Eastern Illinois University The Keep
Undergraduate Honors Theses Honors College
5-2013
Puccinia mariae-wilsoniae and Claytonia virginica: A Pathogen's Tale
Sarah A. Schlund
Follow this and additional works at: https://thekeep.eiu.edu/honors_theses
Part of the Plant Pathology Commons Puccinia mariae-wilsoniae and Claytonia virginica: A pathogen's tale
by
Sarah A. Schlund
HONORS THESIS
SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
BACHELOR OF SCIENCE IN BIOLOGICAL SCIENCES WITH HONORS
AT EASTERN ILLINOIS UNIVERSITY
CHARLESTON, ILLINOIS
May 2012
I hereby recommend that this Honors Thesis be accepted as fulfilling this part of the undergraduate degree cited above:
Thesis Director Date
Honors Program Director Date ABSTRACT
Rusts are economically important fungal plant pathogens. For the majority of rust species, complete lifehistory data, including host range, geographic distribution, plant response to the rust, identity of alternate hosts, and mode of sexual reproduction are incomplete. The purpose of this study was to examine the life history of Puccinia mariae-wilsoniae, a rust on
Claytonia virginica (spring beauty), and to observe responses in leaf anatomy to its fungal pathogen. Spring beauty is an ephemeral woodland plant that lasts three to four weeks and P. mariae-wilsoniae infects C. virginica almost as soon as the plant emerges from dormancy in
Spring. Population studies in March and April, 2012, as well as March and April, 2013, examined the abundance and spread of infectionwithin several populations. Infected leaves, inflorescences, and corms with attached roots were collected, fixed in FAA, stored in 70% ethanol, embedded in paraffin, sectioned, and mounted on slides foranatomical study. While the presence of aecia and aeciospores has been reported in other studies, this project has demonstrated the presence of telia and teliospores on C. virginica leaves and inflorescences.
Population studies demonstrate that there is not a strong correlation between population density and infection rate at Laursen's Woods and Baber' s Woods, but there is a positive correlation at
Rocky Branch Nature Preserve. DNA sequencing indicated that the rust infecting C. virginica is
P. mariae-wilsoniae, while anatomical studies demonstrated changes in the location of fungal reproductive structures from previous observations with C. virginica. ACKNOWLDEGMENTS
I thank the Department of Biological Science and the Honors College at Eastern Illinois
University forpartial funding of this project. I also thank several people who helped me with this project: Dr. Richard Abbot forpictures from Kentucky and Illinois; Dr. Cathie Aime for rust specific primers, the DNA extraction protocol, and assistance in the laboratory at Purdue
University; Dr. JeffreyLaursen for the use of his property to collect data for population studies and specimens foranatomical studies; Dr. Scott Meiners forstatistical analysis of the population
study data; and Dr. Barbara Carlsward for all her help in the lab and for teaching me so much
about anatomy and microtechnique as well as her encouragement in completing my undergraduate thesis. I am also thankfulfor Dr. Andrew Methven's help in interpreting the life
cycle of P. mariae-wilsoniae and all of his work in the field. I would like to thank him for
introducing me to the world of plant pathology and forthe encouragement he has given me in
completing my undergraduate thesis. I extend my appreciation to those who helped in collecting
data in the field and interpreting the results in the lab. Finally, I would like to thank my friends
and my familyfor their words of encouragement and support throughout this process.
11 TABLE OF CONTENTS
PAGE
ABSTRACT ...... i
ACKNOWLEDGMENTS...... i i
LIST OF TABLES AND FIGURES ...... iv
INTRODUCTION ...... 1
METHODS AND MATERIALS ...... 7
RESULTS ...... 10
DISCUSSION ...... 12
LITERATURE CITED ...... 17
TABLES ...... 20
FIGURES ...... 21
VITA...... 26
Ill LIST OF TABLES AND FIGURES
TABLES
Table 1. ANOVA for site and year data and interaction for all three locations.
Table 2. Interactions between all three locations.
Table 3. ANCOVA forsite, year, total and their interactions for all three locations.
FIGURES
Fig. 1. A) Claytonia virginica growing in Kentucky. B) Uninfected C. virginica plants growing in Illinois. C) Unifected whole plant of C. virginica.
Fig. 2. Design forpopulation study. Six plots taken every 3 m along a transect 15 m long.
Fig. 3. Population density for each quadrat.
Fig. 4. Proportion of infected plants per quadrat.
Fig. 5. Interaction of population density and proportion of infected plants at Laursen's Woods.
Fig. 6. Interaction of population density and proportion of infected plants at Baber's Woods.
Fig. 7. Interaction of population density and proportion of infected plants at Rocky Branch Nature Preserve.
Fig. 8. A) Spermagonia (arrowhead) on lower leaf surfaceat 187.5X B, C) Spermagonia on lower leaf surface.
Fig. 9. A) Aecia on lower leaf surface at 75X B) Aecia on upper and lower leaf surfaces. C) Aecia with aeciospores on inflorescence axis.
Fig. 10. A) Claytonia virginica calyx infected with aecia. B) Enlarged picture of infected calyx.
