UNIVERSITY OF CALIFORNIA, SAN DIEGO
Heparan Sulfate 3-O-sulfation: A Rare Modification in Search of a Function
A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy
in
Biomedical Sciences
by
Bryan Edward Thacker
Committee in charge:
Professor Jeffrey D. Esko, Chair Professor Richard Gallo Professor Tracy Handel Professor Karl Willert Professor Benjamin Yu
2014
Copyright
Bryan Edward Thacker, 2014
All rights reserved.
The Dissertation of Bryan Edward Thacker is approved, and it is acceptable in quality and form for publication on microfilm and electronically:
Chair
University of California, San Diego
2014
iii DEDICATION
To my parents, who always challenged me to do my best and sacrificed to give me
every opportunity to succeed.
To my wonderful wife, who has been loving and supportive through all the missed
dinners and nights as a “single” mom.
To my little buddies Easton and Jude, who brighten my life and inspire me every day.
iv TABLE OF CONTENTS
Signature Page ...... iii
Dedication ...... iv
Table of Contents ...... v
List of Abbreviations ...... ix
List of Figures ...... x
List of Tables ...... xi
Acknowledgements ...... xii
Vita ...... xiv
Abstract of the Dissertation ...... xvi
Chapter 1 Heparan Sulfate 3-O-sulfation: A Rare Modification in Search of a Function ...... 1
1.1 Summary ...... 1
1.2 Introduction ...... 1
1.3 Prevalence of 3-O-sulfation ...... 4
1.4 Sites of modification by Hs3sts ...... 5
1.5 Insights into substrate specificity from structural studies of Hs3sts ...... 13
1.6 Evolutionary origin of the Hs3sts ...... 19
1.7 Expression patterns of the Hs3sts ...... 21
1.8 Biochemical and physiological implications of 3-O-sulfation ...... 23
1.8.1 Antithrombin ...... 24
1.8.2 Herpes simplex virus glycoprotein D ...... 29
v 1.8.3 Fibroblast growth factors (FGFs) ...... 30
1.8.4 Cyclophilin B ...... 32
1.8.5 Stabilin ...... 32
1.9 3-O-sulfation in development and disease ...... 33
1.9.1 3-O-sulfation in development ...... 33
1.9.2 Diseases related to 3-O-sulfation ...... 35
1.10 Conclusions ...... 37
1.11 Acknowledgements ...... 39
1.12 Literature cited ...... 40
Chapter 2 Discovery of Novel Ligands that Depend on 3-O-sulfation ...... 54
2.1 Summary ...... 54
2.2 Introduction ...... 54
2.3 Results ...... 57
2.3.1 Creation of affinity matrices ...... 57
2.3.2 Identification of 3-O-sulfate dependent proteins ...... 63
2.3.3 Validation of neuropilin-1 as a 3-O-sulfate dependent ligand .... 68
2.4 Discussion ...... 69
2.5 Experimental methods ...... 72
2.5.1 Reagents ...... 72
2.5.2 Cell line culture ...... 73
2.5.3 Affinity matrix production ...... 73
2.5.4 Fractionation on affinity matrices ...... 76
2.6 Acknowledgements ...... 77
vi 2.7 Literature cited ...... 77
2.8 Supplemental tables ...... 83
Chapter 3 Enhanced Binding of Neuropilin-1 to 3-O-sulfated Heparan Sulfate Modulates Neuronal Growth Cone Collapse ...... 92
3.1 Summary ...... 92
3.2 Introduction ...... 92
3.3 Results ...... 97
3.3.1 Interaction of neuropilin-1 with 3-O-sulfated heparan sulfate .... 97
3.3.2 3-O-sulfate in semaphorin-3a induced growth cone collapse ... 100
3.4 Discussion ...... 105
3.5 Methods ...... 109
3.5.1 Reagents ...... 109
3.5.2 Cell lines ...... 110
3.5.3 Heparin binding plate ELISA ...... 110
3.5.4 Flow cytometry ...... 111
3.5.5 Mouse models ...... 112
3.5.6 Growth cone collapse assay ...... 112
3.5.7 Quantitative PCR ...... 113
3.5.8 Statistics ...... 114
3.6 Acknowledgements ...... 114
3.7 Literature cited ...... 115
Chapter 4 Conclusions and Future Directions ...... 120
4.1 Summary ...... 120
vii 4.2 Protein fractionation on 3-O-sulfated affinity matrices ...... 120
4.3 Future directions for affinity fractionation ...... 122
4.4 3-O-sulfate modulates axonal growth cone collapse ...... 125
4.5 Future directions for 3-O-sulfate modulating neuropilin-1 function ...... 126
4.6 Concluding remarks ...... 129
4.7 Acknowledgements ...... 130
4.8 Literature cited ...... 131
viii LIST OF ABBREVIATIONS
AT antithrombin
BMP bone morphogenic protein
CNBr cyanogen bromide
DRG dorsal root ganglion
FGF fibroblast growth factor
FGFR fibroblast growth factor receptor gD herpes simplex virus glycoprotein D
HABP2 hyaluronan binding protein 2
Hs3st heparan sulfate 3-O-sulfotransferase hPLAP human placental alkaline phosphatase
HSV herpes simplex virus
LIF leukemia inhibitory factor
NDST N-deacetylase-N-sulfotransferases
NRP neuropilin
PAP 3′-phosphoadenosine-5′-phosphate
PAPS 3′-phosphoadenosine-5′-phosphosulfate
RAGE receptor for advanced glycation endproducts
Sema3a semaphorin-3a
STAT signal transduction and activator of transcription
ix LIST OF FIGURES
Figure 1-1. Structure of the antithrombin-binding pentasaccharide found in heparin ... 3
Figure 1-2. Structural interactions of 3-O-sulfotransferases with oligosaccharide substrates ...... 16
Figure 1-3. Phylogenetic analysis of Hs3sts ...... 20
Figure 1-4. Stereo diagram of pentasaccharide-antithrombin interaction ...... 26
Figure 2-1. Construction and validation of 3-O-sulfated heparan sulfate affinity matrices ...... 58
Figure 2-2. Fractionation of serum on affinity matrices ...... 65
Figure 3-1. Binding of proteins to 3-O-sulfated heparan sulfate ...... 97
Figure 3-2. Binding of neuropilin-1 to the cell surface ...... 99
Figure 3-3. Axonal growth cone collapse modulated by 3-O-sulfation ...... 102
x LIST OF TABLES
Table 1-1. Oligosaccharides containing 3-O-sulfated glucosamine units ...... 7
Table 1-2. Human HS3ST Expression ...... 22
Table 2-1. Peptide counts of 3-O-sulfate dependent candidate proteins in affinity matrix eluates ...... 67
Supplemental Table 2-S1. Complete LC/MS results of bovine serum fractionated on affinity matrices ...... 83
Supplemental Table 2-S2. Complete LC/MS results of mouse serum fractionated on affinity matrices ...... 86
Supplemental Table 2-S3. Complete LC/MS results of human serum fractionated on affinity matrices ...... 90
xi ACKNOWLEDGEMENTS
I would be ungrateful if I failed to mention the many people who have helped me successfully navigate the graduate program. First and foremost, I am grateful to my advisor Jeff Esko who welcomed me as a young and inexperienced scientist into the lab, allowed me to make my mistakes and provided constant support and guidance.
He has provided the ideal environment for me to become a reasonably competent scientist. I am also grateful to my committee members Rich Gallo, Tracy Handel, Karl
Willert and Ben Yu for their guidance over the past several years. I was supported for two full years by the Cancer Cell Biology training grant T32CA067754, which also provided valuable training through curriculum and monthly workshops.
I also thank my colleagues who provided the guidance that was essential for my success. I am especially thankful to Stephane Sarrazin who was my first mentor at the bench when I joined the lab. Ding Xu and Roger Lawrence have provided a tremendous amount of guidance throughout my research project. Many other Esko lab members, past and present, have provided intellectual and emotional support along the way. These include Jon Gonzales, Philip Gordts, Emylie Seamen, Chrissa Dwyer and
Chris Lamanna. I am thankful for their contributions. Thanks are in order, as well, for the talented technical and administrative staff who make the research go. These include Danyin Song, Patrick Secrest, Chelsea Nora, Peili Hsu and Steve Portillo.
Finally, I would like to thank Gina Butcher, Leanne Nordeman and Kathy
Klingenberg of the BMS program for patiently attending to all my never-ending requests.
xii Chapter 1 has been published as a review article Heparan Sulfate 3-O- sulfation: A Rare Modification in Search of a Function in Matrix Biology 2014, (35)
60-72. The dissertation author was the primary author of the review with Ding Xu,
Roger Lawrence and Jeffrey D. Esko as co-authors. We are grateful to Jian Liu, H.
Joseph Yost, Joseph Zaia and Ulf Lindahl for their critical review of the manuscript and helpful comments. This work was supported by GM93131 and HL107150 (to
J.D.E.) and by training grant T32CA067754 (to B.E.T.) from the National Institutes of
Health and by grant 13BGlA14150008 (to D.X.) from the American Heart Association.
The work in Chapters 2, 3 and 4 is being prepared together for publication. The dissertation author is the primary author of this work with coauthors Emylie Seamen,
Roger Lawrence, Jian Liu and Jeffrey D. Esko. This work benefited from the generous contribution of recombinant neuropilin-1 from Dr. Craig Vander Kooi (University of
Kentucky) and the blocking antibody mAb-NRP1A from Genentech. Proteomic analyses were performed by the UCSD Biomolecular/Proteomics Mass Spectrometry
Facility. Microscopy was performed in the UCSD School of Medicine Light
Microscopy Facility. This work was supported by GM93131 and HL107150 (to
J.D.E.) and by training grant T32CA067754 (to B.E.T.) from the National Institutes of
Health.
xiii VITA
Education:
2006 Bachelor of Science, Mechanical Engineering Bachelor of Art, Biochemistry University of Arizona
2008 Master of Science, Bioengineering University of California, San Diego
2014 Doctor of Philosophy, Biomedical Sciences University of California, San Diego
Publications:
Thacker BE, Lawrence R, Seamen E, Liu J, Esko JD. Expanding the 3-O- sulfate Proteome - Enhanced Binding of Neuropilin-1 to 3-O-sulfated Heparan Sulfate Modulates Neuronal Growth Cone Collapse Manuscript in preparation.
Seamen E, Thacker BE, Lawrence R, Kampmann M, Weissman JS, McManus MT, Esko JD. Identification of novel regulators of proteoglycan biosynthesis using a genome-wide shRNA screen. Manuscript in preparation.
Thacker BE, Xu D, Lawrence R, Esko JD. Heparan sulfate 3-O-sulfation: A rare modification in search of a function. (2014) Matrix Biol. 35, 60-72.
Thacker BE, Tomiya A, Hulst J, Suzuki K, Bremner SN, Gastwirt R, Lieber RL, Ward SR. Passive mechanical properties and related proteins change with botulinum neurotoxin A injection of normal skeletal muscle. (2012) J Orthop Res. 30, 497-502.
Gesteira TF, Coulson-Thomas VJ, Taunay-Rodrigues A, Oliveira V, Thacker BE, Juliano MA, Pasqualini R, Arap W, Tersariol IL, Nader HB, Esko JD, Pinhal MA. Inhibitory peptides of the sulfotransferase domain of the heparan sulfate enzyme, N-deacetylase-N- sulfotransferase-1. (2011) J Biol Chem. 18, 5338-46.
Lancaster MA, Gopal DJ, Kim J, Saleem SN, Silhavy JL, Louie CM, Thacker BE, Williams Y, Zaki MS, Gleeson JG. Defective Wnt-dependent cerebellar midline fusion in a mouse model of Joubert syndrome. (2011) Nat Med. 17, 726-31.
xiv
Regev GJ, Kim CW, Thacker BE, Tomiya A, Garfin SR, Ward SR, Lieber RL. Regional myosin heavy chain distribution in selected paraspinal muscles. (2010) Spine 35, 1265-70.
Ward SR, Tomiya A, Regev GJ, Thacker BE, Benzl RC, Kim CW, Lieber RL. Passive mechanical properties of the lumbar multifidus muscle support its role as a stabilizer. (2009) J Biomech 42, 1384-9.
xv
ABSTRACT OF THE DISSERTATION
Heparan Sulfate 3-O-sulfation: A Rare Modification in Search of a Function
by
Bryan Edward Thacker
Doctor of Philosophy in Biomedical Sciences
University of California, San Diego, 2014
Professor Jeffrey D. Esko, Chair
Heparan sulfate structural heterogeneity is driven, in part, by the placement of sulfate groups at various positions in the polysaccharide. While many ligands bind to heparan sulfate without strict requirements for the positions of sulfate groups, binding of a small number of known ligands is influenced by the presence of a sulfate at the
C3 position of a glucosamine residue. In mammals, seven enzymes can catalyze the addition of 3-O-sulfate groups, suggesting the possibility of other, previously unidentified, ligands whose binding is influenced by 3-O-sulfated sequences. Chapter
1 contains a comprehensive review of the synthesis, biochemistry and physiology
xvi related to 3-O-sulfate. Chapter 2 describes the development and use of heparan sulfate affinity matrices to identify ligands that rely on 3-O-sulfate. Neuropilin-1, a modulator of vasculogenesis and axonal guidance, is one of the 3-O-sulfate dependent ligands identified. Chapter 3 demonstrates that 3-O-sulfate is required for high affinity binding of neuropilin-1 to heparan sulfate. Furthermore, 3-O-sulfation influences a neuropilin-
1 dependent process, namely neuronal growth cone collapse. Chapter 4 elaborates on the implications of these findings and the future work needed to fully characterize 3-
O-sulfation. This work indicates the existence of many proteins that rely on 3-O- sulfate and outlines the methodology needed to identify and characterize their interaction with heparan sulfate.
xvii Chapter 1
Heparan Sulfate 3-O-sulfation: A Rare Modification in Search of a Function
1.1 Summary
Many protein ligands bind to heparan sulfate, which results in their presentation, protection, oligomerization or conformational activation. Binding depends on the pattern of sulfation and arrangement of uronic acid epimers along the chains. Sulfation at the C3 position of glucosamine is a relatively rare, yet biologically significant modification, initially described as a key determinant for binding and activation of antithrombin and later for infection by type I herpes simplex virus. In mammals, a family of seven heparan sulfate 3-O-sulfotransferases installs sulfate groups at this position and constitutes the largest group of sulfotransferases involved in heparan sulfate formation. However, to date very few proteins or biological systems have been described that are influenced by 3-O-sulfation. This review describes our current understanding of the prevalence and structure of 3-O-sulfation sites, expression and substrate specificity of the 3-O-sulfotransferase family and the emerging roles of 3-O-sulfation in biology.
1.2 Introduction
Heparan sulfate is a type of sulfated glycosaminoglycan found covalently attached to a small set of extracellular matrix and plasma membrane proteoglycans. Its origin is ancient, having emerged during metazoan evolution, and its utility is evident, as only minor changes in composition have occurred over more than 500 million years
1 2 of evolution (Medeiros et al., 2000). Many so-called heparin-binding proteins are known, many of which bind to heparan sulfate under physiological conditions and modulate cell division and differentiation, tissue morphogenesis and architecture, and organismal physiology (Bishop et al., 2007; Ori et al., 2008; Xu and Esko, 2014).
Binding to heparan sulfate can have many effects on the protein ligand, ranging from simple presentation and/or stabilization to induction of conformational change, receptor–ligand interactions and protein oligomerization as a prelude to signaling.
Thus, much interest exists in understanding the rules that guide the selective engagement of proteins with heparan sulfate chains.
Heparan sulfate is a linear polysaccharide composed of alternating glucosamine and uronic acid residues (Fig. 1-1) (Esko and Selleck, 2002). During polymerization of the chains, several classes of sulfotransferases install sulfate groups at various positions, including C2 of the uronic acid and N-, C6 and C3 of the glucosamine units. These reactions occur substoichiometrically in segments of variable size along the chain resulting in highly heterogeneous products with variable sulfation. The addition of the 3-O-sulfate group to glucosamine units is a relatively rare modification, present in only a limited number of chains or absent entirely
(Marcum et al., 1986a; Pejler et al., 1987a; de Agostini et al., 2008). It is also one of the last modifications in biosynthesis (Zhang et al., 2001a,b), meaning that the substrates for the 3-O-sulfotransferases (Hs3sts) are sulfated oligosaccharides that have already been modified at other positions by the N-, 2-O- and 6-O- sulfotransferases and by the C5 epimerase (Kusche et al., 1988).
3
-2
- OSO3 -1 O O 0 HO -OOC OSO - O 3 +1 CH3CONH O O O HO - - +2 OH O3SO OOC - O SNH OSO - 3 OH 3 O O O O - HO O3SO
- 3O SNH O
Figure 1-1. Structure of the antithrombin-binding pentasaccharide found in heparin. The individual residues of the pentasaccharide are numbered relative to the N-sulfo-glucosamine-3-sulfate residue at position 0. The central 3-O-sulfate group generated by Hs3st-1 (shown in red) and the 6-O-sulfate group at residue −2 (shown in blue) account for the majority of the binding energy of antithrombin to heparin. Note that the 6-O-sulfate group on the 3-O-sulfated glucosamine residue is dispensable and that residue −2 can be N-sulfated.
Binding to heparan sulfate depends on complementarity between positively charged amino acids in the protein ligands and the negatively charged sulfate groups and uronic acid epimers in the polysaccharide chain (Lindahl and Li, 2009; Xu and
Esko, 2014). In general, two types of interactions occur, those that depend on overall sulfation and those based on specific types or arrangements of sulfated residues and uronic acid epimers. The former group consists of ligands that can accommodate different arrangements of sulfated sugars, presumably because of conformational flexibility in the binding site that can fit different orientations of sulfate and carboxyl groups in the chains. The latter group consists of ligands that rely on specific subsets of sulfate groups or the spacing of sulfated domains, and ligands that depend on a specific sequence of sulfated sugar residues (some containing a 3-O-sulfated 4 glucosamine) for optimal binding. The paucity of known proteins that are influenced by 3-O-sulfation is rather surprising given the large family of Hs3sts involved in heparan sulfate biosynthesis. This review focuses on 3-O-sulfation, in particular the origin, substrate specificity, protein structure and expression pattern of the Hs3st family, and the small family of proteins described to date whose activity is influenced by 3-O-sulfation.
1.3 Prevalence of 3-O-sulfation
The prevalence of 3-O-sulfation in natural heparan sulfates is largely unknown.
Reasons for this lack of information include difficulty in obtaining large quantities of heparan sulfate for structural analyses and lack of technology to quantitate the 3-O- sulfate group. Historically, the 3-O-sulfate group was discovered by searching for enzymes that remove sulfate groups from heparin. An enzyme in the urine was discovered that released the 3-O-sulfate group from synthetic radioactive N- sulfoglucosamine-3-sulfate (Leder, 1980) and from the non-reducing end of heparin fragments (Lindahl et al., 1980). We now know this enzyme as arylsulfatase G and its deficiency results in a lysosomal storage disease in mice in which heparan sulfate accumulates (Kowalewski et al., 2012). Since Leder's initial study, chemical analyses,
NMR and mass spectrometry have confirmed the presence of 3-O-sulfate groups in heparin (Lindahl et al., 1980; Meyer et al., 1981; Yamada et al., 1993) and in some preparations of heparan sulfate (Marcum et al., 1986a; Pejler et al., 1987a; Edge and
Spiro, 1990). These latter studies indicate that the prevalence of 3-O-sulfation varies based on the source of heparan sulfate. Heparan sulfate from endothelial cells contains 5 about one 3-O-sulfate group per 100 disaccharides (Marcum et al., 1986a). Five to ten percent of disaccharides from heparan sulfate derived from Reichert's basement membrane contains 3-O-sulfate (Pejler et al., 1987a), whereas basement membrane heparan sulfate from Engelbreth–Holm–Swarm mouse tumor does not contain any 3-
O-sulfate (Pejler et al., 1987a). Heparan sulfate from follicular fluid contains about 6%
3-O-sulfated glucosamine units (de Agostini et al., 2008). Certain animal species produce copious amounts of 3-O-sulfated heparin. For example, the clam,
Anomalocardia brasiliana, produces heparin with one 3-O-sulfate for every 5 disaccharides (Pejler et al., 1987b). Many tissues express one or more isozymes of
Hs3st, suggesting the presence of 3-O-sulfate groups, but very few of these heparan sulfates have been analyzed structurally to date.
1.4 Sites of modification by Hs3sts
The Hs3sts represent the largest gene family among all heparan sulfate sulfotransferases (Liu and Pedersen, 2007). Vertebrates generally have seven isozymes of Hs3st divided into two subgroups based on the homology of the sulfotransferase domain (Liu and Pedersen, 2007). Zebrafish has one additional Hs3st. Hs3st-2, -3a, -
3b, -4 and -6 form one subgroup, sharing greater than 80% sequence identity in the sulfotransferase domain (Lawrence et al., 2007). This group is often referred to as
“gD-type” Hs3sts because all members of the subfamily can generate binding sites for glycoprotein gD of type I herpes simplex virus (Shukla et al., 1999; Xia et al., 2002;
Tiwari et al., 2005; Xu et al., 2005; O'Donnell et al., 2006). Hs3st-1 and -5 form the other subgroup, sharing 71% identity in the sulfotransferase domain (Xia et al., 2002). 6
These two sulfotransferases have in common the capacity to generate a binding site for antithrombin and thus are designated “AT-type” sulfotransferases. In vertebrates, the
AT-type and gD-type subgroups share about 60% amino acid identity in the sulfotransferase domain (Lawrence et al., 2007).
Based on the large number of Hs3sts and the observation that they probably act after other sulfotransferases, one might assume that they show selectivity for substrates. Indeed, Hs3st-1 preferentially modifies sites in which a glucuronic acid devoid of 2-O-sulfate resides to the non-reducing side of the target glucosamine unit
(Position −1, Fig. 1-1) (Table 1-1) (Liu et al., 1996; Shworak et al., 1997; Zhang et al.,
1999; Mochizuki et al., 2008). The enzyme will tolerate iduronic acid in this position, but 2-O-sulfation specifically prevents its action (Zhang et al., 2001b; Nguyen et al.,
2012). In contrast, Hs3st-2, -3, -4 and -6 (gD-types) preferentially modify sites in which position −1 is 2-sulfo-iduronic acid (Liu et al., 1999a; Wu et al., 2004; Xu et al.,
2005; Lawrence et al., 2007; Mochizuki et al., 2008; Meissen et al., 2009). Hs3st-5 modifies sites irrespective of 2-O-sulfation and consequently can produce both AT- and gD-type modifications (Liu et al., 1999a; Xia et al., 2002; Chen et al., 2003;
Mochizuki et al., 2003; Duncan et al., 2004; Chen and Liu, 2005; Mochizuki et al.,
2008; Xu et al., 2008).
