DOCSLIB.ORG

Pattern of Change in Histone 3 Lysine 9 Acetylation and Histone Deacetylases in Development of Zebrafish Embryo

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pattern of Change in Histone 3 Lysine 9 Acetylation and Histone Deacetylases in Development of Zebrafish Embryo c Indian Academy of Sciences RESEARCH NOTE Pattern of change in histone 3 lysine 9 acetylation and histone deacetylases in development of zebrafish embryo YANNING LI, JUNXIA WANG, YING XIE, SHUFENG LIU∗ and YE TIAN Hebei Key Lab of Laboratory Animal, Hebei Medical University, Shijiazhuang 050017, People’s Republic of China [Li Y., Wang J., Xie Y., Liu S. and Tian Y. 2014 Pattern of change in histone 3 lysine 9 acetylation and histone deacetylases in development of zebrafish embryo. J. Genet. 93, 539–544] Introduction portion of histone proteins (Li et al. 2004). Histone acety- lation occurs at lysine residues and at positions that are Histone 3 lysine 9 acetylation (H3K9ac) is involved in devel- conserved in eukaryotes, especially for histones H3 and opment of eukaryotic organisms, and ordered H3K9 deacety- H4 (Ekwall 2005). Kratz et al. (2010) found that histone lation and individual histone deacetylase (HDAC) are essen- 3 lysine 9 acetylation (H3K9ac) is generally associated tial during embryogenesis. However, the change patterns of with transcription initiation and unfolded chromatin, thereby H3K9ac in development of zebrafish (Danio rerio)embryo positively influencing gene expression. H3K9ac has been have not been reported yet. Although single HDAC has been reported to be enriched in embryonic stem cells and may be studied, the dynamic change of HDAC profile in zebrafish a member of pluripotency (Hezroni et al. 2011). Embryonic embryo development is still unclear. In this study, zebrafish stem cell differentiation and oocyte maturation are accom- embryos were collected at various times after fertilization panied by reduced H3K9ac (Krejcí et al. 2009; Huang et al. and the level of K9-acetylated H3 (H3K9ac) and the expres- 2012). sion profiles of HDAC1, HDAC3, HDAC4 and HDAC6 Histone acetylation is regulated by the opposing histone were evaluated. The results showed that in zebrafish embryo acetyltransferase (HAT) and histone deacetylase (HDAC) development, H3K9ac content significantly decreased, espe- enzymes. Although histone acetylation is important for tran- cially at 48 h postfertilization (hpf). The expression pro- scriptional activation, removal of acetyl groups by HDACs files of HDAC1, HDAC3, HDAC4 and HDAC6 changed is equally important for gene transcription regulation (Lin during embryo development, and, moreover, the change in and Dent 2006). The HDAC superfamily is vast and ancient, HDAC3 expression was opposite to the change in level of dating back to prokaryotes (Haberland et al. 2009). The H3K9ac. The level of HDAC3 protein confirmed the expres- most studied HDACs are HDAC1, HDAC3, HDAC4 and sion changes, indicating that HDAC3 may play a role in HDAC6. As HDACs are highly conserved in many organ- H3K9 deacetylation at 48 hpf. These findings revealed the isms, their basic functions can be investigated using less change patterns of H3K9ac and HDACs in zebrafish embryo complex and experimentally tractable model organisms such development, and suggested that H3K9 deacetylation and as zebrafish (Ekwall 2005; Haberland et al. 2009; Sivasubbu HDAC3 might be more important in the middle stages than et al. 2013). other stages of zebrafish embryo development. Lin and Dent (2006) reported that ordered H3K9 deacety- Dynamic programmes of gene expression are required lation and HDACs are required during embryogenesis. for normal development, and histone modifications as epi- Embryonic development depends on HDAC1, which has genetic mechanisms of regulation of gene expression have a ubiquitous pattern of synthesis (Pillai et al. 2004;Noël been investigated in the last few years (Puppin et al. 2011; et al. 2008;Harrisonet al. 2011). HDAC3 is essential for Paradowska et al. 2012). Posttranslational modifications of proper development of many body systems (Farooq et al. histones are emerging as an important step in transcrip- 2008;Bhaskaraet