Fig. 11. A) Infected whole plant of C. vilginica with aecia. B) Enlarged picture of infected inflorescence axis.
Fig. 12. A) Telia as seen with transmitted light through an intact leaf at 37.5X B) Telia on upper and lower leaf surfaces. C) Telia with teliospores on upper leaf surface.
Fig. 13. A) Whole plant of C. virginica infected with telia. B) Enlarged picture of infected leaf and calyx.
IV INTRODUCTION
Fungal rusts are a complex group of organisms which can be found ubiquitously throughout the world (Figueiredo and Passador, 2008) and are capable of surviving in diverse geographic ranges due to their complex life cycles. There are more than 7,000 species of obligate rust fungi with complex life cycles in Uredinales (Basidiomycota) that can be harmful plant pathogens (Aime, 2006). Studies on different rust genera show that diversification occurred early in the rust lineage and can be seen in the differences between indeterminate and determinate spermagonia that characterize specific genera (Hiratsuka and Cummins, 1963). A phylogenetic study by Aime (2006) showed that at a family level, rusts are influenced by, and possess morphological features indicating, co-evolution with their host. In the interim, numerous phylogenetic studies have been done to show the correlation between fungalrust's morphology and relationship with their host (Aime, 2006; Minnis et al., 2012).
As noted in morphological studies by Hennen and Buritica (1980), ancestral rusts reside on more primitive plants, while complex rusts tend to reside on more derived plants. In addition to morphology, host selection has also played a critical role in evolutionary changes that have occurred in rusts (Aime, 2006). One of the main problems with interpreting evolutionary relationships of rusts is that there are very few classification systems, including those needed for
Puccinia and Uromyces (Minnis et al., 2012). The non-phylogenetic system used by most mycologists has become a staple in deciphering which type of rust is present and its host range.
Although rusts are ubiquitous throughout the world, it is presumed that they originated in the tropics (Hennen and Buritica, 1980). Rusts attack a wide range of plants, include mosses, ferns and gymnosperms as well as monocots and dicots (Hennen and Buritica, 1980). Species of
Puccinia can be found ubiquitously throughout the world, with the exception of polar regions
1 (Cummins, 1959). Within Basidiomycota, Puccinia and Uromyces have become highly specialized for specific hosts depending on if these rusts are heteroecious or autoecious
(Hiratsuka and Cummins, 1963 ).
According to Hennen and Buritica (1980), many rusts are obligate parasites and specialized for a specific host. However, Arthur et al. (1929) and Jackson (1931) found that autoecious (one host) life cycles possessed by some rusts were likely heteroecious (two hosts) at
one time. One of the unique characteristics about rust fu ngi which make them so difficultto study is that their heteroecious life cycles separate their haploid and dikaryotic phases (Hiratsuka and Hiratsuka, 1980). Both heteroecious and autoecious species are present in the genus
Puccinia, and P. mariae-wilsoniae is an autoecious rust (Cummins, 1959).
Claytonia virginica (Fig. IA) possesses small flowers consisting of five petals (Fig. IB),
five stamens opposite the petals, two sepals, and a gynoecium that can produce many seeds with
basal placentation (Milby, 1980). This spring woodland plant exhibits rapid growth and
reproduction followed by senescence after the completion of sexual reproduction in early spring
(Whigham and Chapa, 1999). Claytonia virginica occurs in deciduous forests before canopy
closure, when sunlight is plentiful (Anderson et al., 2004). Many woodland herbaceous plants
exhibit clonal growth, including C. virginica which produces corms in the topsoil, their primary
mode of reproduction is asexual (Whigham and Chapa, 1999). Corms are used to offset
herbivore damage and to allow for regeneration of damaged organs as well as sexual
reproduction (Whigham and Chapa, 1999). For C. virginica, clonal reproduction is beneficial
because vegetative reproduction is more energy efficient, has a higher likelihood of
morphological plasticity, and plants can share resources through clonal reproduction (Whigham
and Chapa, 1999).
2 Depending on the length of the growing season, disease, and herbivory, corms may not have enough resources stored to grow well in the following season (Whigham and Chapa, 1999).
As observed by Anderson et al. (2004), C. virginica becomes infected witha fungalrust that appears on organs above ground. For this reason, the plant needs to acquire enough energy through photosynthesis during its short growing season. If C virginica is inhibited by P. mariae wilsoniae, it may not be able to store enough resources to survive until the following spring.
Stomata can be found on the upper and lower surfaces of leaves of C virginia and even on aerial stems (Milby, 1980). The leaves have one main vein with several lateral veins, while the mesophyll layer is simple and undifferentiated (Milby, 1980). The midrib that extends throughout each pair of leaves arises from a cauline vascular bundle (Milby, 1980). These anatomical features are crucial in understanding interactions between C. virginica and P. mariae wilsoniae.