Heparin lyases, which depolymerize heparin and heparan sulfate into disaccharides by beta-eliminative cleavage of the hexosaminic linkages, have the interesting property of generating “resistant” tetrasaccharide products bearing 3-O- sulfated glucosamine at the reducing end (Yamada et al., 1993; Shriver et al., 2000). A recent study of heparin lyase II showed that the resistance to digestion of the bond 7 ; ;
)
- ) ) ; ; ; ) Xia et et Xia Xu et al., al., et Xu Shworak Shworak ; ; ; Shworak et et Shworak Zhang et et Zhang ; ;
Zhang et al., al., et Zhang ; Xu et al., 2005 al., et Xu ; Mochizuki et al., al., et Mochizuki Wu et al., 2004 al., et Wu 2004 al., et Wu Mochizuki et al., 2003 al., et Mochizuki 2003 al., et Mochizuki ; ; ; ; ;
) Liu et al., 1996 al., et Liu 1999a al., et Liu 2002 al., et Xia unsubstituted unsubstituted ; ; ; Liu et al., 1996 al., et Liu 2005 Liu, and Chen 2001b al., et Zhang 2008 al., et Xu 2005 Liu, and Chen 2005 Liu, and Chen -
References ; ; ; ; ; ; N ) 2003 Xu et al., 2008 al., et Xu
et al., 2008 al., et ;
Xu et al., 2008 al., et Xu )
) ;
Xu et al., 2005 al., et Xu )
; ) unsaturated double bond in the non the bond in double unsaturated Chen et al., 2003 al., et Chen al., et Chen 2003 al., et Chen 2003 al., et Chen 1999a al., et Liu 2003 al., et Chen 2003 al., et Chen 2003 al., et Mochizuki 2007 al., et Lawrence 2007 al., et Lawrence ( 1997 al., ( 2004 al., et Duncan 1997 al., et 2001b ( ( 2001b al., ( ( 2004 al., et Duncan 2002 al., ( 2004 al., et Duncan 2008 ( 2008 ( 2008 al., et Mochizuki ( Mochizuki - at pHfrom 1 and at
- -
6 - 5 5 5 5 6 3, 3, ------
5, - 1, 1, 1, 1, 2 2, 5, 5 2, 2, ------
3b, - 5 5 Enzyme - - create a 4, 5 a create
Hs3st Hs3st Hs3st Hs3st Hs3st Hs3st 3a, Hs3st Hs3st Hs3st 4, Hs3st 4, Only oligosaccharides from natural sources or that were were sources or that from natural Only oligosaccharides sulfoglucosamine sulfoglucosamine
- N 17 sulfated glucosamine units. units. glucosamine sulfated -
. UA). The stereochemistry of the uronic acid is lost after digestion. Nitrous acid Nitrous acid digestion. after is lost acid of uronic the UA). stereochemistry The O - 4,5 Δ
Oligosaccharide
S3)
(D2S9)
(D0S9) (I2M9)
(G0M9) (I0M9)
Oligosaccharides containing 3 containing Oligosaccharides
. GlcNS3S (D2 GlcNS3S GlcNS3S6S - - 1 aMan3S(G2M3) - aMan3S(I2M3) aMan3S6S - GlcNS3S6S - - - aMan3S(G0M3) aMan3S6S aMan3S(I0M3) aMan3S6S - - - - UA UA2S UA2S 4,5 4,5 4,5 Table 1 Table heparin/heparan generate used to generally are Two methods table. this in included Hs3stare purified with isozymes generated lyases Heparin polysaccharides: order from higher oligosaccharides sulfate by (indicated acid uronic end reducing from of formation anhydromannose the in results decomposition by aMan) pH 4.5 (indicated at glucosamine Disaccharides GlcA GlcA IdoA IdoA GlcA2S IdoA2S IdoA2S Δ Δ Δ 8
)
) )
)
) )
Zhang et al., 1999 al., et Zhang
Zhang et al., 1999 al., et Zhang
) ) ; ) Xu et al., 2011 al., et Xu ) ) ) ; Xu and Esko, 2014 Esko, and Xu
;
) ; )
References ) )
) ) Bienkowski and Conrad, 1985 Conrad, and Bienkowski 1985 Conrad, and Bienkowski 2012 al., et Nguyen 2012 al., et Nguyen 1993 al., et Yamada 2014 Esko, and Xu 1993 al., et Yamada 1999b al., et Liu 1999b al., et Liu 2003 al., et Kuberan 1982 al., et Linhardt 2012 al., et Nguyen 1996 al., et Tsuda 1993 al., et Desai 1996 al., et Tsuda 2004 al., et Wu 2004 al., et Wu 2012 al., et Pempe ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (
3a 3a 3a 1 1 3a 3a 1 4 4 1 ------type type type type type type type ------Enzyme AT AT Hs3st Hs3st Hs3st Hs3st AT Hs3st Hs3st Hs3st AT Hst3st AT AT AT Hs3st Hs3st Hs3st
-
I0S6) 0S9) -
18 G
- G0S3) - G0S6) G0S9 I2S6) - - - G0S9 I2S9) - - I0A6 I2S3)
- - I0A6 I0S9 - - G0S9 - G0S0 - I2S0) (D2S6 G0S0 -
- aMan(A6 -
(D0A0 G0S9
-
GlcA -
GlcNS6S (D2A6 GlcNS6S
- G0S9) - GlcNS3S (D2S6 GlcNS3S GlcNS3S6S I2H9) G0S9) GlcNS6S (G0S9 GlcNS6S - - - GlcNS6S (I0S6 GlcNS6S G0S3) - - - - I2H3) I0S6) - G0M9) - IdoA I0S6) - - - G0M3) GlcNS3S (D0A0 GlcNS3S GlcNS3S6S GlcNS (A6 GlcNS GlcNS6S - - - - - GlcA GlcA (D2S0 GlcA D0S6 - -
- (
D2S0 (I0A6 ( IdoA2S
- IdoA2S IdoA2S IdoA2S IdoA2S Oligosaccharide - - - - GlcNS3S6S - GlcN3S GlcN3S GlcN3S6S GlcNAc6S GlcNAc6S - - - - GlcNS3S (D0A6 GlcNS3S (D0A6 GlcNS3S6S
- - GlcNS6S (G0S9 GlcNS6S GlcNS3S6S GlcNS6S (I0S9 GlcNS6S GlcNS3S6S - - - aMan3S(I0A6 aMan3S6S - GlcNS GlcNS - - - - GlcNS3S6S GlcA - - IdoA IdoA - - GlcA GlcA IdoA IdoA - - IdoA
- -
GlcA IdoA2S IdoA2S - GlcNS3S6S GlcNS3S6S
GlcA GlcA - - - - - GlcA GlcA - - - - GlcA - GlcA GlcA - - GlcNS GlcNS GlcNS6S GlcNAc6S GlcNS6S - - - - - 1,Continued. - GlcNAc6S GlcNAc6S GlcNS6S GlcNAc GlcNAc - - - - - GlcNS3S6S GlcNS3S6S GlcNAc6S GlcNAc6S GlcNS3S6S GlcNS6S ------UA UA UA UA2S UA2S UA2S UA2S UA2S UA UA 4,5 4,5 4,5 4,5 4,5 4,5 4,5 4,5 4,5 4,5 Tetrasaccharides IdoA IdoA GlcA IdoA Δ Δ Δ Δ Δ Pentasaccharides GlcNAc6S Hexasaccharides IdoA GlcA Δ Δ Δ Δ Δ Heptasaccharides GlcNAc6S Table Table 1 9 ;
) ;
)
Guerrini et al., 2008 al., et Guerrini )
) ; ) ) ) 8 ) ) Guerrini et al., 2006 al., et Guerrini ) Thunberg et al., 1982 al., et Thunberg
; References ) ;
) ) Xu et al., 2011 al., et Xu 1981 al., et Casu 1982 al., et Linhardt 1981 al., et Casu 2012 al., et Pempe 1982 al., et Ototani 2006 al., et Guerrini 1993 al., et Desai 2002 al., et Liu 2008 al., et Guerrini 2008 al., et Guerrini 2013 al., et Guerrini 200 al., et Copeland ( ( ( ( ( ( ( 1981 Yosizawa, and Ototani ( 2008 al., et Guerrini ( ( ( ( (
-
a 1 1 3 2 - - - -
type type type type type type type type , gD ------Enzyme Hs3st AT AT AT Hs3st AT AT AT Hs3st AT AT AT type Hs3st - - - -
I2S6 - 19 (I0S6 -
- (D0S0
GlcNS6S GlcNS6S GlcNS6S GlcNS6S GlcNS6S aMan - - - G0S9 - aMan6S - aMan6S GlcNAc6S GlcNAc6S - - - aMan - IdoA2S GlcNS (D2S0 GlcNS - IdoA2S - GlcA - - IdoA2S IdoA2S IdoA2S IdoA - - - - GlcN3S6S - IdoA2S IdoA2S - - aMan(S6 IdoA2S - - IdoA2S - GlcNS6S - GlcNS3S6S GlcA IdoA2S
- GlcNS6S GlcNS6S GlcNS3S6S - - - - - GlcNS6S GlcNS3S6S GlcNS3S6S - - - GlcNS6S - GlcNS3S6S GlcNS3S - - GlcNS IdoA2S - IdoA±2S - IdoA2S IdoA2S GlcA IdoA2S GlcA - - - - - GlcNS6S - - IdoA2S GlcA - GlcA -
IdoA2S - -
UA2S - Oligosaccharide I2S6)
GlcNS6S IdoA2S GlcNS6S - - - I2S6) - - GlcNAc6S GlcNAc6S
- - GlcNS3S6S GlcNS3S6S GlcNS3S6S
- - - GlcNAc6S I2S9 GlcNAc6S GlcNAc - GlcNS3S6S - - - - I2S9 GlcNS3S6S G0M0) - - - IdoA GlcA IdoA2S I2S6) cA - - - - I2S6) I2S6) I0A6) GlcA GlcA GlcA IdoA±2S ------IdoA I2M6) I2M6) - IdoA - - -
G0S9 Gl
I2S6 - - -
- GlcNS3S6S GlcA - IdoA2S - I2/0S6 - I2S6 I2S6 G0S9 - - - - I2S6 G0S9
- I2S0) - G0S9 - - I2M0) I2H9) 6 - - GlcNS GlcNS6S GlcNS6S GlcNS6S GlcA - - - - - 1,Continued. GlcNS6S - GlcNAc6S GlcNS GlcNAc6S GlcNAc6S - G0S9 G0S9 I2/0S6 I0A G0A6 ------G0S9 - - - I0A6 GlcNS3S6S GlcNS6S GlcNAc6S - G0S3 I2S6 G0M0) - U2S0 ------UA2S UA UA2S UA UA UA2S UA UA2S 4,5 4,5 4,5 4,5 4,5 4,5 4,5 4,5 I2S6 GlcNS6S G0M0) Octasaccharides IdoA2S (I2S6 IdoA G0S9 IdoA (I0A6 GlcA (G0S9 Δ I0A6 Δ (D0A6 Δ (D2S6 Δ I2A0 Δ (D0A6 Δ (D2S6 Δ (D0A6 GlcNS6S Δ (D2S6 GlcNS6S Table Table 1 10
)
) ) ) ) ) )
) References
)
) Xu et al., 2012b al., et Xu 2012 al., et Pempe 1993 al., et Desai 2010 al., et Liu 1982 al., et Linhardt 2012 al., et Pempe 2012 al., et Pempe 2012 al., et Pempe 2012 al., et Pempe 2013 al., et Viskov ( ( ( ( ( ( ( ( ( (
5 -
1 1 1, 1 1 1 1 ------type type type - - - Enzyme Hs3st Hs3st AT Hs3st AT Hs3st Hs3st Hs3st Hs3st AT - -
- - - -
- - I2S6) 20 GlcA ------G2/0S6 - GlcNS6S - I2/0S6 GlcNS6S - - GlcNAc6S GlcNS3S6S G0S9
- - - GlcNS6S - GlcA±2S GlcA±2S
GlcNS6S IdoA±2S IdoA±2S - - G2/0S6 - - - - I2/0S6 IdoA IdoA2S I0A6 GlcA - - - - - IdoA2S G0M0) - - IdoA2S - G0M0) I2S6 - - G2/0S6 I2/0S6 GlcNS6S GlcNS6S - IdoA±2S
- GlcNS6S GlcNS6S - - - - -
GlcNS6S G2/0S6
- - GlcNS6S G0S9 I2/0S6 - GlcNS3S6S - GlcNS3S6S - I2S6) - - - I2S6) - n (G0S9 n GlcNS3S6S - GlcA±2S GlcA±2S
G0M0) GlcNS6S IdoA±2S IdoA±2S IdoA2S - - - G2/0S6 GlcA - - - I2S6 GlcA - - - - I2/0S6 - IdoA2S I2S6 aMa - aMan(G0S9 - - - -
GlcA - G0S9 G0M0) - G0S9 G0) - - GlcA G0S9 - Oligosaccharide GlcA I2/0S6 G2/0S6 - - - IdoA±2S GlcNS6S GlcNS6S - - GlcNS6S GlcNS6S - - - - - GlcNS6S (D0A6 GlcNS6S - GlcNAc6S G0S9 I0A6 - GlcNS3S6S
I2S6 - GlcNS3S6S - - I0S6 - GlcNS6S I2/0S6 - GlcNS3S6S - - - - IdoA GlcNS6S I2S6
GlcNS6S - G0S9 GlcA - - - GlcA IdoA±2S GlcA±2S IdoA±2S GlcA±2S IdoA2S - - IdoA (D2S6 ------
GlcA
- I2/0S6 GlcNS3S6S aMan(G0S9 aMan(G0S9 -
- - -
G0S9 - G0S9 GlcNS6S GlcA GlcA GlcA IdoA±2S GlcA±2S - - 1,Continued. ------GlcNS6S GlcNS6S GlcNS6S (I2S6 GlcNS6S G0M0) GlcNAc6S - - - - G0M0) - - GlcNAc6S GlcNS3S6S aMan(G0S9 GlcNS3S6S GlcNS3S6S GlcNS3S6S GlcNS3S6S GlcNS3S6S ------UA2S UA 4,5 4,5 Nonasaccharides GlcA (G0A6 GlcA GlcNS6S aMan(S6 Decasaccharides Δ IdoA2S GlcA GlcA IdoA2S IdoA2S GlcA GlcNS6S GlcA GlcNS6S Dodecasaccharides GlcA GlcNS6S I2/0S6 GlcA GlcNS6S G2/0S6 Δ GlcA Table Table 1 11 between positions −2 and −1 appears to arise from failure to bind the substrate caused by steric hindrance due to the proximity of Asn405 in the active site of the enzyme and the 3-OH group of the bound glucosamine residue (Zhao et al., 2011). Three tetrasaccharides produced by lyase treatment of heparan sulfate modified by Hs3st-1 consist of D0A6-G0S3, D0A6-G0S9 and D0A0-G0M3 (Zhang et al., 1999).1 The tetrasaccharide structures produced by Hs3st-3 have been identified as D2S0-I2H3 and
D2S0-I2H9, suggesting that Hs3st-3 modifies N-unsubstituted glucosamines (Liu et al.,
1999b). This conclusion is not without controversy. The evidence suggesting an N- unsubstituted glucosamine derives from studies using nitrous acid to depolymerize the chains. At pH 4, nitrous acid treatment results in cleavage only at N-unsubstituted glucosamine residues (Shively and Conrad, 1976). Thus, the sensitivity of the tetrasaccharide to pH 4 nitrous acid suggested that the 3-O-sulfate group was located on an N-unsubstituted glucosamine (Liu et al., 1999b). A later study of Hs3st-3- modified octasaccharides enriched for gD binding came to a similar conclusion (Liu et al., 2002). However, in the original study the tetrasaccharide was also sensitive to low pH nitrous acid, which only reacts with N-sulfoglucosamine (Liu et al., 1999b), suggesting that the pH selectivity of nitrous acid might be altered by 3-O-sulfation
1 To simplify the representation of constituent disaccharides, we use a disaccharide structure code (DSC, Lawrence et al., 2008). In DSC, an uronic acid is designated as U, G, I or D for an unspecified 4,5 hexuronic acid, D-glucuronic acid, L-iduronic acid or Δ - unsaturated uronic acid, respectively. The N substituent is either H, A, S or R for hydrogen, acetate, sulfate or some other substituent, respectively. The presence and location of ester-linked sulfate groups are depicted by the number of the carbon atom on which the sulfate group is located or by 0 if absent. For example, I2S6 refers to a disaccharide composed of 2-sulfoiduronic acid-N-sulfoglucosamine-6-sulfate, whereas D2S6 refers to a similarly 4,5 structured disaccharide that instead has a Δ -double bond in the uronic acid. M refers to anhydromannose. The presence of 3-O- and 6-O-sulfate on the same hexosamine is indicated by the number 9. 12
(Liu et al., 1999b). Recent NMR experiments identified a persistent hydrogen bond within the AT-pentasaccharide between the internal glucosamine sulfamate NH and the adjacent 3-O-sulfate group, suggesting that the 3-O-sulfation may confer certain structural constraints that could affect chemical and enzymatic sensitivity (Langeslay et al., 2012). Recently, we observed that resistant tetrasaccharides derived from CHO cells expressing Hs3st-3 consisted of structures containing GlcNS3S without evidence of N-unsubstituted 3-O-sulfated glucosamine (R.L. and J.D.E., unpublished results).
Resistant tetrasaccharides have also been observed in heparan sulfate modified in vitro by Hs3st-2, -4 and -5 (Lawrence et al., 2007; Mochizuki et al., 2008). Limited analytical work on hexasaccharides derived from heparan sulfate modified by Hs3st-4 following partial digest with heparin lyases suggested two structures, D0A0-G0S0-
I2S3 and D0A0-G0S0-I2S9 (Wu et al., 2004). Thus, the idea that 3-O-sulfation can occur on unsubstituted glucosamine residues may be incorrect.
Analysis of resistant tetrasaccharides undoubtedly oversimplifies the complexity of domains bearing 3-O-sulfate. Because of the cleavage pattern of the lyases, all Hs3st-modified oligosaccharides studied thus far have the 3-O-sulfate group at the reducing end of the fragment. Thus, there is little information about the oligosaccharide sequence towards the reducing side of the 3-O-sulfation site (i.e. at the
+1, +2 and +3 positions). To investigate this question, Hs3st-3 activity has been measured against libraries of defined oligosaccharides (Nguyen et al., 2012). These studies showed that active substrates contained an iduronic acid residue to the reducing side of the acceptor, whereas substrates containing glucuronic acid and 2- sulfo-iduronic acid at this position were inactive. In this respect, the specificity of 13
Hs3st-3 differs from that of Hs3st-1, which permits a 2-sulfo-iduronic acid at the +1 position (Fig. 1-1). More extensive oligosaccharide libraries are needed to better define the acceptor specificity of the Hs3sts. Recently, Kowalewski et al. reported that arylsulfatase G catalyzes the removal of the 3-O-sulfate groups during lysosomal degradation (Kowalewski et al., 2012). Analysis of the non-reducing ends of the chains that accumulate in the liver showed that heparinase digestion released a significant amount of acetylated trisaccharide with the structure S3-U0A0. Thus the chains that accumulate in different tissues from the mutant could be used to obtain additional information about the structure on the reducing side of the 3-O-sulfated unit.
The possibility that the Hs3sts might also exhibit some promiscuity should also be considered. Thus, under some conditions, a gD-type 3-O-sulfotransferase might create AT-type heparan sulfate and vice versa. Glomerular epithelial cells produce
AT-type heparan sulfate and express Hs3st-1 and -3, but none of the other Hs3sts, including Hs3st-5. Nevertheless, when the cells were derived from Hs3st-1-/- mice, low levels of antithrombin-binding heparan sulfate were detected (Girardin et al.,
2005). Similarly, small amounts of AT-binding heparan sulfate were produced using recombinant Hs3st-3 in vitro (Girardin et al., 2005).
1.5 Insights into substrate specificity from structural studies of Hs3sts
X-ray crystal structures have been solved for the sulfotransferase domains of
Hs3st-1, -3 and -5 (Edavettal et al., 2004; Moon et al., 2004; Xu et al., 2008). These structures, accompanied by extensive mutational studies, form the basis of our understanding of the working mechanism of this enzyme family and provide insights 14 into the substrate specificity of the enzymes. The overall fold of the Hs3st sulfotransferase domain is very similar to the sulfotransferase domain of N- deacetylase-N-sulfotransferases (Ndst), consistent with ~30% sequence identity of these enzymes (Edavettal et al., 2004). All of the sulfotransferases utilize the high- energy sulfate donor, 3′-phosphoadenosine-5′-phosphosulfate (PAPS). Thus, not surprisingly Hs3st and Ndst1 share almost identical structure in the binding site for
PAPS, and they both use a conserved glutamate (E184 in Hs3st-3, Fig. 1-2A) as the catalytic base (Kakuta et al., 1999, 2003; Edavettal et al., 2004). The major difference between Hs3st and Ndst is in the heparan sulfate-binding cleft, where significantly more positively charged amino acid residues are present in Hs3st. The difference likely reflects the distinct substrate selectivity of Hs3st and Ndst; Ndsts act on N- acetylated domains of the chains and initiate polymer modification, whereas Hs3sts usually act late requiring a pattern of sulfate groups in the target site (Edavettal et al.,
2004).
Perhaps the most interesting information to glean from structural studies of the
Hs3sts is how the isozymes distinguish subtle differences in the target substrates, which in turn allows the enzymes to generate distinct products. Co-crystallization of
Hs3st-3, 3′-phosphoadenosine-5′-phosphate (PAP) and a tetrasaccharide substrate has revealed how enzyme structure can influence substrate specificity (Moon et al., 2004).
An extensive hydrogen-bonding network was observed in the substrate-binding cleft involving K161, R166, K215, Q255, K368 and R370, the acceptor glucosamine
(sulfation-site, sugar residue T-2 in the tetrasaccharide substrate, Fig. 1-2A) and neighboring uronic acids (T-1 and T-3, Fig. 1-2A). All six residues are completely 15 conserved in all Hs3st family members and across species. Ndst1 lacks three of the six residues, K161, R166 and Q255, suggesting that they contribute to the recognition of substrates unique to Hs3sts. However, the conservation of these residues across the
Hs3st isozymes suggests that they do not dictate substrate specificity.
A comparison of Hs3st-1 and Hs3st-3 co-crystal structures with oligosaccharide substrates revealed that the substrates orient differently in the two enzymes (Moon et al., 2012). The orientation of the acceptor glucosamine (position 0,
T-2 and H-3 in the hexasaccharide substrate, Fig. 1-2B) and non-reducing end uronic acid (position - 1, T-1 and H-2) were nearly identical in the two crystal structures, but the 2-sulfo-iduronic acid unit at the reducing side of the acceptor glucosamine
(position +1, T-3 and H- 4) was found in a chair conformation in Hs3st-1 (H-4, Fig. 1-
2B), whereas in Hs3st-3 it was found in a skew boat conformation (T-3, Fig. 1-2B).
The chair conformation preferred by Hs3st-1 approximates the carboxyl group of the
2-sulfo-iduronic acid unit (H-4) and the C2-OH of the uronic acid on the non-reducing side of the acceptor glucosamine (H-2). If the iduronic acid H-2 in the heptasaccharide were 2-O-sulfated, charge repulsion would result between the sulfate and carboxylate groups due to their close proximity (Fig. 1-2C, red dashed line indicates a distance of only 2.8 Å). In contrast, Hs3st-3 induces a skew boat conformation of the 2-sulfo- iduronic acid T-3 (Fig. 1-2C), which provides more distance between the carboxylate and the sulfate groups (Fig. 1-2C, yellow dashed line indicates a distance of 3.2 Å).
Importantly, Hs3st-3 also places a lysine residue (K259) between the 2-O-sulfate group of residue T-1 and the carboxylate group of residue T-3, which would help neutralize the negative charges and thus prevent charge repulsion (Fig. 1-2C). K259 is 16
Figure 1-2. Structural interactions of 3-O-sulfotransferases with oligosaccharide substrates. (A) Stereo diagram of the interaction between Hs3st-3 and the tetrasaccharide D2S6-I2S6 (PDB code 1T8U). Side chains of critical amino acid residues that mediate substrate binding are shown as thick gray sticks. Possible hydrogen bonds between side chains and tetrasaccharide are pictured as black broken lines. The C3-OH group of the glucosamine residue to be sulfated is shown as a red sphere. The sulfate donor mimic, 3′-phosphoadenosine 5′-phosphate (PAP) is shown, and the protein backbone is shown as a cartoon in the background. (B) Superposition of Hs3st-3 bound tetrasaccharide (D2S6-I2S6; green, PDB code 1T8U) and heptasaccharide (A6-G0S6-I2S6-G0M0; white, PDB code 3UAN). The surface of Hs3st-1 is rendered in gray. Residues in tetrasaccharides are labeled as T-1 to T-4. Residues in the heptasaccharide are labeled as H-1 to H-6 (the anhydromannose residue is not shown). (C) Role of K259 in Hs3st-3 substrate recognition. The tetrasaccharide and heptasaccharide are colored and numbered as in B. Putative hydrogen bonds between K259 and the 2-O-sulfate group of T-1 and the carboxylate of T-3 are shown in black dashed lines. The distance between the 2-O-sulfate of T-1 and carboxylate of T-3 are shown as a yellow broken line. The distance between the 2- O-sulfate of T-1 and the carboxylate of H-4 are shown as a red broken line. (D–F) Role of gate residues in substrate recognition. The gate residues are shown as large spheres and labeled in white, and the tetrasaccharide is shown with the C3-OH group shown as a red sphere. The molecular surface of each enzyme is shown in gray. The distance between gate residues is pictured as black broken lines. The tetrasaccharide is modeled into Hs3st-1 (PDB code 1VKJ) and Hs3st-5 (PDB code 3BD9) by superimposing their structures on that of the Hs3st-3/tetrasaccharide complex (PDB code 1T8U) using PyMol (Schrödinger). 17
A
PAP T-1 PAP T-1 T-4 T-4
T-2 T-2 T-3 T-3
B C N167
H-6 H-5 H-5
- 2-O-SO3 K259 COO- 3.2Å H-4 T-4 2.8Å H-2 COO- H-3 H-2 H-4 T-3 H-3 T-1 T-2 T-3 H-1 T-1 T-2
D E F
H271 G365 A306
˚ 6.7 A ˚ 14.2 A 14.2 A ˚
E88 G182 S120
Hs3st-1 Hs3st-3 Hs3st-5 18 conserved among all gD-type Hs3sts, suggesting that it might also participate in other gD-type Hs3sts in the selection of substrates containing 2-sulfo-iduronic acid (Liu et al., 1999a; Wu et al., 2004; Xu et al., 2005; Lawrence et al., 2007; Mochizuki et al.,
2008). Consistent with this idea, Hs3st-1 contains an uncharged asparagine residue in place of K259 (N167, Fig. 1-2C), which might explain why Hs3st-1 will not act on substrates bearing 2-sulfo-iduronic acid at the -1 position, but will tolerate either glucuronic or iduronic acid (Zhang et al., 1999, 2001b; Mochizuki et al., 2008).
When the crystal structures of Hs3st-1, -3 and -5 were superimposed, it was observed that two residues in Hs3st-1, H271 and E88, form a narrow opening that would contact the polysaccharide substrate at multiple sites including the two sugar residues to the non-reducing side of the sulfation site (+2 and +3 positions) (Fig. 1-
2D) (Xu et al., 2008; Moon et al., 2012). The corresponding residues in Hs3st-3 (G182 and G365) and Hs3st-5 (S120 and A306) are much smaller and form a significantly wider opening (Fig. 1-2E,F). The nature of these “gate” residues seems to regulate the substrate specificities of Hs3st-1 and Hs3st-5 in a substantial way. Mutation of these residues to glycine in Hs3st-1, or to histidine and glutamic acid in Hs3st-5, had little or no effect on catalytic activity, but had a profound effect on substrate specificity.
Remarkably, interchanging these two residues in Hs3st-1 and Hs3st-5 was sufficient to convert the substrate specificity of one enzyme into another.
Based on these studies, it is clear that substrate specificity is determined by amino acids distal to the catalytic site. Also, the evidence strongly suggests that Hs3sts recognize at least a pentasaccharide motif spanning from one sugar unit to the reducing end of the sulfation site, to three sugar units to the non-reducing side. Larger 19 oligosaccharides may confer additional specificity. The diversification of the Hs3st family suggests that there may be distinct substrate specificities even within a subgroup of Hs3sts.
1.6 Evolutionary origin of the Hs3sts
As mentioned above, Homo and other mammals express seven Hs3sts, whereas
Danio (zebrafish) expresses eight. In comparison to vertebrates, Hs3st isozymes in invertebrates are much less numerous. Drosophila (fruit fly) and Caenorhabditis
(nematode) both have one gD- and one AT-type transferase (Kamimura et al., 2004;
Tecle et al., 2013), whereas Strongylocentrotus (sea urchin) and Planaria (flatworm) have only a single Hs3st related most closely to an AT-type transferase (Fig. 1-3). The
Nematosetella (sea anemone), a member of the Cnidarian phylum, has two Hs3sts whereas Hydra has only one, but all three share ~50% amino acid sequence identity to human Hs3sts. In contrast, Trichoplax, a placozoan generally considered as a sister clade to bilaterians and Cnidarians, do not have any Hs3st homologs, but homologs of all other heparan sulfate sulfotransferases appear to be present. Porifera (sponges) do not express any homologs of the sulfotransferases, suggesting that sponges lack heparan sulfate. Based on this information, we propose that the primordial Hs3st originated early in eumetazoan evolution (excluding Porifera), probably first emerging in a common ancestor of bilaterians and cnidarians (Fig. 1-3).
Although Hs3sts appear to be widely distributed in nature, demonstration of 3-
O-sulfate groups in heparan sulfate derived from non-vertebrate species other than A. brasiliana (clam) is lacking. Attreed et al. (2012) showed that the single chain 20
Vetebrates (human, fish) > 7 Hs3sts
Echinoderms (Sea urchin) 1 Hs3st
Deuterostomes Arthropods (Drosophila) 2 Hs3st Protostomes Bilaterian
Nematodes (C. elegans) 2 Hs3sts Cnidaria
Flatworms (Planarian) 1 Hs3st
Hydra 1 Hs3st
Sea anemone 2 Hs3sts
Placozoans (Trichoplax) 0 Hs3st
Porifera (sponge) No HS
Figure 1-3. Phylogenetic analysis of Hs3sts. The number of Hs3st isozymes identified in each species was deduced from existing publications, NCBI protein database searches and comparison of key amino acids that define substrate and catalytic sites. The phylogenetic tree depicts their evolutionary relationship (adapted from Medeiros et al. 2000). The proposed origin of Hs3st is indicated with an arrow.
antibody (HS4C3), which reacts with a 3-O-sulfated determinant containing 2-O- and
6-O-sulfate groups in heparan sulfate and heparin (Ten Dam et al., 2006), binds to specific cellular targets in C. elegans, suggesting the presence of 3-O-sulfated motifs.
We have detected 3-O-sulfated disaccharides and tetrasaccharides in heparan sulfate from zebrafish embryos. These structures were diminished by specific Hs3st morpholinos. Furthermore, expression of cDNAs encoding the different zebrafish
Hs3sts in CHO cells results in expression of both AT- and gD-type heparan sulfate 21
(R.L., H. Joseph Yost, Adam Cadwallader and J.D.E., unpublished findings). The context of the 3-O-sulfate groups in these organisms remains unknown.
