Genome-Wide Disease Screening in Early Human Embryos with Primary Template-Directed Amplification
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Identification of FBXL4 As a Metastasis Associated Gene in Prostate Cancer
Identification of FBXL4 as a Metastasis Associated Gene in Prostate Cancer Elzbieta Stankiewicz1 , Xueying Mao1, D Chas Mangham2 , Lei Xu1, Marc Yeste- Velasco1, Gabrielle Fisher3, Bernard North3, Tracy Chaplin1, Bryan Young4, Yuqin Wang1, Jasmin Kaur Bansal1, Sakunthala Kudahetti1, Lucy Spencer1, Christopher S Foster5, Henrik Moller6, Peter Scardino7, R Tim Oliver1, Jonathan Shamash1, Jack Cuzick3, Colin S Cooper8, Daniel M Berney1,+, Yong-Jie Lu1,+,* 1 Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK 2 The Robert Jones and Agnes Hunt Orthopaedic Hospital, Department of Pathology, Oswestry, Shropshire SY10 7AG, UK 3 Cancer Research UK Centre for Epidemiology, Mathematics and Statistics, Wolfson Institute of Preventive Medicine, Queen Mary University of London, London EC1 6BQ, UK 4 Centre for Haemato-Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK 5 Division of Cellular and Molecular Pathology, University of Liverpool, Liverpool L69 3BX, UK 6 King's College London, Cancer Epidemiology and Population Health, London SE1 9RT, UK 7 Department of Urology, Memorial Sloan Kettering Cancer Center, New York, NY 10065, USA 1 8 School of Medicine, University of East Anglia, Norwich, NR4 7TJ, UK +These authors contributed equally as senior role *Corresponding author: Yong-Jie Lu, Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, Telephone number: 442078823563, Fax: 442078823884, e-mail address: [email protected] 2 Abstract Prostate cancer is the most common cancer among western men, with a significant mortality and morbidity reported for advanced metastatic disease. Current understanding of metastatic disease is limited due to difficulty of sampling as prostate cancer mainly metastasizes to bone. -
Exploring the Relationship Between Gut Microbiota and Major Depressive Disorders
E3S Web of Conferences 271, 03055 (2021) https://doi.org/10.1051/e3sconf/202127103055 ICEPE 2021 Exploring the Relationship between Gut Microbiota and Major Depressive Disorders Catherine Tian1 1Shanghai American School, Shanghai, China Abstract. Major Depressive Disorder (MDD) is a psychiatric disorder accompanied with a high rate of suicide, morbidity and mortality. With the symptom of an increasing or decreasing appetite, there is a possibility that MDD may have certain connections with gut microbiota, the colonies of microbes which reside in the human digestive system. In recent years, more and more studies started to demonstrate the links between MDD and gut microbiota from animal disease models and human metabolism studies. However, this relationship is still largely understudied, but it is very innovative since functional dissection of this relationship would furnish a new train of thought for more effective treatment of MDD. In this study, by using multiple genetic analytic tools including Allen Brain Atlas, genetic function analytical tools, and MicrobiomeAnalyst, I explored the genes that shows both expression in the brain and the digestive system to affirm that there is a connection between gut microbiota and the MDD. My approach finally identified 7 MDD genes likely to be associated with gut microbiota, implicating 3 molecular pathways: (1) Wnt Signaling, (2) citric acid cycle in the aerobic respiration, and (3) extracellular exosome signaling. These findings may shed light on new directions to understand the mechanism of MDD, potentially facilitating the development of probiotics for better psychiatric disorder treatment. 1 Introduction 1.1 Major Depressive Disorder Major Depressive Disorder (MDD) is a mood disorder that will affect the mood, behavior and other physical parts. -