Diseases caused by species of Puccinia can damage vascular plants including grasses, sorghum, sugar cane, sunflowers, asparagus, and snapdragons (Cummins, 1959). While C. virginica may not be an economically important crop, its presence in the forestis important as an aesthetic appeal and it may be used ecologically as a food source for herbivores. In addition, if C. virginica were to disappear, P. mariae-wilsoniae may follow suit because of its autoecious nature. The evolution of growth and reproduction rates in C virginica has been shaped by cooler temperatures in early spring as well as canopy development of deciduous trees in late spring due to decreased photosynthetic rates (Schemske, 1977). Flowers of this spring ephemeral only open after temperatures exceed 11-13 C (Schemske, 1977) because bees are typically the main pollinators forthese flowers, and these insects are active only when temperatures exceed 13 C.
The two main families proposed for rusts are Melampsoraceae and Pucciniaceae (Hennen and
3 Buritica, 1980). As described by Dietel (1928), Pucciniaceae was originally divided into fourteen tribes. In order to determine where P. mariae-wilsoniae fits into Pucciniaceae, it is essential to examine its structure.
Rusts can have up to five different spore stages during their life cycle, all of which are morphologicaly unique from one species to another (Hiratsuka and Hiratsuka, 1980).
Morphological features, including size and shape of spermagonia, are invaluable characters in the identification of species, while other structural features (i.e., aecia, uredinia, etc.) may not be as useful in systematic studies (Hiratsuka and Cummins, 1963; Hiratsuka and Hiratsuka, 1980).
Hiratsuka and Cummins (1963) described how the placement and shape of the spermagonia is characteristic for a rust genus and now there are six subgroups of rusts based on spermagonia
(Hiratsuka and Hiratsuka, 1980). More than twenty different genera have type four spermagonia, including Puccinia, Uromyces, Chysocelis, Maravalia, Gambleola, and Endophyllum (Hiratsuka and Hiratsuka, 1980). Type four spermagonia are subepidermal, determinate, have well developed periphyses as bounding structures, and a convex hymenium (Hiratsuka and Cummins,
1963). According to Cummins (1936), about seventy percent of the species placed in Puccinia
(including P. mariae-wilsoniae) and Uromyces have type four spermagonia and are autoecious.
Although some species in the Pucciniaceae lack spermagonia, most species produce spermagonia in addition to aecial primordial (Hiratsuka and Cummins, 1963). Puccinia mariae-wilsoniae has epiphyllous spermagonia and amphigenous aecia with ellipsoid aeciospores (Arthur and
Cummins, 1962). Spermagonia in Puccinia and Uromyces have a characteristic hymenium and well-developed periphyses that can be used to differentiate these genera from other rusts
(Hiratsuka and Cummins, 1963). Morphological variability has been documented in the spermagonia of Puccinia and can vary in position, host tissue placement or hymenium shape
4 (Hiratsuka and Cummins, 1963). Spermagonia in Puccinia are also reported to show some variation in shape, indicating possible heterogeneous species (Hiratsuka and Cummins, 1963).
Rusts with indeterminate spermagonia are irregularly distributed and vary in size (Hiratsuka and
Cummins, 1963). Spermagonia are produced on a haploid mycelium and are involved in creating the dikaryotic phase (Hiratsuka and Hiratsuka, 1980). Hiratsuka and Cummins (1963) observed that the size of the nucleus had a direct correlation with the size of the spermatium. Cummins and Hiratsuka (2003) have grouped rusts based on spermagonia type, including taxa in
Pucciniaceae.
Aecia forP. mariae-wilsoniae appear to be, amphigenous and evenly scattered on the infected tissue (Arthur and Cummins, 1962). These structures originate in the host subepidermally and produce mostly verrucose, wart-like, unicellular, dikaryotic aeciospores
(Cummins and Hiratsuka, 1983). Once aecia are mature, they break through the cuticle layer to disperse mature aeciospores. According to Cummins (1959), aeciospores appear catenulate or in tightly packed stacks. Staining of the aecia and aeciospores with hematoxylin enhances the appearance and shape of these structures and makes it easier to observe with a compound microscope.
Teliospores are specialized dikaryotic cells in which karyogamy occurs, and before they germinate to form basidia in which meiosis takes place (Savile, 1976; Cummins and Hiratsuka,
2003). Teliospores are typically pedicellate, two celled with a thick septum, and feature a single germ pore per cell (Cummins, 1959). Some species of Puccinia may have telia which are one celled, three-celled, or even four-celled as opposed to the typical two-celled type (Cummins and
Hiratsuka, 1983). Cummins (1959) proposed a method foridentifying genera based on morphological characteristics of teliospores which is useful in identifying many rusts (Hennen
5 and Buritica, 1980). Most modern mycologists rely on molecular analyses to identify rusts however, rather than morphology. Morphology has had many inconsistencies due to capabilities we now possess to observe rust characteristics microscopically which is why scientists are utilizing molecular analyses more frequently because it is more reliable.