al. 2010;Fenget al. 2011; Sun et al. tional regulation of eukaryotic genes. Particularly important 2011). Stage-specific expression of HDAC4 is seen during is acetylation of specific lysine residues in the N-terminal mouse and zebrafish development (Vega et al. 2004;Zhu et al. 2012). HDAC6 is a key regulator of cytoskele- ∗ ton, cell migration and cell–cell interactions (Dallavalle For correspondence. E-mail: [email protected] Yanning Li and Junxia Wang contributed equally to this work. et al. 2012;Liuet al. 2012). Although individual HDACs Keywords. embryo development; histone 3 lysine 9 acetylation; histone deacetylase; zebrafish. Journal of Genetics, Vol. 93, No. 2, August 2014 539 Yanning Li et al. have been studied in zebrafish, the expression profiles of antibody (FITC-conjugated secondary antibody, Zhongshan, HDAC1, HDAC3, HDAC4 and HDAC6 in zebrafish embryo China) for 30 min at 37◦C. After incubation with 4,6- development and the question of which HDAC plays a diamidino-2-phenylindole (DAPI) for 10 min, the embryos more decisive role in H3K9 deacetylation have not been were placed on a microscope slide and images were taken clarified. with a laser confocal scanning microscope (Olympus, Tokyo, In this study, zebrafish embryos were collected at 24 hpf, Japan). Controls (PBS instead of the first antibody) were 48 hpf and 72 hpf. The level of H3K9ac and the expres- used. sion profiles of HDAC1, HDAC3, HDAC4 and HDAC6 during embryo development were investigated with confo- cal microscopy, Western blotting and reverse transcription Reverse transcription polymerase chain reaction polymerase chain reaction (RT-PCR). Levels of mRNA of HDAC1, HDAC3, HDAC4 and HDAC6 were quantified by RT-PCR. Total RNA was isolated using Trizol reagent (Takara, Dalian, China) and reverse tran- Materials and methods scribed into cDNA using RevertAid First Strand cDNA syn- thesis kit (Fermentas, Shenzhen, China), followed by PCR Zebrafish amplification using specific primers (table 1). PCR condi- Adult zebrafish were obtained from the Department of Lab- tions were 94◦C for 5 min, followed by 94◦C for 30 s, anneal- oratory Animal Sciences, Hebei Medical University, China, ing temperature (table 1) for 30 s, and 72◦Cfor1minfora and maintained according to standard husbandry protocols total of 28 cycles, and finally 72◦C for 5 min. The amplified (Lawrence 2007;Jiaet al. 2012). Adult fish were fed brine DNA was visualized by electrophoresis on 1.5% agarose gel. ◦ shrimp twice daily. Temperature (28±0.5 C), pH (7.0±0.5), Actin primers were used as internal standard. and light cycle (14 h light / 10 h dark) were electronically controlled and remotely monitored. The night before breed- ing day, a baffle was placed to separate male and female Western blotting zebrafish. The following morning, fertilized eggs were har- vested and incubated in sterile breeding system water at Levels of histone H3, H3K9ac and HDAC3 were deter- 28◦C. Embryos were collected at 24, 48 and 72 hpf and used mined by Western blotting, using the protocol previously for further detection. described (Li et al. 2010). Briefly, zebrafish embryos were lysed in lysis buffer (RIPA, Solarbio, Beijing, China) to extract whole protein. Protein content was determined by NanoDrop-1000 (Thermo Scientific, Shanghai, China). Then, Laser confocal microscopy detection samples were separated by SDS-polyacrylamide gel elec- Zebrafish embryos were fixed in 4% paraformaldehyde, trophoresis (PAGE) and transferred to a polyvinylidene flu- washed with phosphate buffer saline (PBS), and incubated oride membrane (Millipore, Shanghai, China). After the with 1% Triton X-100 for 30 min at room temperature. Then, membrane was blocked with 5% skimmed milk in PBS, after washing with PBS, they were blocked with 10% goat anti-H3 (Cell Signaling Technology, Shanghai, China), anti- serum for 1 h and incubated with the primary antibody (anti- H3K9ac (Cell Signaling Technology), anti-HDAC3 antibod- H3K9ac, Cell Signaling Technology, Shanghai, China; anti- ies (GeneTex, Irvine, USA) or anti-beta-actin (Cell Signaling whole HDAC3, GeneTex, Irvine, USA). After again washing Technology) were used. Band intensity