Global Ubiquitylation Analysis of Mitochondria in Primary Neurons
bioRxiv preprint doi: https://doi.org/10.1101/2021.04.01.438131; this version posted April 1, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Global ubiquitylation analysis of mitochondria in primary neurons identifies physiological Parkin targets following activation of PINK1 Odetta Antico1#, Alban Ordureau2#, Michael Stevens1, Francois Singh1, Marek φ Gierlinski3, Erica Barini1 , Mollie L. Rickwood1, Alan Prescott4, Rachel Toth1, Ian G. Ganley1, J. Wade Harper2*, and Miratul M. K. Muqit1* 1MRC Protein Phosphorylation and Ubiquitylation Unit, School of Life Sciences, University of Dundee, Dundee, United Kingdom, DD1 5EH, U.K. 2Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA 3Data Analysis Group, Division of Computational Biology, School of Life Sciences, University of Dundee, Dundee, United Kingdom, DD1 5EH, U.K. 4Dundee Imaging Facility, School of Life Sciences, University of Dundee, Dundee, United Kingdom, DD1 5EH, U.K #Denotes Equal Contribution φCurrent address: AbbVie Deutschland GmbH & Co, Knollstr, 67061, Ludwigshafen, Germany *Correspondence: [email protected] or [email protected] Keywords Neurons, PINK1, Parkin, ubiquitin, Parkinson’s disease, Mitochondria, Running Title: Ubiquitin analysis of mitochondria in neurons 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.01.438131; this version posted April 1, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. -
Highly Frequent Allelic Loss of Chromosome 6Q16-23 in Osteosarcoma: Involvement of Cyclin C in Osteosarcoma
1153-1158 5/11/06 16:31 Page 1153 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 18: 1153-1158, 2006 Highly frequent allelic loss of chromosome 6q16-23 in osteosarcoma: Involvement of cyclin C in osteosarcoma NORIHIDE OHATA1, SACHIO ITO2, AKI YOSHIDA1, TOSHIYUKI KUNISADA1, KUNIHIKO NUMOTO1, YOSHIMI JITSUMORI2, HIROTAKA KANZAKI2, TOSHIFUMI OZAKI1, KENJI SHIMIZU2 and MAMORU OUCHIDA2 1Science of Functional Recovery and Reconstruction, 2Department of Molecular Genetics, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, Shikata-cho 2-5-1, Okayama 700-8558, Japan Received June 13, 2006; Accepted August 14, 2006 Abstract. The molecular pathogenesis of osteosarcoma is very rearrangements (1,2). It has been reported that both RB1 and complicated and associated with chaotic abnormalities on many TP53 pathways are inactivated, and the regulation of cell cycle chromosomal arms. We analyzed 12 cases of osteosarcomas is impaired in most osteosarcomas (1). For example, deletion/ with comparative genomic hybridization (CGH) to identify mutation of the CDKN2A gene encoding both p16INK4A and chromosomal imbalances, and detected highly frequent p14ARF on 9p21 (3-5), amplification of the CDK4 (6), CCND1, chromosomal alterations in chromosome 6q, 8p, 10p and MDM2 genes (4), and other aberrations related to inactivation 10q. To define the narrow rearranged region on chromosome 6 of these pathways have been found. Tumor suppressor genes with higher resolution, loss of heterozygosity (LOH) analysis (TSGs) are suspected to be involved in tumorigenesis of was performed with 21 microsatellite markers. Out of 31 cases, osteosarcoma. Loss of heterozygosity (LOH) studies have 23 cases (74%) showed allelic loss at least with one marker on detected frequent allelic loss at 3q, 13q, 17p and 18q (7). -
Lessons Learned from Additional Research Analyses of Unsolved Clinical Exome Cases Mohammad K