The objective of my study was to better understand the life history of P. mariae wilsoniae and observe the interaction between P. mariae-wilsoniae and C. virginica through the use of anatomical studies. Population studies were used to observe the rust on its host. I examined the number of infected individuals in several populations at a specific location and examined the rust spore stages present on these ephemeral woodland plants. Based on results from population and anatomical studies, molecular data were utilized to confirm the identity of
P. mariae-H1ilsoniae on C. virginica in woodlands surrounding Charleston, Illinois.
6 METHODSAND MATERIALS
Three separate locations were utilized forthis study: Laursen's Woods, south of
Charleston, IL (Coles County, IL); Baber's Woods (Edgar County, IL); and Rocky Branch
Nature Preserve (Clark County, IL). Fifteenmeter transects were used to sample four populations at Laursen's and Baber's Woods while five, 15 m transects were used at Rocky
Branch. In each population, I laid down 0.25 m2 quadrats constructed fromPVC pipe every 3 m on alternating sides of a 15 m transect for a total of six study areas at each transect (Fig. 2). I recorded the number of plants present, as well as individuals infected with aecia, and telia in each quadrat. Plants samples were fixed in FAA (9 parts 70% ethanol, 0.5 parts glacial acetic acid, and 0.5 parts 40% formalin) for 3-5 days and transferred into 70% ethanol forstorage before being sectioned for anatomical studies (Carlsward et al., 2006). Whole plants were also taken from Laursen's Woods for molecular studies.
Fixed specimens were cut into 1 cm2 pieces, dehydrated using a graduated tertiary butyl alcohol/ethyl alcohol series, embedded in a high melting point paraffin (mp= 55°C), sectioned using a rotary microtome (thickness= 10 µm), and stained with Heidenhain's iron-alum hematoxylin-safranin followingCarlsward et al. ( 1997). Stained sections were then differentiated and dehydrated with a graduated ethanol series, cleared with limonene (CitriSolv, Fisher
Scientific Company), and mounted on microscope slides using Permount followingCarlsward et al. (2006) foranatomical studies. My observations were made with a Zeiss Axioskop 40 microscope, and photographs were taken using an attached OptixCam digital camera. Whole plants were observed under a Nikon SMZ-2T dissecting microscope and were photographed with a Spot Insight QE digital camera.
7 Whole plants not used forhistology were used formolecular studies to confirm the identity of P. mariae-wilsoniae. Following Aime (2006), dried plant tissue with aecia and telia were placed in 2 mL Bead Solution tubes forDNA extraction using an Ultra Clean Plant DNA
Isolation Kit (MoBio Laboratories, Solana Beach, CA , USA) To amplify the internal transcribed region (ITS), polymerase chain reactions (PCR) were performed in 25 µL reaction volumes with l.25 µL of a 10 µM forward ( PMWITS-F [5'-GGCACTGTTGTTGTCATTGC]) and reverse
(PMWITS-Rint [5'-TGAGCTAGGTAGCAGCAGCA] or PMWITS-R [5'
TCCTTAATCCCACATTGCTG]) primers (Aime, 2006), 12.5 µL PCR Master Mix (Promega,
Madison, WI, USA), and 10 µL DNA template (10- to 100-fold dilutions, followingAime,
2006).
Two separate PCR programs were used forthis experiment. Two samples of rust DNA were amplified using primers PMWITS-F and PMWITS-Rint and the PMWITS program. One sample contained DNA from telia and the other from aecia. This program entailed an initial denaturing step at 94 C for 5 min, followedby 36 cycles denatured at 94 C for30 s, 48 C for 45 s, and 72 C for 45 s with a final extension step of 72 C for 7 min. The other two samples of rust
DNA were amplified using primers PMWITS-F and PMWITS-R and the ITS4545 program. One sample contained DNA from telia while the other sample was taken from an infected plant with aecia on the leaves that did not show any sign of infection on the inflorescence axis where the tissue sample was taken. The second sample was taken to determine see if the rust was systemic in C. virginica. The PCR program entailed an initial denaturing step at 94 C for5 min, followed by 45 cycles at 94 C for30 s, 45 C for 45 s, and 72 C for45 s with a final extension step at 72 C for 7 min. These samples were cleaned using the ExoSAP protocol and a nested PCR was performed using primers PMWITS-F and PMWITS-R with the ITS4545 program. All four
8 samples were sequenced and the sequences were compared to those in GenBank
(http://www.ncbi.nlm.nih.gov/genbank/).
Population data were compared using SAS. Calculations for total density were performed with an analysis of variance (ANOVA) test for site and year as the independent variables and their interactions. An analysis of covariance (ANCOVA) was performed using the infection data with site and year as categorical values and the total number of infected individuals as a continuous variable. A Spearman's Correlation Coefficient was used to understand the interactions in ANCOV A for population density and the proportion of individuals infected.
9 RESULTS
Population studies revealed that forLaursen's Woods there was a mean value of 35.29
plants per quadrat in 2012 (Fig. 3) with a proportion of infected individuals of 0.060 (Fig. 4). In
2013, 3 2. 92 plants per qua drat were recorded with a proportion of infected individuals of 0.024.