was quantified and with PBS, the embryos were incubated with the secondary calculated. Table 1. Primers used for PCR detection. Annealing Product Primers temperature (◦C) size (bp) HDAC1: sense 5TAGCACATAACTTTACTGTCCCATC 3 53 376 Antisense 5 ACAACCACTGAACTCTGGAATAATC 3 HDAC3: sense 5 TCAAGATACACAGGTGCCTCATTAC 3 53 379 Antisense 5 TCTGGTCATCAATGCCATCTCG 3 HDAC4: sense 5 CTCTGCTAAGGAGGAAGGACGGACC 3 55 449 Antisense 5 GAGAGTGTTGTGAGCCGAGCCGC 3 HDAC6: sense 5 GTCCCGTTGTCATCGGATACCAG 3 55 495 Antisense 5 TCCTCTGAGTTTGGGAAGAATGC 3 Actin: sense 5 TTCACCACCACAGCCGAAAGAG 3 55 222 Antisense 5 ACCGCAAGATTCCATACCCAGG 3 540 Journal of Genetics, Vol. 93, No. 2, August 2014 H3K9ac and HDAC in zebrafish embryo development Statistical analysis (figure 2). H3K9ac level was significantly lower at 48 hpf and 72 hpf (P < 0.01), then at 24 hpf (P < 0.05). At 72 hpf, Statistical analysis of the data was performed using SPSS H3K9ac was significantly higher (P < 0.05) than at 48 hpf. software (IBM, Armonk, USA) and the results are presented The results demonstrate that H3K9ac decreased during as means ± SD. The experiments were repeated twice. One- zebrafish embryo development, especially at 48 hpf. way analysis of variance (ANOVA) was used to find differ- ences, and multiple comparisons were conducted using Dun- nett’s test, and significant differences identified at P < 0.05. Expression profile of HDAC genes in zebrafish embryo development Expression of HDAC1, HDAC3, HDAC4 and HDAC6 genes Results was evaluated by RT-PCR (figure 3,A&B).HDAC3 expres- sion was higher at 48 hpf than at 24 hpf and HDAC1 expres- H3K9ac decreased with zebrafish embryo development sion was significantly lower at 72 hpf (P < 0.05). Expres- H3K9ac was detected by confocal microscopy and quanti- sion of HDAC1 and HDAC3 was lower and that of HDAC6 fied by Western blotting. H3K9ac was widespread through higher at 72 hpf than at 48 hpf (P < 0.05). The results also the embryo at 24 hpf, hardly detected at 48 hpf, and con- show that HDAC1 expression was high at 24 hpf and 48 hpf, centrated in the tail at 72 hpf (figure 1). The results were but decreased at 72 hpf.
Load more

Recommended publications
  • PCAF-Dependent Epigenetic Changes Promote Axonal Regeneration in the Central Nervous System
    ARTICLE Received 13 Dec 2013 | Accepted 27 Feb 2014 | Published 1 Apr 2014 DOI: 10.1038/ncomms4527 PCAF-dependent epigenetic changes promote axonal regeneration in the central nervous system Radhika Puttagunta1,*, Andrea Tedeschi2,*, Marilia Grando So´ria1,3, Arnau Hervera1,4, Ricco Lindner1,3, Khizr I. Rathore1, Perrine Gaub1,3, Yashashree Joshi1,3,5, Tuan Nguyen1, Antonio Schmandke1, Claudia J. Laskowski2, Anne-Laurence Boutillier6, Frank Bradke2 & Simone Di Giovanni1,4 Axonal regenerative failure is a major cause of neurological impairment following central nervous system (CNS) but not peripheral nervous system (PNS) injury. Notably, PNS injury triggers a coordinated regenerative gene expression programme. However, the molecular link between retrograde signalling and the regulation of this gene expression programme that leads to the differential regenerative capacity remains elusive. Here we show through systematic epigenetic studies that the histone acetyltransferase p300/CBP-associated factor (PCAF) promotes acetylation of histone 3 Lys 9 at the promoters of established key regeneration-associated genes following a peripheral but not a central axonal injury. Furthermore, we find that extracellular signal-regulated kinase (ERK)-mediated retrograde signalling is required for PCAF-dependent regenerative gene reprogramming. Finally, PCAF is necessary for conditioning-dependent axonal regeneration and also singularly promotes regeneration after spinal cord injury. Thus, we find a specific epigenetic mechanism that regulates axonal regeneration of CNS axons, suggesting novel targets for clinical application. 1 Laboratory for NeuroRegeneration and Repair, Center for Neurology, Hertie Institute for Clinical Brain Research, University of Tu¨bingen, 72076 Tu¨bingen, Germany. 2 Department of Axonal Growth and Regeneration, German Center for Neurodegenerative Disease, 53175 Bonn, Germany.