Eldomery et al. Genome Medicine (2017) 9:26 DOI 10.1186/s13073-017-0412-6 RESEARCH Open Access Lessons learned from additional research analyses of unsolved clinical exome cases Mohammad K. Eldomery1,18†, Zeynep Coban-Akdemir1†, Tamar Harel1†,JillA.Rosenfeld1, Tomasz Gambin1,2, Asbjørg Stray-Pedersen3, Sébastien Küry4,SandraMercier4,5,DavorLessel6,JonasDenecke7, Wojciech Wiszniewski1,8, Samantha Penney1, Pengfei Liu1,9,WeiminBi1,9, Seema R. Lalani1,8, Christian P. Schaaf1,8,10, Michael F. Wangler1,8, Carlos A. Bacino1,8, Richard Alan Lewis1,10, Lorraine Potocki1,8, Brett H. Graham1,8,JohnW.Belmont1,8, Fernando Scaglia1,8,JordanS.Orange11,12, Shalini N. Jhangiani13,TheodoreChiang13, Harsha Doddapaneni13, Jianhong Hu13, Donna M. Muzny13, Fan Xia1,9, Arthur L. Beaudet1,9,EricBoerwinkle13,14, Christine M. Eng1,9, Sharon E. Plon1,8,11,15,V.ReidSutton1,8, Richard A. Gibbs1,13,16, Jennifer E. Posey1, Yaping Yang1,9 and James R. Lupski1,8,11,13,17* Abstract Background: Given the rarity of most single-gene Mendelian disorders, concerted efforts of data exchange between clinical and scientific communities are critical to optimize molecular diagnosis and novel disease gene discovery. Methods: We designed and implemented protocols for the study of cases for which a plausible molecular diagnosis was not achieved in a clinical genomics diagnostic laboratory (i.e. unsolved clinical exomes). Such cases were recruited to a research laboratory for further analyses, in order to potentially: (1) accelerate novel disease gene discovery; (2) increase the molecular diagnostic yield of whole exome sequencing (WES); and (3) gain insight into the genetic mechanisms of disease. Pilot project data included 74 families, consisting mostly of parent–offspring trios. -
A Genomic Approach to Delineating the Occurrence of Scoliosis in Arthrogryposis Multiplex Congenita
G C A T T A C G G C A T genes Article A Genomic Approach to Delineating the Occurrence of Scoliosis in Arthrogryposis Multiplex Congenita Xenia Latypova 1, Stefan Giovanni Creadore 2, Noémi Dahan-Oliel 3,4, Anxhela Gjyshi Gustafson 2, Steven Wei-Hung Hwang 5, Tanya Bedard 6, Kamran Shazand 2, Harold J. P. van Bosse 5 , Philip F. Giampietro 7,* and Klaus Dieterich 8,* 1 Grenoble Institut Neurosciences, Université Grenoble Alpes, Inserm, U1216, CHU Grenoble Alpes, 38000 Grenoble, France; [email protected] 2 Shriners Hospitals for Children Headquarters, Tampa, FL 33607, USA; [email protected] (S.G.C.); [email protected] (A.G.G.); [email protected] (K.S.) 3 Shriners Hospitals for Children, Montreal, QC H4A 0A9, Canada; [email protected] 4 School of Physical & Occupational Therapy, Faculty of Medicine and Health Sciences, McGill University, Montreal, QC H3G 2M1, Canada 5 Shriners Hospitals for Children, Philadelphia, PA 19140, USA; [email protected] (S.W.-H.H.); [email protected] (H.J.P.v.B.) 6 Alberta Congenital Anomalies Surveillance System, Alberta Health Services, Edmonton, AB T5J 3E4, Canada; [email protected] 7 Department of Pediatrics, University of Illinois-Chicago, Chicago, IL 60607, USA 8 Institut of Advanced Biosciences, Université Grenoble Alpes, Inserm, U1209, CHU Grenoble Alpes, 38000 Grenoble, France * Correspondence: [email protected] (P.F.G.); [email protected] (K.D.) Citation: Latypova, X.; Creadore, S.G.; Dahan-Oliel, N.; Gustafson, Abstract: Arthrogryposis multiplex congenita (AMC) describes a group of conditions characterized A.G.; Wei-Hung Hwang, S.; Bedard, by the presence of non-progressive congenital contractures in multiple body areas. -
Journal Pre-Proof
