DOCSLIB.ORG

Mutational and Functional Analysis Reveals ADAMTS18 Metalloproteinase As a Novel Oncogene in Melanoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mutational and Functional Analysis Reveals ADAMTS18 Metalloproteinase As a Novel Oncogene in Melanoma Supplementary Material: Mutational and Functional Analysis Reveals ADAMTS18 Metalloproteinase as a Novel Oncogene in Melanoma Yardena Samuels* * Corresponding author: Yardena Samuels, National Human Genome Research Institute, NIH, 50 South Drive, MSC 8000, Building 50, Room 5140, Bethesda MD 20892-8000, Phone: 301-451-2628, Fax: 301-480-9864, Email: [email protected] Supplementary Figures A T:A-> A:T ADAMTS genes T:A-> G:C T:A-> C:G C:G->A:T Mutation Type C:G->G:C C:G->T:A 0102030405060 Number of Mutations B T:A-> A:T ADAMTS18 T:A-> G:C T:A-> C:G C:G->A:T Mutation Type C:G->G:C C:G->T:A 024681012 Number of Mutations Supplementary Figure 1. Mutation spectra of single base pair substitutions. The number of each of the six classes of base substitutions resulting in nonsynonymous changes are shown in (A) for ADAMTS genes and in (B) for ADAMTS18 gene. A Reference Reference Tumor Tumor D8 D21 11608 13664 C230T(S77L) C637T(R213W) Reference Reference Tumor Tumor C16 B15 11254 13948 C2939A(P980H) C2954G(A985G) Reference Reference Tumor Tumor 13MD B01 13562 11704 C697T(P233S) G1359A(G450E) B Normal Tumor G299A(R100Q) C1779T(S593S) Normal Tumor 2496delT 2496delTT 829 829 NFEFFLQCPAK* NFEFFCNVRQSERWNSLLPKQK* Supplementary Figure 2. Detection of mutations in ADAMTS18. Representative examples of mutations identified in ADAMTS18. In each case, the top sequence chromatogram was either obtained from the NCBI Reference sequence (A) or from normal tissue of the relevant patient (B). The lower sequence chromatograms were from indicated tumors in either melanoma cases (A) or colorectal cancer cases (B). Arrows indicate the location of missense mutations. The nucleotide and amino acid alterations are shown at the bottom of each chromatogram. A B A375 pooled clones-FLAG IP Pooled ADAMTS18 clones C638S Q904X P1035S WT G312E Mel-STR A375 vector P452S Q1002X α-FLAG WT WT vector vector adamts18 α gapdh -tubulin 1 1.3 12.5 Supplementary Figure 3. Stable expression of wild-type and mutant ADAMTS18 in melanoma cell line. Mel-STR and A375 melanoma cells were used to generate stable pooled clones expressing either wild type ADAMTS18, mutant ADAMTS18 or empty vector. A. Mel-STR and A375 cells transduced with wild type (WT) ADAMTS18 or empty vector were analyzed by reverse transcription-PCR (RT-PCR). GAPDH was used as an internal control. B. A375 cells ectopically expressing wild type ADAMTS18, mutant ADAMTS18 or empty vector were analyzed by immunoprecipitation using anti-FLAG (M2) beads and western blotted using anti-FLAG-HRP (upper panel). Cell lysates