    [Show full text]
  • Screening HDAC Inhibitors
    APPLICATION NOTE Cellular Imaging and Analysis Key Features • Identify candidate compounds using high throughput biochemical AlphaLISA® assays • Validate candidates in a high content imaging approach HDAC inhibitor Screening HDAC Inhibitors – A Workflow Introduction Comprising High An epigenetic trait is a stably inherited phenotype resulting from changes in a Throughput and High chromosome without alterations in the Content Screening DNA sequence [Berger et al., 2009]. Key mechanisms of epigenetic gene regulation are pathways which affect the packaging of DNA into chromatin, thereby determining the accessibility of DNA to transcription. These pathways include DNA methylation, chromatin remodeling and histone modifications. Aberrations in epigenetic mechanisms are well known to be associated with the biology of cancer, which suggests that epigenetic enzymes may be promising cancer drug targets [Ducasse and Brown, 2006]. In comparison to normal cells, cancer cell genomes are characterized by, among other things, a decrease in histone modifications such as acetylation [Ropero and Esteller, 2007]. Histone acetylation by histone acetyltransferases leads to loosening of DNA-histone interactions, allowing gene expression. In contrast, histone deacetylation by histone deacetylases (HDACs) increases the interaction between DNA and histones and leads to a decrease in gene expression (Figure 1). To perform the AlphaLISA assay, all steps were performed as previously described [Rodriguez-Suarez et al., 2011]. Briefly, HDAC-1 was pre-incubated with different concentrations of the HDAC inhibitor TSA, or Assay Buffer alone, for 5 min at room temperature, before addition of the H3K9ac peptide (AnaSpec, 64361). After 1h of enzymatic reaction time, AlphaLISA Acceptor Beads (PerkinElmer, AL138C) were added and the reaction mix was incubated for 1h, followed by addition of Streptavidin Figure 1: DNA accessibility is regulated by acetylation of core histones.
    [Show full text]
  • Nucleosome Eviction Along with H3k9ac Deposition Enhances Sox2 Binding During Human Neuroectodermal Commitment
    Cell Death and Differentiation (2017) 24, 1121–1131 OPEN Official journal of the Cell Death Differentiation Association www.nature.com/cdd Nucleosome eviction along with H3K9ac deposition enhances Sox2 binding during human neuroectodermal commitment Yanhua Du1,2, Zhenping Liu2, Xinkai Cao2, Xiaolong Chen2, Zhenyu Chen3, Xiaobai Zhang2, Xiaoqing Zhang*,1,3 and Cizhong Jiang*,1,2 Neuroectoderm is an important neural precursor. However, chromatin remodeling and its epigenetic regulatory roles during the differentiation of human neuroectodermal cells (hNECs) from human embryonic stem cells (hESCs) remain largely unexplored. Here, we obtained hNECs through directed differentiation from hESCs, and determined chromatin states in the two cell types. Upon differentiation, H2A.Z-mediated nucleosome depletion leads to an open chromatin structure in promoters and upregulates expression of neuroectodermal genes. Increase in H3K9ac signals and decrease in H3K27me3 signals in promoters result in an active chromatin state and activate neuroectodermal genes. Conversely, decrease in H3K9ac signals and increase in H3K27me3 signals in promoters repress pluripotency genes. Moreover, H3K9ac signals facilitate the pluripotency factor Sox2 binding to target sites unique to hNECs. Knockdown of the acetyltransferase Kat2b erases H3K9ac signals, disrupts Sox2 binding, and fails the differentiation. Our results demonstrate a hierarchy of epigenetic regulation of gene expression during the differentiation of hNECs from hESCs through chromatin remodeling. Cell Death and Differentiation (2017) 24, 1121–1131; doi:10.1038/cdd.2017.62; published online 5 May 2017 Chromatin remodeling offers the epigenetic basis for tran- that H3K4me3 and H3K27me3 effectively distinguish genes scriptional regulation and has a pivotal role in many biological with different expression levels and reflect lineage potential.11 A processes such as cell differentiation, embryonic develop- recent HPLC-MS-based quantitative proteomics identified ment, and so on.