At Baber's Woods the mean value of total plants was 39.88 per quadrat in 2012 with a
proportion of infected individuals of 0.0058. In 2013, 50. 96 plants per quadrat were recorded
with a proportion of infected individuals of 0.0067. At Rocky Branch the mean value was 25.97
plants per quadrat in 2012 with a proportion infected of individuals of 0.074. In 2013, 39.50
plants per quadrat were recorded with a proportion of infected individuals of 0.043. The model
fit (R-squared value) for the total density from the ANOVA test (Tables 1-2) was 0.15. The
ANCOVA test results (Table 3) showed that there was a difference in the total number of
individuals in a population, and that there was an interaction between the number of individuals
2 2 and site (r = 0.22). Spearman correlation coefficients showed that both Laursen's Woods (r =
2 0.095, P = 0.52) and Baber's Woods (r = 0.15, P = 0.32) had similar population densities and
2 infection rates (Figs. 5-6). However, Rocky Branch (r = 0.41, P = 0.0013) showed a difference
between the two categories (Fig. 7).
Spermagonia (Fig. 8A) were found on the lower surface of the leaves and appeared as a
tight mass of fungal hyphae (Figs. 8B, C). Periphyses were not seen in sectioned leaves using the
compound microscope, but a few receptive hyphae were visible on whole leaves when observed
under the dissecting microscope (Fig. 9A). Aecia (Fig. 9A) were present predominantly on the
lower surface of the leaf (Figs. 9B, C), but a few were noted on the upper surface as well (Fig.
9B). The aecia are initially subepidermal and once mature, break through the epidermis and
cuticle to release aeciospores. Tight stacks of unicellular aeciospores were arranged in the aecia
10 (Fig. 9C). These pustules were also present on the calyx (Figs. lOA, B) and inflorescence axis
(Figs. 11A, B) of C virginica. Telia were present on both the upper and lower surface of the leaves (Figs. 12A, B). While telia also develop under the epidermal layer and emerge once they reach maturity, teliospores are two-celled (Fig. 12C). Mounds of telia with teliospores were also found on the inflorescence axis and calyx (Figs. 13A, B).
Molecular analyses showed that none of the three rusts sampled exhibited any sequence variation. Blasting the three rust sequences in GenBank confirmed that all three samples were fromP. mariae-wilsoniae. The forth sample, which was used as a systemic control for C. virginica, tested negative for fungalDNA which proved the infection is not systemic.
11 DISCUSSION
While taxonomists have emphasized differentmorphological features in rust systematics over the years (Ono and Hennen, 1983), genera such as Puccinia, Uromyces, and Prmpodium are quite advanced and contain well-defined and developed bounding structures (Hiratsuka and
Cummins, 1963). Some of the morphological characteristics used to identify rust families and tribes are not always helpfuland can be misleading (Hennen and Buritica, 1980). Many rust
species exhibit the same morphological features, making it difficult to distinguish genera and/or species. While morphological features are important when differentiating rusts, there is variability in the morphology that can occur between species (Aime, 2006).
Few anatomical studies focusing on the interaction between Puccinia and its host have been conducted. The results of this anatomical study indicated inconsistencies between previous
studies and the parasite-host interactions found in P. mariae-wilsoniae and C. virginica. For
example, it is not uncommon for sperrnagonia to be present on the lower surface of the leaf My
observations represent the firsttime such a location for the rust on this host species has been
reported (Figs. 8B, C).
Spermagonia position in the host is a distinguishable and reliable character used to
decipher rust species (Hiratsuka and Cummins, 1963). These structures are hermaphroditic
because they not only contain spermatia ("male") but also flexuous hyphae ("female") (Hiratsuka
and Hiratsuka, 1980). The two main forms of spermagonia are: 1) flatand indefinite, subcortical
or subcuticular; and, 2) determinate, globular or flask shaped (A rthur et al., 1929). One of the
most important morphological characteristics used in identifying rusts is the presence of
bounding structures or patterns of growth (Hiratsuka and Hiratsuka, 1980) and not spermagonial
position on the host.
12 Hiratsuka and Cummins (1963) defined type four spermagonia as being determinate, sitting just inside the epidermis, with a strongly concave hymenium and well-developed periphyses as the bounding structures near the entrance (Hiratsuka and Hiratsuka, 1980). In my study, spermagonia were observed on the lower surface of the leaf and no periphyses were present (Figs. 8B, C). Hyphae emerging from the spermagonia are often observed and are called flexuous or receptive hyphae (Hiratsuka and Hiratsuka, 1980). Spermagonia frommy samples of
C. virginica appeared as flexuous hyphae on the undersurface of the leaves (Fig. 8A). Most genera with type fourspermagonia have an aecial stage, but a high percentage of them do not possess the uredineal stage (Hiratsuka and Hiratsuka, 1980), which is also true forP. mariae wilsoniae. My results agree with the observations of type four spermagonia as determinate, well defined, concave structures with flexuous hyphae (Figs. 8A-C). Periphyses were not observed in my samples, and spermagonia were located on the lower surface of the leaf which has never been reported for P. mariae-wilsoniae. Bounding structures were not observed in any of the spermagonia present in my study.