were immunoblotted with anti-α-tubulin as a loading control (lower panel). A B ADAMTS18-FLAG A375 shRNA clones #4 shRNA #5 shRNA pLKO.1 #4 shRNA #5 shRNA pLKO.1 α-FLAG Endogenous ADAMTS18 GAPDH α-tubulin Supplementary Figure 4. Mutant ADAMTS18 is essential for the migration of melanoma cells harboring these mutations. Melanoma cells harboring either wild type or mutant ADAMTS18 were infected with either control shRNA or two different shRNA constructs targeted against ADAMTS18 (#4 and #5) and selected to form stable pooled clones. A. Cell lysates from transiently transfected HEK-293T cells were immunoblotted with the indicated antibody. Anti-α-tubulin was used as a loading control. B. A375 cells were used to generate clones as in A. RT-PCR was performed to demonstrate stable knock down of endogenous ADAMTS18 message. GAPDH was used as an internal control. Table S1. ADAMTS genes analyzed CCDS accession # Ref Seq accession # Gene Name Other names CCDS33524.1 NM_006988.3 ADAMTS1 C3-C5; METH1; KIAA1346 CCDS4444.1 NM_014244.2 ADAMTS2 NPI; PCINP; PCPNI; hPCPNI; ADAM-TS2; ADAMTS-3 CCDS3553.1 NM_014243.1 ADAMTS3 ADAMTS-4; KIAA0366 CCDS1223.1 NM_005099.4 ADAMTS4 ADMP-1; ADAMTS-2; ADAMTS-4; KIAA0688 CCDS13579.1 NM_007038.2 ADAMTS5 ADMP-2; ADAMTS11; FLJ36738 CCDS3983.2 NM_197941.2 ADAMTS6 ADAM-TS6 CCDS32303.1 NM_014272.3 ADAMTS7 ADAM-TS7; DKFZp434H204 CCDS41732.1 NM_007037.4 ADAMTS8 METH2; ADAM-TS8; FLJ41712 CCDS2903.1 NM_182920.1 ADAMTS9 FLJ42955; KIAA1312 CCDS12206.1 NM_030957.2 ADAMTS10 WMS; ADAM-TS10 CCDS34140.1 NM_030955.2 ADAMTS12 PRO4389 CCDS6972.1 NM_139027.2 ADAMTS13 TTP; VWFCP; C9orf8; vWF-CP; FLJ42993; MGC118899; MGC118900; DKFZp434C2322 CCDS7307.1 NM_139155.2 ADAMTS14 FLJ32820 CCDS8488.1 NM_139055.1 ADAMTS15 MGC126403 CCDS43299.1 NM_139056.2 ADAMTS16 FLJ16731; ADAMTS16s CCDS10383.1 NM_139057.2 ADAMTS17 FLJ16363; FLJ32769 CCDS10926.1 NM_199355.2 ADAMTS18 ADAMTS21 CCDS4146.1 NM_133638.3 ADAMTS19 FLJ16042 CCDS31778.1 NM_025003.3 ADAMTS20 GON-1 Table S2. Primers used for PCR amplification and sequencing of ADAMTS genes CCDS Ref Seq Gene Exon Forward Primer Reverse Primer Sequencing Primer accession accession ADAMTS1 1 CCDS33524.1 NM_006988.3 AGCTGAGTTCACCAATCCAAAC GAGGAGGACGAGGAGCTAGTG GTAAAACGACGGCCAGT ADAMTS1 1 CCDS33524.1 NM_006988.3 GGTGCCGGAGTAGAAGCAGT GCCTCTCAGTGTCTCCAACTTT GTAAAACGACGGCCAGT ADAMTS1 2, 3 CCDS33524.1 NM_006988.3 TTTCCAAATGTCCAGAGCTACTAC# ACCGGGATGCAGAGCACTAT# GTAAAACGACGGCCAGT ADAMTS1 4 CCDS33524.1 NM_006988.3 GCTACTCAACCGGAAGCACTAT# GGACAAATGAATGAATCCCTGT# GTAAAACGACGGCCAGT ADAMTS1 5 CCDS33524.1 NM_006988.3 TGGAGACATAAATCATCAGCATTA CAAAGCCCATTCATTCACATT GTAAAACGACGGCCAGT ADAMTS1 5, 6, 7 CCDS33524.1 NM_006988.3 CATTGTTCCTCTCTAAAGGTTTTTC GTGTATCAACGGCAAGTGTGTG GTAAAACGACGGCCAGT ADAMTS1 6, 7 CCDS33524.1 NM_006988.3 TGCAAGCATGTGAAGTGTTAGAT TGCTGATGATTTATGTCTCCATTT