~

v Appendix B. Furin Activation

8 chase(h) 0 2 3 4 c:: o- -+- fur/f/ha ~ ~125 -o- H69L:fur/flha +J ·- ·- +J 1:j .Q. jg 100 I~ (.) (]) 0 ~-!::.- 75 fur/f/ha C.Q) g ~50 E g- 2s Ea. ·- e oo 1 4 1:j 6C. 2 3 I~ (.) time(hr) H69L:fur/f/ha c fur/f/ha H69L:fur/f/ha

Figure 4

209

210 210

Figure Figure 5 5

I I a_ a_ tubulinj tubulinj

Q Q

~-COPI ~-COPI I I

I I PACS-21 PACS-21

WB: WB:

I I

+ + ~-COP- -

c.o c.o

PACS-2- + +

(J) (J)

~ ~ --

scr.+ scr.+

.2 .2 SiRNA: SiRNA:

~ ~

~ ~ c c

=E: =E:

(j:)Oj (j:)Oj

ctS ctS

~ ~ ~~ ~~

;§~ ;§~ ~~ ~~

~-COP ~-COP scr. scr. PACS-2 PACS-2

D D ~...... ~...... ~fb- ~fb-

WB:furin WB:furin

,... ,...

I I

IP:M21 IP:M21

GST-furinco GST-furinco GST GST

I I WB: WB:

PACS-21 PACS-21

I I

._.I ._.I

-~ .>~ -' -'

P-furin P-furin 3

2

+ + + + CK2 CK2

A A B B

Appendix Appendix B. B. Furin Furin Activation Activation Appendix B. Furin Activation

Table 1. Peptidyl substrates

PEPTIDE SEQUENCE pH Km kcat kca/Km kca /Km (tM) (s-') (s-'M') (Rel.) 5 PS-1 * Abz-Ala-Lys-Arg-Arg-Thr-Lys-Arg107 ~ Asp-Val-Tyr(N02)-Ala 7.5 1.99 1.90 9.58 X 10 1.000 5 6.0 1.62 1.03 6.34 X 10 0.661 5 PS-2* Abz-His-Arg-Gly-Val-Thr-Lys-Arg75 ~ Ser-Leu-Tyr(N02)-Ala 7.5 23.75 6.37 2.68 X 10 0.279 5 6.0 6.59 2.92 4.43 X 10 0.458 5 PS-2: Abz-Ly_s_-Arg-Gly-Val-Thr-Lys-Arg75 ~ Ser-Leu-Tyr(N02)-Ala 7.5 8.01 2.05 2.56 X 10 0.267 5 H69K 6.0 11.95 1.61 1.35 X 10 0.141 4 PS-2: Abz-Leu-Arg-Gly-Val-Thr-Lys-Arg75 ~ Ser-Leu-Tyr(N02)-Ala 7.5 38.20 2.90 7.59 X 10 0.079 4 H69L 6.0 45.93 2.66 5.79 X 10 0.060

*, from (Anderson et al., 2002).

211

212 212

3 phosphatidylinositol-3,4,5-bisphosphate(PI3,4,5P phosphatidic phosphatidic acid acid (PA), (PA), and and phosphatidylserine phosphatidylserine ), ), (PS). (PS).

(S (S 1P), 1P),

phosphatidylinositol-3,4-bisphosphate phosphatidylinositol-3,4-bisphosphate 2

(PI3,4P phosphatidylinositol-3,5-bisphosphate phosphatidylinositol-3,5-bisphosphate 2 ), ), (PI3,5P ), ),

phosphate phosphate (PI5P), (PI5P), phosphatidylethanolamine phosphatidylethanolamine (PE), (PE), phosphatidylcholine phosphatidylcholine (PC), (PC), sphingosine-1-phosphate sphingosine-1-phosphate

phosphatidylinositol-3-phosphate phosphatidylinositol-3-phosphate (PI3P), (PI3P), phosphatidylinositol-4-phosphate phosphatidylinositol-4-phosphate (PI4P), (PI4P), phosphatidylinositol-5-

are are Lysophosphatidic Acid Acid Lysophosphatidic (LPA), (LPA), Lysophosphocholine Lysophosphocholine (LPC), (LPC), phosphatidylinositol phosphatidylinositol (Ptdlns), (Ptdlns),