Spore characteristics and stages are also useful in classifying rust fungi in a phylogenetic context (Hiratsuka and Hiratsuka, 1980). Aecia with unicellular aeciospores are typically present on both the upper and lower surface, and this was confirmed in both field examination and anatomical studies (Fig. 9B, lOB, l IB). The aecia produce one-celled aeciospores arranged in neat stacks (Fig. 9C). It's because of these complex forms and unique spore types that rusts can adapt to challenging environments (Figueiredo and Passador, 2008).
Puccinia mariae-wilsoniae lacks the uredinial stage but contains the telial stage. The telia are hypophyllous bearing oblong teliospores with cinnamon-brown walls and papilla at each end
(Arthur and Cummins, 1962). Previous studies only reported telia on the upper surface of the
13 leaves, whereas my results showed that telia are present on both leaf surfaces (Fig. 12B). These inconsistencies with previous studies called into question the identity of the rust I found at my study sites, especially if morphology is the best method foridentifying rust genera.
Autoecious rusts are believed to be more phylogenetically advanced compared to other species that require two hosts to complete their life cycle (Hennen and Buritica, 1980).
Mycologists who study Uredinales believe that rusts have been capable of changing with their hosts throughout evolutionary history (Hennen and Buritica, 1980). For example, Puccinia sporoboli var. robusta has spermagonial and aecial stages on fivedifferent Yucca but fails to
formaecia on Sansevieria (Baxter, 1971) . This may indicate that at some point in time, P. sporoboli var. robusta coevolved with species of Yucca because of host suitability. For the same reasons, it is also possible that P. mariae-wilsoniae co-evolved with C. virginica. Based on differencesI found in spermagonia, aecia and telia distribution, there is a chance that co evolution may still be occurring between this pathogen and its host
Damaging rusts, such as those found on sugarcane, have been studied in order to understand their phylogenetic relationships to other rusts through morphology and DNA sequencing (Dixon et al. , 2010). Researchers have started to rely less on morphology for rust identificationbecause these structural features can be difficult to interpret due to the variability of complex life cycles, and rapidly evolving characters (Dixon et al., 2010). In addition, rust identificationusing DNA sequences has not been performed as frequently as other fungi because of the difficulties in extracting and amplifying pure rust DNA (Aime, 2006). Dixon et al. (2010) found three larger groups within Pucciniaceae in their phylogenetic study of sugarcane rust using rDNA gene (18S and 28S) sequences (including those of P. mariae-1vilsoniae). Additional phylogenetic studies of Pucciniaceae, using LSU and SSU data in parsimony and maximum
14 likelihood analyses, show that this family has three clades (Minnis et al. 2012). Sequences of the
ITS region using rust-specific primers confirmed the identity of P. mariae-wilsoniae in my study, even though there were morphological differences with previous studies, possibly indicating that this rust has diverged enough to make it somewhat distinguishable from other rusts.
My population studies show that while plant density can be quite high, the rate of infection can be relatively low at a specific location. I also observed that the infection rate can vary at each location between years (Fig. 4). Baber's Woods had an increase in the average number of individuals present per quadrat from20 12 to 2013, but the rate of infection remained relatively constant. Laursen's Woods had a steady population, but the number of infected individuals decreased between years. Rocky Branch Nature Preserve had a greater number of individuals, while the number of plants infected per quadrat at this location was lower. It appears that there is no direct correlation between the number of individuals present per location and infection rate between the years of my study. I observed differences between total population density and the number of plants infected.
I found that Laursen's Woods and Baber's Woods showed similar patterns of plant density and incidence of infection (Fig. 5, Fig. 6). There was a correlation in number of individuals present and the proportion of infected individuals at Rocky Branch Nature Preserve
(Fig.7). This location may have showed a significant difference compared to Laursen's Woods and Baber's Woods because there was the least amount of disturbance at this location. Laursen's
Woods had previously been logged and Baber's Woods had been logged in addition to being burned. It is possible the lack of disturbances at Rocky Branch Nature Preserve may have lead to the positive association between total density and proportion of individuals infected.
15 Because C. virginica only actively grows for4-5 weeks in early spring when temperatures are optimal, it leaves the question of how this plant initially becomes infected. The location and mechanism of overwintering on this rust are still unclear. Anderson et al. (2004) found that flowering shoot biomass and fruit number both decreased by 63% and seed number decreased by 53% per fruit due to rust infection. In addition, seed production was severely decreased in late spring, when the canopy closed because it blocked available light to C. virginica growing on the forest floor(Schemske, 1977). Afterthe last flowerhas been produced, and shortly before the forestcanopy fully develops, all above ground parts of the plant begin to senesce (Schemske, 1977). If the rust is present it must also senesce, but where and how it overwinters needs further study.
16 LITERATURE CITED
Aime, M.C. 2006. Toward resolving family-level relationships in rust fungi (Uredinales).
Mycoscience 47: 112-122.
Anderson, W., D.A. Wait, and S. Dayton. 2004. Fungal infection alters community interactions
and ecosystem functions of a spring ephemeral plant [abstract] In: Ecological Society of
America Annual Meeting. 2004 August. Portland, OR.