GTAAAACGACGGCCAGT ADAMTS1 8, 9 CCDS33524.1 NM_006988.3 ATCCAGGTCTGCAGGTGA TGTGTCATTAGCACCATAGGC GTAAAACGACGGCCAGT ADAMTS1 8, 9 CCDS33524.1 NM_006988.3 CAATGACCCATGCTGAAAAAGT CAGATTCCACCTCTGTCTGTGT GTAAAACGACGGCCAGT ADAMTS1 9 CCDS33524.1 NM_006988.3 CCTTACTGATACACCTCACTGGTTA CAGGAACAATGGCAGCTTTCT GTAAAACGACGGCCAGT ADAMTS2 1 CCDS4444.1 NM_014244.2 CCAAGTCAGGCTGGACGAC# GCTCTCTAGGTGGGGACGTT# GTAAAACGACGGCCAGT ADAMTS2 2 CCDS4444.1 NM_014244.2 GTGGTCTCCGCCGATCTAAC CCAAGGGACTCCCAGGTAAC GTAAAACGACGGCCAGT ADAMTS2 3 CCDS4444.1 NM_014244.2 AGGTGGGAGGTACTCCCTGAG CCAAGCTGGTCTGTGGAGAG GTAAAACGACGGCCAGT ADAMTS2 4 CCDS4444.1 NM_014244.2 TAATACCCTCGGTTCAGGGTG TAACAAGGAAATCGGCAGAGC GTAAAACGACGGCCAGT ADAMTS2 5 CCDS4444.1 NM_014244.2 AAGGTGGCTCCTAGTTGATGG CAAACGCACACACTCTCCAAG GTAAAACGACGGCCAGT ADAMTS2 5 CCDS4444.1 NM_014244.2 TTCTGGCAAACGCACACACT CATTGGGGATGCAGTAATATGAG GTAAAACGACGGCCAGT ADAMTS2 6 CCDS4444.1 NM_014244.2 GTCAACACTACAGCCTGCTCG CTGCCCTGACACTCTTCCC GTAAAACGACGGCCAGT ADAMTS2 6 CCDS4444.1 NM_014244.2 CTTCCCTGCCCTGACACTCT TGACATTTGCCTTCTGTGGA GTAAAACGACGGCCAGT ADAMTS2 7 CCDS4444.1 NM_014244.2 AGTTGCCTGTGGTAGAGAGGG CACAGAGGAGAAGTGGGCAG GTAAAACGACGGCCAGT ADAMTS2 8 CCDS4444.1 NM_014244.2 CAAATTGCAGCAGGTAGATGG CCGCACACAAGCTTAGAGGAC GTAAAACGACGGCCAGT ADAMTS2 9 CCDS4444.1 NM_014244.2 TCTGTCCTTGAATGGCAAGTG GCCGGTCCTCACACTGTC GTAAAACGACGGCCAGT ADAMTS2 10 CCDS4444.1 NM_014244.2 AGAATCACAACACCCACCAGC AGCATCAGAAGCACAGGGTG GTAAAACGACGGCCAGT ADAMTS2 11 CCDS4444.1 NM_014244.2 CAATGAGGCCTGTCTTCTGG CTCCAGAACTGGTGTGCAGC GTAAAACGACGGCCAGT ADAMTS2 12 CCDS4444.1 NM_014244.2 CCTGACAGGCTGGACAACTG TGCAGGATCAGAGGCACAAG GTAAAACGACGGCCAGT ADAMTS2 13 CCDS4444.1 NM_014244.2 GGAAATTTCTCCTGCTTGGTG CTCATGCATCTTGCCAATACC GTAAAACGACGGCCAGT ADAMTS2 14 CCDS4444.1 NM_014244.2 CCAGGTGTTCGAGACTGGG CCGACTTAGGATTCTCCCTCC GTAAAACGACGGCCAGT ADAMTS2 15 CCDS4444.1 NM_014244.2 GCCAGAGAAATACCAGGGTCC CTGAGCAGAGGGACAGGTTG GTAAAACGACGGCCAGT ADAMTS2 16 CCDS4444.1 NM_014244.2 TGTCGTGGCACAGAGGAAAC CTCTGACCAAGTCGGAGCC GTAAAACGACGGCCAGT ADAMTS2 16 CCDS4444.1 NM_014244.2 CTGAAGGGTCAGGAGGCTCA CTGCTGTTTCAGCCAGACATA GTAAAACGACGGCCAGT ADAMTS2 17 CCDS4444.1 NM_014244.2 TGCCATGAATGATGAGACTCC AAAGGTCCCTGCTGTGGC GTAAAACGACGGCCAGT ADAMTS2 18 CCDS4444.1 NM_014244.2 ATTGTCATCACAAGGGTGAGC GTCAAATGCCTCGGATGATG GTAAAACGACGGCCAGT ADAMTS2 20 CCDS4444.1 NM_014244.2 GCATGTGGGTCCCTTCTTTAG CTGAACCAAGCCTCTGACACC GTAAAACGACGGCCAGT ADAMTS2 21 CCDS4444.1 NM_014244.2 AGAGGGACGGGATAGCTGAG AAGGCAAGCTCCACAGGG GTAAAACGACGGCCAGT ADAMTS2 22 CCDS4444.1 NM_014244.2 TGCTCACAGCTTGTGTGTCAG ATTAGGTTGGGTGGCTGGAC GTAAAACGACGGCCAGT ADAMTS2 22 CCDS4444.1 NM_014244.2 AGTCTTGTCCCGCTATTGCTC TCTCCATGACACAGGATTTGC GTAAAACGACGGCCAGT ADAMTS3 1 CCDS3553.1 NM_014243.1 CGGAGTGGGAGTCGTAACCT CGCTCGTCTCTCTCGCTAATAC GTAAAACGACGGCCAGT ADAMTS3 2 CCDS3553.1 NM_014243.1 AATTTAGCCCCAGGAAAGTGG TTCTCTGTTAGTTTTTGTAGCTTCTCC