BSA BSA for for ten ten minutes minutes each, each, and and then then probed probed with with affinity affinity purified purified PACS-1 PACS-1 antibody antibody 601. 601. The The spotted spotted lipids lipids

TBST TBST ~-tg/ml ~-tg/ml +3% +3% faf-BSA faf-BSA overnight overnight at at 4 4 The The membrane membrane C. C. was was washed washed three three times times with with TBST TBST +3% +3% faf­

acid acid free free BSA BSA (faf-BSA, (faf-BSA, Sigma# Sigma# A-7030) A-7030) for for one one hour hour at at room room temperature. temperature. PACS-1 PACS-1 was was overlayed overlayed at at 0.5 0.5

onto onto a a lipid-spotted lipid-spotted membrane membrane (Echelon (Echelon Biosciences). Biosciences). The The membrane membrane

was was first first blocked blocked in in TBST TBST +3% +3% fatty fatty

Figure Figure 2. 2. PACS-1 PACS-1 binds binds to to PI3P. PI3P. Full-length Full-length his-tagged his-tagged PACS-1 PACS-1 expressed expressed in in baculovirus baculovirus was was overlaid overlaid

0 0 0 0 PC PC Blank Blank

00 00

PE PE PS PS

00 00

PISP PISP PA PA

00 00

3 3 PI4P PI4P PI3,4,5P

00 00

2 2 PI3P PI3P PI4,5P

00 00

2 2 Ptdlns Ptdlns PI3,5P

00 00

2 2 LPC LPC PI3,4P

00 00

LPA LPA S1P S1P

A A B B

on on cell cell lysate lysate to to

confirm confirm expression expression of of PACS-1 PACS-1 proteins. proteins.

Lysate,,__ Lysate,,______. __.

--IHAwestern --IHAwestern

anti-myc anti-myc mAb mAb 9E11. 9E11. Control Control western western

blotting blotting was was done done

~======~ ~======~

transferred transferred to to nitrocellulose nitrocellulose and and western western blotted blotted with with

I I

precipitated precipitated complexes complexes were were separated separated Lysate' Lysate' by by SDS-PAGE, SDS-PAGE,

Myc Myc western western

immunoprecipitated immunoprecipitated

with with polyclonal polyclonal HA HA antibody. antibody. The The

'L..------l 'L..------l

Co-IP Co-IP

inhibitor inhibitor and and HA-P HA-P ACS-1 ACS-1 protein protein was was

I I

Myc Myc western western lysed lysed in in mRIPA+1mM mRIPA+1mM DTT DTT and and COMPLETE COMPLETE protease protease

expressing expressing HA- or or Myc- Tagged Tagged PACS-1, PACS-1, or or both, both, were were

iii iii

:::!: :::!: :I: :I: :I: :I: Figure Figure PACS-1 PACS-1 1. 1. forms forms an an oligomer oligomer in in cells. cells. A7 A7 cells cells

Express: Express:

>-

as as <( <(

<( <(

c: c: (,) (,) I I I I

~ ~ ~ ~

I I ~ ~ ~ ~

(.) (.) (.) (.)

en en (.) (.) en en

en en

I I I I

,.. ,.. ,.. ,.. I I

,.. ,.. + +

:::!: :::!:

g. g.

I I ~ ~

(.) (.)

1 1 and and 2 2 and and discussed discussed

in in Chapter Chapter 4. 4. en en

I I

,.. ,..

2) 2) how how P P ACS-1 ACS-1 is is recruited recruited to to membranes. membranes. These These are are described described in in the legends legends the to to Figures Figures

This This appendix appendix records records two two preliminary preliminary results results regarding regarding 1) 1) the the activation activation of of PACS-1, PACS-1, and and

Summary Summary

APPENDIXC APPENDIXC

Appendix Appendix C. C. Preliminary Preliminary Results Results