Arthur, J.C. 1934. Manual ofthe Rusts in United States and Canada. Lafayette, Indiana: Purdue
Research Foundation.
Arthur, J.C. and G.B. Cummins. 1962. Manual of the Rusts in United States and Canada. Hafner
Publishing Company. New York. pp. 282-285.
Arthur, J.C., F.D. Kem, C.R. Orton, F.D. Fromme, H.S. Jackson, E.B. Mains, and G.R. Bisby.
1929. The Plant Rusts (Uredinales). J. Wiley & Sons, Inc. New York. pp. 446.
Baxter, J.W. 1971. Life cycle studies of two North American grass rusts. Mycologia 63: 889-
890.
Carlsward, B.S., W.L. Stem, and B. Bytebier. 2006. Comparative vegetative anatomy and
systematics of the angraecoids (Vandeae, Orchidaceae) with an emphasis on the leafless
habit. Botanical Journal of the Linnean Society 151: 165-218.
Carlsward, B.S., W.L. Stem, W.S. Judd, and T.W. Lucansky. 1997. Comparative leaf anatomy
and systematics in Dendrobium, sections Aporum and Rhizobium (Orchidaceae).
International Journal of Plant Sciences 158: 332-342.
Cummins, G.B. 1936. Phylogenetic significance of the pores in urediospores. Mycologia 28:
103-132.
Cummins, G.B. 1959. Illustrated Genera ofRust Fungi. Burgess, Minneapolis. pp. 96-97, 131.
17 Cummins, G.B. and Y. Hiratsuka. 1983. Illustrated Genera of Rust Fungi. Revised Ed. The
American Phytopathological Society, St. Paul, Minnesota. pp. 95-96, 152.
r Cummins, G.B. and Y. Hiratsuka. 2003. Illustrated Genera of Rust Fungi, 3 d Ed. American
Phytopathological Society, St. Paul, MN.
Dietel, P. 1928. Uredinales. In, Engler & Prantl, Die Natilrlichen Pflanzerifamilien, 2nd Ed. 6: 24-
98.
Dixon, L.J, L.A. Castlebury, M.C. Aime, N.C. Glynn, and J.C. Comstock. 2010. Phylogenetic
relationships of sugarcane rust fungi. Mycological Progress 9: 459-468.
Figueiredo, M.B. and M.M. Passador. 2008. Morfologia, furn;:oesdos soros e variac;:oes dos
ciclos vitais das ferrugens. Arqivos do Instituto Biol6gico 75: 117-134.
Hennen, J.F. and R. Buritica C. 1980. A brief summary of modem rust taxonomic and
evolutionary theory. Reportsof the Tottori MycologicalInstitute (Japan) 18: 243-256.
Hiratsuka, Y. and G.B. Cummins. 1963. Morphology of the spermogonia of the rust fungi.
Mycologia 55: 487-507.
Hiratsuka, Y. and N. Hiratsuka. 1980. Morphology of spermogonia and taxonomy of rust fungi.
Reports of the Tottori Mycological Institute (Japan) 18: 257-268.
Jackson, H. S. 1931. Present evolutionary tendencies and the origin of life cycles in the
Uredinales. Memoirs of the Torrey Botanical Club 18: 1-108.
Milby, T.H. 1980. Studies in the Floral Anatomy ofClaytonia (Portulacaceae). American Journal
of Botany 67: 1046-1050.
Minnis, AM., AR. McTaggart, A.Y. Rossman, and M.C. Aime. 2012. Taxonomy of mayapple
rust: The genus Allodus resurrected. Mycologia 104: 942-950.
18 Ono, Y. and J.F. Hennen. 1983. Taxonomy of the Chaconiaceous genera (Uredinales).
Transactions of the Mycological Society of Japan 24: 369-402.
Savile, D.B.O. 1976. Evolution of the rust fungi(Uredinales ) as reflected by their ecological
problems. Evolutionary Biology 9: 137-207.
Schemske, D.W. 1977. Flowering phenology and seed set in Claytoniavirginica (Portulaceae).
Bulletin of the Tottery Botanical Club 104: 254-263.
Whigham, D.F. and A.S. Chapa. 1999. Timing and intensity of herbivory: Its influence on the
performance of clonal woodland herbs. Plant Species Biology 14: 29-37.
19 TABLES
Table 1. Analysis of variance (ANOV A) for site and year data and interaction fortotal population density for all three locations.
ANOVA Source DF Mean Sguare F Value Pr>F Site 2 2447.301 7.04 0.0012 Year 1 2120.107 6. 10 0.0146 Site*Year 2 932.2591 2.68 0.0717
Table 2. Interactions between all three locations fortotal population density at each site also through the analysis of variance (ANOVA).
Tukey's Studentized Range Site Comparison Difference Between Means Simultaneous 95% Confidence Limits Baber-Laursen 11.313 2.305 20.32 Baber-Rocky 12.683 4. 138 21.229 Laursen-Baber -11.313 -20.32 -2. 305 Laursen-Rocky 1.371 -7175 9.916 Rocky-Baber -12.683 -2 1.229 -4. 138 Rocky-Laursen -1.371 -9.916 7. 175
Table 3. Analysis of covariance (ANCOVA) forsite, year, local population and their interactions for all three locations with infected individuals.