GTAAAACGACGGCCAGT ADAMTS3 3 CCDS3553.1 NM_014243.1 CTTGGAATAATGTCGTCTTCG TTGTCTGTGTTATGTTCTCCTGTG GTAAAACGACGGCCAGT ADAMTS3 4 CCDS3553.1 NM_014243.1 ACAAGAGAACATGGCAATCACA ACTGAAGGTAGCATGGAACTCA GTAAAACGACGGCCAGT ADAMTS3 5 CCDS3553.1 NM_014243.1 GCACATATTTTGGCACAGTCA TGTAGCAGGTCTGTCTGATCGTA GTAAAACGACGGCCAGT ADAMTS3 6 CCDS3553.1 NM_014243.1 GGCAGTTTCTTCTCCTCAATTTC CTAGCTGGCCCTCAGATACACT GTAAAACGACGGCCAGT ADAMTS3 7 CCDS3553.1 NM_014243.1 GGCATTTAACATTGAGAACTCCAC TGGTATCATTTGACTTTCACACA GTAAAACGACGGCCAGT ADAMTS3 8 CCDS3553.1 NM_014243.1 ATTTAGTTTCCGTGCATGACCT GAGAAATGACTGCTGCCAAAG GTAAAACGACGGCCAGT ADAMTS3 9 CCDS3553.1 NM_014243.1 GACTTATGGCTTCAAGTATTGTGAC TGCTTTTGTAGTAGCCCATGAA GTAAAACGACGGCCAGT ADAMTS3 10 CCDS3553.1 NM_014243.1 CATCAGCTCTCTGCTAGTCTGTC TAGGTGTCAGGATGTGCCCTAC GTAAAACGACGGCCAGT ADAMTS3 11 CCDS3553.1 NM_014243.1 TATCCATTGTTTCAAGCCAACA CTTGAGAGCTGCCAAACC GTAAAACGACGGCCAGT ADAMTS3 12 CCDS3553.1 NM_014243.1 CTTCGTTTGATCTTCTTCATCA AAATCTTACCAACTGTGCAAGC GTAAAACGACGGCCAGT ADAMTS3 13 CCDS3553.1 NM_014243.1 ATAGTGCTGCTTGCCAGGAACT TTGAGCTTTGTGTTTTGTTTTATTTT GTAAAACGACGGCCAGT ADAMTS3 14 CCDS3553.1 NM_014243.1 TTCTGCCAGTGACCAAAGTT GAAGTGAGTTGCATCCTGTAAGA GTAAAACGACGGCCAGT ADAMTS3 15 CCDS3553.1 NM_014243.1 TCAGCAGCTAAATTTTGATTATGTTT TTGTTGTAACTCATCTGCTTTCC GTAAAACGACGGCCAGT ADAMTS3 15 CCDS3553.1 NM_014243.1 TTCCTTAAAAGGTAATCTGAATAACAA
Load more

Recommended publications
  • Role of Proteases in Dysfunctional Placental Vascular Remodelling in Preeclampsia
    Accepted Manuscript Role of proteases in dysfunctional placental vascular remodelling in preeclampsia Jaime A. Gutiérrez, Isabel Gómez, Delia I. Chiarello, Rocío Salsoso, Andrés D. Klein, Enrique Guzmán-Gutiérrez, Fernando Toledo, Luis Sobrevia PII: S0925-4439(19)30115-2 DOI: https://doi.org/10.1016/j.bbadis.2019.04.004 Reference: BBADIS 65448 To appear in: BBA - Molecular Basis of Disease Received date: 23 February 2018 Revised date: 20 December 2018 Accepted date: 6 January 2019 Please cite this article as: J.A. Gutiérrez, I. Gómez, D.I. Chiarello, et al., Role of proteases in dysfunctional placental vascular remodelling in preeclampsia, BBA - Molecular Basis of Disease, https://doi.org/10.1016/j.bbadis.2019.04.004 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. ACCEPTED MANUSCRIPT Role of proteases in dysfunctional placental vascular remodelling in preeclampsia Jaime A. Gutiérrez1,7 *, Isabel Gómez1, Delia I Chiarello7, Rocío Salsoso5,7†, Andrés D Klein2, Enrique Guzmán-Gutiérrez3, Fernando Toledo4,7, Luis Sobrevia5,6,7 * 1 Cellular Signaling and Differentiation Laboratory (CSDL), School of Medical Technology, Health Sciences Faculty, Universidad San Sebastián, Santiago 7510157, Chile. 2 Centro de Genética y Genómica, Facultad de Medicina, Clínica Alemana Universidad del Desarrollo, Santiago 7590943, Chile.