Journal Pre-proof A novel homozygous missense variant in MATN3 causes spondylo-epimetaphyseal dysplasia Matrilin 3 type in a consanguineous family Samina Yasin, Saima Mustafa, Arzoo Ayesha, Muhammad Latif, Mubashir Hassan, Muhammad Faisal, Outi Makitie, Furhan Iqbal, Sadaf Naz PII: S1769-7212(20)30038-0 DOI: https://doi.org/10.1016/j.ejmg.2020.103958 Reference: EJMG 103958 To appear in: European Journal of Medical Genetics Received Date: 22 January 2020 Revised Date: 11 May 2020 Accepted Date: 17 May 2020 Please cite this article as: S. Yasin, S. Mustafa, A. Ayesha, M. Latif, M. Hassan, M. Faisal, O. Makitie, F. Iqbal, S. Naz, A novel homozygous missense variant in MATN3 causes spondylo-epimetaphyseal dysplasia Matrilin 3 type in a consanguineous family, European Journal of Medical Genetics (2020), doi: https://doi.org/10.1016/j.ejmg.2020.103958. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier Masson SAS. Authorship statement Samina Yasin: Methodology, Investigation, Formal analysis, Data curation, -
Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ...................................................... -
Mutations in FBXL4, Encoding a Mitochondrial Protein, Cause Early-Onset Mitochondrial Encephalomyopathy
ARTICLE Mutations in FBXL4, Encoding a Mitochondrial Protein, Cause Early-Onset Mitochondrial Encephalomyopathy Xiaowu Gai,1,21 Daniele Ghezzi,2,21 Mark A. Johnson,3,21 Caroline A. Biagosch,4,5,21 Hanan E. Shamseldin,6,21 Tobias B. Haack,4,5,21 Aurelio Reyes,3 Mai Tsukikawa,7 Claire A. Sheldon,7 Satish Srinivasan,8 Matteo Gorza,4,5 Laura S. Kremer,4,5 Thomas Wieland,4,5 Tim M. Strom,4,5 Erzsebet Polyak,7 Emily Place,7,9 Mark Consugar,10 Julian Ostrovsky,8 Sara Vidoni,3 Alan J. Robinson,3 Lee-Jun Wong,10 Neal Sondheimer,7 Mustafa A. Salih,11 Emtethal Al-Jishi,12 Christopher P. Raab,13 Charles Bean,13 Francesca Furlan,14 Rossella Parini,14 Costanza Lamperti,2 Johannes A. Mayr,15 Vassiliki Konstantopoulou,16 Martina Huemer,17 Eric A. Pierce,9,18 Thomas Meitinger,4,5 Peter Freisinger,19,22 Wolfgang Sperl,15,22 Holger Prokisch,4,5,22 Fowzan S. Alkuraya,6,20,22,* Marni J. Falk,7,22 and Massimo Zeviani2,3,22,* Whole-exome sequencing and autozygosity mapping studies, independently performed in subjects with defective combined mitochon- drial OXPHOS-enzyme deficiencies, identified a total of nine disease-segregating FBXL4 mutations in seven unrelated mitochondrial disease families, composed of six singletons and three siblings. All subjects manifested early-onset lactic acidemia, hypotonia, and devel- opmental delay caused by severe encephalomyopathy consistently associated with progressive cerebral atrophy and variable involve- ment of the white matter, deep gray nuclei, and brainstem structures. A wide range of other multisystem features were variably seen, including dysmorphism, skeletal abnormalities, poor growth, gastrointestinal dysmotility, renal tubular acidosis, seizures, and episodic metabolic failure. -
Hypoxia Drives Transient Site-Specific Copy Gain and Drug-Resistant Gene Expression
Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Hypoxia drives transient site-specific copy gain and drug-resistant gene expression Joshua C. Black,1,7 Elnaz Atabakhsh,1,7 Jaegil Kim,2,7 Kelly M. Biette,1 Capucine Van Rechem,1 Brendon Ladd,1 Paul d. Burrowes,1 Carlos Donado,1 Hamid Mattoo,1 Benjamin P. Kleinstiver,3,4 Bing Song,1 Grasiella Andriani,5 J. Keith Joung,3,4 Othon Iliopoulos,1,6 Cristina Montagna,5 Shiv Pillai,1 Gad Getz,2,3 and Johnathan R. Whetstine1 1Massachusetts General Hospital Cancer Center, Department of Medicine, Harvard Medical School, Charlestown, Massachusetts 02129, USA; 2Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, Massachusetts 02142, USA; 3Massachusetts General Hospital Cancer Center, Department of Pathology, Harvard Medical School, Charlestown, Massachusetts 02129, USA; 4Massachusetts General Hospital Center for Computational and Integrative Biology, Charlestown, Massachusetts 