ANCOVA Source DF Te III SS Mean Sguare F Value Pr>F Site 2 0.085 0.043 1.78 0. 17 Year 1 0.019 0.019 0.78 0.38 Site*Year 2 0.11 0.054 2.23 0.11 Total 1 0.098 0.098 4.08 0.045 total*Site 2 0.20 0. 10 4. 11 0.018 total*year 1 0.000093 0.000093 0.00 0.95 total*site*year 2 0.099 0.049 2.05 0.13
20 FIGURES
Fig. 1. A) Claytonia virginicagrowing in Kentucky. B) Uninfected C. virginica plants growing in Illinois. C) Uninfected whole plant of C. vir�nica.
O.Om 3.0m 6.0m 9.0m 12.0m 15.0m
Fig. 2. Design forpopulation study. Six 0.25 m2 quadrats every 3 m along a 15 m
70
.... co: i.. 60 "C co: = O' 50 i.. � Q. rll 40 .... c::: co: ii: 30 .... 0 i.. � 20 ,.Q e = z 10
0
Baber's Woods Laursen's Woods Rocky Branch
Fig. 3. Mean population density for each quadrat. Gray bars indicate data from201 2 and black bars indicate data from 2013.
21 0. 12
Baber'sWoods Laursen'sWoods RockyBranch
Fig. 4. Proportionof infected plants per quadrat. Gray bars indicate data from 2012 and black bars indicate data from 2013.
0.3
"Cl • � "t 0.25 � ....c • c 0.2 Q • tQ §'0.15 • ""' • • � • 0. 1 •
0.05 • •
.. 0 0 10 20 30 40 50 60 70 80
Local Plant Density
Fig. 5. Interaction of population density and proportion of infected plants at Laursen's Woods, Coles Co., Illinois.
22 0.12
"Q -� c.J 0.1 • � -c § 0.08
tc s 0.06 .... � 0.04 • • 0.02 • • •
0 0 20 40 60 80 100 120 140
Local Plant Density
Fig. 6. Interaction of population density and proportion of infected plants at Baber's Woods, Edgar Co., Illinois.
0.7 "Q � • ti 0.6 � c "; 0.5 c •t: &.0.4 ....c � 0.3 • 0.2 • • • 0.1 • • ...... � .. • • • • • • 0 0 10 20 30 40 50 60 70 80
LocalPlant Density
Fig. 7. Interaction of population density and proportion of infected plants at Rocky Branch Nature Preserve, Clark Co., Illinois.
23 Fig. 8. A) Spermagonia (arrowhead) on lower leaf surface at 187.SX. B, C) Spermagonia on lower leaf surface.
Fig. 9. A) Aecia on lower leaf surface at 75X. B) Aecia on upper and lower leaf surfaces. C) Aecia with aeciospores on inflorescence axis.
Fig. 10. A) Claytonia virginica calyx infected with aecia. B) Enlarged picture of infected calyx.
24 Fig. 11. A) Infected whole plant of C. virginica with aecia. B) Enlarged picture of infected inflorescence axis.
Fig. 12. A) Telia as seen with transmitted light through an intact leaf at 37.SX. B) Telia on upper and lower leaf surfaces. C) Telia with teliospores on upper leaf surface.
A I
Fig. 13. A) Infected whole plant of C. virginica with telia. B) Enlarged picture of infected leaf and calyx.
25 VITA
Sarah Ann Schlund was bornon June 30, 1991, in Princeton, Illinois and raised in rural
Princeton on a small grain farm. She attended Princeton High School where she was a member of the National Honor Society and graduated in June, 2009. She enrolled at EasternIllinois
University in Charleston in August, 2009. While a student at EasternIllinois she was a Rising
Star Award recipient in Fall 2010, awarded the Robert Edward Witters Scholarship in Spring
2012, the Warner Award in Botany in Spring 2012, the Eunice W. Dougherty Scholarship in Fall
2012, an Errett and Maize Warner Award in Botany in Spring 2013, and the Distinguished
Senior Award in Spring 2013. Sarah received an Undergraduate Research Grant fromthe
Department of Biological Sciences in Fall 2012 and an a Undergraduate Research, Scholarship and Creative Activity Grant fromthe Honors College in Fall 2012 in support of her research.
She presented her research at ScienceFest, the NCUR conference in La Crosse, Wisconsin, and at the Illinois State Academy of Sciences annual meeting in Spring 2013. She received a SURE award from the College of Sciences and the Best Oral Presentation award in the Botany Division of the Illinois State Academy of Sciences in Spring 2013. Sarah will graduate fromEastern
Illinois University in May, 2013 with a B.S. in Biological Sciences. She will continue her education in the graduate program in Plant Pathology at the University of Nebraska-Lincoln where she will study Goss's Wilt on corn under the direction of Dr. Tamra Jackson-Ziems and
Dr. Greg Kruger.
26