1.7 Expression patterns of the Hs3sts
The expression of Hs3st genes is exquisitely controlled in a spatiotemporal manner in vertebrates, befitting a family of seven isozymes (Table 1-2). Human
HS3ST-1, -3a and -3b transcripts are widely expressed in many organs, whereas expression of HS3ST-2 and -4 has been primarily detected in the brain (Shworak et al.,
1999; Lawrence et al., 2007; Mochizuki et al., 2008). HS3ST-5 is expressed in skeletal muscle (Xia et al., 2002). In the mouse, Hs3st-6 is expressed predominantly in the liver and kidney with lower expression in the heart, brain, lung and testis (Xu et al.,
2005). At least one Hs3st gene is expressed in nearly every cell line examined thus far and many express multiple Hs3st genes simultaneously (Girardin et al., 2005;
Vanpouille et al., 2007; Deligny et al., 2010). Notable exceptions are the CHO cell line and Engelbreth–Holm–Swarm mouse tumor, which synthesize heparan sulfate devoid of 3-O-sulfation (Pejler et al., 1987a; Zhang et al., 2001b).
Particular attention has been focused on Hs3st expression in the nervous system. Several Hs3st genes are spatially regulated in the mouse cerebrum and cerebellum throughout development (Yabe et al., 2005). Whole mount in situ hybridization demonstrated unique expression patterns of each of the Hs3st genes in the Zebrafish brain (Cadwallader and Yost, 2006). Studies of a transgenic mouse, in which the human placental alkaline phosphatase (hPLAP) was inserted next to the start codon of Hs3st-2, showed expression in trigeminal and dorsal root ganglia during B.E. Thacker et al. / Matrix Biology xxx (2013) xxx–xxx 7
rhythm and is inducible by light (Borjigin et al., 2003; Kuberan et al., 2004). In intestinal epithelium, Hs3st-1 expression increases in response to IL-4 and IL-13 (Takeda et al., 2010). In contrast, stimulation of human microvascular endothelial cells with TNF-α or LPS diminishes expres- sion of HS3ST-1 mRNA (Krenn et al., 2008). Finally, Hs3st-3 was upregu- lated in urothelium in response to IL-6 (Wood et al., 2011). In most of these examples, it remains unknown if sulfotransferase protein levels, enzyme activity or heparan sulfate structure were also affected. When F9 mouse embryonal carcinoma cells were differentiated into parietal endoderm using retinoic acid, cAMP and theophylline, the expression of Hs3st1 increased more than 100-fold with a corresponding increase in production of heparan sulfate that binds to antithrombin (Zhang et al., 1998).
7. Biochemical and physiological implications of 3-O-sulfation
Hundreds of heparan sulfate-binding proteins have been identified and much effort has been expended to determine the structural features in heparan sulfate that mediate binding (Xu and Esko, in press). Most studies have overlooked the effect of 3-O-sulfation on binding, generally because of the lack of available material for study. For this reason only six proteins have been demonstrated biochemically to be affected by 3-O-sulfation.
7.1. Antithrombin
Fig. 3. Phylogenetic analysis of Hs3sts. The number of Hs3st isozymes identified in each species was deduced from existing publications, NCBI protein database searches and com- Antithrombin is the best characterized protein in which 3-O-sulfate parison of key amino acids that define substrate and catalytic sites. The phylogenetic tree groups play a crucial role in binding to heparin/heparan sulfate and it depicts their evolutionary relationship (adapted from Medeiros et al. 2000). The proposed serves as the paradigm for how one can unravel the structural context origin of Hs3st is indicated with an arrow. of relevant, biologically active 3-O-sulfated glucosamine residues (Lindahl et al., 1980). Determining the location of these rare groups in neuronal cells within the trigeminal ganglia (Lawrence et al., 2007). In a sea of differentially sulfated domains is a formidable problem, D. melanogaster and C. elegans, the two Hs3st genes are expressed in spe- compounded by the fact that obtaining multimilligram amounts of hep- cific cells, including small subsets of neurons (Kamimura et al., 2004; aran sulfate from any source is quite difficult and costly. The analysis of Tecle et al., 2013). The spatially and temporally restricted pattern of ex- the antithrombin binding site was greatly simplified because of its en- pression of Hs3st genes in the nervous system suggests a neurological richment in heparin, which is available in kilogram quantities (Höök role for 3-O-sulfation. A mild neuronal patterning defect in C. elegans et al., 1976; Hopwood et al., 1976; Lindahl et al., 1979, 1980; was seen after loss of function of the enzymes (discussed in Riesenfeld et al., 1981; Lindahl et al., 1983; Atha et al., 1985). Thus, it Section 8.1), but to date no such role has been demonstrated in other was possible to partially cleave the chains into smaller oligosaccharides organisms. and to obtain sufficient material for separating fragments into high and There is a notable lack of information about the factors that regulate low affinity fractions, disaccharide analysis, chemical degradation and the expression of the Hs3st genes (e.g. transcription factors, promoter NMR studies (Yamada et al., 1993). The antithrombin binding motif and enhancer sequences, etc.). This should be a fruitful area of investiga- was subsequently identified in heparan sulfate expressed by endothelial tion based on the differential expression of the isozymes across different cells, fibroblasts and in other tissues (Marcum et al., 1983; Marcum and tissues and during development and the observation that external stim- Rosenberg, 1985; Marcum et al., 1986a,b; De Agostini et al., 1990). It uli can affect the expression of the Hs3st genes. For example, Hs3st-2 ex- should be pointed out that all of these studies focused on sequences pression and 3-O-sulfation in the pineal gland varies with Circadian that bind to antithrombin, but in fact heparan sulfate chains contain 3- O-sulfate groups at sites that do not bind with high affinity to anti- 22 thrombin. In the absence of a ligand like antithrombin, the nature of many of these sites remains uncharacterized. Table 2 Antithrombin is an inhibitor of the proteases thrombin, factor IXa HumanTable 1HS3ST-2. Humanexpression. HS3ST Expression and factor Xa and plays a central role in hemostasis. It also plays less ap- Gene Tissue Reference preciated roles as an inhibitor of inflammation and angiogenesis HS3ST-1 Heart, brain, lung, kidney, spleen, Shworak et al. (1999), (O'Reilly et al., 1999; Wiedermann Ch and Romisch, 2002). Heparin stomach, small intestine, colon, testis Mochizuki et al. (2008) binding to antithrombin induces a conformational change that increases HS3ST-2 Brain Shworak et al. (1999), its catalytic activity by several orders of magnitude (Rosenberg and Mochizuki et al. (2008) Damus, 1973; Huntington et al., 1996). Indeed, heparin is routinely HS3ST-3a Heart, placenta, lung, liver, kidney, Shworak et al. (1999), spleen, stomach, small intestine, Mochizuki et al. (2008) used as an anticoagulant in the clinic based on its ability to activate colon, testis antithrombin. HS3ST-3b Heart, placenta, lung, liver, kidney, Shworak et al. (1999), Much effort went into identifying the minimum active heparin spleen, stomach, colon, testis, Mochizuki et al. (2008) structure, which turns out to be a pentasaccharide with the structure pancreas, skeletal muscle HS3ST-4 Brain Shworak et al. (1999), A6-G0S9-I2S6 or A6-G0S3-I2S6 bearing a critical 3-O-sulfate on the Mochizuki et al. (2008) middle N-sulfo-glucosamine residue (Fig. 1)(Thunberg et al., 1982; HS3ST-5 Brain, spinal cord, skeletal muscle Xia et al. (2002), Choay et al., 1983). Based on genetic studies in mice, Hs3st-1 is respon- Mochizuki et al. (2003, 2008) sible for the overwhelming majority of antithrombin-binding structures HS3ST-6 Liver, kidney Xu et al. (2005) (HajMohammadi et al., 2003). Hs3st-1 is generally thought to be a
Please cite this article as: Thacker, B.E., et al., Heparan sulfate 3-O-sulfation: A rare modification in search of a function, Matrix Biol. (2013), development (Hasegawa and Wang, 2008). Expression of Hs3st-2 and -4 appeared http://dx.doi.org/10.1016/j.matbio.2013.12.001 associated with a subset of neuronal cells within the trigeminal ganglia (Lawrence et al., 2007). In D. melanogaster and C. elegans, the two Hs3st genes are expressed in specific cells, including small subsets of neurons (Kamimura et al., 2004; Tecle et al.,
2013). The spatially and temporally restricted pattern of expression of Hs3st genes in the nervous system suggests a neurological role for 3-O-sulfation. A mild neuronal patterning defect in C. elegans was seen after loss of function of the enzymes
(discussed in Section 1.9), but to date no such role has been demonstrated in other organisms.
There is a notable lack of information about the factors that regulate the expression of the Hs3st genes (e.g. transcription factors, promoter and enhancer sequences, etc.). This should be a fruitful area of investigation based on the differential expression of the isozymes across different tissues and during 23 development and the observation that external stimuli can affect the expression of the
Hs3st genes. For example, Hs3st-2 expression and 3-O-sulfation in the pineal gland varies with Circadian rhythm and is inducible by light (Borjigin et al., 2003; Kuberan et al., 2004). In intestinal epithelium, Hs3st-1 expression increases in response to IL-4 and IL-13 (Takeda et al., 2010). In contrast, stimulation of human microvascular endothelial cells with TNF-α or LPS diminishes expression of HS3ST-1 mRNA
(Krenn et al., 2008). Finally, Hs3st-3 was upregulated in urothelium in response to IL-
6 (Wood et al., 2011). In most of these examples, it remains unknown if sulfotransferase protein levels, enzyme activity or heparan sulfate structure were also affected. When F9 mouse embryonal carcinoma cells were differentiated into parietal endoderm using retinoic acid, cAMP and theophylline, the expression of Hs3st-1 increased more than 100-fold with a corresponding increase in production of heparan sulfate that binds to antithrombin (Zhang et al., 1998).
1.8 Biochemical and physiological implications of 3-O-sulfation
Hundreds of heparan sulfate-binding proteins have been identified and much effort has been expended to determine the structural features in heparan sulfate that mediate binding (Xu and Esko, 2014). Most studies have overlooked the effect of 3-O- sulfation on binding, generally because of the lack of available material for study. For this reason only six proteins have been demonstrated biochemically to be affected by
3-O-sulfation.
24
1.8.1 Antithrombin
Antithrombin is the best characterized protein in which 3-O-sulfate groups play a crucial role in binding to heparin/heparan sulfate and it serves as the paradigm for how one can unravel the structural context of relevant, biologically active 3-O- sulfated glucosamine residues (Lindahl et al., 1980). Determining the location of these rare groups in a sea of differentially sulfated domains is a formidable problem, compounded by the fact that obtaining multimilligram amounts of heparan sulfate from any source is quite difficult and costly. The analysis of the antithrombin binding site was greatly simplified because of its enrichment in heparin, which is available in kilogram quantities (Höök et al., 1976; Hopwood et al., 1976; Lindahl et al., 1979,
1980; Riesenfeld et al., 1981; Lindahl et al., 1983; Atha et al., 1985). Thus, it was possible to partially cleave the chains into smaller oligosaccharides and to obtain sufficient material for separating fragments into high and low affinity fractions, disaccharide analysis, chemical degradation and NMR studies (Yamada et al., 1993).
The antithrombin binding motif was subsequently identified in heparan sulfate expressed by endothelial cells, fibroblasts and in other tissues (Marcum et al., 1983;
Marcum and Rosenberg, 1985; Marcum et al., 1986a,b; De Agostini et al., 1990). It should be pointed out that all of these studies focused on sequences that bind to antithrombin, but in fact heparan sulfate chains contain 3-O-sulfate groups at sites that do not bind with high affinity to antithrombin. In the absence of a ligand like antithrombin, the nature of many of these sites remains uncharacterized.
Antithrombin is an inhibitor of the proteases thrombin, factor IXa and factor
Xa and plays a central role in hemostasis. It also plays less appreciated roles as an 25 inhibitor of inflammation and angiogenesis (O'Reilly et al., 1999; Wiedermann Ch and
Romisch, 2002). Heparin binding to antithrombin induces a conformational change that increases its catalytic activity by several orders of magnitude (Rosenberg and
Damus, 1973; Huntington et al., 1996). Indeed, heparin is routinely used as an anticoagulant in the clinic based on its ability to activate antithrombin.
Much effort went into identifying the minimum active heparin structure, which turns out to be a pentasaccharide with the structure A6-G0S9-I2S6 or A6-G0S3-I2S6 bearing a critical 3-O-sulfate on the middle N-sulfo-glucosamine residue (Fig. 1-1)
(Thunberg et al., 1982; Choay et al., 1983). Based on genetic studies in mice, Hs3st-1 is responsible for the overwhelming majority of antithrombin-binding structures
(HajMohammadi et al., 2003). Hs3st-1 is generally thought to be a limiting factor in generating antithrombin binding sites (Zhang et al., 1998). However, in the presence of excess Hs3st-1, the precursor structures become limiting. Evidence also suggests that non-precursor saccharides can inhibit Hs3st-1, which presumably compete with the substrate for binding to the enzyme (Razi and Lindahl, 1995).
The presence of N-acetylglucosamine-6-sulfate and glucuronic acid at the − 2 and − 1 positions of the pentasaccharide sequence suggests that the binding site occurs in the transition zones between highly sulfated “NS” domains and unmodified “NA” domains (Lindahl et al., 1983; Zhang et al., 2001a). Biochemical studies demonstrated that the 3-O-sulfate group at position 0 and 6-O-sulfate group on the N- acetylglucosamine residue at position −2 account for more than half of the binding energy released when antithrombin interacts with the pentasaccharide (Atha et al.,
1985, 1987). The absence of the 3-O-sulfate group decreases affinity by several orders 26
of magnitude (KD = 30 nM versus 500 µM) and reduces both the conformation change induced in antithrombin and the inhibition of Factor Xa (Atha et al., 1985, 1987). The co-crystal structures of antithrombin and bound oligosaccharide suggest that while several basic and polar residues in antithrombin make salt bridges and hydrogen bonds with the pentasaccharide, the most pivotal interaction that stabilizes the complex is the one between residue K114 and the 3-O-sulfate group (Jin et al., 1997; Li et al., 2004).
This interaction orients K114 in an optimal conformation to form hydrogen bonds and salt bridges with sugar residues at position +1 and +2 (Fig. 1-4) (Richard et al., 2009).
The literature frequently describes antithrombin-binding heparin as “the pentasaccharide structure”, suggesting that only a unique pentasaccharide can bind to antithrombin. This notion is overly simplistic in that other oligosaccharides can bind and activate antithrombin. Some of these structures have higher affinity and result in
-2 -2 -1 0 -1 0 +1 +1
N45 N45
- +2 - +2 3-O-SO3 3-O-SO3 R129 K114 R129 K114 K125 R46 K125 R46 R47 R47
Figure 1-4. Stereo diagram of pentasaccharide–antithrombin interaction (PDB code: 2GD4). Heparan sulfate binding residues of antithrombin (salmon) and the pentasaccharide (gray) are shown in sticks, and the antithrombin protein backbone is shown in cartoon (salmon). Putative salt bridges and hydrogen bonds stabilized by the 3-O-sulfate group and K114 are shown as broken lines. Sugar residues in the pentasaccharide are labeled as in Fig. 1. 27 more robust activation of antithrombin than the minimal pentasaccharide. These include an identical pentasaccharide with a second 3-O-sulfate group on the N-sulfo- glucosamine at position + 2 or 3-O-sulfated heparan sulfate devoid of iduronic acid or
2-sulfo-iduronic acid at the + 1 position (Zhang et al., 2001b; Chen et al., 2007;
Guerrini et al., 2008, 2013).
Only about one-third of typical unfractionated heparin preparations have the ability to bind and activate antithrombin (Höök et al., 1976; Lam et al., 1976). In most tissues examined to date, the percentage of heparan sulfate chains bearing AT-type sequences is quite low. For example, only 5% of heparan sulfate chains from bovine aortic endothelial cells, human umbilical vein endothelial cells and rat microvascular endothelial cells binds with high affinity to antithrombin (Marcum et al., 1986a;
Kojima et al., 1992; Mertens et al., 1992). In several tissues examined in the rat, approximately 5–10% of heparan sulfate chains contained a high affinity-binding site
(Horner, 1990). The brain and spleen have antithrombin binding sites on ~20% of the chains (Horner, 1990). Surprisingly, over 50% of heparan sulfate chains found in follicular fluid bind with high affinity and activate antithrombin (de Agostini et al.,
2008). The production of anticoagulant heparan sulfate proteoglycans in granulosa cells peaks prior to ovulation, linking AT-type heparan sulfate production to the menstrual cycle (Princivalle et al., 2001). Heparin/heparan sulfate with low affinity for antithrombin also contains 3-O-sulfation, apparently in a context that does not support antithrombin activation (Shworak et al., 1997). The purpose of 3-O-sulfate catalyzed by Hs3st-1 in contexts other than antithrombin-binding sites is currently unknown. 28
Mutations that affect heparin binding to antithrombin underscore the importance of heparan sulfate-induced activation of antithrombin in vivo. Several mutations that interrupt the heparin-binding site of antithrombin have been identified in human patients, some with thrombotic phenotypes (Koide et al., 1984; Gandrille et al., 1990; Lane et al., 1996). Accordingly, a knock-in mouse with a point mutation
(R48C) corresponding to a human variant produces antithrombin with reduced affinity for heparin (Dewerchin et al., 2003). This mouse suffers from severe spontaneous thrombosis beginning as early as birth and is unresponsive to heparin. As described above, AT-type 3-O-sulfation unquestionably endows heparan sulfate with high inhibitory activity towards Factor Xa, yet 3-O-sulfation seems dispensable in maintaining hemostatic tone in vivo based on inactivation of Hs3st-1 in the mouse
-/- (HajMohammadi et al., 2003). Surprisingly, Hs3st-1 mice do not exhibit a prothrombic phenotype despite having drastically reduced levels of AT-type heparan sulfate (HajMohammadi et al., 2003). Two explanations for this finding have been proposed. First, the other 3-O-sulfotransferases (in particular Hs3st-5) may create sufficient AT-type heparan sulfate to compensate for loss of Hs3st-1. Other gD-type 3-
O-sulfotransferases can create AT-type heparan sulfate as well, albeit much less efficiently than Hs3st-1 (HajMohammadi et al., 2003; Girardin et al., 2005). Second, studies have shown that suboptimal heparan sulfate structures, including those without
3-O-sulfation, may activate antithrombin sufficiently to maintain hemostasis
(Nordenman et al., 1978; Scully et al., 1988; Streusand et al., 1995; Richard et al.,
2009). 29
Antithrombin also has anti-inflammatory and anti-angiogenic properties that
-/- may be influenced by 3-O-sulfation (Wiedermann Ch and Romisch, 2002). Hs3st-1 mice are hypersensitive to LPS-induced inflammation and antithrombin has a protective effect in the presence of AT-type heparan sulfate (Shworak et al., 2010).
The details and mechanism of this effect have not yet been elucidated. Cleaved and latent forms of antithrombin lose their anticoagulant properties but have anti- angiogenic properties (O'Reilly et al., 1999). These forms of antithrombin retain their preference for 3-O-sulfated heparan sulfate and binding to heparan sulfate influences
-/- the anti-angiogenic activity (Zhang et al., 2005; Schedin-Weiss et al., 2008). Hs3st-1 mice experience intrauterine growth retardation and spontaneous eye degeneration
(HajMohammadi et al., 2003), suggesting that other undiscovered ligands may require
3-O-sulfated sequences created by Hs3st-1.
1.8.2 Herpes simplex virus glycoprotein D
Glycoprotein D (gD), an envelope glycoprotein of Herpes Simplex virus, facilitates viral fusion by interacting with cellular entry receptors that include 3-O- sulfated heparan sulfate (Shukla et al., 1999). Wild type CHO cells are resistant to
HSV-1 infection, but transgenic expression of Hs3st-2, -3a, -3b, -4, -5 and -6 allows
HSV infection (Shukla et al., 1999; Xia et al., 2002; Tiwari et al., 2005; Xu et al.,
2005; O'Donnell et al., 2006). Primary human corneal fibroblasts also produce 3-O- sulfated heparan sulfate, which renders them susceptible to HSV-1 entry (Tiwari et al.,
2006). The affinity of gD for 3-O-sulfated heparan sulfate is relatively low; the 30
addition of 3-O-sulfate lowers the KD of gD for heparan sulfate from 43 µM to 2 µM.
Nevertheless, 3-O-sulfation results in a dramatic increase of susceptibility to viral infection (Shukla et al., 1999). These findings demonstrate an important principle, namely that 3-O-sulfation can have a profound biological effect without inducing a high affinity binding site for the protein per se.
Recombinant gD has been used to purify a 3-O-sulfated octasaccharide (Liu et al., 2002). The reported structure contained a 3-O-sulfated, N-unsubstituted glucosamine, but this structure should be reevaluated based on the arguments presented earlier (see Section 1.4) (Liu et al., 1999b). Other octasaccharides derived from heparin can also interact with gD and have been proposed as potentially clinically relevant inhibitors of infection (Copeland et al., 2008; Hu et al., 2011). The binding site for heparan sulfate has been mapped to the N-terminal portion of gD by mutagenesis and crystallography (Carfi et al., 2001; Yoon et al., 2003). Co- crystallization studies are needed to determine how 3-O-sulfation promotes binding of gD to heparan sulfate and facilitates membrane fusion.
1.8.3 Fibroblast growth factors (FGFs)
There is indirect evidence for a role of 3-O-sulfation in the binding of FGF7 and FGF receptors (FGFR) to heparan sulfate. Heparin was fractionated over antithrombin to obtain high and low affinity material. Only the fraction of heparin with high affinity for antithrombin bound to FGFR1, supported FGF1 or FGF2 binding to FGFR1, and facilitated FGF1-induced DNA synthesis (McKeehan et al.,
1999; Ye et al., 2001). This fraction also protected FGF7 from proteolysis better than 31 unfractionated heparin (Ye et al., 2001). Fractionation of size-defined heparin oligosaccharides on immobilized FGF7 produced high affinity octasaccharides that also had anticoagulant activity (Luo et al., 2006). These octasaccharides also enhanced
FGF7-stimulated DNA synthesis and intracellular signaling in mouse keratinocytes
(Luo et al., 2006). Further information about the structure of the binding sequence or the structure of the complex is not yet available.
In Zebrafish, left–right patterning during early development is driven in part by cilia-dependent fluid flow in Kupffer's vesicle (Essner et al., 2005). Two Hs3sts independently influence cilia function in the Kupffer's vesicle (Neugebauer et al.,
2013). Morpholino knockdown of Hs3st-5 resulted in decreased cilia length, which showed synergistic effects upon loss of FGF8. FGF8 is a known heparin binding protein, but it remains to be seen if binding of FGF8 to heparan sulfate is influenced by 3-O-sulfation. On the other hand, knockdown of Hs3st-6 results in normal cilia length but impaired cilia movement, which correlated with disruption of dynein organization. Hs3st-3z, -5, -6 and -7 are coexpressed in the cells making up Kupffer's vesicle, but are not able to compensate for loss of either Hs3st-5 or -6. Likewise, knockdown of Hs3st-3z or -7 did not reproduce the left–right patterning defect. These findings demonstrate distinct roles for multiple 3-O-sulfotransferases coexpressed in the same cells. Furthermore, they demonstrate that individual members of each subgroup of Hs3st may create unique 3-O-sulfated sequences with distinct biological properties. 32
1.8.4 Cyclophilin B
Cyclophilin B stimulates lymphocyte adhesion and migration upon binding to cell surface heparan sulfate (Allain et al., 2002). Cyclophilin B binds to heparin octasaccharides with high affinity (KD = 16 nM) (Vanpouille et al., 2007). Like gD, the heparan sulfate binding site for cyclophilin B has been suggested to contain a 3-O- sulfated N-unsubstituted glucosamine (Vanpouille et al., 2007). siRNA mediated knockdown of Hs3st-3a in Jurkat T cells resulted in the loss of cyclophilin B binding to the cell surface and loss of ERK phosphorylation. HeLa cells express Hs3st-2, -3a, -
3b, -5 and -6 but do not support cyclophilin binding (Vanpouille et al., 2007). This finding suggests the possibility that heparan sulfate on HeLa cells lacks other structural features (e.g. appropriate N- or O-sulfation) that are required for cyclophilin
B binding (Deligny et al., 2010).
1.8.5 Stabilin
Clearance of circulating heparin occurs primarily in liver sinusoidal endothelial cells by stabilin-1 and -2 in a manner that appears to be enhanced by 3-O-sulfation
(Borjigin et al., 2003; Pempe et al., 2012). Stabilin-1 and -2 overexpressing cells took up Hs3st-1-modified oligosaccharide more efficiently than an identical non-3-O- sulfated oligosaccharide. Antithrombin was able to inhibit this effect, suggesting that the antithrombin binding sequence can also bind to stabilin. In addition, mice cleared
Hs3st-1-modified oligosaccharides faster than oligosaccharides devoid of 3-O- sulfation. Thus, while not required for clearance, 3-O-sulfation facilitates the removal of soluble heparin and presumably heparan sulfate through stabilin-1 and -2. 33
1.9 3-O-sulfation in development and disease
1.9.1 3-O-sulfation in development
Evidence is emerging that 3-O-sulfation can modulate various developmental processes in model organisms. As described above, studies of left–right asymmetry implicate Hs3st-5 in FGF8-mediated signaling in Zebrafish. Recent studies show that expression of Hs3st-7 is required for normal development of the Zebrafish heart
(Samson et al., 2013b). Morpholino knockdown of Hs3st-7 in the developing
Zebrafish resulted in disorganization of cardiac contractile apparatus with reduced ventricular contraction. In normal Zebrafish, Hs3st-7 expression somehow restricts the expression of bone morphogenetic protein 4 (BMP4) to the atrioventricular junction.
Upon loss of Hs3st-7, BMP4 expression expands throughout the atrium and ventricle and causes loss of cardiac contractility. Although previous studies showed that BMP7 can interact with heparan sulfate (Irie et al., 2003; Midorikawa et al., 2003), this is the first report indicating a role for 3-O-sulfation in binding and sequestration.
Leukemia inhibitory factor (LIF) plays a role in maintaining stem cells by activating signaling through signal transduction and activator of transcription 3
(STAT3). In tissue culture, withdrawal of LIF results in differentiation of mouse embryonic stem cells and a concurrent upregulation of Hs3st-5 (Hirano et al., 2012).
That cell surface 3-O-sulfation increased was also suggested by cell surface binding of a single chain antibody (HS4C3) with propensity to bind 3-O-sulfated heparan sulfate
(Ten Dam et al., 2006). Interestingly, overexpression of Hs3st-5 induced differentiation of mouse embryonic stem cells even in the presence of LIF. Hs3st-5 presumably acts by increasing 3-O-sulfation of cell surface proteoglycans, which in 34 turn alters signaling. Indeed, overexpression of Hs3st-5 resulted in redistribution of
Fas, a member of the tumor necrosis factor receptor family, to lipid rafts on the cell surface. Activation of Fas signaling was inferred by activation of Caspase-3 and degradation of Nanog. Whether 3-O-sulfated heparan sulfate binds to Fas or one or more signaling receptors on the cell surface remains unknown.
C. elegans expresses two 3-O-sulfotransferases, hst-3.1 and hst-3.2 that group phylogenetically with AT-type and gD-type Hs3sts, respectively (Tecle et al., 2013).