    [Show full text]
  • Global Histone Modifications in Breast Cancer Correlate with Tumor Phenotypes, Prognostic Factors, and Patient Outcome
    Published OnlineFirst April 14, 2009; DOI: 10.1158/0008-5472.CAN-08-3907 Research Article Global Histone Modifications in Breast Cancer Correlate with Tumor Phenotypes, Prognostic Factors, and Patient Outcome Somaia E. Elsheikh,1,7 Andrew R. Green,1 Emad A. Rakha,1 Des G. Powe,1 Rabab A. Ahmed,1,8 Hilary M. Collins,2 Daniele Soria,3 Jonathan M. Garibaldi,3 Claire E. Paish,1 Amr A. Ammar,7 Matthew J. Grainge,4 Graham R. Ball,6 Magdy K. Abdelghany,2,9 Luisa Martinez-Pomares,5 David M. Heery,2 and Ian O. Ellis1 1Department of Histopathology, School of Molecular Medical Sciences, University of Nottingham and Nottingham Universities Hospital Trust, Schools of 2Pharmacy and 3Computer Science, 4Division of Epidemiology and Public Health, and 5School of Molecular Medical Sciences, Institute of Infection, Immunity and Inflammation, University of Nottingham; 6Division of Life Sciences, Nottingham Trent University, Nottingham, United Kingdom; 7Department of Pathology, Faculty of Medicine, Menoufyia University, Menoufyia, Egypt; 8Department of Pathology, Faculty of Medicine, Asuit University, Asuit, Egypt; and 9Department of Pathology, Faculty of Medicine, Suez Canal University, Ismailia, Egypt Abstract Introduction Post-translational histone modifications are known to be Breast cancer is a heterogeneous disease ranging from altered in cancer cells, and loss of selected histone acetylation premalignant hyperproliferation to invasive and metastatic carci- and methylation marks has recently been shown to predict nomas (1). Disease progression is poorly understood but is likely patient outcome in human carcinoma. Immunohistochemistry due to the accumulation of genetic mutations leading to was used to detect a series of histone lysine acetylation widespread changes in gene expression and, in particular, affecting (H3K9ac, H3K18ac, H4K12ac, and H4K16ac), lysine methyla- the expression of tumor suppressors and oncogenes (2).
    [Show full text]
  • Epigenomic Analysis Reveals DNA Motifs Regulating Histone Modifications in Human and Mouse
    Epigenomic analysis reveals DNA motifs regulating histone modifications in human and mouse Vu Ngoa,1, Zhao Chenb,1, Kai Zhanga, John W. Whitakerb, Mengchi Wanga, and Wei Wanga,b,c,2 aGraduate Program of Bioinformatics and Systems Biology, University of California, San Diego, La Jolla, CA 92093-0359; bDepartment of Chemistry and Biochemistry, University of California, San Diego, La Jolla, CA 92093-0359; and cDepartment of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, CA 92093-0359 Edited by Steven Henikoff, Fred Hutchinson Cancer Research Center, Seattle, WA, and approved January 3, 2019 (received for review August 6, 2018) Histones are modified by enzymes that act in a locus, cell-type, and An analogy is that a transcription factor (TF) recognizes the same developmental stage-specific manner. The recruitment of enzymes DNA motif but its binding sites are cell-type–dependent. However, if to chromatin is regulated at multiple levels, including interaction we identify all motifs enriched in the TF binding sites across a large with sequence-specific DNA-binding factors. However, the DNA- and diverse set of cell types, the most common motif is likely the one binding specificity of the regulatory factors that orchestrate spe- recognized by the TF. Histone modifications are more complicated cific histone modifications has not been broadly mapped. We have than a single TF binding and one histone mark can be regulated by analyzed 6 histone marks (H3K4me1, H3K4me3, H3K27ac, H3K27me3, K3H9me3, H3K36me3) across 121 human cell types and tissues from multiple factors recognizing different motifs. Therefore, a compar- the NIH Roadmap Epigenomics Project as well as 8 histone marks ative analysis across diverse cell types/tissues is critical.