    [Show full text]
  • Comparative Transcriptome Analysis of Embryo Invasion in the Mink Uterus
    Placenta 75 (2019) 16–22 Contents lists available at ScienceDirect Placenta journal homepage: www.elsevier.com/locate/placenta Comparative transcriptome analysis of embryo invasion in the mink uterus T ∗ Xinyan Caoa,b, , Chao Xua,b, Yufei Zhanga,b, Haijun Weia,b, Yong Liuc, Junguo Caoa,b, Weigang Zhaoa,b, Kun Baoa,b, Qiong Wua,b a Institute of Special Animal and Plant Sciences, Chinese Academy of Agricultural Sciences, Changchun, China b State Key Laboratory for Molecular Biology of Special Economic Animal and Plant Science, Chinese Academy of Agricultural Sciences, Changchun, China c Key Laboratory of Embryo Development and Reproductive Regulation of Anhui Province, College of Biological and Food Engineering, Fuyang Teachers College, Fuyang, China ABSTRACT Introduction: In mink, as many as 65% of embryos die during gestation. The causes and the mechanisms of embryonic mortality remain unclear. The purpose of our study was to examine global gene expression changes during embryo invasion in mink, and thereby to identify potential signaling pathways involved in implantation failure and early pregnancy loss. Methods: Illumina's next-generation sequencing technology (RNA-Seq) was used to analyze the differentially expressed genes (DEGs) in implantation (IMs) and inter- implantation sites (inter-IMs) of uterine tissue. Results: We identified a total of 606 DEGs, including 420 up- and 186 down-regulated genes in IMs compared to inter-IMs. Gene annotation analysis indicated multiple biological pathways to be significantly enriched for DEGs, including immune response, ECM complex, cytokine activity, chemokine activity andprotein binding. The KEGG pathway including cytokine-cytokine receptor interaction, Jak-STAT, TNF and the chemokine signaling pathway were the most enriched.
    [Show full text]
  • ADAMTS13 and 15 Are Not Regulated by the Full Length and N‑Terminal Domain Forms of TIMP‑1, ‑2, ‑3 and ‑4
    BIOMEDICAL REPORTS 4: 73-78, 2016 ADAMTS13 and 15 are not regulated by the full length and N‑terminal domain forms of TIMP‑1, ‑2, ‑3 and ‑4 CENQI GUO, ANASTASIA TSIGKOU and MENG HUEE LEE Department of Biological Sciences, Xian Jiaotong-Liverpool University, Suzhou, Jiangsu 215123, P.R. China Received June 29, 2015; Accepted July 15, 2015 DOI: 10.3892/br.2015.535 Abstract. A disintegrin and metalloproteinase with thom- proteolysis activities associated with arthritis, morphogenesis, bospondin motifs (ADAMTS) 13 and 15 are secreted zinc angiogenesis and even ovulation [as reviewed previously (1,2)]. proteinases involved in the turnover of von Willebrand factor Also known as the VWF-cleaving protease, ADAMTS13 and cancer suppression. In the present study, ADAMTS13 is noted for its ability in cleaving and reducing the size of the and 15 were subjected to inhibition studies with the full-length ultra-large (UL) form of the VWF. Reduction in ADAMTS13 and N-terminal domain forms of tissue inhibitor of metallo- activity from either hereditary or acquired deficiency causes proteinases (TIMPs)-1 to -4. TIMPs have no ability to inhibit accumulation of UL-VWF multimers, platelet aggregation and the ADAMTS proteinases in the full-length or N-terminal arterial thrombosis that leads to fatal thrombotic thrombocy- domain form. While ADAMTS13 is also not sensitive to the topenic purpura [as reviewed previously (1,3)]. By contrast, hydroxamate inhibitors, batimastat and ilomastat, ADAMTS15 ADAMTS15 is a potential tumor suppressor. Only a limited app can be effectively inhibited by batimastat (Ki 299 nM). In number of in-depth investigations have been carried out on the conclusion, the present results indicate that TIMPs are not the enzyme; however, expression and profiling studies have shown regulators of these two ADAMTS proteinases.