Loss of function of either 3-O-sulfotransferase resulted in aberrant branching of the hermaphrodite-specific neuron. Furthermore, an extra branching phenotype of the AIY interneuron induced by overexpression of the extracellular adhesion molecule kal-1 depends on the expression of hst-3.2. Interestingly, reexpression of hst-3.2 specifically in the AIY interneuron was not sufficient to restore the phenotype, whereas panneuronal or muscle specific rescue of hst-3.2 expression restored the branching phenotype. This finding indicates that 3-O-sulfated heparan sulfate acts in trans (i.e. from a neighboring cell). These results also demonstrate that 3-O-sulfation can influence neuronal patterning in development and suggest kal-1 as a candidate heparin-binding protein that is influenced by 3-O-sulfation.
The effect of 3-O-sulfation has also been investigated in Drosophila. Like C. elegans, Drosophila expresses two 3-O-sulfotransferases (Hs3st-A and -B) that cluster by sequence homology with the mammalian AT-type and gD-type 3-O- sulfotransferases, respectively (Kamimura et al., 2004) (Fig. 1-3). Loss of either 3-O- sulfotransferase resulted in embryonic or larval lethality. Tissue specific loss of Hs3st-
B in Drosophila has been suggested to cause significant structural defects similar to 35 those seen by inactivation of Notch and Notch target genes. These results are surprising because none of the Notch ligands appear to bind to heparan sulfate and obvious Notch phenotypes have not been detected in mice lacking Hs3st-1 or -2
(although this may be explained as compensation by the other 3-O-sulfotransfersases) or in C. elegans lacking all 3-O-sulfation. Conceivably, the dependence of Notch signaling on 3-O-sulfation may be restricted to Drosophila.
1.9.2 Diseases related to 3-O-sulfation
Aberrant expression of the 3-O-sulfotransferases as a result of DNA hypermethylation is emerging as a common theme in cancer biology. CpG islands located upstream of the transcription start site and within the first exon of the HS3ST-2 gene are hypermethylated in breast, colon, lung and pancreatic cancers (Miyamoto et al., 2003). In the tumor samples studied, HS3ST-2 was essentially silenced as a result of hypermethylation, an effect that was reversed by treatment with a DNA- methyltransferase inhibitor. Another epigenetic study of heparan sulfate biosynthetic enzymes in chondrosarcoma cells showed that HS3ST-1, -2, -3a and -6 were all hypermethylated (Bui et al., 2010). Reversing methylation boosted expression of these
HS3STs 1.5- to 2.7-fold and resulted in decreased cell proliferation, increased cell adhesion and decreased cell migration. Hypermethylation of the HS3ST-2 gene has also been detected in B-cell, T-cell and myeloid malignancies, cervical cancer and its immediate precursor, cervical intraepithelial neoplasia (Shivapurkar et al., 2007; Jiang et al., 2009; Martin-Subero et al., 2009). Aberrant methylation of HS3ST-2 may prove useful as a biomarker for early detection of prostate and cervical cancer (Shivapurkar 36 et al., 2007; Mahapatra et al., 2012). Restoration of 3-O-sulfation suppresses tumor growth suggesting that activation of Hs3sts could be a useful therapeutic target in cancer patients. Whether alterations in Hs3st expression in these systems affect the structure of heparan sulfate has not been determined, nor have the proteins influenced by 3-O-sulfation been identified. It remains unclear if DNA methylation is a general mechanism that regulates Hs3st expression under normal physiological conditions.
Pathogens other than HSV-1 may have evolved to co-opt 3-O-sulfation.
Linkage analysis revealed an association between Hs3st-3a/Hs3st-3b and sensitivity to parasitemia induced by Plasmodium falciparum (Atkinson et al., 2012). A genome- wide association study linked mother to infant transmission of HIV to Hs3st-3a expression and Hs3st-3b expression is upregulated in patients with HIV-associated dementia (Boven et al., 2007; Joubert et al., 2010). Finally, Hs3st-3a expression may suppress Hepatitis B virus replication in hepatocytes through an unidentified mechanism (Zhang et al., 2010). These interesting results deserve additional consideration to define the relevant ligands and receptors that interact with 3-O- sulfated heparan sulfate.
At least eight lysosomal enzymes are responsible for the degradation of heparan sulfate. Recently, arylsulfatase G was identified as the enzyme that removes
3-O-sulfate groups from non-reducing end N-sulfoglucosamine-3-sulfate (Kowalewski et al., 2012). Like many other heparan sulfate degradative enzymes, loss of arylsulfatase G in mice results in lysosomal accumulation of heparan sulfate and characteristics typical of other mucopolysaccharidoses. Whether loss of 3-O-sulfatase results in a Sanfilippo type syndrome in humans awaits discovery of a patient lacking 37 the enzyme. The 3-O-sulfatase is unable to remove 3-O-sulfate from N-unsubstituted glucosamine-3-sulfate, a putative product of gD-type Hs3sts. If any of the Hs3sts generate N-unsubstituted glucosamine-3-sulfate then there must be another so far unidentified 3-O-sulfatase.
1.10 Conclusions
Any discussion of heparan sulfate–protein interactions must address the question of specificity (Kreuger et al., 2006; Lindahl and Li, 2009; Xu and Esko,
2014). Antithrombin is clearly unusual in that its biological activity critically depends on high affinity binding to a 3-O-sulfated pentasaccharide. The requirement for the 3-
O-sulfate group is so great, that in its absence, the affinity of the interaction drops several orders of magnitude. Stated in another way, the affinity of the interaction is of sufficient magnitude to drive a conformational change adequate to activate antithrombin. Can we expect other ligands to show similar characteristics? Many, but not all, heparan sulfate binding proteins show an “analog” response with respect to charge, i.e. affinity and biological activity increases as the degree of sulfation increases. Thus, one could argue that the presence of a 3-O-sulfate group in the context of other modifications merely increases the local charge density providing another opportunity for non-specific interaction. However, it is difficult to explain the evolution of seven 3-O-sulfotransferases differing in substrate specificity and tissue expression to merely increase charge density. Clearly, the information emerging from genetic studies in model organisms indicates selective and crucial interactions occur between some ligands and 3-O-sulfated heparan sulfate. Future studies should focus 38 on characterizing the physical interaction of these ligands with 3-O-sulfated oligosaccharides and expanding the repertoire of known 3-O-sulfate dependent proteins.
The large number of Hs3st genes and their complex spatial and temporal expression provides a system that has the potential to control ligand binding and signaling in multiple tissues and at different stages of development. To date very few proteins have been described whose activity is enhanced by or dependent upon 3-O- sulfation. We also know little about the chemical context in which 3-O-sulfation takes place and how the biosynthetic process is orchestrated to generate the precursor structures required by the Hs3sts. To a large extent, technical issues have limited progress. First, the small amounts of heparan sulfate available from defined sources makes classical fractionation schemes, like that used to define the antithrombin- binding site in heparin, technically demanding. Second, most methods to characterize sites of 3-O-sulfation have been based on a “bottom-up” approach using degradative techniques. Third, structural studies have been limited by the lack of defined standards, which also limits characterization of the sulfotransferases. Fourth, few researchers have focused on 3-O-sulfation, probably due to its rarity and the various analytical and synthetic barriers described above.
Although this assessment of the field may appear gloomy, we believe that the field has turned a corner. New “top-down” analytical methods based on tandem mass spectrometry and ion-mobility methods hold great promise for providing much greater contextual information about the structures of 3-O-sulfation sites (Meissen et al.,
2009; Kailemia et al., 2013). Chemical and chemoenzymatic methods have been 39 recently developed that have the capacity to produce multimilligram quantities of defined oligosaccharides, providing much needed reagents to aid in the discovery of new ligands and to characterize the binding sites in the enzymes and in the protein ligands (Arungundram et al., 2009; Xu et al., 2011, 2012). Genetic studies of model organisms focused on 3-O-sulfation have begun to yield interesting insights into the biological function of the Hs3sts and new ligands to study. Inactivation of the genes in cells by silencing methods, TALEN technology and gene targeting in embryonic stem cells provide new tools to study the biological implications of altering 3-O-sulfation in vitro and in vivo. These advances should fuel a resurgence of interest in 3-O-sulfation and eventually lead to a more complete understanding of this relatively rare and mystifying modification.
1.11 Acknowledgements
This chapter has been published as a review article Heparan Sulfate 3-O- sulfation: A Rare Modification in Search of a Function in Matrix Biology 2014, (35)
60-72. The dissertation author was the primary author of the review with Ding Xu,
Roger Lawrence and Jeffrey D. Esko as co-authors. We are grateful to Jian Liu, H.
Joseph Yost, Joseph Zaia and Ulf Lindahl for their critical review of the manuscript and helpful comments. This work was supported by GM93131 and HL107150 (to
J.D.E.) and by training grant T32CA067754 (to B.E.T.) from the National Institutes of
Health and by grant 13BGlA14150008 (to D.X.) from the American Heart Association.
40
1.12 Literature cited
Allain, F., Vanpouille, C., Carpentier, M., Slomianny, M.C., Durieux, S., Spik, G., 2002. Interaction with glycosaminoglycans is required for cyclophilin B to trigger integrin-mediated adhesion of peripheral blood T lymphocytes to extracellular matrix. Proc. Natl. Acad. Sci. U. S. A. 99, 2714–2719.
Arungundram, S., Al-Mafraji, K., Asong, J., Leach III, F.E., Amster, I.J., Venot, A., Turnbull, J.E., Boons, G.J., 2009. Modular synthesis of heparan sulfate oligosaccharides for structure–activity relationship studies. J. Am. Chem. Soc. 131, 17394–17405.
Atha, D.H., Lormeau, J.C., Petitou, M., Rosenberg, R.D., Choay, J., 1985. Contribution of monosaccharide residues in heparin binding to antithrombin III. Biochemistry 24, 6723–6729.
Atha, D.H., Lormeau, J.C., Petitou, M., Rosenberg, R.D., Choay, J., 1987. Contribution of 3-O- and 6-O-sulfated glucosamine residues in the heparin-induced conformational change in antithrombin III. Biochemistry 26, 6454–6461.
Atkinson, A., Garnier, S., Afridi, S., Fumoux, F., Rihet, P., 2012. Genetic variations in genes involved in heparan sulphate biosynthesis are associated with Plasmodium falciparum parasitaemia: a familial study in Burkina Faso. Malar. J. 11, 108.
Attreed, M., Desbois, M., van Kuppevelt, T.H., Bulow, H.E., 2012. Direct visualization of specifically modified extracellular glycans in living animals. Nat. Methods 9, 477–479.
Bienkowski, M.J., Conrad, H.E., 1985. Structural characterization of the oligosaccharides formed by depolymerization of heparin with nitrous acid. J Biol Chem. 260, 356–365.
Bishop, J.R., Schuksz, M., Esko, J.D., 2007. Heparan sulphate proteoglycans fine-tune mammalian physiology. Nature 446, 1030–1037.
Borjigin, J., Deng, J., Sun, X., De Jesus, M., Liu, T., Wang, M.M., 2003. Diurnal pineal 3-O-sulphotransferase 2 expression controlled by beta-adrenergic repression. J. Biol. Chem. 278, 16315–16319.
Boven, L.A., Noorbakhsh, F., Bouma, G., van der Zee, R., Vargas, D.L., Pardo, C., McArthur, J.C., Nottet, H.S., Power, C., 2007. Brain-derived human immunodeficiency virus-1 Tat exerts differential effects on LTR transactivation and neuroimmune activation. J. Neurovirol. 13, 173–184.
41
Bui, C., Ouzzine, M., Talhaoui, I., Sharp, S., Prydz, K., Coughtrie, M.W., Fournel- Gigleux, S., 2010. Epigenetics: methylation-associated repression of heparan sulfate 3- O-sulfotransferase gene expression contributes to the invasive phenotype of H-EMC- SS chondrosarcoma cells. Faseb J. 24, 436–450.
Cadwallader, A.B., Yost, H.J., 2006. Combinatorial expression patterns of heparan sulfate sulfotransferases in zebrafish: I. The 3-O-sulfotransferase family. Dev. Dyn. 235, 3423–3431.
Carfi, A., Willis, S.H., Whitbeck, J.C., Krummenacher, C., Cohen, G.H., Eisenberg, R.J., Wiley, D.C., 2001. Herpes simplex virus glycoprotein D bound to the human receptor HveA. Mol. Cell 8, 169–179.
Casu, B., Oreste, P., Torri, G., Zoppetti, G., Choay, J., Lormeau, J.C., Petitou, M., Sinay, P., 1981. The structure of heparin oligosaccharide fragments with high anti- (factor Xa) activity containing the minimal antithrombin III-binding sequence. Chemical and 13C nuclear-magnetic-resonance studies. Biochem J. 197, 599–609.
Chen, J., Liu, J., 2005. Characterization of the structure of antithrombin-binding heparan sulfate generated by heparan sulfate 3-O-sulfotransferase 5. Biochim. Biophys. Acta 1725, 190–200.
Chen, J., Duncan, M.B., Carrick, K., Pope, R.M., Liu, J., 2003. Biosynthesis of 3-O- sulfated heparan sulfate: unique substrate specificity of heparan sulfate 3-O- sulfotransferase isoform 5. Glycobiology 13, 785–794.
Chen, J., Jones, C.L., Liu, J., 2007. Using an enzymatic combinatorial approach to identify anticoagulant heparan sulfate structures. Chem. Biol. 14, 986–993.
Choay, J., Petitou, M., Lormeau, J.C., Sinay, P., Casu, B., Gatti, G., 1983. Structure– activity relationship in heparin: a synthetic pentasaccharide with high affinity for antithrombin III and eliciting high anti-factor Xa activity. Biochem. Biophys. Res. Commun. 116, 492–499.
Copeland, R., Balasubramaniam, A., Tiwari, V., Zhang, F., Bridges, A., Linhardt, R.J., Shukla, D., Liu, J., 2008. Using a 3-O-sulfated heparin octasaccharide to inhibit the entry of herpes simplex virus type 1. Biochemistry 47, 5774–5783. de Agostini, A., Watkins, S.C., Slayter, H.S., Youssoufian, H., Rosenberg, R.D., 1990. Localization of anticoagulantly active heparan sulfate proteoglycans in vascular endothelium: antithrombin binding on cultured endothelial cells and perfused rat aorta. J. Cell Biol. 111, 1293–1304. de Agostini, A.I., Dong, J.C., de Vantery Arrighi, C., Ramus, M.A., Dentand-Quadri, I., Thalmann, S., Ventura, P., Ibecheole, V., Monge, F., Fischer, A.M., 42
HajMohammadi, S., Shworak, N.W., Zhang, L., Zhang, Z., Linhardt, R.J., 2008. Human follicular fluid heparan sulfate contains abundant 3-O-sulfated chains with anticoagulant activity. J. Biol. Chem. 283, 28115–28124.
Deligny, A., Denys, A., Marcant, A., Melchior, A., Mazurier, J., van Kuppevelt, T.H., Allain, F., 2010. Synthesis of heparan sulfate with cyclophilin B-binding properties is determined by cell type-specific expression of sulfotransferases. J. Biol. Chem. 285, 1701–1715.
Desai, U.R., Wang, H., Ampofo, S.A., Linhardt, R.J., 1993. Oligosaccharide composition of heparin and low-molecular-weight heparins by capillary electrophoresis. Anal. Biochem. 213, 120–127.
Dewerchin, M., Herault, J.P., Wallays, G., Petitou, M., Schaeffer, P., Millet, L., Weitz, J.I., Moons, L., Collen, D., Carmeliet, P., Herbert, J.M., 2003. Life-threatening thrombosis in mice with targeted Arg48-to-Cys mutation of the heparin-binding domain of antithrombin. Circ. Res. 93, 1120–1126.
Duncan, M.B., Chen, J., Krise, J.P., Liu, J., 2004. The biosynthesis of anticoagulant heparan sulfate by the heparan sulfate 3-O-sulfotransferase isoform 5. Biochim. Biophys. Acta 1671, 34–43.
Edavettal, S.C., Lee, K.A., Negishi, M., Linhardt, R.J., Liu, J., Pedersen, L.C., 2004. Crystal structure and mutational analysis of heparan sulfate 3-O-sulfotransferase isoform 1. J. Biol. Chem. 279, 25789–25797.
Edge, A.S., Spiro, R.G., 1990. Characterization of novel sequences containing 3-O- sulfated glucosamine in glomerular basement membrane heparan sulfate and localization of sulfated disaccharides to a peripheral domain. J. Biol. Chem. 265, 15874–15881.
Esko, J.D., Selleck, S.B., 2002. Order out of chaos: assembly of ligand binding sites in heparan sulfate. Annu. Rev. Biochem. 71, 435–471.
Essner, J.J., Amack, J.D., Nyholm, M.K., Harris, E.B., Yost, H.J., 2005. Kupffer's vesicle is a ciliated organ of asymmetry in the zebrafish embryo that initiates left-right development of the brain, heart and gut. Development 132, 1247–1260.
Gandrille, S., Aiach, M., Lane, D.A., Vidaud, D., Molho-Sabatier, P., Caso, R., de Moerloose, P., Fiessinger, J.N., Clauser, E., 1990. Important role of arginine 129 in heparin-binding site of antithrombin III. Identification of a novel mutation arginine 129 to glutamine. J. Biol. Chem. 265, 18997–19001.
Girardin, E.P., Hajmohammadi, S., Birmele, B., Helisch, A., Shworak, N.W., de Agostini, A.I., 2005. Synthesis of anticoagulantly active heparan sulfate proteoglycans 43 by glomerular epithelial cells involves multiple 3-O-sulfotransferase isoforms and a limiting precursor pool. J. Biol. Chem. 280, 38059–38070.
Guerrini, M., Guglieri, S., Beccati, D., Torri, G., Viskov, C., Mourier, P., 2006. Conformational transitions induced in heparin octasaccharides by binding with antithrombin III. Biochem J. 399, 191–198.
Guerrini, M., Guglieri, S., Casu, B., Torri, G., Mourier, P., Boudier, C., Viskov, C., 2008. Antithrombin-binding octasaccharides and role of extensions of the active pentasaccharide sequence in the specificity and strength of interaction. Evidence for very high affinity induced by an unusual glucuronic acid residue. J. Biol. Chem. 283, 26662–26675.
Guerrini, M., Elli, S., Mourier, P., Rudd, T.R., Gaudesi, D., Casu, B., Boudier, C., Torri, G., Viskov, C., 2013. An unusual antithrombin-binding heparin octasaccharide with an additional 3-O-sulfated glucosamine in the active pentasaccharide sequence. Biochem. J. 449, 343–351.
HajMohammadi, S., Enjyoji, K., Princivalle, M., Christi, P., Lech, M., Beeler, D., Rayburn, H., Schwartz, J.J., Barzegar, S., De Agostini, A.I., Post, M.J., Rosenberg, R.D., Shworak, N.W., 2003. Normal levels of anticoagulant heparan sulfate are not essential for normal hemostasis. J. Clin. Invest. 111, 989–999.
Hasegawa, H., Wang, F., 2008. Visualizing mechanosensory endings of TrkC- expressing neurons in HS3ST-2-hPLAP mice. J. Comp. Neurol. 511, 543–556.
Hirano, K., Sasaki, N., Ichimiya, T., Miura, T., Van Kuppevelt, T.H., Nishihara, S., 2012. 3-O-Sulfated heparan sulfate recognized by the antibody HS4C3 contribute to the differentiation of mouse embryonic stem cells via Fas signaling. PLoS ONE 7, e43440.
Höök, M., Bjork, I., Hopwood, J., Lindahl, U., 1976. Anticoagulant activity of heparin: separation of high-activity and low-activity heparin species by affinity chromatography on immobilized antithrombin. FEBS Lett. 66, 90–93.
Hopwood, J., Höök, M., Linker, A., Lindahl, U., 1976. Anticoagulant activity of heparin: isolation of antithrombin-binding sites. FEBS Lett. 69, 51–54.
Horner, A.A., 1990. Rat heparan sulphates. A study of the antithrombin-binding properties of heparan sulphate chains from rat adipose tissue, brain, carcase, heart, intestine, kidneys, liver, lungs, skin and spleen. Biochem. J. 266, 553–559.
Hu, Y.P., Lin, S.Y., Huang, C.Y., Zulueta, M.M., Liu, J.Y., Chang, W., Hung, S.C., 2011. Synthesis of 3-O-sulfonated heparan sulfate octasaccharides that inhibit the herpes simplex virus type 1 host-cell interaction. Nat. Chem. 3, 557–563. 44
Huntington, J.A., Olson, S.T., Fan, B.Q., Gettins, P.G.W., 1996. Mechanism of heparin activation of antithrombin. Evidence for reactive center loop preinsertion with expulsion upon heparin binding. Biochemistry 35, 8495–8503.
Irie, A., Habuchi, H., Kimata, K., Sanai, Y., 2003. Heparan sulfate is required for bone morphogenetic protein-7 signaling. Biochem. Biophys. Res. Commun. 308, 858–865.
Jiang, Y., Dunbar, A., Gondek, L.P., Mohan, S., Rataul, M., O'Keefe, C., Sekeres, M., Saunthararajah, Y., Maciejewski, J.P., 2009. Aberrant DNA methylation is a dominant mechanism in MDS progression to AML. Blood 113, 1315–1325.
Jin, L., Abrahams, J.P., Skinner, R., Petitou, M., Pike, R.N., Carrell, R.W., 1997. The anticoagulant activation of antithrombin by heparin. Proc. Natl. Acad. Sci. U. S. A. 94, 14683–14688.
Joubert, B.R., Lange, E.M., Franceschini, N., Mwapasa, V., North, K.E., Meshnick, S.R., 2010. A whole genome association study of mother-to-child transmission of HIV in Malawi. Genome Med. 2, 17.
Kailemia, M.J., Li, L., Xu, Y., Liu, J., Linhardt, R.J., Amster, I.J., 2013. Structurally informative tandem mass spectrometry of highly sulfated natural and chemoenzymatically synthesized heparin and heparan sulfate glycosaminoglycans. Mol. Cell. Proteomics 12, 979–990.
Kakuta, Y., Sueyoshi, T., Negishi, M., Pedersen, L.C., 1999. Crystal structure of the sulfotransferase domain of human heparan sulfate N-deacetylase/N-sulfotransferase 1. J. Biol. Chem. 274, 10673–10676.
Kakuta, Y., Li, L., Pedersen, L.C., Pedersen, L.G., Negishi, M., 2003. Heparan sulphate N-sulphotransferase activity: reaction mechanism and substrate recognition. Biochem. Soc. Trans. 31, 331–334.
Kamimura, K., Rhodes, J.M., Ueda, R., McNeely, M., Shukla, D., Kimata, K., Spear, P.G., Shworak, N.W., Nakato, H., 2004. Regulation of Notch signaling by Drosophila heparan sulfate 3-O sulfotransferase. J. Cell Biol. 166, 1069–1079.
Koide, T., Odani, S., Takahashi, K., Ono, T., Sakuragawa, N., 1984. Antithrombin III Toyama: replacement of arginine-47 by cysteine in hereditary abnormal antithrombin III that lacks heparin-binding ability. Proc. Natl. Acad. Sci. U. S. A. 81, 289–293.
Kojima, T., Leone, C.W., Marchildon, G.A., Marcum, J.A., Rosenberg, R.D., 1992. Isolation and characterization of heparan sulfate proteoglycans produced by cloned rat microvascular endothelial cells. J. Biol. Chem. 267, 4859–4869.
45
Kowalewski, B., Lamanna, W.C., Lawrence, R., Damme, M., Stroobants, S., Padva, M., Kalus, I., Frese, M.A., Lubke, T., Lullmann-Rauch, R., D'Hooge, R., Esko, J.D., Dierks, T., 2012. Arylsulfatase G inactivation causes loss of heparan sulfate 3-O- sulfatase activity and mucopolysaccharidosis in mice. Proc. Natl. Acad. Sci. U. S. A. 109, 10310–10315.
Krenn, E.C., Wille, I., Gesslbauer, B., Poteser, M., van Kuppevelt, T.H., Kungl, A.J., 2008. Glycanogenomics: a qPCR-approach to investigate biological glycan function. Biochem. Biophys. Res. Commun. 375, 297–302.
Kreuger, J., Spillmann, D., Li, J.P., Lindahl, U., 2006. Interactions between heparan sulfate and proteins: the concept of specificity. J. Cell Biol. 174, 323–327.
Kuberan, B., Lech, M.Z., Beeler, D.L., Wu, Z.L., Rosenberg, R.D., 2003. Enzymatic synthesis of antithrombin III-binding heparan sulfate pentasaccharide. Nat Biotechnol. 21, 1343–1346.
Kuberan, B., Lech, M., Borjigin, J., Rosenberg, R.D., 2004. Light-induced 3-O- sulfotransferase expression alters pineal heparan sulfate fine structure. A surprising link to circadian rhythm. J. Biol. Chem. 279, 5053–5054.
Kusche, M., Bäckström, G., Riesenfeld, J., Petitou, M., Chaoy, J., Lindahl, U., 1988. Biosynthesis of heparin. O-Sulfation of the antithrombin-binding region. J. Biol. Chem. 263, 15474–15484.
Lam, L.H., Silbert, J.E., Rosenberg, R.D., 1976. The separation of active and inactive forms of heparin. Biochem. Biophys. Res. Commun. 69, 570–577.
Lane, D.A., Kunz, G., Olds, R.J., Thein, S.L., 1996. Molecular genetics of antithrombin deficiency. Blood Rev. 10, 59–74.
Langeslay, D.J., Young, R.P., Beni, S., Beecher, C.N., Mueller, L.J., Larive, C.K., 2012. Sulfamate proton solvent exchange in heparin oligosaccharides: evidence for a persistent hydrogen bond in the antithrombin-binding pentasaccharide Arixtra. Glycobiology 22, 1173–1182.
Lawrence, R., Yabe, T., Hajmohammadi, S., Rhodes, J., McNeely, M., Liu, J., Lamperti, E.D., Toselli, P.A., Lech, M., Spear, P.G., Rosenberg, R.D., Shworak, N.W., 2007. The principal neuronal gD-type 3-O-sulfotransferases and their products in central and peripheral nervous system tissues. Matrix Biol. 26, 442–455.
Lawrence, R., Lu, H., Rosenberg, R.D., Esko, J.D., Zhang, L., 2008. Disaccharide structure code for the easy representation of constituent oligosaccharides from glycosaminoglycans. Nat. Methods 5, 291–292.
46
Leder, I.G., 1980. A novel 3-O sulfatase from human urine acting on methyl-2-deoxy- 2-sulfamino-alphs-D-glucopyranoside 3-sulfate. Biochem. Biophys. Res. Commun. 94, 1183–1189.
Li, W., Johnson, D.J., Esmon, C.T., Huntington, J.A., 2004. Structure of the antithrombin–thrombin–heparin ternary complex reveals the antithrombotic mechanism of heparin. Nat. Struct. Mol. Biol. 11, 857–862.
Linhardt, R.J., Fitzgerald, G.L., Cooney, C.L., Langer, R., 1982. Mode of action of heparin lyase on heparin. Biochimica et biophysica acta. 702, 197–203.
Lindahl, U., Li, J.P., 2009. Interactions between heparan sulfate and proteins—design and functional implications. Int. Rev. Cell Mol. Biol. 276, 105–159.
Lindahl, U., Backstrom, G., Höök, M., Thunberg, L., Fransson, L.A., Linker, A., 1979. Structure of the antithrombin-binding site in heparin. Proc. Natl. Acad. Sci. U. S. A. 76, 3198–3202.