    [Show full text]
  • Epigenetics and Chromatin/Cellcycle2019 Histone
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.16.341446; this version posted October 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Epigenetics and Chromatin/CellCycle2019 Histone modifications form a cell-type-specific chromosomal bar code that modulates and maintains patterns of gene expression through the cell cycle John A. Halsall1*, Simon Andrews2, Felix Krueger2, Charlotte E. Rutledge1, Gabriella Ficz3, Wolf Reik3, Bryan M. Turner1* 1: Chromatin and Gene Regulation Group, Institute of Cancer and Genomic Sciences, University of Birmingham, UK 2: Bioinformatics, The Babraham Institute, Cambridge, UK 3: Epigenetics Programme, The Babraham Institute, Cambridge, UK *Corresponding Authors: Professor Bryan Turner, Dr John Halsall, Chromatin and Gene Regulation Group, Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, University of Birmingham, B15 2TT Email: [email protected] [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.16.341446; this version posted October 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Epigenetics and Chromatin/CellCycle2019 ABSTRACT Background Chromatin configuration influences gene expression in eukaryotes at multiple levels, from individual nucleosomes to chromatin domains several Mb long. Post-translational modifications (PTM) of core histones seem to be involved in chromatin structural transitions, but how remains unclear.
    [Show full text]
  • Histone H3k9ac Antibody, SNAP-Chip® Certified Catalog No
    Histone H3K9ac Antibody, SNAP-ChIP® Certified Catalog No. 13-0033 Lot No. 21125003-01 Pack Size 100 µg Type Monoclonal Host Rabbit Target Size 15 kDa Reactivity H, M, WR Format Aff. Pur. IgG Appl. ChIP, ChIP-Seq, WB, ICC, E, L Product Description: This antibody meets EpiCypher’s “SNAP-ChIP® Certified” criteria for SNAP-ChIP-qPCR: Histone H3K9ac antibody (3 μg) was tested in specificity and efficient target enrichment in a ChIP experiment (<20% a native ChIP experiment using chromatin from K-562 cells (3 μg) cross-reactivity across the panel, >5% recovery of target input). with the SNAP-ChIP K-AcylStat Panel (EpiCypher Catalog No. Histone H3 is one of the four proteins that are present in the 19-3001) spiked-in prior to micrococcal nuclease digestion. nucleosome, the basic repeating subunit of chromatin, consisting of Specificity (left y-axis) was determined by qPCR for the DNA 147 base pairs of DNA wrapped around an octamer of core histone barcodes corresponding to modified nucleosomes in the SNAP- proteins (H2A, H2B, H3 and H4). This antibody reacts to H3K9ac ChIP K-AcylStat panel (x-axis). Black bar represents antibody when present alone as well as in combination with nearby acetylations efficiency (right y-axis; log scale) and indicates percentage of the (tetraAc-H3). No cross reactivity with extended acyl states (H3K9bu, target immunoprecipitated relative to input. H3K9cr) or other lysine acylations in the EpiCypher SNAP-ChIP K- tetraAc-H3 is K4,K9,K14,K18ac; tetraAc-H4 is K5,K8,K12,K16ac; AcylStat panel is detected. tetraAc-H2A is K5,K8,K13,K15ac Immunogen: Synthetic peptide corresponding to histone H3 acetylated lysine 9.