    [Show full text]
  • ADAMTS Proteases in Vascular Biology
    Review MATBIO-1141; No. of pages: 8; 4C: 3, 6 ADAMTS proteases in vascular biology Juan Carlos Rodríguez-Manzaneque 1, Rubén Fernández-Rodríguez 1, Francisco Javier Rodríguez-Baena 1 and M. Luisa Iruela-Arispe 2 1 - GENYO, Centre for Genomics and Oncological Research, Pfizer, Universidad de Granada, Junta de Andalucía, 18016 Granada, Spain 2 - Department of Molecular, Cell, and Developmental Biology, Molecular Biology Institute, University of California, Los Angeles, Los Angeles, CA 90095, USA Correspondence to Juan Carlos Rodríguez-Manzaneque and M. Luisa Iruela-Arispe: J.C Rodríguez-Manzaneque is to be contacted at: GENYO, 15 PTS Granada - Avda. de la Ilustración 114, Granada 18016, Spain; M.L. Iruela-Arispe, Department of Molecular, Cell and Developmental Biology, UCLA, 615 Charles Young Drive East, Los Angeles, CA 90095, USA. [email protected]; [email protected] http://dx.doi.org/10.1016/j.matbio.2015.02.004 Edited by W.C. Parks and S. Apte Abstract ADAMTS (a disintegrin and metalloprotease with thrombospondin motifs) proteases comprise the most recently discovered branch of the extracellular metalloenzymes. Research during the last 15 years, uncovered their association with a variety of physiological and pathological processes including blood coagulation, tissue repair, fertility, arthritis and cancer. Importantly, a frequent feature of ADAMTS enzymes relates to their effects on vascular-related phenomena, including angiogenesis. Their specific roles in vascular biology have been clarified by information on their expression profiles and substrate specificity. Through their catalytic activity, ADAMTS proteases modify rather than degrade extracellular proteins. They predominantly target proteoglycans and glycoproteins abundant in the basement membrane, therefore their broad contributions to the vasculature should not come as a surprise.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Secreted Metalloproteinase ADAMTS-3 Inactivates Reelin
    The Journal of Neuroscience, March 22, 2017 • 37(12):3181–3191 • 3181 Cellular/Molecular Secreted Metalloproteinase ADAMTS-3 Inactivates Reelin Himari Ogino,1* Arisa Hisanaga,1* XTakao Kohno,1 Yuta Kondo,1 Kyoko Okumura,1 Takana Kamei,1 Tempei Sato,2 Hiroshi Asahara,2 Hitomi Tsuiji,1 Masaki Fukata,3 and Mitsuharu Hattori1 1Department of Biomedical Science, Graduate School of Pharmaceutical Sciences, Nagoya City University, Nagoya, Aichi 467-8603, Japan, 2Department of Systems BioMedicine, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo 113-8510, Japan, and 3Division of Membrane Physiology, Department of Molecular and Cellular Physiology, National Institute for Physiological Sciences, National Institutes of Natural Sciences, Okazaki, Aichi 444-8787, Japan The secreted glycoprotein Reelin regulates embryonic brain development and adult brain functions. It has been suggested that reduced Reelin activity contributes to the pathogenesis of several neuropsychiatric and neurodegenerative disorders, such as schizophrenia and Alzheimer’s disease; however, noninvasive methods that can upregulate Reelin activity in vivo have yet to be developed. We previously found that the proteolytic cleavage of Reelin within Reelin repeat 3 (N-t site) abolishes Reelin activity in vitro, but it remains controversial as to whether this effect occurs in vivo. Here we partially purified the enzyme that mediates the N-t cleavage of Reelin from the culture supernatant of cerebral cortical neurons. This enzyme was identified as a disintegrin and metalloproteinase with thrombospondin motifs-3 (ADAMTS-3). Recombinant ADAMTS-3 cleaved Reelin at the N-t site. ADAMTS-3 was expressed in excitatory neurons in the cerebral cortex and hippocampus.