Lindahl, U., Backstrom, G., Thunberg, L., Leder, I.G., 1980. Evidence for a 3-O- sulfated D-glucosamine residue in the antithrombin-binding sequence of heparin. Proc. Natl. Acad. Sci. U. S. A. 77, 6551–6555.
Lindahl, U., Backstrom, G., Thunberg, L., 1983. The antithrombin-binding sequence in heparin. Identification of an essential 6-O-sulfate group. J. Biol. Chem. 258, 9826– 9830.
Liu, J., Pedersen, L.C., 2007. Anticoagulant heparan sulfate: structural specificity and biosynthesis. Appl. Microbiol. Biotechnol. 74, 263–272.
Liu, J., Shworak, N.W., Fritze, L.M.S., Edelberg, J.M., Rosenberg, R.D., 1996. Purification of heparan sulfate D-glucosaminyl 3-O-sulfotransferase. J. Biol. Chem. 271, 27072–27082.
Liu, J., Shworak, N.W., Sinay, P., Schwartz, J.J., Zhang, L., Fritze, L.M., Rosenberg, R.D., 1999a. Expression of heparan sulfate D-glucosaminyl 3-O-sulfotransferase isoforms reveals novel substrate specificities. J. Biol. Chem. 274, 5185–5192.
Liu, J.A., Shriver, Z., Blaiklock, P., Yoshida, K., Sasisekharan, R., Rosenberg, R.D., 1999b. Heparan sulfate D-glucosaminyl 3-O-sulfotransferase-3A sulfates N- unsubstituted glucosamine residues. J. Biol. Chem. 274, 38155–38162.
Liu, J., Shriver, Z., Pope, R.M., Thorp, S.C., Duncan, M.B., Copeland, R.J., Raska, C.S., Yoshida, K., Eisenberg, R.J., Cohen, G., Linhardt, R.J., Sasisekharan, R., 2002. Characterization of a heparan sulfate octasaccharide that binds to herpes simplex virus type 1 glycoprotein D. J. Biol. Chem. 277, 33456–33467. 47
Liu, R., Xu, Y., Chen, M., Weiwer, M., Zhou, X., Bridges, A.S., DeAngelis, P.L., Zhang, Q., Linhardt, R.J., Liu, J., 2010. Chemoenzymatic design of heparan sulfate oligosaccharides. J Biol Chem. 285, 34240–34249.
Luo, Y., Ye, S., Kan, M., McKeehan, W.L., 2006. Structural specificity in a FGF7- affinity purified heparin octasaccharide required for formation of a complex with FGF7 and FGFR2IIIb. J. Cell. Biochem. 97, 1241–1258.
Mahapatra, S., Klee, E.W., Young, C.Y., Sun, Z., Jimenez, R.E., Klee, G.G., Tindall, D.J., Donkena, K.V., 2012. Global methylation profiling for risk prediction of prostate cancer. Clin. Cancer Res. 18, 2882–2895.
Marcum, J.A., Rosenberg, R.D., 1985. Heparin-like molecules with anticoagulant activity are synthesized by cultured endothelial cells. Biochem. Biophys. Res. Commun. 126, 365–372.
Marcum, J.A., Fritze, L., Galli, S.J., Karp, G., Rosenberg, R.D., 1983. Microvascular heparin-like species with anticoagulant activity. Am. J. Physiol. 245, H725–H733.
Marcum, J.A., Atha, D.H., Fritze, L.M., Nawroth, P., Stern, D., Rosenberg, R.D., 1986a. Cloned bovine aortic endothelial cells synthesize anticoagulantly active heparan sulfate proteoglycan. J. Biol. Chem. 261, 7507–7517.
Marcum, J.A., Conway, E.M., Youssoufian, H., Rosenberg, R.D., 1986b. Anticoagulantly active heparin-like molecules from cultured fibroblasts. Exp. Cell Res. 166, 253–258.
Martin-Subero, J.I., Ammerpohl, O., Bibikova, M., Wickham-Garcia, E., Agirre, X., Alvarez, S., Bruggemann, M., Bug, S., Calasanz, M.J., Deckert, M., Dreyling, M., Du, M.Q., Durig, J., Dyer, M.J., Fan, J.B., Gesk, S., Hansmann, M.L., Harder, L., Hartmann, S., Klapper, W., Kuppers, R., Montesinos-Rongen, M., Nagel, I., Pott, C., Richter, J., Roman-Gomez, J., Seifert, M., Stein, H., Suela, J., Trumper, L., Vater, I., Prosper, F., Haferlach, C., Cruz Cigudosa, J., Siebert, R., 2009. A comprehensive microarray-based DNA methylation study of 367 hematological neoplasms. PLoS One 4, e6986.
McKeehan, W.L., Wu, X.C., Kan, M., 1999. Requirement for anticoagulant heparan sulfate in the fibroblast growth factor receptor complex. J. Biol. Chem. 274, 21511– 21514.
Medeiros, G.F., Mendes, A., Castro, R.A.B., Baú, E.C., Nader, H.B., Dietrich, C.P., 2000. Distribution of sulfated glycosaminoglycans in the animal kingdom: widespread occurrence of heparin-like compounds in invertebrates. Biochim. Biophys. Acta Gen. Subj. 1475, 287–294.
48
Meissen, J.K., Sweeney, M.D., Girardi, M., Lawrence, R., Esko, J.D., Leary, J.A., 2009. Differentiation of 3-O-sulfated heparin disaccharide isomers: identification of structural aspects of the heparin CCL2 binding motif. J. Am. Soc. Mass Spectrom. 20, 652–657.
Mertens, G., Cassiman, J.J., Van den Berghe, H., Vermylen, J., David, G., 1992. Cell surface heparan sulfate proteoglycans from human vascular endothelial cells. Core protein characterization and antithrombin III binding properties. J. Biol. Chem. 267, 20435–20443.
Meyer, B., Thunberg, L., Lindahl, U., Larm, O., Leder, I.G., 1981. The antithrombin- binding sequence of heparin studied by n.m.r. spectroscopy. Carbohydr. Res. 88, C1– C4.
Midorikawa, Y., Ishikawa, S., Iwanari, H., Imamura, T., Sakamoto, H., Miyazono, K., Kodama, T., Makuuchi, M., Aburatani, H., 2003. Glypican-3, overexpressed in hepato-cellular carcinoma, modulates FGF2 and BMP-7 signaling. Int. J. Cancer 103, 455–465.
Miyamoto, K., Asada, K., Fukutomi, T., Okochi, E., Yagi, Y., Hasegawa, T., Asahara, T., Sugimura, T., Ushijima, T., 2003. Methylation-associated silencing of heparan sulfate D-glucosaminyl 3-O-sulfotransferase-2 (3-OST-2) in human breast, colon, lung and pancreatic cancers. Oncogene 22, 274–280.
Mochizuki, H., Yoshida, K., Gotoh, M., Sugioka, S., Kikuchi, N., Kwon, Y.D., Tawada, A., Maeyama, K., Inaba, N., Hiruma, T., Kimata, K., Narimatsu, H., 2003. Characterization of a heparan sulfate 3-O-sulfotransferase-5, an enzyme synthesizing a tetrasulfated disaccharide. J. Biol. Chem. 278, 26780–26787.
Mochizuki, H., Yoshida, K., Shibata, Y., Kimata, K., 2008. Tetrasulfated disaccharide unit in heparan sulfate: enzymatic formation and tissue distribution. J. Biol. Chem. 283, 31237–31245.
Moon, A.F., Edavettal, S.C., Krahn, J.M., Munoz, E.M., Negishi, M., Linhardt, R.J., Liu, J., Pedersen, L.C., 2004. Structural analysis of the sulfotransferase (3-O- sulfotransferase isoform 3) involved in the biosynthesis of an entry receptor for herpes simplex virus 1. J. Biol. Chem. 279, 45185–45193.
Moon, A.F., Xu, Y., Woody, S.M., Krahn, J.M., Linhardt, R.J., Liu, J., Pedersen, L.C., 2012. Dissecting the substrate recognition of 3-O-sulfotransferase for the biosynthesis of anti-coagulant heparin. Proc. Natl. Acad. Sci. U. S. A. 109, 5265–5270.
Neugebauer, J.M., Cadwallader, A.B., Amack, J.D., Bisgrove, B.W., Yost, H.J., 2013. Differential roles for 3-OSTs in the regulation of cilia length and motility. Development 140, 3892–3902. 49
Nguyen, T.K., Arungundram, S., Tran, V.M., Raman, K., Al-Mafraji, K., Venot, A., Boons, G.J., Kuberan, B., 2012. A synthetic heparan sulfate oligosaccharide library reveals the novel enzymatic action of D-glucosaminyl 3-O-sulfotransferase-3a. Mol. Biosyst. 8, 609–614.
Nordenman, B., Danielsson, A., Bjork, I., 1978. The binding of low-affinity and high- affinity heparin to antithrombin. Fluorescence studies. Eur. J. Biochem. 90, 1–6.
O'Donnell, C.D., Tiwari, V., Oh, M.J., Shukla, D., 2006. A role for heparan sulfate 3- O-sulfotransferase isoform 2 in herpes simplex virus type 1 entry and spread. Virology 346, 452–459.
O'Reilly, M.S., Pirie-Shepherd, S., Lane, W.S., Folkman, J., 1999. Antiangiogenic activity of the cleaved conformation of the serpin antithrombin. Science 285, 1926– 1928.
Ori, A., Wilkinson, M.C., Fernig, D.G., 2008. The heparanome and regulation of cell function: structures, functions and challenges. Front. Biosci. 13, 4309–4338.
Ototani, N., Kikuchi, M., Yosizawa, Z., 1982. Structure and biological activity of finback-whale (Balaenoptera physalus L.) heparin octasaccharide. Chemical, carbon- 13 nuclear-magnetic-resonance, enzymic and biological studies. Biochem J. 205, 23– 30.
Pejler, G., Danielsson, I., Björk, U., Lindahl, H.B. Nader, Dietrich, C.P., 1987a. Structure and antithrombin-binding properties of heparin isolated from the clams Anomalocardia brasiliana and Tivela mactroides. J. Biol. Chem. 262, 11413–11421.
Pejler, G., Bäckström, G., Lindahl, U., Paulsson, M., Dziadek, M., Fujiwara, S., Timpl, R., 1987b. Structure and affinity for antithrombin of heparan sulfate chains derived from basement membrane proteoglycans. J. Biol. Chem. 262, 5036–5043.
Pempe, E.H., Xu, Y., Gopalakrishnan, S., Liu, J., Harris, E.N., 2012. Probing structural selectivity of synthetic heparin binding to stabilin protein receptors. J. Biol. Chem. 287, 20774–20783.
Princivalle, M., Hasan, S., Hosseini, G., de Agostini, A.I., 2001. Anticoagulant heparan sulfate proteoglycans expression in the rat ovary peaks in preovulatory granulosa cells. Glycobiology 11, 183–194.
Razi, N., Lindahl, U., 1995. Biosynthesis of heparin/heparan sulfate. The D- glucosaminyl 3-O-sulfotransferase reaction: target and inhibitor saccharides. J. Biol. Chem. 270, 11267–11275.
50
Richard, B., Swanson, R., Olson, S.T., 2009. The signature 3-O-sulfo group of the anticoagulant heparin sequence is critical for heparin binding to antithrombin but is not required for allosteric activation. J. Biol. Chem. 284, 27054–27064.
Riesenfeld, J., Thunberg, L., Höök, M., Lindahl, U., 1981. The antithrombin-binding sequence of heparin. Location of essential N-sulfate groups. J. Biol. Chem. 256, 2389–2394.
Rosenberg, R.D., Damus, P.S., 1973. The purification and mechanism of action of human antithrombin-heparin cofactor. J. Biol. Chem. 248, 6490–6505.
Samson, S.C., Ferrer, T., Jou, C.J., Sachse, F.B., Shankaran, S.S., Shaw, R.M., Chi, N.C., Tristani-Firouzi, M., Yost, H.J., 2013b. 3-OST-7 Regulates BMP-Dependent Cardiac Contraction. PLoS biology. 11, e1001727.
Schedin-Weiss, S., Richard, B., Hjelm, R., Olson, S.T., 2008. Antiangiogenic forms of antithrombin specifically bind to the anticoagulant heparin sequence. Biochemistry 47, 13610–13619.
Scully, M.F., Ellis, V., Kakkar, V.V., 1988. Heparan sulphate with no affinity for antithrombin III and the control of haemostasis. FEBS Lett. 241, 11–14.
Shivapurkar, N., Sherman, M.E., Stastny, V., Echebiri, C., Rader, J.S., Nayar, R., Bonfiglio, T.A., Gazdar, A.F., Wang, S.S., 2007. Evaluation of candidate methylation markers to detect cervical neoplasia. Gynecol. Oncol. 107, 549–553.
Shively, J.E., Conrad, H.E., 1976. Formation of anhydrosugars in the chemical depolymerization of heparin. Biochemistry 15, 3932–3942.
Shriver, Z., Sundaram, M., Venkataraman, G., Fareed, A., Linhardt, R., Biemann, K., Sasisekharan, R., 2000. Cleavage of the antithrombin III binding site in heparin by heparinases and its implication in the generation of low molecular weight heparin. Proc. Natl. Acad. Sci. U. S. A. 97, 10365–10370.
Shukla, D., Liu, J., Blaiklock, P., Shworak, N.W., Bai, X.M., Esko, J.D., Cohen, G.H., Eisenberg, R.J., Rosenberg, R.D., Spear, P.G., 1999. A novel role for 3-O-sulfated heparan sulfate in herpes simplex virus 1 entry. Cell 99, 13–22.
Shworak, N.W., Liu, J., Fritze, L.M.S., Schwartz, J.J., Zhang, L.J., Logeart, D., Rosenberg, R.D., 1997. Molecular cloning and expression of mouse and human cDNAs encoding heparan sulfate D-glucosaminyl 3-O-sulfotransferase. J. Biol. Chem. 272, 28008–28019.
Shworak, N.W., Liu, J.A., Petros, L.M., Zhang, L.J., Kobayashi, M., Copeland, N.G., Jenkins, N.A., Rosenberg, R.D., 1999. Multiple isoforms of heparan sulfate D- 51 glucosaminyl 3-O-sulfotransferase—isolation, characterization, and expression of human cDNAs and identification of distinct genomic loci. J. Biol. Chem. 274, 5170– 5184.
Shworak, N.W., Kobayashi, T., de Agostini, A., Smits, N.C., 2010. Anticoagulant heparan sulfate to not clot—or not? Prog. Mol. Biol. Transl. Sci. 93, 153–178.
Streusand, V.J., Bjork, I., Gettins, P.G., Petitou, M., Olson, S.T., 1995. Mechanism of acceleration of antithrombin-proteinase reactions by low affinity heparin. Role of the antithrombin binding pentasaccharide in heparin rate enhancement. J. Biol. Chem. 270, 9043–9051.
Takeda, K., Hashimoto, K., Uchikawa, R., Tegoshi, T., Yamada, M., Arizono, N., 2010. Direct effects of IL-4/IL-13 and the nematode Nippostrongylus brasiliensis on intestinal epithelial cells in vitro. Parasite Immunol. 32, 420–429.
Tecle, E., Diaz-Balzac, C.A., Bulow, H.E., 2013. Distinct 3-O-sulfated heparan sulfate modification patterns are required for kal-1-dependent neurite branching in a context- dependent manner in Caenorhabditis elegans. G3 (Bethesda) 3, 541–552.
Ten Dam, G.B., Kurup, S., van de Westerlo, E.M., Versteeg, E.M., Lindahl, U., Spillmann, D., van Kuppevelt, T.H., 2006. 3-O-Sulfated oligosaccharide structures are recognized by anti-heparan sulfate antibody HS4C3. J. Biol. Chem. 281, 4654–4662.
Thunberg, L., Bäckström, G., Lindahl, U., 1982. Further characterization of the antithrombin-binding sequence in heparin. Carbohydr. Res. 100, 393–410.
Tiwari, V., O'Donnell, C.D., Oh, M.J., Valyi-Nagy, T., Shukla, D., 2005. A role for 3- O-sulfotransferase isoform-4 in assisting HSV-1 entry and spread. Biochem. Biophys. Res. Commun. 338, 930–937.
Tiwari, V., Clement, C., Xu, D., Valyi-Nagy, T., Yue, B.Y., Liu, J., Shukla, D., 2006. Role for 3-O-sulfated heparan sulfate as the receptor for herpes simplex virus type 1 entry into primary human corneal fibroblasts. J. Virol. 80, 8970–8980.
Tsuda, H., Yamada, S.H., Yamane, Y., Yoshida, K., Hopwood, J.J., Sugahara, K., 1996. Structures of five sulfated hexasaccharides prepared from porcine intestinal heparin using bacterial heparinase - Structural variants with apparent biosynthetic precursor-product relationships for the antithrombin III-binding site. J Biol Chem. 271, 10495–10502.
Vanpouille, C., Deligny, A., Delehedde, M., Denys, A., Melchior, A., Lienard, X., Lyon, M., Mazurier, J., Fernig, D.G., Allain, F., 2007. The heparin/heparan sulfate sequence that interacts with cyclophilin B contains a 3-O-sulfated N-unsubstituted glucosamine residue. J. Biol. Chem. 282, 24416–24429. 52
Viskov, C., Elli, S., Urso, E., Gaudesi, D., Mourier, P., Herman, F., Boudier, C., Casu, B., Torri, G., Guerrini, M., 2013. Heparin dodecasaccharide containing two antithrombin-binding pentasaccharides: structural features and biological properties. J Biol Chem. 288, 25895–25907.
Wiedermann Ch, J., Romisch, J., 2002. The anti-inflammatory actions of antithrombin—a review. Acta Med. Austriaca 29, 89–92.
Wood, M.W., Breitschwerdt, E.B., Gookin, J.L., 2011. Autocrine effects of interleukin-6 mediate acute-phase proinflammatory and tissue-reparative transcriptional responses of canine bladder mucosa. Infect. Immun. 79, 708–715.
Wu, Z.L., Lech, M., Beeler, D.L., Rosenberg, R.D., 2004. Determining heparan sulfate structure in the vicinity of specific sulfotransferase recognition sites by mass spectrometry. J. Biol. Chem. 279, 1861–1866.
Xia, G.Q., Chen, J.H., Tiwari, V., Ju, W.J., Li, J.P., Malmström, A., Shukla, D., Liu, J., 2002. Heparan sulfate 3-O-sulfotransferase isoform 5 generates both an antithrombin- binding site and an entry receptor for herpes simplex virus, type 1. J. Biol. Chem. 277, 37912–37919.
Xu, D., Esko, J.D., 2014. Demystifying heparan sulfate-binding proteins. Annu. Rev. Biochem. 83 (in press).
Xu, D., Tiwari, V., Xia, G., Clement, C., Shukla, D., Liu, J., 2005. Characterization of heparan sulphate 3-O-sulphotransferase isoform 6 and its role in assisting the entry of herpes simplex virus type 1. Biochem. J. 385, 451–459.
Xu, D., Moon, A.F., Song, D., Pedersen, L.C., Liu, J., 2008. Engineering sulfotransferases to modify heparan sulfate. Nat. Chem. Biol. 4, 200–202.
Xu, Y., Masuko, S., Takieddin, M., Xu, H., Liu, R., Jing, J., Mousa, S.A., Linhardt, R.J., Liu, J., 2011. Chemoenzymatic synthesis of homogeneous ultralow molecular weight heparins. Science 334, 498–501.
Xu, Y., Pempe, E.H., Liu, J., 2012. Chemoenzymatic synthesis of heparin oligosaccharides with both anti-factor Xa and anti-factor IIa activities. J. Biol. Chem. 287, 29054–29061.
Yabe, T., Hata, T., He, J., Maeda, N., 2005. Developmental and regional expression of heparan sulfate sulfotransferase genes in the mouse brain. Glycobiology 15, 982–993.
Yamada, S., Yoshida, K., Sugiura, M., Sugahara, K., Khoo, K.H., Morris, H.R., Dell, A., 1993. Structural studies on the bacterial lyase-resistant tetrasaccharides derived 53 from the antithrombin III-binding of porcine intestinal heparin. J. Biol. Chem. 268, 4780–4787.
Ye, S., Luo, Y.D., Lu, W.Q., Jones, R.B., Linhardt, R.J., Capila, I., Toida, T., Kan, M., Pelletier, H., McKeehan, W.L., 2001. Structural basis for interaction of FGF-1, FGF-2, and FGF-7 with different heparan sulfate motifs. Biochemistry 40, 14429–14439.
Yoon, M., Zago, A., Shukla, D., Spear, P.G., 2003. Mutations in the N termini of herpes simplex virus type 1 and 2 gDs alter functional interactions with the entry/fusion receptors HVEM, Nectin-2, and 3-O-sulfated heparan sulfate but not with Nectin-1. J. Virol. 77, 9221–9231.
Zhang, L.J., Schwartz, J.J., Miller, J., Liu, J., Fritze, L.M.S., Shworak, N.W., Rosenberg, R.D., 1998. The retinoic acid and cAMP-dependent up-regulation of 3-O- sulfotransferase-1 leads to a dramatic augmentation of anticoagulantly active heparan sulfate biosynthesis in F9 embryonal carcinoma cells. J. Biol. Chem. 273, 27998– 28003.
Zhang, L.J., Yoshida, K., Liu, J., Rosenberg, R.D., 1999. Anticoagulant heparan sulfate precursor structures in F9 embryonal carcinoma cells. J. Biol. Chem. 274, 5681–5691.
Zhang, L.J., Beeler, D.L., Lawrence, R., Lech, M., Liu, J., Davis, J.C., Shriver, Z., Sasisekharan, R., Rosenberg, R.D., 2001a. 6-O-Sulfotransferase-1 represents a critical enzyme in the anticoagulant heparan sulfate biosynthetic pathway. J. Biol. Chem. 276, 42311–42321.
Zhang, L.J., Lawrence, R., Schwartz, J.J., Bai, X.M., Wei, G., Esko, J.D., Rosenberg, R.D., 2001b. The effect of precursor structures on the action of glucosaminyl 3-O- sulfotransferase-1 and the biosynthesis of anticoagulant heparan sulfate. J. Biol. Chem. 276, 28806–28813.
Zhang, W., Swanson, R., Izaguirre, G., Xiong, Y., Lau, L.F., Olson, S.T., 2005. The heparin-binding site of antithrombin is crucial for antiangiogenic activity. Blood 106, 1621–1628.
Zhang, Z., Liu, X., Chen, J., Su, H., Luo, Q., Ye, J., Tang, N., Zhang, W., Chen, W., Ko, B.C., Huang, A., 2010. Heparin sulphate D-glucosaminyl 3-O-sulfotransferase 3B1 plays a role in HBV replication. Virology 406, 280–285.
Zhao, W., Garron, M.L., Yang, B., Xiao, Z., Esko, J.D., Cygler, M., Linhardt, R.J., 2011. Asparagine 405 of heparin lyase II prevents the cleavage of glycosidic linkages proximate to a 3-O-sulfoglucosamine residue. FEBS Lett. 585, 2461–2466.
Chapter 2
Discovery of Novel Ligands that Depend on 3-O-sulfation
2.1 Summary
Heparan sulfate structural heterogeneity arises from the placement of sulfate groups at various positions in the polysaccharide. Whereas many ligands bind to heparan sulfate without strict requirements for specific sulfate groups, binding of a small number of known ligands is influenced by the presence of a sulfate at the C3 position of a glucosamine residue. In mammals, seven enzymes can catalyze the addition of 3-O-sulfate groups, suggesting the possibility of other, previously unidentified, ligands whose binding is influenced by 3-O-sulfated sequences. To identify these ligands, affinity matrices were created using CHO-S heparan sulfate, with and without modification by recombinant 3-O-sulfotransferases. Serum was fractionated on the matrices and several proteins binding specifically to the 3-O- sulfated resins were identified by mass spectrometry. Neuropilin-1, a modulator of vasculogenesis, angiogenesis and axonal guidance, bound specifically to affinity matrices with 3-O-sulfation. These results lay out a method for identifying proteins influenced by 3-O-sulfation and indicate a number of 3-O-sulfate dependent candidate proteins, including neuropilin-1.
2.2 Introduction
Heparan sulfate is a polysulfated glycosaminoglycan found covalently attached to proteins at the cell membrane and in the extracellular matrix. Heparan sulfate binds
54 55 to numerous extracellular proteins thereby influencing their interactions with the cell.
In this way, it plays a role in diverse physiological functions including cell proliferation, cell differentiation, developmental patterning, hemostasis, immunity and inflammation (Bishop et al., 2007; Linhardt et al., 1982; Ori et al., 2008). Heparan sulfate is a heterogeneous polysaccharide. Its synthesis is non-template driven and the various epimerases and sulfotransferases act in a substoichiometric manner (Esko and
Selleck, 2002). Heparan sulfate can be variably sulfated at multiple positions including the C2 position of uronic acids and the C2 amine, C3 and C6 positions of glucosamine.
A family of seven heparan sulfate 3-O-sulfotransferases (Hs3sts) mediates the installation of 3-O-sulfates. These enzymes are expressed in a temporally and spatially regulated manner, suggesting that they play distinct roles in organismal physiology
(Cadwallader and Yost, 2006; Kuberan et al., 2004; Mochizuki et al., 2008). Members of this family also have different substrate specificities, meaning that they place 3-O- sulfates in different contexts in the polysaccharide. Hs3st-1 and -5 are able to create a pentasaccharide with high affinity for antithrombin (AT), although they clearly install
3-O-sulfate groups at other sites as well (Liu et al., 1996; Xia et al., 2002). For this reason, Hs3st-1 and -5 are known as AT-type Hs3sts. Hs3st-2, -3a, -3b, -4, -5 and -6 place 3-O-sulfate groups in a context that facilitates binding of the Herpes Simplex
Virus 1 glycoprotein D (gD) (O'Donnell C et al., 2006; Shukla et al., 1999; Tiwari et al., 2005; Xia et al., 2002; Xu et al., 2005). Therefore, these enzymes are categorized as gD-type sulfotransferases. It is possible that substrate specificities differ within members of each category, although these differences have not been elucidated. 56
Despite the large number of 3-O-sulfotransferases, sulfation at the 3-O position is relatively rare in mammals. Of the sources of heparan sulfate analyzed so far, 3-O- sulfation is found on less than 10 percent of glucosamine units and is sometimes entirely absent (de Agostini et al., 2008; Pejler et al., 1987). Endothelial cells generate heparan sulfate that contains only 1 percent 3-O-sulfated glucosamine units (Marcum et al., 1986). Therefore, it appears that in most preparations of heparan sulfate, 3-O- sulfation does not contribute to the bulk charge of heparan sulfate. Rather, its presence seems to create specific sulfated motifs that result in selective binding to proteins.