    [Show full text]
  • Original Article Expression of SIRT1, H3k9me3, H3k9ac and E-Cadherin and Its Correlations with Clinicopathological Characteristics in Gastric Cancer Patients
    Int J Clin Exp Med 2016;9(9):17219-17231 www.ijcem.com /ISSN:1940-5901/IJCEM0019542 Original Article Expression of SIRT1, H3K9me3, H3K9Ac and E-cadherin and its correlations with clinicopathological characteristics in gastric cancer patients Jiajia Xu1, Weijie Wang2, Xueqing Wang1, Lihua Zhang1, Peilin Huang3 1Department of Pathology, Zhongda Hospital, School of Medicine, Southeast University, Nanjing 210009, China; 2Department of Gynaecology and Obstetrics, Subei People’s Hospital, Yangzhou 225001, China; 3School of Medi- cine, Southeast University, Nanjing 210009, China Received November 10, 2015; Accepted January 23, 2016; Epub September 15, 2016; Published September 30, 2016 Abstract: Aberrant expression of SIRT1, H3K9me3, H3K9Ac and E-cadherin is considered to be associated with tu- morigenesis and survival outcomes. In this study, we aim to investigate the expression of SIRT1, H3K9me3, H3K9Ac and E-cadherin and their associations with clinicopathological features in gastric cancer. A total of 105 gastric can- cer samples were obtained from patients underwent gastrectomy. Twenty corresponding normal adjacent tissues were simultaneously taken as control. The expression of SIRT1, H3K9me3, H3K9Ac and E-cadherin in these tissues was detected by immunohistochemical and their correlations with clinicopathological features were analyzed. Sig- nificant increase of SIRT1 expression was noted in gastric cancer compared with that of normal adjacent tissues (P<0.001). SIRT1 expression was markedly associated with tumor invasion depth (P=0.026), lymph node metasta- sis (P=0.001), clinical stage (P=0.004) and survival time (P=0.029). No significant difference was identified in the expression of H3K9Ac between gastric and normal tissues. Furthermore, the expression of H3K9Ac was unrelated with gender, age, tumor size, differential degree, invasion depth, lymph node metastasis, clinical stage and survival time (P>0.05).
    [Show full text]
  • Alphalisa Acetyl-Histone H3 Lysine 9 (H3k9ac)
    TECHNICAL NOTE AlphaLISA Acetyl-Histone H3 Lysine 9 AlphaLISA #13 (H3K9ac) Cellular Detection Kit Authors Jean-Philippe Levesque-Sergerie Marie Boulé Anne Labonté Jean-Francois Michaud Nathalie Rouleau Lucille Beaudet ® Mathieu Arcand AlphaLISA PerkinElmer, Inc. Montreal, QC Canada, H3J 1R4 This AlphaLISA® immunodetection assay monitors changes in the levels of acetylated histone H3 lysine 9 (H3K9ac) in cellular extracts. Emission • AL714C: 500 assay points 615 nm • AL714F: 5,000 assay points Biotin Anti-H3 AlphaLISA Assays K Excitation B Anti-mark The AlphaLISA technology allows performing no-wash homogeneous 680 nm Acceptor proximity immunoassays using Alpha Donor and AlphaLISA Acceptor beads. In this technical note, we present an optimized assay for Streptavidin Extracted Donor Histone H3 measuring changes in the levels of H3K9ac after treatment of cells with sodium butyrate and Trichostatin A (TSA), two non-selective Figure 1. Schematic representation of the AlphaLISA cellular assay for the detection of histone deacetylase (HDAC) inhibitors. Following a homogeneous modified histone proteins. histone extraction protocol, the mark of interest is detected by the addition of a biotinylated anti-Histone H3 (C-terminus) antibody and AlphaLISA Acceptor beads conjugated to an antibody (Ab) specific to the mark. The biotinylated antibody is then captured by Streptavidin (SA) Donor beads, bringing the two beads into proximity. Upon laser irradiation of the Donor beads at 680 nm, short-lived singlet oxygen molecules produced by the Donor beads can reach the Acceptor beads in proximity to generate an amplified chemiluminescent signal at 615 nm. Detection of Histone H3 Acetylated on Lysine 9 in Standard Protocol Cellular Extracts: • Distribute 10 µL of cells in the wells of a CulturPlate-384 microtiter plate.
    [Show full text]
  • Natural Antisense Transcript PEBP1P3 Regulates the RNA Expression, DNA Methylation and Histone Modification of CD45 Gene
    G C A T T A C G G C A T genes Article Natural Antisense Transcript PEBP1P3 Regulates the RNA Expression, DNA Methylation and Histone Modification of CD45 Gene Zhongjing Su 1,* , Guangyu Liu 2, Bin Zhang 1, Ze Lin 3 and Dongyang Huang 2,* 1 Department of Histology and Embryology, Shantou University Medical College, No. 22, Xinling Road, Shantou 515041, China; [email protected] 2 Department of Cell Biology, Shantou University Medical College, No. 22, Xinling Road, Shantou 515041, China; [email protected] 3 Department of Central Laboratory, Shantou University Medical College, No. 22, Xinling Road, Shantou 515041, China; [email protected] * Correspondence: [email protected] (Z.S.); [email protected] (D.H.) Abstract: The leukocyte common antigen CD45 is a transmembrane phosphatase expressed on all nucleated hemopoietic cells, and the expression levels of its splicing isoforms are closely related to the development and function of lymphocytes. PEBP1P3 is a natural antisense transcript from the opposite strand of CD45 intron 2 and is predicted to be a noncoding RNA. The genotype-tissue expression and quantitative PCR data suggested that PEBP1P3 might be involved in the regulation of expression of CD45 splicing isoforms. To explore the regulatory mechanism of PEBP1P3 in CD45 expression, DNA methylation and histone modification were detected by bisulfate sequencing PCR and chromatin immunoprecipitation assays, respectively. The results showed that after the antisense RNA PEBP1P3 was knocked down by RNA interference, the DNA methylation of CD45 intron 2 Citation: Su, Z.; Liu, G.; Zhang, B.; was decreased and histone H3K9 and H3K36 trimethylation at the alternative splicing exons of Lin, Z.; Huang, D.