02129, USA; 5Department of Genetics, Pathology, Albert Einstein College of Medicine, Yeshiva University, Bronx, New York 10461, USA; 6Department of Medicine, Division of Hematology-Oncology, Massachusetts General Hospital, Boston, Massachusetts 02114, USA Copy number heterogeneity is a prominent feature within tumors. The molecular basis for this heterogeneity re- mains poorly characterized. Here, we demonstrate that hypoxia induces transient site-specific copy gains (TSSGs) in primary, nontransformed, and transformed human cells. Hypoxia-driven copy gains are not dependent on HIF1α or HIF2α; however, they are dependent on the KDM4A histone demethylase and are blocked by inhibition of KDM4A with a small molecule or the natural metabolite succinate. Furthermore, this response is conserved at a syntenic region in zebrafish cells. -
FBXL4 Gene F-Box and Leucine Rich Repeat Protein 4
FBXL4 gene F-box and leucine rich repeat protein 4 Normal Function The FBXL4 gene provides instructions for making a member of a family of proteins called F-box and leucine rich repeat proteins. Like other members of this family, FBXL4 associates with a group of proteins to form a complex. The protein complex that contains FBXL4 is found within cell structures called mitochondria. Mitochondria are involved in a wide variety of cellular activities, including energy production, chemical signaling, and regulation of cell growth and division (proliferation) and cell death ( apoptosis). Mitochondria contain their own DNA, known as mitochondrial DNA (mtDNA), which is essential for the normal function of these structures. As part of the protein complex, the FBXL4 protein is likely involved in the maintenance of mtDNA. Having an adequate amount of mtDNA is essential for normal energy production within cells. Health Conditions Related to Genetic Changes FBXL4-related encephalomyopathic mitochondrial DNA depletion syndrome More than 47 mutations in the FBXL4 gene have been found to cause FBXL4-related encephalomyopathic mtDNA depletion syndrome. This condition affects multiple body systems and is often fatal in early childhood. It is primarily associated with brain dysfunction combined with muscle weakness (encephalomyopathy). Many of the mutations that cause FBXL4-related encephalomyopathic mtDNA depletion syndrome impair the FBXL4 protein's ability to attach (bind) to other proteins, disrupting the formation of the protein complex, which impairs normal maintenance of mtDNA. Problems with mtDNA maintenance can reduce the amount of mtDNA (known as mtDNA depletion). Depletion of mtDNA impairs mitochondrial function in many of the body's cells and tissues. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name F-box and leucine-rich repeat protein 4 Gene Symbol FBXL4 Organism Human Gene Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box) which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains Fbls containing leucine-rich repeats and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and in addition to an F-box contains at least 9 tandem leucine-rich repeats. Gene Aliases FBL4, FBL5 RefSeq Accession No. NC_000006.11, NT_025741.15 UniGene ID Hs.536850 Ensembl Gene ID ENSG00000112234 Entrez Gene ID 26235 Assay Information Unique Assay ID qHsaCIP0030601 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000369244, ENST00000229971 Amplicon Context Sequence TCTCAGAAATAACTTCTAAGCAAGTTTCATTAAGAAAGTGGCTGCAAGACAATTCA AGGCGTACTAATTCGGATCCACAAACCTTCAGAAACCTGCTAAATCCTGCAACAG AGATGAAGCCTCTATTGCCA Amplicon Length (bp) 101 Chromosome Location 6:99347266-99353340 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 102 R2 0.9987 cDNA Cq 21.77 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 81.5