The binding of proteins to heparan sulfate is driven largely by electrostatic interactions between negatively charged sulfates and carboxylates of the glycan and basic residues of the protein (Linhardt et al., 1982). In many instances, the affinity of the ligand for heparan sulfate depends on the degree of sulfation without any particular dependence on the spatial placement of the sulfate groups. A small number of proteins, however, have been characterized that prefer a specific sequence containing
3-O-sulfate. In addition to AT and gD, fibroblast growth factor 7, fibroblast growth factor receptor 1, cyclophilin B and stabilin have been identified as being influenced by 3-O-sulfation. This small number of known ligands whose binding is enhanced by
3-O-sulfate is surprising given the large number of 3-O-sulfotransferases, their distinct substrate specificity and their unique expression patterns (Deligny et al., 2010;
McKeehan et al., 1999; Pempe et al., 2012). Furthermore, recent work has shown that
3-O-sulfation modulates various developmental and pathological processes, including stem cell differentiation, left-right patterning, cardiac development, neuronal targeting and tumor progression. The heparan sulfate binding proteins that participate in these 57 activities remain unknown (Bui et al., 2010; Hirano et al., 2012; Miyamoto et al.,
2003; Neugebauer et al., 2013; Samson et al., 2013; Tecle et al., 2013). For these reasons, I hypothesized that there are additional proteins whose binding to heparan sulfate and physiological functions are influenced by 3-O-sulfation. To identify these proteins, I constructed affinity matrices containing heparan sulfate with and without 3-
O-sulfation, fractionated serum and identified a number proteins that bound specifically to the 3-O-sulfated heparan sulfate. Among these proteins was neuropilin-
1 (NRP1), a known heparin-binding protein that mediates angiogenesis, vasculogenesis and axonal guidance (He and Tessier-Lavigne, 1997; Kawasaki et al.,
1999; Kolodkin et al., 1997). My results lay the groundwork for identifying proteins influenced by 3-O-sulfation and indicate that a number of such candidate proteins exist in serum.
2.3 Results
2.3.1 Creation of affinity matrices
To discover proteins that recognize 3-O-sulfated heparan sulfate, three types of affinity matrices were created containing Hs3st-1-modified heparan sulfate, Hs3st-2- modified heparan sulfate and heparan sulfate without 3-O-sulfation (Fig. 2-1A). A source of heparan sulfate devoid of 3-O-sulfation was needed as the starting material for these matrices. CHO-S cells produce heparan sulfate without 3-O-sulfation and can be cultured at high density to produce milligram quantities of heparan sulfate. Heparan sulfate was isolated from the medium conditioned by these cells and contaminants were removed by sequential digestions using DNase, RNase, chondroitinase ABC and 58
Figure 2-1. Construction and validation of 3-O-sulfated heparan sulfate affinity matrices. (A) Production scheme of Hs3st-1 (HS3.1) and Hs3st-2 (HS3.2) modified heparan sulfate from CHO-S conditioned medium. (B) Elution of CHO-S [S35]heparan sulfate from Sepharose CL-6B. The molecular weight (kDa) of polysaccharide standards is shown above the graph, as described previously (Wasteson, 1971). The chromatogram is representative of four independent heparan sulfate preparations. (C, D) Modification of CHO-S heparan sulfate by recombinant Hs3st-1 (C) and MBP- Hs3st-2 (D). Representative data shown from four independent experiments. (E) Extracted ion current from LC/MS analysis of heparin lyase digestion products from the three preparations of heparan sulfate. Individual disaccharides are designated using the disaccharide structural code. 3-O-sulfated species are labeled in red. (F) Extent of immobilization of CHO-S [S35]heparan sulfate on activated (solid bars) and inactivated (open bars) resins. Data is shown as the mean ± s.d. of three independent determinations. (G, H) Immobilization of heparin (G, n = 2) or heparan sulfate (H, n = 1) on CNBr-activated Sepharose. (I) Fractionation of AT, FGF2 and RAGE on affinity matrices. The flow through (FT), 0.5 M and 1 M NaCl fractions are shown by silver stain. A representative gel is shown.
Fig 1 59
A B
CHO-S E DNase/RNase Chondroitinase ABC Pronase HS CHO HS C
No enzyme, Hs3st-1 or MBP-Hs3st-2 HS3.1
CHO HS HS3.1 HS3.2
Immobilization on CNBr-activated D Sepharose HS3.2
HS HS3.1 HS3.2
F G H
I HS HS3.1 HS3.2 FT 0.5 1 FT 0.5 1 FT 0.5 1
AT
FGF2
RAGE
60
Pronase. 1 L of CHO-S conditioned medium yielded 1.0 – 1.5 mg of purified heparan sulfate. The heparan sulfate was radiolabeled using Hs3st-1 with [35S]PAPS and then applied to a Sepharose CL-6B column to determine chain length (Fig. 2-1B). The chain lengths observed were distributed around a single peak (Kav = 0.55) corresponding to ~15 kDa molecular weight or ~30 disaccharides average chain length
(Wasteson, 1971).
Purified CHO-S heparan sulfate was modified using recombinant sulfotransferases to introduce 3-O-sulfation in a controlled manner. The objective was to introduce 3-O-sulfated sites for protein binding without significantly changing the bulk charge of the polysaccharide. A significant change in the bulk charge might promote non-3-O-sulfate-specific binding of proteins. Hs3st-1 and MBP-Hs3st-2 were used with [35S]PAPS to measure the extent of modification by either enzyme to CHO-
S heparan sulfate. Modification with either Hs3st-1 (Fig. 2-1C) or -2 (Fig. 2-1D) demonstrated saturability at high concentrations. The maximum extent of modification was one 3-O-sulfate to every 18 or 19 disaccharides for Hs3st-1 and -2, respectively.
Therefore, an average of ~1.5 protein binding sites that contain 3-O-sulfate were created on each heparan sulfate chain. For the CHO-S heparan sulfate starting material, each disaccharide contains one negatively charged uronic acid and an average of 0.9 negatively charged sulfates (Lawrence et al., 2008b). Therefore, for a given chain of 30 disaccharides, Hs3st modification increased the total number of negative charges from 57.0 to 58.5, less than a 3 percent increase. The reaction conditions that yielded maximum sulfation were scaled to produce multi-milligram quantities of Hs3st-1 or Hs3st-2 modified heparan sulfate.
61
To demonstrate the addition of 3-O-sulfate structurally, heparin lyases were used to digest the heparan sulfate and the resultant products were analyzed by LC/MS.
Digestion with a combination of heparin lyases I, II and III reduces heparan sulfate to disaccharide components except for certain resistant 3-O-sulfate containing tetrasaccharides (Yamada et al., 1993). As expected, no 3-O-sulfated structures were detected in unmodified CHO-S heparan sulfate although strong signals were evident for several commonly occurring N-, 2-O- and 6-O-sulfate containing disaccharides1
(D0S0, D0A6, D2S0, D0S6, D2S6) (Fig. 2-1E). Hs3st-1 modification produced heparan sulfate containing an additional tetrasaccharide (D0A6-G0S3) characteristic of AT-type 3-O-sulfation. Hs3st-2 modification produced two gD-type disaccharides
(D2S3, D2S9) and two uncharacterized gD-type tetrasaccharides (Tetra-A and Tetra-
B). This analysis confirms the presence of appropriate 3-O-sulfated structures in the
Hs3st-1 and Hs3st-2 modified heparan sulfate preparations.
Various commercially available activated resins were tested for their ability to immobilize heparan sulfate. Initial screening of various resins demonstrated a high background binding of serum proteins to several inactivated resins including aminohexyl-Sepharose, Affi-gel Hz, UltraLink Biosupport and CarboLink Coupling
Gel. Additional trials with resins that react with primary amines (N-
1 To simplify the representation of constituent disaccharides, we use a disaccharide structure code (DSC, Lawrence et al., 2008a). In this code, a uronic acid is designated as U, G, I or D for an unspecified 4,5 hexuronic acid, D-glucuronic acid, L-iduronic acid or Δ -unsaturated uronic acid, respectively. The N- substituent on glucoasmine is either H, A or S for hydrogen, acetate or sulfate, respectively. The presence and location of ester-linked sulfate groups are depicted by the number of the carbon atom on which the sulfate group is located or by 0 if absent. For example, I2S6 refers to a disaccharide composed of 2-sulfoiduronic acid-N-sulfoglucosamine-6-sulfate, whereas D2S6 refers to a similarly 4,5 structured disaccharide that instead has a Δ -double bond in the uronic acid. The presence of 3-O- and 6-O-sulfate on the same hexosamine is indicated by the number 9.
62 hydroxysuccinimide (NHS)-activated agarose, Affi-gel 10 and cyanogen bromide
(CNBr)-activated Sepharose) led to lower background binding. Primary amines in the heparan sulfate potentially exist in proteoglycan peptide stubs and rare N- unsubstituted glucosamines. Using 1.3 mg/ml input of [35S]heparan sulfate, with
CNBr-activated Sepharose yielded 0.32 mg/ml of heparan sulfate immobilized per resin, a higher density than both NHS-activated agarose and Affigel 10 (Fig. 2-1F). β- elimination of the heparan sulfate, which removes the peptide stub, had little effect on the immobilization efficiency of CNBr-activated Sepharose, indicating that the heparan sulfate was immobilized to these resins primarily via N-unsubstituted glucosamines. For heparin (Fig. 2-1G) and heparan sulfate (Fig. 2-1H), the density of glycosaminoglycan immobilized on CNBr-activated Sepharose was dependent on the concentration of soluble glycosaminoglycan in the immobilization reaction. To create high-density resins, 13.3 mg/ml heparan sulfate was incubated with CNBr-activated
Sepharose, which generated affinity matrices with a density of 2.8 mg/ml of heparan sulfate (Fig. 2-1H). Only about 15 percent of total heparan sulfate could be immobilized using this chemistry, which probably reflects the low occurrence of N- unsubstituted glucosamines in the heparan sulfate preparation. Using this methodology, affinity matrices were generated containing unmodified, Hs3st-1 modified or Hs3st-2 modified CHO-S heparan sulfate.
The function of the affinity matrices was tested by challenging various proteins to bind to the resins. AT requires a specific 3-O-sulfated pentasaccharide structure for high affinity binding to heparan sulfate (Thunberg et al., 1982). Hs3st-1 but not Hs3st-
2 can efficiently produce this pentasaccharide (Liu et al., 1999). When AT was passed
63 over the affinity matrices, it failed to bind to the non-3-O-sulfated resin and the gD- type resin and was found entirely in the flow-through fractions (Fig. 2-1I). AT bound to the Hs3st-1 modified resin and was eluted at both 0.5 M and 1 M NaCl. The portion of AT found in the flow-through fraction suggests partial degradation of the protein or that the amount of protein loaded exceeded the binding capacity of the resin.
Fibroblast growth factor 2 (FGF2) and receptor for advanced glycation endproducts
(RAGE) have no known dependence on 3-O-sulfation for binding to heparan sulfate.
When RAGE was applied to the affinity matrices, all protein was bound by each of the resins and eluted completely at 0.5 M NaCl (Fig. 2-1I). When FGF2 was applied to the resins, all of the protein bound to the resins and was eluted at 1 M NaCl (Fig. 2-1I).
Therefore, these proteins bind to the affinity matrices with no apparent preference for
3-O-sulfation. gD has been described as a protein that depends on gD-type 3-O- sulfation for binding to heparan sulfate (Shukla et al., 1999). When gD was applied to the affinity matrices, it failed to bind to any of the resins, which probably reflects its low affinity for heparan sulfate, even with appropriate 3-O-sulfation (Shukla et al.,
1999).
2.3.2 Identification of 3-O-sulfate dependent proteins
Having produced functional affinity matrices with 3-O-sulfated heparan sulfate, I now turned my attention to identifying novel proteins whose binding to heparan sulfate was dependent on 3-O-sulfation. Serum is an abundant source of soluble proteins, many of which have been described as heparin binding proteins.
Equal amounts of human, bovine or mouse serums were passed over the three affinity
64 matrices in parallel to collect heparan sulfate binding proteins (Fig. 2-2A). The resins were then washed extensively with 200 mM NaCl and the bound proteins were eluted using 1 M NaCl. The eluates were concentrated and a portion of each was analyzed by
PAGE and silver stain (Fig. 2-2B-D). The remaining eluate was reserved for proteomic analysis. By silver stain, dozens of protein bands were evident in the eluates, most of which appeared to be equally abundant in eluates from each of the resins. One striking difference was the appearance of a band at ~65 kDa which was highly enriched in the eluates from the Hs3st-1 modified matrices. This band is the appropriate molecular weight for AT and appeared in the eluates from human, bovine and mouse serum. Using silver stain, no additional protein was detected eluting from the resins at greater than 1 M NaCl.
Proteomic analysis was performed on the eluates to determine the identity of any proteins that eluted specifically from the 3-O-sulfated matrices. The quantity of each protein in the eluates is a function of both the affinity of the protein for the affinity matrix and the abundance of the protein in serum. Therefore, proteins of high and low abundance in the eluates were considered as potential candidate 3-O-sulfate dependent proteins so long as they were enriched on the 3-O-sulfated matrices.
Proteomic quantification was performed using the number of times a peptide that was attributed to a certain protein was detected in the eluate. The number of peptides for each protein was compared across the eluates from the three affinity matrices. A summation of all peptides in an eluate along with the PAGE/silver stain analysis ensured that the total amount of protein eluted from each matrix was similar. The analysis was repeated multiple times using bovine (Supplemental Table 2-S1), mouse
65
Fig 2
A B Mouse Serum C Bovine Serum D Human Serum
Serum HS HS3.1 HS3.2 HS HS3.1 HS3.2 HS HS3.1 HS3.2
190 115 80 70 * * * 50 HS HS3.1 HS3.2
Silver Stain 30 1 M NaCl 25 PAGE Mass Spectrometry 15
10
NRP1 WB AT
E HS HS3.1 HS3.2 FT 0.5 1 FT 0.5 1 FT 0.5 1
NRP1
Figure 2-2. Fractionation of serum on affinity matrices. (A) Work flow for identification of 3-O-sulfate dependent ligands by affinity chromatography. (B, C, D) Elution profile of mouse (B), bovine (C) and human (D) serums from the affinity matrices. An asterisk shows the position of a band specific to the HS3.1 column and migrating at a position appropriate for AT. Eluates were immunoblotted for NRP1 and AT. Blots are shown below the matching silver stains, which serve as the loading control. Representative data is shown from multiple experiments. (E) Elution profile of recombinant human NRP1 from the affinity matrices. The flow through (FT) and eluates (0.5 or 1.0 M NaCl) are shown. Data shown is representative of three independent experiments.
66
(Supplemental Table 2-S2) and human (Supplemental Table 2-S3) serums to build confidence in candidate 3-O-sulfate dependent proteins.
In each sample, hundreds of peptides were detected corresponding to between
43 and 175 distinct proteins (Supplemental Tables 2-S1, S2, S3). The most abundant proteins found in the eluates across all species were albumin, alpha-2-macroglobulin,
AT, transferrin and complement component 3, each known heparin binding proteins except for albumin (Ori et al., 2011). As expected, AT was anywhere from 5- to 51- fold enriched in the eluates from Hs3st-1 modified resins compared to the control resin
(Table 2-1) and served as an internal control for that affinity matrix. AT was also slightly enriched on the Hs3st-2 modified resin. About half of all the proteins identified in human serum have been characterized as heparin binding proteins
(Supplemental Table 2-S3)(Ori et al., 2011). The remainder may be novel heparan sulfate binding proteins but non-specific binding or binding to the resin in complex with another protein cannot be excluded.
The vast majority of proteins were equally represented in the eluates from each of the affinity matrices, indicating no preferential binding to 3-O-sulfated heparan sulfate under the conditions tested. However, a few proteins were found enriched in the eluates of 3-O-sulfated resins. Candidate 3-O-sulfate dependent proteins were identified as proteins whose peptide count across multiple analyses was repeatedly 2.5 times higher on a 3-O-sulfated affinity matrix compared to the control resin. Since serum from three different species was analyzed, homologs of proteins across these species were considered together. To eliminate spurious results from the least abundant proteins, those proteins that were represented by only one peptide per
67
8 4 1 2 124 (2.4) (1.8) (2.9) (61.9) (16.0) HS3.1 Human 1 7 1 HS (5.1) (16.6) 1 2 6 1 3 3 3 2 3 11 28 18 (1.4) (5.1) (1.2) (5.4) (2.9) (5.3) (40.0) (18.8) (10.2) (21.9) (20.5) (28.3) HS3.2 1 3 1 6 1 1 80 14 (1.4) (9.4) (4.0) (4.5) (1.6) (55.5) (12.7) (38.2) HS3.1 The compiled results are shown compiled The are results
Mouse 2 4 HS (8.6) 3 3 3 6 231 (8.5) (5.3) (11.1) (78.9) (20.5) HS3.1 Mouse 1 9 4 1 HS (4.5) (23.9) (12.1) 3 8 5 1 5 4 6 7 17 13 (4.5) (8.2) (0.6) (8.5) (29.9) (29.8) (13.3) (25.8) (10.9) (26.0) HS3.2 1 6 2 1 2 1 7 2 3 37 (1.7) (6.2) (0.5) (3.4) (4.2) (3.6) (49.7) (23.6) (17.7) (19.3) HS3.1 Bovine 2 Bovine 7 HS (16.1) The accession number for each protein in mouse is displayed proteinthe eachnumberaccessionname. is withproteinmouseThe displayed in for
1 8 1 51 (3.6) (1.8) (70.5) (12.6) HS3.1 sulfate dependent candidate proteins in sulfate proteins affinity dependent candidate eluates. matrix - O Bovine 1 Bovine - 1 3 HS 3 (1.9) (4.2)
ero peptides identified.peptides ero analyses using bovine, mouse and human serum. The number of Thegreater to serum.attributed peptidesanalyses with using and of mouse protein bovine, each number human Peptide counts Peptide of Decorin Biglycan (P41317) (P13609) (Q543J5) (O88783) Clusterin Serglycin (Q549A5) (Q549X6) (Q6PAR3) (Q6GR78) (Q8BH61) (Q8K0D2) (Q3TNY9) (Q3UKR1) (Q9DBD0) 1. Neuropilin 1 Neuropilin Antithrombin - Amyloid beta A4 Amyloid beta Coagulation factor V Coagulation factor Synaptotagmin-like 4 Coagulation factor XIII Coagulation factor Mannose-binding protein C Mannose-binding protein Hyaluronan-binding protein 2 protein Hyaluronan-binding Putative uncharacterized protein uncharacterized Putative Protein Name Protein Table Table 2 from multiple Empty boxesresulting displayedparentheses.eluates. Thecoverage is proteinin than percentage shown confidence 95% is for samples z reflectwith
68 analysis were excluded. In this manner, twelve novel 3-O-sulfate dependent candidate proteins were identified (Table 2-1). One of these proteins, NRP1, was chosen for further analysis for reasons described below. Notably, NRP2 was also detected specifically in eluates from 3-O-sulfated affinity matrices using bovine serum but was not considered a candidate protein because it was observed in only one analysis.
Recovery of extracellular proteins from tissue samples for fractionation on the affinity matrices was attempted using gentle Dounce homogenization or protease digestion. After proteomic analysis, the majority of proteins identified were nuclear proteins (e.g. histones, ribosomal proteins, nucleotide binding proteins) apparently released by rupture of cell membranes during processing. In spite of these complications, NRP1 and hyaluronan binding protein 2 (HABP2) were detected specifically in the eluates from 3-O-sulfated affinity matrices using protein extracted from mouse brain. These results reproduce the fractionation of NRP1 and HABP2 from serum. The development of superior techniques to extract extracellular protein from tissue without disrupting cell membranes will facilitate the discovery of additional 3-O-sulfate dependent proteins using these affinity matrices.
2.3.3 Validation of neuropilin-1 as a 3-O-sulfate dependent ligand
To validate the proteomic results, I proceeded to confirm that one of the candidate proteins binds specifically to the 3-O-sulfated affinity matrices. NRP1 was a high confidence ligand because it was detected exclusively in the eluates of 3-O- sulfated resins in multiple experiments using all types of serum that were analyzed.
Furthermore, the heparin binding domains of NRP1 can be readily produced as
69 recombinant protein, which facilitated biochemical analysis (Vander Kooi et al.,
2007). Also, NRP1 plays roles in angiogenesis, vasculogenesis and axonal guidance with well-developed experimental systems, which enabled downstream biological assays (Pan et al., 2007). Western blot of the affinity matrix eluates verified that NRP1 bound specifically to the 3-O-sulfated resins for both mouse and bovine serum (Fig. 2-
2B, C). By Western blot, AT was also highly enriched in the mouse serum eluates from the Hs3st-1-modified resin (Fig. 2-2B). Application of recombinant human
NRP1 to the affinity matrices also confirmed its specificity. On the non-3-O-sulfated resin, most of the protein was found in the flow through fraction (Fig. 2-2E). On the
Hs3st-1 and Hs3st-2 modified resins, most of the protein eluted at 500 mM NaCl while a minor fraction eluted at 1 M NaCl. Thus, recombinant NRP1 reproduced the fractionation results obtained using serum.
2.4 Discussion
Mammals express seven heparan sulfate 3-O-sulfotransferases with distinct expression patterns and substrate specificities. The activity of these sulfotransferases affects a variety of physiological processes. The heparan sulfate binding proteins that respond to 3-O-sulfation and drive these physiological processes are largely unknown.
For these reasons, I hypothesized that there are unidentified heparan sulfate binding proteins that depend on 3-O-sulfation for binding and performing their functions. This chapter outlines the methods used to test this hypothesis. The creation of 3-O-sulfated affinity matrices has been described. These matrices have been validated using heparan sulfate structural analysis and the binding of control ligands. Fractionating
70 serum over the matrices revealed twelve candidate proteins. Since the addition of 3-O- sulfate increased the negative charge of the heparan sulfate by only three percent, I hypothesize that the interaction of these proteins with 3-O-sulfated heparan sulfate is due to a specific sulfation pattern rather than an increase in bulk charge. However, I cannot exclude that these proteins were bound to the resin via bridging of another 3-O- sulfate dependent ligand. Individual testing using purified protein is needed to clarify this issue.
Of the twelve candidate proteins, six are known heparin binding proteins, including amyloid beta A4, biglycan, clusterin, HABP2, mannose-binding protein C and NRP1 (Ori et al., 2011). As an internal control, binding of AT was also highly enriched on the Hs3st-1 modified heparan sulfate. In many instances, the 3-O-sulfate dependent candidate proteins were found exclusively in the eluates from the 3-O- sulfated matrices. Unlike AT, all of the novel proteins bound similarly to both Hs3st-1 and Hs3st-2 modified heparan sulfate. All are traditionally known as secreted proteins except amyloid beta A4, NRP1 and synaptotagmin-like-4. NRP1 can be produced as a secreted isoform (Rossignol et al., 2000) and fragments of amyloid beta A4 can be released from the cell surface by proteolytic cleavage (Thinakaran and Koo, 2008), which explains how they could be found in the serum.
The candidate proteins discovered by fractionation of serum suggest a number of physiological roles of 3-O-sulfation. NRP1, a modulator of vasculogenesis and axonal guidance, is the subject of Chapter 3. Amyloid beta A4 is another cell surface protein that modulates neuronal dendrite growth and branching in addition to synaptic function (Billnitzer et al., 2013; Tyan et al., 2012). Peptide fragments of amyloid beta
71 are found in neuronal plaques that are characteristic of Alzheimer’s disease (Masters et al., 1985). Heparan sulfate binds amyloid beta and is also a known component of neuronal plaques (Schubert, 1989; Snow et al., 1988). Clusterin, also a known heparin binding protein, is an extracellular chaperon that sequesters amyloid beta to prevent its aggregation (Narayan et al., 2012; Pankhurst et al., 1998). Thus, it is thought to protect against plaque formation in Alzheimer’s disease. Since both amyloid beta and clusterin were identified as 3-O-sulfate dependent candidate proteins, it is interesting to imagine that 3-O-sulfation may modulate plaque formation via its interactions with these proteins.
In addition to AT, three proteins involved in regulating coagulation eluted specifically from the 3-O-sulfated matrices. These proteins were coagulation factor V, coagulation factor XIII and HABP2. Factor V is a cofactor with Factor Xa that facilitates activation of prothrombin (Nesheim et al., 1979). Factor XIII crosslinks fibrin chains, which stabilizes the fibrin clot (Ariens et al., 2002). Therefore, both of these factors facilitate clot formation. Whether binding to 3-O-sulfated heparan sulfate modulates the activity of these proteins is an open question that should be investigated. HABP2 is a protease that plays two opposing roles in hemostasis. It activates coagulation factor VII, which stimulates clot formation (Romisch et al.,
1999a). It also activates pro-urokinase, which leads to plasmin activation and degradation of fibrin clots (Romisch et al., 1999b). Its activation is an autocatalytic event that is accelerated by heparin binding (Etscheid et al., 2000). The finding that
HABP2 binds specifically to 3-O-sulfated affinity matrices suggests that heparan sulfate 3-O-sulfation plays a role in the activation of HABP2 possibly balancing its
72 coagulant or anticoagulant activities. Unlike AT, which is activated only by Hs3st-1 modified heparan sulfate, these coagulation factors bound to resins modified by either
Hs3st-1 or -2.
Interestingly, a two chondroitin sulfate proteoglycans (biglycan and decorin) and one chondroitin/heparan sulfate proteoglycan (serglycin) appeared specifically in the eluates from 3-O-sulfated heparan sulfate. Decorin and serglycin have not been described as heparin binding proteins. It is possible that these proteins were bound in a complex to another protein that is a 3-O-sulfate dependent ligand. Interestingly, NRP1 in some cell types and amyloid beta A4 can be part-time proteoglycans (Schubert et al., 1988; Shintani et al., 2006; Shioi et al., 1993).
To date, my search for proteins that are modulated by 3-O-sulfation has been restricted to serum. The discovery of twelve candidate proteins in serum alone suggests that there may be many additional proteins whose binding to heparan sulfate is influenced by 3-O-sulfation. My efforts described in this chapter lay the groundwork for identifying these proteins from any source of soluble protein.
Analyses of other protein sources will likely reveal additional ligands and physiological processes that are influenced by 3-O-sulfation.
2.5 Experimental methods
2.5.1 Reagents
DEAE Sephacel, Sepharose 6B and PD-10 columns were from GE Healthcare.
Amylose resin was from New England Biolabs. DNase, RNase, Pronase and CNBr activated-Sepharose were from Sigma. Chondroitinase ABC was from Seikagaku.
73
NuPAGE gels and silver stain kit were from Invitrogen. The BCA protein assay kit was from Pierce. Recombinant human his-NRP1 (a1a2b1b2) was from R&D Systems.
Purified AT was from Aniara and recombinant human FGF2 was from Shenandoah
Biotechnology. Recombinant RAGE was produced as described previously (Xu et al.,
2013). Immunoblotting for NRP1 was performed using a rabbit pAb to NRP1 from
BioVision. Immunoblotting for AT was performed using a goat anti-human pAb to antithrombin III from R&D Systems.
2.5.2 Cell line culture
CHO-S cells were from Invitrogen and were cultured in 1 L vented suspension culture flasks (37°C, 8 percent CO2, 130 rpm) using CHO-S FreeStyle medium plus 8 mM L-glutamine. Cells were seeded at 0.5 x 106 cells/ml and conditioned medium was harvested 5 days later at about 5.0 x 106 cells/ml.