    [Show full text]
  • Pancancer Progression Human Vjune2017
    Gene Symbol Accession Alias/Prev Symbol Official Full Name AAMP NM_001087.3 - angio-associated, migratory cell protein ABI3BP NM_015429.3 NESHBP|TARSH ABI family, member 3 (NESH) binding protein ACHE NM_000665.3 ACEE|ARACHE|N-ACHE|YT acetylcholinesterase ACTG2 NM_001615.3 ACT|ACTA3|ACTE|ACTL3|ACTSG actin, gamma 2, smooth muscle, enteric ACVR1 NM_001105.2 ACTRI|ACVR1A|ACVRLK2|ALK2|FOP|SKR1|TSRI activin A receptor, type I ACVR1C NM_145259.2 ACVRLK7|ALK7 activin A receptor, type IC ACVRL1 NM_000020.1 ACVRLK1|ALK-1|ALK1|HHT|HHT2|ORW2|SKR3|TSR-I activin A receptor type II-like 1 ADAM15 NM_207195.1 MDC15 ADAM metallopeptidase domain 15 ADAM17 NM_003183.4 ADAM18|CD156B|CSVP|NISBD|TACE ADAM metallopeptidase domain 17 ADAM28 NM_014265.4 ADAM 28|ADAM23|MDC-L|MDC-Lm|MDC-Ls|MDCL|eMDC II|eMDCII ADAM metallopeptidase domain 28 ADAM8 NM_001109.4 CD156|MS2 ADAM metallopeptidase domain 8 ADAM9 NM_001005845.1 CORD9|MCMP|MDC9|Mltng ADAM metallopeptidase domain 9 ADAMTS1 NM_006988.3 C3-C5|METH1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 ADAMTS12 NM_030955.2 PRO4389 ADAM metallopeptidase with thrombospondin type 1 motif, 12 ADAMTS8 NM_007037.4 ADAM-TS8|METH2 ADAM metallopeptidase with thrombospondin type 1 motif, 8 ADAP1 NM_006869.2 CENTA1|GCS1L|p42IP4 ArfGAP with dual PH domains 1 ADD1 NM_001119.4 ADDA adducin 1 (alpha) ADM2 NM_001253845.1 AM2|dJ579N16.4 adrenomedullin 2 ADRA2B NM_000682.4 ADRA2L1|ADRA2RL1|ADRARL1|ALPHA2BAR|alpha-2BAR adrenoceptor alpha 2B AEBP1 NM_001129.3 ACLP AE binding protein 1 AGGF1 NM_018046.3 GPATC7|GPATCH7|HSU84971|HUS84971|VG5Q
    [Show full text]
  • Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals
    animals Review Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals Mohammadreza Mohammadabadi 1 , Farhad Bordbar 1,* , Just Jensen 2 , Min Du 3 and Wei Guo 4 1 Department of Animal Science, Faculty of Agriculture, Shahid Bahonar University of Kerman, Kerman 77951, Iran; [email protected] 2 Center for Quantitative Genetics and Genomics, Aarhus University, 8210 Aarhus, Denmark; [email protected] 3 Washington Center for Muscle Biology, Department of Animal Sciences, Washington State University, Pullman, WA 99163, USA; [email protected] 4 Muscle Biology and Animal Biologics, Animal and Dairy Science, University of Wisconsin-Madison, Madison, WI 53558, USA; [email protected] * Correspondence: [email protected] Simple Summary: Skeletal muscle mass is an important economic trait, and muscle development and growth is a crucial factor to supply enough meat for human consumption. Thus, understanding (candidate) genes regulating skeletal muscle development is crucial for understanding molecular genetic regulation of muscle growth and can be benefit the meat industry toward the goal of in- creasing meat yields. During the past years, significant progress has been made for understanding these mechanisms, and thus, we decided to write a comprehensive review covering regulators and (candidate) genes crucial for muscle development and growth in farm animals. Detection of these genes and factors increases our understanding of muscle growth and development and is a great help for breeders to satisfy demands for meat production on a global scale. Citation: Mohammadabadi, M.; Abstract: Farm-animal species play crucial roles in satisfying demands for meat on a global scale, Bordbar, F.; Jensen, J.; Du, M.; Guo, W.
    [Show full text]
  • Identi Ed a Disintegrin and Metalloproteinase with Thrombospondin Motifs 6 Serve As a Novel Gastric Cancer Prognostic Biomarker
    Identied a Disintegrin and Metalloproteinase with Thrombospondin Motifs 6 Serve as a Novel Gastric Cancer Prognostic Biomarker by Integrating Analysis of Gene Expression Prole Ya-zhen Zhu GuangXi University of Chinese Medicine https://orcid.org/0000-0001-6932-698X Yi Liu Guangxi Cancer Hospital and Guangxi Medical University Aliated Cancer Hospital Xi-wen Liao Guangxi Cancer Hospital and Guangxi Medical University Aliated Cancer Hospital Xian-wei Mo Guangxi Cancer Hospital and Guangxi Medical University Aliated Cancer Hospital Yuan Lin Guangxi Cancer Hospital and Guangxi Medical University Aliated Cancer Hospital Wei-zhong Tang Guangxi Cancer Hospital and Guangxi Medical University Aliated Cancer Hospital Shan-shan Luo ( [email protected] ) Research article Keywords: ADAMTS, mRNA, gastric cancer, prognosis Posted Date: July 14th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-41038/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/31 Abstract Objective: We aimed to explore the prognostic value of a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS) genes in gastric cancer (GC). Methods: The RNA-sequencing (RNA-seq) expression data for 351 GC patients and other relevant clinical data was acquired from The Cancer Genome Atlas (TCGA). Survival analysis and a genome-wide gene set enrichment analysis (GSEA) were performed to dene the underlying molecular value of the ADAMTS genes in GC development. Results: The Log rank test with both Cox regression and Kaplan–Meier survival analysis showed that ADAMTS6 expression prole correlated with the GC patients’ clinical outcome. Patients with a high expression of ADAMTS6 were associated with poor overall survival (OS).