    [Show full text]
  • The Involvement of Histone H3 Acetylation in Bovine Herpesvirus 1 Replication in MDBK Cells
    viruses Article The Involvement of Histone H3 Acetylation in Bovine Herpesvirus 1 Replication in MDBK Cells Liqian Zhu 1,2,*,† , Xinyi Jiang 1,2,†, Xiaotian Fu 1,2, Yanhua Qi 3 and Guoqiang Zhu 1,2,* 1 College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China; [email protected] (X.J.); [email protected] (X.F.) 2 Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, China 3 College of Life Science, Zhengzhou University, Zhengzhou 450066, China; [email protected] * Correspondence: [email protected] (L.Z.); [email protected] (G.Z.) † These authors contributed equally to this work. Received: 3 August 2018; Accepted: 25 September 2018; Published: 27 September 2018 Abstract: During bovine herpesvirus 1 (BoHV-1) productive infection in cell cultures, partial of intranuclear viral DNA is present in nucleosomes, and viral protein VP22 associates with histones and decreases histone H4 acetylation, indicating the involvement of histone H4 acetylation in virus replication. In this study, we demonstrated that BoHV-1 infection at the late stage (at 24 h after infection) dramatically decreased histone H3 acetylation [at residues K9 (H3K9ac) and K18 (H3K18ac)], which was supported by the pronounced depletion of histone acetyltransferases (HATs) including CBP/P300 (CREB binding protein and p300), GCN5L2 (general control of amino acid synthesis yeast homolog like 2) and PCAF (P300/CBP-associated factor). The depletion of GCN5L2 promoted by virus infection was partially mediated by ubiquitin-proteasome pathway. Interestingly, the viral replication was enhanced by HAT (histone acetyltransferase) activator CTPB [N-(4-Chloro-3-trifluoromethylphenyl)-2-ethoxy-6-pentadecylbenzamide], and vice versa, inhibited by HAT inhibitor Anacardic acid (AA), suggesting that BoHV-1 may take advantage of histone acetylation for efficient replication.
    [Show full text]
  • Mitotic H3k9ac Is Controlled by Phase-Specific Activity of HDAC2, HDAC3 and SIRT1
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.08.434337; this version posted March 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Mitotic H3K9ac is controlled by phase-specific activity of HDAC2, HDAC3 and SIRT1 Shashi Gandhi1, Raizy Mitterhoff1, Rachel Rapoport1, Sharon Eden1, Alon Goran2 and Itamar Simon1* 1Department of Microbiology and Molecular Genetics, Institute of Medical Research Israel-Canada, Faculty of Medicine, The Hebrew University, Jerusalem 91120, Israel; 2 Department of Medicine, University of California, San Diego, La Jolla, California 92093, USA *Corresponding Author [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.03.08.434337; this version posted March 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Mitosis comprises multiple changes, including chromatin condensation and transcription reduction. Intriguingly, while histone acetylation levels are reduced during mitosis, the mechanism of this reduction is unclear. We studied the mitotic regulation of H3K9ac by using inhibitors of histone deacetylases. We evaluated the involvement of the targeted enzymes in regulating H3K9ac during mitotic stages and cytokinesis by immunofluorescence and immunoblots. We identified HDAC2, HDAC3 and SIRT1 as modulators of the mitotic levels of H3K9ac. HDAC2 inhibition increased H3K9ac levels in prophase, whereas HDAC3 or SIRT1 inhibition, increased H3K9ac levels in metaphase.
    [Show full text]