2.5.3 Affinity matrix production
CHO-S conditioned medium was stored at -20°C with 0.02 percent sodium azide until further processing. Conditioned medium was filtered and then passed over
DEAE-Sephacel to collect the glycosaminoglycans. DEAE-Sephacel was equilibrated with 10 bed volumes of 50 mM sodium acetate, pH 6.0, 150 mM NaCl, washed with
20 bed volumes of 50 mM sodium acetate, pH 6.0, 250 mM NaCl and eluted with 5 bed volumes of 50 mM sodium acetate, pH 6.0, 1 M NaCl. The eluate was dialyzed against 100 volumes of water and lyophilized to dryness. The pellet was dissolved in
50 mM Tris, pH 8.0, 50 mM NaCl, 2.5 mM MgCl2, 2.5 mM KCl, 0.5 mM CaCl2 and
74
0.02 percent sodium azide and the contaminating DNA, RNA, chondroitin sulfate and protein were removed using simultaneous DNase, RNase, chondroitinase ABC digests followed by Pronase digest. The heparan sulfate was purified using DEAE-Sephacel chromatography and PD-10 desalting. The amount of heparan sulfate and protein was quantified using the carbazole assay (Bitter and Muir, 1962) and the BCA protein assay. The amount of remaining nucleic acid contamination was measured by A260/280.
The amount of remaining chondroitin sulfate was measured by A232 following digestion with chondroitinase ABC. Digests were repeated if necessary to remove remaining contaminants. The length of the heparan sulfate chains was determined by gel filtration using Sepharose 6B and radiolabeled heparan sulfate as described previously (Wasteson, 1971).
Recombinant human Hs3st-1 was produced in K. lactis as described previously
(Zhou et al., 2011). Recombinant human MBP-Hs3st-2 was produced by cloning the sulfotransferase domain of Hs3st-2 into the pMAL-c2x vector. Recombinant protein was produced as described previously (Xu et al., 2007). Briefly, the expression vector was transduced into Origami-B cells carrying the pGro7 plasmid, which expresses the
E. coli chaperonin proteins GroEL and GroES. E. coli was grown up in LB plus 2 mg/ml glucose, 12.5 ug/ml tetracyclin, 15 ug/ml kanamycin, 20 ug/ml chloramphenicol and 50 ug/ml carbenicillin. Expression was induced with 1 mg/ml L- arabinose and 0.1 mM IPTG for 22 hours. Cell pellets were sonicated and MBP-Hs3st-
2 was purified by FPLC on an amylose column followed by heparin-Sepharose.
Protein was quantified by BCA protein assay, tested for purity by gel electrophoresis and tested for enzymatic activity, as described below.
75
The sulfate donor, 3’-phosphoadenosine-5’-phosphosulfate (PAPS), was produced as described previously (Zhou et al., 2011). Briefly, cell lysate was produced from E. coli BL21 Star(DE3) expressing ATP sulfurylase/APS kinase and pyrophosphatase after overnight stimulation with 0.2 mM IPTG. PAPS synthesis reaction conditions were 50 mM Tris, pH 8.0, 22.5 mM ATP disodium, 100 mM
Na2SO4, 10 mM MgCl2, 10 mM LiCl, 0.6 mg/ml lysate containing ATP sulfurylase and APS kinase and 0.3 mg/ml lysate containing pyrophosphatase. Radiolabeled
35 35 [ S]PAPS were created by adding [ S]H2SO4 to the reaction. The reaction was incubated for 6 hours at 30°C. PAPS were purified using DEAE-Sephacel washed with water and eluted with 300 mM NaCl. The concentration of PAPS was quantified by A260 and the presence of PAPS in the eluate was verified by LC/MS.
The activities of Hs3st-1 and MBP-Hs3st-2 were tested as follows. The reaction buffer was 50 mM MES, pH 7.0, 5 mM MgCl2, 5 mM MnCl2, 120 ug/ml
BSA, 20 ug/ml protamine chloride and 0.5 % Triton X-100. Various amounts of
Hs3st-1 or MBP-Hs3st-2 were incubated with 5 ug CHO-S heparan sulfate and 400
µM PAPS in a total volume of 50 µl for 2 hours at 37°C. The heparan sulfate was purified on DEAE-Sephacel equilibrated with 50 mM sodium acetate, pH 6.0, 150 mM NaCl, 0.1% Triton X-100, washed with 50 mM sodium acetate, pH 6.0, 250 mM
NaCl and eluted with 50 mM sodium acetate, pH 6.0, 1 M NaCl. The amount of sulfate incorporated was measured by scintillation counting.
To produce multimilligram quantities of 3-O-sulfated heparan sulfate, reaction conditions were scaled volumetrically using cold PAPS. To assess the extent of 3-O- sulfate incorporation, a small scale reaction with [35S]PAPS was performed in parallel.
76
The presence of appropriate AT-type and gD-type 3-O-sulfation in the reaction products was determined by GRIL-LC/MS as described previously (Lawrence et al.,
2008b).
Glycosaminoglycan was immobilized on CNBr-activated Sepharose as described in the product literature. Briefly, glycosaminoglycan was dried from water on a SpeedVac and dissolved in 100 mM NaHCO3, pH 8.3, 500 mM NaCl. Dry resin was hydrated and washed with 20 bed volumes of 1 mM HCl. Resin was allowed to settle and excess HCl was removed. Then, the resin was suspended in glycosaminoglycan solution to create 2:1 solution to resin by volume. The resin was turned end over end for 1 hour at room temperature. Unconjugated glycosaminoglycan was recovered by multiple washes of PBS with 1 M NaCl. The concentration of glycosaminoglycan on the bead was determined by scintillation counting following immobilization of [35S]glycosaminoglycan or by heparin lyase digestion and measurement of A232 following immobilization of cold glycosaminoglycan.
2.5.4 Fractionation on affinity matrices
The binding of individual proteins to the affinity matrices was determined as follows. The matrices were equilibrated with 20 bed volumes of 50 mM Tris, pH 7.4,
200 mM NaCl, 2 mM CaCl2 and 2 mM MgCl2, then 0.5 to 2 µg of purified protein in equilibration buffer was passed through each resin. The matrices were washed with 25 bed volumes of equilibration buffer and protein was eluted with 2.5 bed volumes of
0.5 M NaCl and 1 M NaCl. The protein in the eluates was precipitated using acetone and detected after gel electrophoresis by silver stain. Human, fetal bovine and mouse
77 serum was diluted 2-fold and fractionated on the affinity matrices except that protein was eluted only at 1 M NaCl. After gel electrophoresis and silver stain, the remaining protein was trypsin digested and analyzed for protein content by LC/MS at the UCSD
Biomolecular/Proteomics Mass Spectrometry Facility.
2.6 Acknowledgments
This chapter will be submitted for publication in conjunction with Chapter 3 and 4. The dissertation author was the primary author of this work with Emylie
Seamen, Roger Lawrence, Jian Liu and Jeffrey Esko as coauthors. This work was supported by grants GM93131 and HL107150 (to J.D.E.), by training grant
T32CA067754 (to B.E.T.) and by F32CA156987 (to E.S) from the National Institutes of Health.
2.7 Literature cited
Ariens, R.A., T.S. Lai, J.W. Weisel, C.S. Greenberg, and P.J. Grant. 2002. Role of factor XIII in fibrin clot formation and effects of genetic polymorphisms. Blood. 100:743-754.
Billnitzer, A.J., I. Barskaya, C. Yin, and R.G. Perez. 2013. APP independent and dependent effects on neurite outgrowth are modulated by the receptor associated protein (RAP). J Neurochem. 124:123-132.
Bishop, J.R., M. Schuksz, and J.D. Esko. 2007. Heparan sulphate proteoglycans fine- tune mammalian physiology. Nature. 446:1030-1037.
Bitter, T., and H.M. Muir. 1962. A modified uronic acid carbazole reaction. Anal. Biochem. 4:330-334.
Bui, C., M. Ouzzine, I. Talhaoui, S. Sharp, K. Prydz, M.W. Coughtrie, and S. Fournel- Gigleux. 2010. Epigenetics: methylation-associated repression of heparan sulfate 3-O- sulfotransferase gene expression contributes to the invasive phenotype of H-EMC-SS chondrosarcoma cells. Faseb J. 24:436-450.
78
Cadwallader, A.B., and H.J. Yost. 2006. Combinatorial expression patterns of heparan sulfate sulfotransferases in zebrafish: I. The 3-O-sulfotransferase family. Developmental dynamics : an official publication of the American Association of Anatomists. 235:3423-3431. de Agostini, A.I., J.C. Dong, C. de Vantery Arrighi, M.A. Ramus, I. Dentand-Quadri, S. Thalmann, P. Ventura, V. Ibecheole, F. Monge, A.M. Fischer, S. HajMohammadi, N.W. Shworak, L. Zhang, Z. Zhang, and R.J. Linhardt. 2008. Human follicular fluid heparan sulfate contains abundant 3-O-sulfated chains with anticoagulant activity. J Biol Chem. 283:28115-28124.
Deligny, A., A. Denys, A. Marcant, A. Melchior, J. Mazurier, T.H. van Kuppevelt, and F. Allain. 2010. Synthesis of heparan sulfate with cyclophilin B-binding properties is determined by cell type-specific expression of sulfotransferases. J Biol Chem. 285:1701-1715.
Esko, J.D., and S.B. Selleck. 2002. Order out of chaos: Assembly of ligand binding sites in heparan sulfate. Annu Rev Biochem. 71:435-471.
Etscheid, M., A. Hunfeld, H. Konig, R. Seitz, and J. Dodt. 2000. Activation of proPHBSP, the zymogen of a plasma hyaluronan binding serine protease, by an intermolecular autocatalytic mechanism. Biol Chem. 381:1223-1231.
He, Z., and M. Tessier-Lavigne. 1997. Neuropilin is a receptor for the axonal chemorepellent Semaphorin III. Cell. 90:739-751.
Hirano, K., N. Sasaki, T. Ichimiya, T. Miura, T.H. Van Kuppevelt, and S. Nishihara. 2012. 3-O-Sulfated Heparan Sulfate Recognized by the Antibody HS4C3 Contribute to the Differentiation of Mouse Embryonic Stem Cells via Fas Signaling. PLoS ONE. 7:e43440.
Kawasaki, T., T. Kitsukawa, Y. Bekku, Y. Matsuda, M. Sanbo, T. Yagi, and H. Fujisawa. 1999. A requirement for neuropilin-1 in embryonic vessel formation. Development. 126:4895-4902.
Kolodkin, A.L., D.V. Levengood, E.G. Rowe, Y.T. Tai, R.J. Giger, and D.D. Ginty. 1997. Neuropilin is a semaphorin III receptor. Cell. 90:753-762.
Kuberan, B., M. Lech, J. Borjigin, and R.D. Rosenberg. 2004. Light-induced 3-O- sulfotransferase expression alters pineal heparan sulfate fine structure. A surprising link to circadian rhythm. J Biol Chem. 279:5053-5054.
Lawrence, R., H. Lu, R.D. Rosenberg, J.D. Esko, and L. Zhang. 2008a. Disaccharide structure code for the easy representation of constituent oligosaccharides from glycosaminoglycans. Nat Methods. 5:291-292.
79
Lawrence, R., S.K. Olson, R.E. Steele, L. Wang, R. Warrior, R.D. Cummings, and J.D. Esko. 2008b. Evolutionary differences in glycosaminoglycan fine structure detected by quantitative glycan reductive isotope labeling. J Biol Chem. 283:33674- 33684.
Linhardt, R.J., A. Grant, C.L. Cooney, and R. Langer. 1982. Differential anticoagulant activity of heparin fragments prepared using microbial heparinase. J Biol Chem. 257:7310-7313.
Liu, J., N.W. Shworak, L.M.S. Fritze, J.M. Edelberg, and R.D. Rosenberg. 1996. Purification of heparan sulfate D-glucosaminyl 3-O-sulfotransferase. J Biol Chem. 271:27072-27082.
Liu, J., N.W. Shworak, P. Sinay, J.J. Schwartz, L. Zhang, L.M. Fritze, and R.D. Rosenberg. 1999. Expression of heparan sulfate D-glucosaminyl 3-O-sulfotransferase isoforms reveals novel substrate specificities. The Journal of biological chemistry. 274:5185-5192.
Marcum, J.A., D.H. Atha, L.M. Fritze, P. Nawroth, D. Stern, and R.D. Rosenberg. 1986. Cloned bovine aortic endothelial cells synthesize anticoagulantly active heparan sulfate proteoglycan. J Biol Chem. 261:7507-7517.
Masters, C.L., G. Simms, N.A. Weinman, G. Multhaup, B.L. McDonald, and K. Beyreuther. 1985. Amyloid plaque core protein in Alzheimer disease and Down syndrome. Proc Natl Acad Sci U S A. 82:4245-4249.
McKeehan, W.L., X.C. Wu, and M. Kan. 1999. Requirement for anticoagulant heparan sulfate in the fibroblast growth factor receptor complex. J Biol Chem. 274:21511-21514.
Miyamoto, K., K. Asada, T. Fukutomi, E. Okochi, Y. Yagi, T. Hasegawa, T. Asahara, T. Sugimura, and T. Ushijima. 2003. Methylation-associated silencing of heparan sulfate D-glucosaminyl 3-O-sulfotransferase-2 (3-OST-2) in human breast, colon, lung and pancreatic cancers. Oncogene. 22:274-280.
Mochizuki, H., K. Yoshida, Y. Shibata, and K. Kimata. 2008. Tetrasulfated disaccharide unit in heparan sulfate: enzymatic formation and tissue distribution. J Biol Chem. 283:31237-31245.
Narayan, P., A. Orte, R.W. Clarke, B. Bolognesi, S. Hook, K.A. Ganzinger, S. Meehan, M.R. Wilson, C.M. Dobson, and D. Klenerman. 2012. The extracellular chaperone clusterin sequesters oligomeric forms of the amyloid-beta(1-40) peptide. Nat Struct Mol Biol. 19:79-83.
80
Nesheim, M.E., J.B. Taswell, and K.G. Mann. 1979. The contribution of bovine Factor V and Factor Va to the activity of prothrombinase. J Biol Chem. 254:10952- 10962.
Neugebauer, J.M., A.B. Cadwallader, J.D. Amack, B.W. Bisgrove, and H.J. Yost. 2013. Differential roles for 3-OSTs in the regulation of cilia length and motility. Development. 140:3892-3902.
O'Donnell C, D., V. Tiwari, M.J. Oh, and D. Shukla. 2006. A role for heparan sulfate 3-O-sulfotransferase isoform 2 in herpes simplex virus type 1 entry and spread. Virology. 346:452-459.
Ori, A., M.C. Wilkinson, and D.G. Fernig. 2008. The heparanome and regulation of cell function: structures, functions and challenges. Front Biosci. 13:4309-4338.
Ori, A., M.C. Wilkinson, and D.G. Fernig. 2011. A systems biology approach for the investigation of the heparin/heparan sulfate interactome. J Biol Chem. 286:19892- 19904.
Pan, Q., Y. Chanthery, W.C. Liang, S. Stawicki, J. Mak, N. Rathore, R.K. Tong, J. Kowalski, S.F. Yee, G. Pacheco, S. Ross, Z. Cheng, J. Le Couter, G. Plowman, F. Peale, A.W. Koch, Y. Wu, A. Bagri, M. Tessier-Lavigne, and R.J. Watts. 2007. Blocking neuropilin-1 function has an additive effect with anti-VEGF to inhibit tumor growth. Cancer Cell. 11:53-67.
Pankhurst, G.J., C.A. Bennett, and S.B. Easterbrook-Smith. 1998. Characterization of the heparin-binding properties of human clusterin. Biochemistry. 37:4823-4830.
Pejler, G., G. B:ackström, U. Lindahl, M. Paulsson, M. Dziadek, S. Fujiwara, and R. Timpl. 1987. Structure and affinity for antithrombin of heparan sulfate chains derived from basement membrane proteoglycans. J Biol Chem. 262:5036-5043.
Pempe, E.H., Y. Xu, S. Gopalakrishnan, J. Liu, and E.N. Harris. 2012. Probing structural selectivity of synthetic heparin binding to stabilin protein receptors. J Biol Chem. 287:20774-20783.
Romisch, J., A. Feussner, S. Vermohlen, and H.A. Stohr. 1999a. A protease isolated from human plasma activating factor VII independent of tissue factor. Blood Coagul Fibrinolysis. 10:471-479.
Romisch, J., S. Vermohlen, A. Feussner, and H. Stohr. 1999b. The FVII activating protease cleaves single-chain plasminogen activators. Haemostasis. 29:292-299.
Rossignol, M., M.L. Gagnon, and M. Klagsbrun. 2000. Genomic organization of human neuropilin-1 and neuropilin-2 genes: identification and distribution of splice variants and soluble isoforms. Genomics. 70:211-222.
81
Samson, S.C., T. Ferrer, C.J. Jou, F.B. Sachse, S.S. Shankaran, R.M. Shaw, N.C. Chi, M. Tristani-Firouzi, and H.J. Yost. 2013. 3-OST-7 regulates BMP-dependent cardiac contraction. PLoS Biol. 11:e1001727.
Schubert, D. 1989. The biological roles of heparan sulfate proteoglycans in the nervous system. Neurobiology of aging. 10:504-506; discussion 510-502.
Schubert, D., R. Schroeder, M. LaCorbiere, T. Saitoh, and G. Cole. 1988. Amyloid β protein precursor is possibly a heparan sulfate proteoglycan core protein. Science. 241:223-226.
Shintani, Y., S. Takashima, Y. Asano, H. Kato, Y. Liao, S. Yamazaki, O. Tsukamoto, O. Seguchi, H. Yamamoto, T. Fukushima, K. Sugahara, M. Kitakaze, and M. Hori. 2006. Glycosaminoglycan modification of neuropilin-1 modulates VEGFR2 signaling. EMBO J. 25:3045-3055.
Shioi, J., L.M. Refolo, S. Efthimiopoulos, and N.K. Robakis. 1993. Chondroitin sulfate proteoglycan form of cellular and cell-surface Alzheimer amyloid precursor. Neurosci Lett. 154:121-124.
Shukla, D., J. Liu, P. Blaiklock, N.W. Shworak, X.M. Bai, J.D. Esko, G.H. Cohen, R.J. Eisenberg, R.D. Rosenberg, and P.G. Spear. 1999. A novel role for 3-O-sulfated heparan sulfate in herpes simplex virus 1 entry. Cell. 99:13-22.
Snow, A.D., H. Mar, D. Nochlin, K. Kimata, M. Kato, S. Suzuki, J. Hassell, and T.N. Wight. 1988. The presence of heparan sulfate proteoglycans in the neuritic plaques and congophilic angiopathy in Alzheimer's disease. Am J Pathol. 133:456-463.
Tecle, E., C.A. Diaz-Balzac, and H.E. Bulow. 2013. Distinct 3-O-sulfated heparan sulfate modification patterns are required for kal-1-dependent neurite branching in a context-dependent manner in Caenorhabditis elegans. G3 (Bethesda). 3:541-552.
Thinakaran, G., and E.H. Koo. 2008. Amyloid precursor protein trafficking, processing, and function. J Biol Chem. 283:29615-29619.
Thunberg, L., G. Bäckström, and U. Lindahl. 1982. Further characterization of the antithrombin-binding sequence in heparin. Carbohydr.Res. 100:393-410.
Tiwari, V., C.D. O'Donnell, M.J. Oh, T. Valyi-Nagy, and D. Shukla. 2005. A role for 3-O-sulfotransferase isoform-4 in assisting HSV-1 entry and spread. Biochem Biophys Res Commun. 338:930-937.
Tyan, S.H., A.Y. Shih, J.J. Walsh, H. Maruyama, F. Sarsoza, L. Ku, S. Eggert, P.R. Hof, E.H. Koo, and D.L. Dickstein. 2012. Amyloid precursor protein (APP) regulates synaptic structure and function. Mol Cell Neurosci. 51:43-52.
82
Vander Kooi, C.W., M.A. Jusino, B. Perman, D.B. Neau, H.D. Bellamy, and D.J. Leahy. 2007. Structural basis for ligand and heparin binding to neuropilin B domains. Proc Natl Acad Sci USA. 104:6152-6157.
Wasteson, A. 1971. A method for the determination of the molecular weight and molecular-weight distribution of chondroitin sulphate. J Chromatogr. 59:87-97.
Xia, G.Q., J.H. Chen, V. Tiwari, W.J. Ju, J.P. Li, A. Malmström, D. Shukla, and J. Liu. 2002. Heparan sulfate 3-O-sulfotransferase isoform 5 generates both an antithrombin-binding site and an entry receptor for herpes simplex virus, type 1. J Biol Chem. 277:37912-37919.
Xu, D., D. Song, L.C. Pedersen, and J. Liu. 2007. Mutational study of heparan sulfate 2-O-sulfotransferase and chondroitin sulfate 2-O-sulfotransferase. J Biol Chem. 282:8356-8367.
Xu, D., V. Tiwari, G. Xia, C. Clement, D. Shukla, and J. Liu. 2005. Characterization of heparan sulphate 3-O-sulphotransferase isoform 6 and its role in assisting the entry of herpes simplex virus type 1. Biochem J. 385:451-459.
Xu, D., J.H. Young, J.M. Krahn, D. Song, K.D. Corbett, W.J. Chazin, L.C. Pedersen, and J.D. Esko. 2013. Stable RAGE-heparan sulfate complexes are essential for signal transduction. ACS chemical biology. 8:1611-1620.
Yamada, S., K. Yoshida, M. Sugiura, K. Sugahara, K.H. Khoo, H.R. Morris, and A. Dell. 1993. Structural studies on the bacterial lyase-resistant tetrasaccharides derived from the antithrombin III-binding of porcine intestinal heparin. J Biol Chem. 268:4780-4787.
Zhou, X., K. Chandarajoti, T.Q. Pham, R. Liu, and J. Liu. 2011. Expression of heparan sulfate sulfotransferases in Kluyveromyces lactis and preparation of PAPS. Glycobiology. 21:771-780.
83
2.8 Supplemental tables
Supplemental Table 2-S1. Complete LC/MS results of bovine serum fractionated on affinity matrices. Each protein name is displayed with its NCBI accession number. The number of peptides attributed to each protein with greater than 95% confidence is shown for the eluate from each of the affinity matrices.
84
Supplemental Table 2-S1. Bovine Serum 1 Bovine Serum 2 Accession Name HS HS3.1 HS HS3.1 HS3.2 gi|30794280 serum albumin precursor 22 9 70 66 62 gi|157954061 alpha-2-macroglobulin 1 2 54 52 47 gi|114326282 serotransferrin precursor 48 48 46 gi|99028969 complement C3 preproprotein 43 38 44 gi|77736341 antithrombin-III precursor 1 51 7 37 17 gi|30794292 lactotransferrin precursor 29 23 18 15 19 gi|41386685 thrombospondin-1 precursor 7 21 14 17 24 gi|27806751 alpha-2-HS-glycoprotein precursor 1 2 24 22 20 gi|27806941 alpha-1-antiproteinase precursor 1 4 24 17 16 gi|77735479 alpha-fetoprotein precursor 19 21 17 gi|148238273 inter-alpha-trypsin inhibitor heavy chain H2 15 14 16 gi|75832116 inter-alpha-trypsin inhibitor heavy chain H4 precursor 17 12 12 gi|155371855 platelet factor 4 3 6 8 10 10 gi|297480566 PREDICTED: apolipoprotein B 7 12 16 gi|114053019 alpha-1B-glycoprotein precursor 11 11 11 gi|77735387 fetuin-B precursor 12 12 9 gi|78369364 vitamin D-binding protein precursor 10 11 10 gi|62460494 hemoglobin fetal subunit beta 2 3 8 9 9 gi|164450479 kininogen-2 isoform I 1 3 10 9 8 gi|94966811 alpha-1-acid glycoprotein precursor 11 10 9 gi|297475230 PREDICTED: pregnancy-zone protein-like 7 12 10 gi|156120445 inter-alpha-trypsin inhibitor heavy chain H3 precursor 11 9 8 gi|27806743 protein AMBP precursor 3 5 7 6 7 gi|262050656 complement C4 8 5 14 gi|297480762 PREDICTED: lipocalin 2 (oncogene 24p3)-like 5 7 6 3 5 gi|164450481 kininogen-2 isoform II 3 6 8 8 gi|129277510 extracellular superoxide dismutase 5 8 2 4 6 gi|157280001 heparin cofactor 2 1 8 8 7 gi|31340900 serpin A3-1 precursor 9 9 6 gi|297463443 PREDICTED: endopin 2B-like 6 10 7 gi|75832097 serpin A3-7 6 9 7 gi|297472284 PREDICTED: heparan sulfate proteoglycan 2 6 15 gi|62460436 hyaluronan-binding protein 2 1 7 13 gi|166159174 angiotensinogen 8 6 7 gi|27806815 plasminogen precursor 4 9 7 gi|75832056 apolipoprotein A-I preproprotein 2 2 6 5 5 gi|78045497 vitronectin 5 5 2 1 6 gi|95147674 complement factor B precursor 9 6 4 gi|268607679 coagulation factor XIII A chain precursor 3 8 2 5 gi|297460089 PREDICTED: apolipoprotein B 2 12 4 gi|27806487 pigment epithelium-derived factor precursor 7 5 5 gi|116812902 hemoglobin subunit alpha 5 5 6 gi|27806739 apolipoprotein E precursor 5 11 1 gi|27806741 beta-2-glycoprotein 1 precursor 6 4 5 gi|27807209 alpha-2-antiplasmin precursor 6 5 4 gi|27806947 prothrombin 5 3 3 4 gi|297466391 PREDICTED: Alpha-2-macroglobulin-like, partial 5 10 gi|110350683 biglycan precursor 6 8 gi|76633778 PREDICTED: syndecan 4-like 3 5 6 gi|153791660 extracellular matrix protein 1 4 8 2 gi|27806789 transthyretin precursor 3 4 6 gi|255003702 fibronectin 1 3 4 5 gi|77735671 amiloride-sensitive amine oxidase 5 2 2 3 1 gi|84000165 complement factor I 5 2 4 gi|148232266 fibulin-1 3 4 4 gi|300795580 phosphatidylinositol-5-phosphate 4-kinase type-2 alpha 4 2 2 3 gi|70778776 serglycin 3 7 gi|76610310 PREDICTED: neuropilin 2 isoform 2 3 6 gi|75832054 actin, cytoplasmic 1 1 3 5 gi|115496418 inter-alpha-trypsin inhibitor heavy chain H1 precursor 4 2 3 gi|164452943 gelsolin a 3 3 3 gi|27806583 heparanase precursor 1 1 1 3 3
85
Supplemental Table 2-S1, Continued.