    [Show full text]
  • Proteolytic Activation Defines Distinct Lymphangiogenic Mechanisms for VEGFC and VEGFD
    Proteolytic activation defines distinct lymphangiogenic mechanisms for VEGFC and VEGFD Hung M. Bui, … , Kari Alitalo, Mark L. Kahn J Clin Invest. 2016;126(6):2167-2180. https://doi.org/10.1172/JCI83967. Research Article Vascular biology Lymphangiogenesis is supported by 2 homologous VEGFR3 ligands, VEGFC and VEGFD. VEGFC is required for lymphatic development, while VEGFD is not. VEGFC and VEGFD are proteolytically cleaved after cell secretion in vitro, and recent studies have implicated the protease a disintegrin and metalloproteinase with thrombospondin motifs 3 (ADAMTS3) and the secreted factor collagen and calcium binding EGF domains 1 (CCBE1) in this process. It is not well understood how ligand proteolysis is controlled at the molecular level or how this process regulates lymphangiogenesis, because these complex molecular interactions have been difficult to follow ex vivo and test in vivo. Here, we have developed and used biochemical and cellular tools to demonstrate that an ADAMTS3-CCBE1 complex can form independently of VEGFR3 and is required to convert VEGFC, but not VEGFD, into an active ligand. Consistent with these ex vivo findings, mouse genetic studies revealed that ADAMTS3 is required for lymphatic development in a manner that is identical to the requirement of VEGFC and CCBE1 for lymphatic development. Moreover, CCBE1 was required for in vivo lymphangiogenesis stimulated by VEGFC but not VEGFD. Together, these studies reveal that lymphangiogenesis is regulated by two distinct proteolytic mechanisms of ligand activation: one in which VEGFC activation by ADAMTS3 and CCBE1 spatially and temporally patterns developing lymphatics, and one in which VEGFD activation by a distinct […] Find the latest version: https://jci.me/83967/pdf The Journal of Clinical Investigation RESEARCH ARTICLE Proteolytic activation defines distinct lymphangiogenic mechanisms for VEGFC and VEGFD Hung M.
    [Show full text]
  • Ivtigation of the Effects of Mechanical Strain in Human Tenocytes
    Investigation of the effects of Mechanical Strain in Human Tenocytes Eleanor Rachel Jones In partial fulfilment of the requirements for the Degree of Doctor of Philosophy University of East Anglia, Biological Sciences September 2012 This copy of the thesis has been supplied on condition that anyone who consults it is understood to recognise that its copyright rests with the author and that use of any information derived there from must be in accordance with current UK Copyright Law. In addition, any quotation or extract must be included full attribution. Abstract Tendinopathies are a range of diseases characterised by pain and insidious degeneration. Although poorly understood, onset is often associated with physical activity. Metalloproteinases are regulated differentially in tendinopathy causing disruptions in extracellular matrix (ECM) homeostasis. An increase in the anti-inflammatory cytokine TGFβ has also been documented. This project aims to investigate the effect of cyclic tensile strain loading and TGFβ stimulation on protease and ECM protein expression by human tenocytes and begin to characterise the pathway of mechanotransduction. Human tenocytes were seeded at 1.5x106 cells/ml into collagen gels (rat tail type I, 1mg/ml) and stretched using a sinusoidal waveform of 0-5% at 1Hz using the Flexcell FX4000T™ system. Cultures were treated with or without 1ng/ml TGFβ1 or inhibitors of TGFβRI, metalloproteinases, RGD, Mannose-6-phosphate, integrin β1 and a thrombospondin as appropriate. qRT-PCR and a cell based luciferase assay were used to assess RNA and TGFβ activity respectively. The prolonged application of 5% cyclic mechanical strain in a 3D culture system induced an anabolic response in protease and matrix genes.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]