Bovine Serum 1 Bovine Serum 2 Accession Name HS HS3.1 HS HS3.1 HS3.2 gi|330417948 collagen alpha-1(XII) chain 1 7 gi|329663966 neuropilin-1 2 6 gi|27806853 lumican precursor 3 5 gi|27806907 clusterin preproprotein 1 2 5 gi|95006989 ribonuclease 4 3 5 gi|84000163 nucleosome assembly protein 1-like 4 2 1 4 gi|119914040 PREDICTED: endopin 1b-like isoform 3 3 4 gi|75812954 fibrinogen alpha chain precursor 1 3 3 gi|77736171 hemopexin precursor 3 2 2 gi|114052298 apolipoprotein A-II precursor 2 3 2 gi|77735883 serum amyloid P-component precursor 2 3 2 gi|262205546 complement C5a anaphylatoxin 1 4 2 gi|114053269 serotransferrin-like 4 3 gi|297484227 PREDICTED: neurexin 2-like 6 gi|27808640 peptidoglycan recognition protein 1 precursor 1 5 gi|134085613 collagen alpha-1(XVIII) chain 2 4 gi|300797019 mannan-binding lectin serine protease 2 2 1 3 gi|27807205 thyroxine-binding globulin precursor 1 2 3 gi|76617373 PREDICTED: nucleosome assembly protein 1-like 1 isoform 4 4 2 gi|76677897 complement factor H precursor 4 2 gi|226373739 serpin A3-6 6 gi|126165236 serpin A3-5 6 gi|76253701 decorin precursor 1 4 gi|139948632 immunoglobulin lambda-like polypeptide 1 2 1 2 gi|297480958 PREDICTED: collagen type 5 alpha 1-like 3 2 gi|116004151 mannan-binding lectin serine protease 1 2 2 1 gi|27807443 spondin-1 precursor 2 3 gi|27806029 neurexin-1-alpha precursor 4 gi|149642955 protein Z-dependent protease inhibitor 1 3 gi|116003813 amyloid beta A4 protein 1 3 gi|114051379 leucine-rich alpha-2-glycoprotein 1 1 2 gi|88319929 metalloproteinase inhibitor 3 precursor 1 1 2 gi|164420709 retinol-binding protein 4 2 1 1 gi|297480386 PREDICTED: IGK protein-like 1 2 1 gi|262073096 cartilage oligomeric matrix protein 4 gi|27806761 aggrecan core protein 3 gi|90093345 microtubule-associated protein RP/EB family member 2 3 gi|155371959 testican-2 1 2 gi|156120795 sulfhydryl oxidase 1 1 2 gi|27806823 osteomodulin precursor 1 2 gi|303324575 acidic leucine-rich nuclear phosphoprotein 32 family member A 1 2 gi|76619991 PREDICTED: platelet basic protein-like 1 2 gi|84370163 protein SET 1 2 gi|115495491 syndecan-1 precursor 1 1 1 gi|165973998 protein S100-A8 2 1 gi|219804724 collagen alpha-1(VI) chain 2 1 gi|255652936 pantetheinase precursor 1 2 gi|27807349 factor XIIa inhibitor precursor 1 2 gi|300793939 afamin 3 gi|329663683 collagen alpha-3(V) chain 2 1 gi|78369302 catalase 3 gi|27806623 fibromodulin 2
86
Supplemental Table 2-S2. Complete LC/MS results of mouse serum fractionated on affinity matrices. Each protein name is displayed with its NCBI accession number. The number of peptides attributed to each protein with greater than 95 % confidence is shown for the eluate from each of the affinity matrices.
87
Supplemental Table 2-S2. Mouse Serum 1 Mouse Serum 2 Accession Name HS HS3.1 HS HS3.1 HS3.2 tr|Q546G4 Albumin 1 239 177 259 152 159 sp|Q61838 Alpha-2-macroglobulin 122 96 132 90 97 sp|Q921I1 Serotransferrin 118 90 104 75 82 tr|Q80YQ1 Thrombospondin 1 129 157 22 31 66 tr|Q543J5 Antithrombin 9 231 4 80 28 tr|Q80XP1 Complement component 3 76 56 79 56 47 sp|Q9Z126 Platelet factor 4 80 101 26 40 51 sp|P28665 Murinoglobulin-1 64 46 58 33 43 sp|P07759 Serine protease inhibitor A3K 55 44 45 28 29 sp|Q00896 Alpha-1-antitrypsin 1-3 44 34 47 27 38 sp|P22599 Alpha-1-antitrypsin 1-2 44 34 46 24 35 sp|P28666 Murinoglobulin-2 40 32 44 24 33 sp|Q00897 Alpha-1-antitrypsin 1-4 37 32 40 23 33 sp|Q91X72 Hemopexin 48 32 35 19 25 sp|P01865 Ig gamma-2A chain C region, membrane-bound form 18 18 27 21 23 sp|P23953 Liver carboxylesterase N 22 19 31 19 15 sp|Q00623 Apolipoprotein A-I 23 14 26 12 26 sp|P20918 Plasminogen 25 26 21 7 21 sp|Q00898 Alpha-1-antitrypsin 1-5 23 17 24 11 24 sp|Q61147 Ceruloplasmin 23 20 25 9 18 sp|P01867 Ig gamma-2B chain C region 22 16 19 15 15 sp|P11276 Fibronectin 20 23 15 8 19 sp|O08677 Kininogen-1 24 17 16 11 14 tr|Q3UBS3 Haptoglobin 27 18 12 11 11 tr|Q8C7G9 Inter alpha-trypsin inhibitor, heavy chain 4 18 17 17 7 16 sp|P01029 Complement C4-B 20 10 13 9 21 sp|P29699 Alpha-2-HS-glycoprotein 18 12 16 13 12 sp|P12246 Serum amyloid P-component 6 13 12 20 19 tr|Q6YK32 Histidine-rich glycoprotein HRG 33 13 9 3 10 sp|P01869 Ig gamma-1 chain C region, membrane-bound form 15 11 17 10 13 sp|P01864 Ig gamma-2A chain C region secreted form 11 8 18 12 16 sp|P01837 Ig kappa chain C region 12 13 14 5 20 sp|P01873 Ig mu chain C region membrane-bound form 17 13 9 7 17 sp|P13020 Gelsolin 15 14 11 7 8 sp|Q91WP6 Serine protease inhibitor A3N 16 13 12 7 7 sp|P06909 Complement factor H 15 15 10 5 7 tr|Q91XF8 Apolipoprotein A-IV 6 7 13 5 9 tr|E9Q5L2 Uncharacterized protein 16 7 16 sp|Q61703 Inter-alpha-trypsin inhibitor heavy chain H2 6 10 10 7 5 sp|P03987 Ig gamma-3 chain C region 8 8 10 3 7 tr|Q5M9K1 Transthyretin 6 9 9 5 5 sp|P01878 Ig alpha chain C region 8 7 8 5 5 sp|P07758 Alpha-1-antitrypsin 1-1 33 sp|P13609 Serglycin 14 18 sp|P21614 Vitamin D-binding protein 6 8 8 6 4 sp|P39876 Metalloproteinase inhibitor 3 10 14 2 3 3 tr|A8DUK4 Beta-globin 6 6 7 7 5 sp|P29788 Vitronectin 3 4 3 6 14 sp|P01942 Hemoglobin subunit alpha 6 2 6 5 9 sp|P06330 Ig heavy chain V region AC38 205.12 11 6 9 tr|A2ATR7 Serine (Or cysteine) proteinase inhibitor, clade G, member 1 7 4 6 4 5 sp|Q61129 Complement factor I 9 8 4 5 tr|Q5ND36 Serine (Or cysteine) peptidase inhibitor, clade F, member 2, isoform CRA_c 4 6 5 3 5 sp|Q61704 Inter-alpha-trypsin inhibitor heavy chain H3 5 4 5 5 4 sp|P19221 Prothrombin 6 7 4 2 4 sp|Q07456 Protein AMBP 10 5 4 3 1 sp|P04186 Complement factor B 9 9 4 sp|Q61702 Inter-alpha-trypsin inhibitor heavy chain H1 7 4 4 4 3 sp|P01757 Ig heavy chain V region J558 11 5 6 sp|Q01339 Beta-2-glycoprotein 1 9 2 4 4 2 tr|Q91VB8 Alpha globin 1 6 4 10 sp|P08226 Apolipoprotein E 4 6 3 3 4 tr|B8JJN0 Complement component 2 (Within H-2S) 9 11 tr|Q4KL81 Actin, gamma, cytoplasmic 1 8 5 3 3 sp|O70362 Phosphatidylinositol-glycan-specific phospholipase D 7 3 4 2 3 sp|P01645 Ig kappa chain V-V region HP 93G7 6 3 3 6 sp|Q8K0D2 Hyaluronan-binding protein 2 6 11 sp|Q91WP0 Mannan-binding lectin serine protease 2 6 5 1 1 4 sp|Q60590 Alpha-1-acid glycoprotein 1 6 4 3 2 2 tr|Q549A5 Clusterin 4 3 3 6 tr|Q3U793 Complement component 1, q subcomponent, beta polypeptide 3 5 3 1 4
88
Supplemental Table 2-S2, Continued. Mouse Serum 1 Mouse Serum 2 Accession Name HS HS3.1 HS HS3.1 HS3.2 sp|P98064 Mannan-binding lectin serine protease 1 2 5 1 7 sp|Q9QXC1 Fetuin-B 3 4 2 3 3 sp|P02088 Hemoglobin subunit beta-1 5 5 4 sp|P01635 Ig kappa chain V-V region K2 (Fragment) 4 2 2 2 4 tr|E9Q414 Uncharacterized protein 2 1 3 7 sp|P01592 Immunoglobulin J chain 2 1 3 2 4 sp|P14847 C-reactive protein 2 3 1 2 4 sp|P18526 Ig heavy chain V region 345 5 3 1 3 sp|Q06770 Corticosteroid-binding globulin 3 4 3 2 tr|Q5SVE8 Epidermal growth factor receptor 6 1 1 1 2 tr|B2RS99 Heparanase 3 8 sp|P09813 Apolipoprotein A-II 5 5 tr|Q9EQI5 Chemokine (C-X-C motif) ligand 7, isoform CRA_b 3 2 2 1 2 sp|P06684 Complement C5 1 4 4 1 tr|Q549X6 Synaptotagmin-like 4 0 6 3 sp|O88947 Coagulation factor X 1 2 1 3 2 sp|P52430 Serum paraoxonase/arylesterase 1 2 3 2 2 sp|P97352 Protein S100-A13 2 3 2 2 sp|P01898 H-2 class I histocompatibility antigen, Q10 alpha chain 3 3 1 2 tr|D3Z7Y0 Glutathione peroxidase 4 1 2 2 sp|Q8BND5 Sulfhydryl oxidase 1 4 2 3 tr|Q6DI63 Complement component 1, q subcomponent, C chain 2 1 5 sp|Q9JJN5 Carboxypeptidase N catalytic chain 1 1 3 3 tr|A2AE15 Complement factor properdin 1 1 1 2 3 sp|P01639 Ig kappa chain V-V region MOPC 41 2 2 1 3 sp|P41317 Mannose-binding protein C 1 3 1 3 sp|P60710 Actin, cytoplasmic 1 5 3 tr|Q8R0P5 Kallikrein B, plasma 1 2 1 2 1 2 sp|P49182 Heparin cofactor 2 3 3 2 sp|Q6GQT1 Alpha-2-macroglobulin-P 3 5 sp|P70389 Insulin-like growth factor-binding protein complex acid labile subunit 3 4 sp|P01657 Ig kappa chain V-III region PC 2413 3 2 2 sp|Q19LI2 Alpha-1B-glycoprotein 2 4 1 sp|Q07235 Glia-derived nexin 7 tr|Q9DCM6 Complement component 1, q subcomponent, alpha polypeptide 2 5 tr|Q6YJU1 GUGU beta 3 4 tr|D3YY36 Uncharacterized protein 7 sp|P12399 Protein CTLA-2-alpha 2 4 sp|Q9DBB9 Carboxypeptidase N subunit 2 1 1 4 sp|P02089 Hemoglobin subunit beta-2 3 3 sp|P01631 Ig kappa chain V-II region 26-10 3 1 2 sp|P01642 Ig kappa chain V-V region L7 (Fragment) 2 1 1 1 1 sp|O70165 Ficolin-1 1 4 sp|P01668 Ig kappa chain V-III region PC 7210 2 3 sp|Q02596 Glycosylation-dependent cell adhesion molecule 1 2 3 tr|Q9DBD0 Putative uncharacterized protein 3 2 sp|P39039 Mannose-binding protein A 1 2 2 sp|Q60994 Adiponectin 1 2 1 1 tr|B1ASJ7 Complement component 8, beta subunit 2 1 2 tr|Q91XL1 Leucine-rich HEV glycoprotein 3 2 sp|P01783 Ig heavy chain V region MOPC 21 (Fragment) 1 3 1 sp|P26043 Radixin 5 sp|P01666 Ig kappa chain V-III region PC 7183 5 tr|Q3UKR1 Decorin 1 3 tr|Q6PAR3 Neuropilin 1 1 3 sp|P01808 Ig heavy chain V region T601 2 2 sp|P01634 Ig kappa chain V-V region MOPC 21 1 1 2 sp|P33622 Apolipoprotein C-III 1 1 2 sp|Q80YY7 Zinc finger protein 618 1 1 1 1 sp|Q9QWK4 CD5 antigen-like 1 1 1 1 tr|Q5I0U6 Amyloid protein A 1 1 1 1 sp|P04945 Ig kappa chain V-VI region NQ2-6.1 1 1 2 sp|P26040 Ezrin 4 sp|P26041 Moesin 4 tr|Q542X9 Superoxide dismutase [Cu-Zn] 4 sp|Q00724 Retinol-binding protein 4 3 1 sp|P01633 Ig kappa chain V19-17 3 sp|P01655 Ig kappa chain V-III region PC 7132 1 2 sp|P70274 Selenoprotein P 1 2 tr|D3Z577 Uncharacterized protein 1 2 sp|P01679 Ig kappa chain V-VI region J539 1 1 1
89
Supplemental Table 2-S2, Continued. Mouse Serum 1 Mouse Serum 2 Accession Name HS HS3.1 HS HS3.1 HS3.2 tr|A2A998 Complement component 8, alpha polypeptide 1 1 1 sp|O89020 Afamin 2 1 sp|Q80YC5 Coagulation factor XII 1 1 1 sp|P01638 Ig kappa chain V-V region L6 (Fragment) 1 1 1 tr|Q91XJ8 Beta-2 microglobulin 1 1 1 sp|Q02105 Complement C1q subcomponent subunit C 3 tr|B9EKN8 TRAF2 and NCK interacting kinase 3 sp|P01804 Ig heavy chain V-III region HPC76 (Fragment) 1 2 tr|Q9DBB7 Zinc-alpha-2-glycoprotein 1 3 tr|Q3TNY9 Biglycan 2 tr|Q91X48 Complement component 4 binding protein 2 tr|Q6GR78 Amyloid beta (A4) protein 1 1 tr|Q8CI01 Protein Z, vitamin K-dependent plasma glycoprotein, isoform CRA_a 1 1 sp|P01680 Ig kappa chain V-IV region S107B 1 1 sp|P18525 Ig heavy chain V region 5-84 1 1 tr|E9Q912 Uncharacterized protein 1 1 sp|P01636 Ig kappa chain V-V region MOPC 149 1 1 sp|P42703 Leukemia inhibitory factor receptor 2 RRRRRtr|B1ARU4 REVERSED Microtubule-actin crosslinking factor 1 1 1 sp|P01727 Ig lambda-1 chain V region S43 1 1 sp|P31725 Protein S100-A9 1 1 tr|A2AC66 Lipopolysaccharide binding protein 1 1 sp|P06683 Complement component C9 2
90
Supplemental Table 2-S3. Complete LC/MS results of human serum fractionated on affinity matrices. Each protein name is displayed with its NCBI accession number. Those proteins that have been identified as heparin binding proteins are shown in bold (Ori et al., 2011). The number of peptides attributed to each protein with greater than 95 % confidence is shown for the eluate from each of the affinity matrices.
91
Supplemental Table 2-S3. Human Serum Accession Name HS HS3.1 gi|115298678 complement component 3 precursor 166 126 gi|4502027 albumin precursor 131 81 gi|4502261 serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1 7 124 gi|66932947 alpha-2-macroglobulin precursor 61 41 gi|4557871 transferrin 57 38 gi|4826762 haptoglobin 49 26 gi|4502133 serum amyloid P component precursor 37 34 gi|67190748 complement component 4A preproprotein 23 23 gi|105990532 apolipoprotein B precursor 35 11 gi|45580723 haptoglobin-related protein 26 13 gi|50363221 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 23 12 gi|47132557 fibronectin 1 isoform 1 preproprotein 7 22 gi|4557485 ceruloplasmin precursor 16 12 gi|4557321 apolipoprotein A-I preproprotein 19 9 gi|169218200 PREDICTED: hypothetical protein 17 9 gi|11321561 hemopexin 14 8 gi|88853069 vitronectin precursor 3 18 gi|156119625 inter-alpha (globulin) inhibitor H1 9 10 gi|67782358 complement factor B preproprotein 13 2 gi|50659080 serpin peptidase inhibitor, clade A, member 3 precursor 9 5 gi|21071030 alpha 1B-glycoprotein precursor 8 5 gi|169163330 PREDICTED: similar to hCG1742442 8 5 gi|156231037 kininogen 1 isoform 1 9 4 gi|70778918 inter-alpha globulin inhibitor H2 polypeptide 7 5 gi|156523970 alpha-2-HS-glycoprotein 7 5 gi|54607120 lactotransferrin 6 5 gi|87298828 complement component 1, q subcomponent, B chain precursor 6 5 gi|42740907 clusterin isoform 2 1 8 gi|4507725 transthyretin 4 5 gi|9257232 orosomucoid 1 precursor 5 4 gi|169207532 PREDICTED: similar to hCG2042717 5 4 gi|56786155 complement component 1, q subcomponent, C chain precursor 6 3 gi|32483410 vitamin D-binding protein precursor 9 gi|4502503 complement component 4 binding protein, alpha chain precursor 3 5 gi|62739186 complement factor H isoform a precursor 6 2 gi|71773110 apolipoprotein A-IV precursor 6 1 gi|4505881 plasminogen 7 gi|4502067 alpha-1-microglobulin/bikunin precursor 4 2 gi|31542984 inter-alpha (globulin) inhibitor H4 5 1 gi|169210412 PREDICTED: similar to hCG1793095 3 2 gi|4503635 coagulation factor II precursor 4 gi|105990535 coagulation factor V precursor 4 gi|21489959 immunoglobulin J chain 2 2 gi|4557287 angiotensinogen preproprotein 3 1 gi|73858566 heparin cofactor II precursor 4 gi|169218204 PREDICTED: similar to kappa immunoglobulin (subgroup V kappa I) 4 gi|38016947 complement component 5 preproprotein 4 gi|73858570 complement component 1 inhibitor precursor 4 gi|21264357 mannan-binding lectin serine protease 1 isoform 1 precursor 2 1 gi|169207530 PREDICTED: similar to hCG1812074 2 1 gi|4502149 apolipoprotein A-II preproprotein 2 1 gi|169218253 PREDICTED: similar to hCG2042722 2 1 gi|39725934 serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 3 gi|153266841 apolipoprotein H precursor 3 gi|4502495 complement component 1, s subcomponent 3 gi|4557325 apolipoprotein E precursor 3 gi|4504165 gelsolin isoform a precursor 3 gi|4557323 apolipoprotein C-III precursor 3 gi|21735616 apolipoprotein L1 isoform b precursor 3 gi|4502337 alpha-2-glycoprotein 1, zinc 3 gi|169209363 PREDICTED: similar to hCG1812074 2 gi|66912184 neuropilin 1 isoform a 2 gi|22091452 apolipoprotein M 1 1 gi|118582275 superoxide dismutase 3, extracellular precursor 1 1 gi|21264363 mannan-binding lectin serine protease 2 isoform 1 precursor 1 1 gi|169163270 PREDICTED: similar to hCG2043206 1 1 gi|19923106 paraoxonase 1 2 gi|5174411 CD5 molecule-like 2 gi|4501987 afamin precursor 2 gi|4505529 orosomucoid 2 2 gi|4758502 hyaluronan binding protein 2 1
Chapter 3
Enhanced Binding of Neuropilin-1 to 3-O-sulfated Heparan Sulfate Modulates
Neuronal Growth Cone Collapse
3.1 Summary
Neuropilin-1 (NRP1), a modulator of axonal guidance, was identified as a protein that depends on 3-O-sulfation for binding to heparan sulfate affinity matrices.
In an ELISA format, NRP1 binding to immobilized heparan sulfate almost completely depended on 3-O-sulfation installed by either Hs3st-1 or -2 with preference for Hs3st-
2. NRP1 binding to CHO and HeLa cell surface was also enhanced by 3-O-sulfation.
To investigate a physiological role of 3-O-sulfation, NRP1-dependent growth cone collapse was analyzed using mouse embryonic dorsal root ganglion explants. Growth cone collapse was inhibited by removal of cell surface heparan sulfate or by the addition of soluble heparin. Explants derived from Hs3st2-/- embryos showed reduced collapse. These results demonstrate that NRP1 requires 3-O-sulfation for high affinity binding to heparan sulfate. Furthermore, 3-O-sulfation influences an NRP1-dependent axonal guidance process, namely growth cone collapse.
3.2 Introduction
In the developing nervous system, the formation of functional neuronal circuits requires precise targeting of billions of axons to their proper destinations. This intricate process is accomplished, in large part, by families of axonal guidance proteins and their corresponding cell surface receptors (reviewed in (Kolodkin and
92 93
Tessier-Lavigne, 2011)). The known axonal guidance proteins include netrins, slits, ephrins and semaphorins. Given the context of the signaling event, these guidance proteins can function as either repulsive or attractive cues. The netrins are secreted proteins that signal through the DCC and UNC5 receptors. Slits are also soluble factors that bind to Robo receptors. As soluble factors, netrins and slits are capable of signaling over extended distances. On the other hand, ephrins appear to function only when bound to the cell surface and therefore play roles as short-range guidance cues, mediated by the Eph receptors. The semaphorins are the largest known group of axonal guidance proteins. This family is comprised of approximately 20 different members. Various members of the semaphorin family are membrane bound or secreted and can therefore act in both short-range and long-range guidance. The semaphorins signal through plexin receptors, and a subset of the semaphorins requires
NRP1 or NRP2 as a coreceptor. Semaphorin3a (Sema3a), in particular, requires NRP1
(He and Tessier-Lavigne, 1997; Kolodkin et al., 1997). In addition to these signaling proteins, various morphogens and growth factors have been shown to play roles in mediating axonal guidance.
During axonal targeting, a specialized organelle found at the terminus of each axon senses and responds to guidance cues (reviewed in (Vitriol and Zheng, 2012)).
This organelle, called the growth cone, contains receptors for the various chemotactic proteins. Upon encountering a chemotactic cue in the environment, the receptor/ligand complex stimulates reorganization of the growth cone cytoskeleton, focal adhesions and membrane trafficking in such a way that reorients the growth cone either toward or away from the cue. The appropriate targeting of axons throughout the organism 94 results from the complex interplay between the multiple chemotactic proteins and their various receptors.
The essential role of NRP1 in axonal targeting is underscored by studies of
NRP1 mutant mice. Two NRP1 mutant mouse models have been developed. One line carries a systemic null allele for NRP1, which results in embryonic lethality and severe defects in cranial, spinal and limb neuronal patterning (Kitsukawa et al., 1997).
The other mouse bears a transgene that replaces the normal allele and encodes a mutant form of NRP1 that no longer binds Sema3a (Gu et al., 2003). This mouse is viable but exhibits embryonic defects in the cranial and spinal nerve fibers, similar to the systemic null mouse. Additionally, defects in neuronal targeting in the corpus callosum and hippocampus have been described. Growth cones of dorsal root ganglion explants from both mouse models were non-responsive to treatment with Sema3a.
NRP1 is a known heparin binding protein although a role for heparan sulfate in
NRP1 mediated axonal guidance has not been described. NRP1 contains five extracellular domains (named a1, a2, b1, b2, c), a transmembrane segment and a small intracellular domain (Pellet-Many et al., 2008). The extracellular domains b1b2 contain the heparin-binding site, which has been mapped by mutagenesis and corresponds to a patch of basic residues on the protein surface (Mamluk et al., 2002;
Vander Kooi et al., 2007). NRP1 requires a heparin octasaccharide for binding, and incubation with a 14-mer derived from heparin will induce oligomerization (Mamluk et al., 2002) (Vander Kooi et al., 2007). Heprin induced oligomerization of NRP1 may be of functional importance as the crystal structure of the ternary complex of NRP1 with Sema3a and plexinA2 shows each component present in a 2:2:2 ratio (Janssen et 95 al., 2012). Whether heparan sulfate facilitates the formation of the holoreceptor complex has not been investigated. However, heparan sulfate appears to facilitate the binding of Sema3a to the cell surface and the addition of soluble heparin to neuronal cell culture modulates growth cone collapse in response to Sema3a (De Wit et al.,
2005).
The interaction of heparan sulfate with many of the other known chemotactic proteins or their receptors have been described (de Wit and Verhaagen, 2007). These interactions clearly have effects on axonal guidance: (1) Slit2 bound to heparin (Wang et al., 1999) and was removed from the cell surface with soluble heparin (Brose et al.,
1999). A heparin oligosaccharide was able to induce oligomerization of Slit2 with
Robo1 (Hussain et al., 2006). Removal of cell surface heparan sulfate reduced the affinity of Slit2 binding to the cell and abolished the repulsive and growth cone collapsing activity of Slit2 (Hu, 2001; Hussain et al., 2006). (2) DCC and Netrin both bind to heparin (Bennett et al., 1997; Serafini et al., 1994) and cell surface heparan sulfate is required for axon extension in response to Netrin1 (Matsumoto et al., 2007).
(3) Analysis of a panel of Ephrins and Eph receptors showed that only Ephrin A3 bound to heparan sulfate (Irie et al., 2008). Phosphorylation of EphA2 and EphA4 receptors and growth cone collapse induced by Ephrin A3 were both sensitive to genetic or enzymatic removal of cell surface heparan sulfate (Irie et al., 2008). (4)
Sema5a binds to both heparan sulfate and chondroitin sulfate (Kantor et al., 2004).
Loss of either glycosaminoglycan attenuates the function of Sema5a, but binding to chondroitin sulfate specifically converts the activity of Sema5a from an attractive cue to an inhibitory cue (Kantor et al., 2004). Additional studies are needed to unravel how 96 heparan sulfate mediates axonal guidance via interaction with multiple axonal guidance proteins.
The role of heparan sulfate in modulating axonal guidance is also evident in a mouse model where Ext1 is conditionally deleted in the brain (Inatani et al., 2003).
This mouse has severe disruption of the major commissural tracts and guidance errors of the retinal axons in the optic chiasm. Many of these defects are phenocopied in mutant mice lacking axonal guidance proteins or their receptors, including Slit1/Slit2
(Plump et al., 2002), Netrin1 (Serafini et al., 1996), DCC (Fazeli et al., 1997), Sema3F
(Sahay et al., 2003), Sema3B (Julien et al., 2005), NRP1 (Gu et al., 2003), NRP2
(Chen et al., 2000; Giger et al., 2000), plexinA4 (Yaron et al., 2005) and Eph receptors
(Henkemeyer et al., 1996; Orioli et al., 1996) suggesting that these gene products overlap functionally with heparan sulfate.
Using heparan sulfate affinity matrices, I identified NRP1 as a protein that depends on 3-O-sulfation for binding to heparan sulfate (Chapter 2). With ELISA and cell surface binding assays, I verified the requirement of 3-O-sulfation for this high affinity interaction. I hypothesized that an NRP1-dependent process, Sema3a-induced axonal growth cone collapse, is modulated by 3-O-sulfation. To test this hypothesis,
Sema3a was used with mouse embryonic dorsal root ganglia in a growth cone collapse assay. My results demonstrated that Sema3a-induced growth cone collapse is modulated by heparan sulfate 3-O-sulfation.
97
3.3 Results
3.3.1 Interaction of neuropilin-1 with 3-O-sulfated heparan sulfate
To study the interaction of NRP1 with 3-O-sulfated heparan sulfate, each type
of heparan sulfate was immobilized in wells of a heparin binding plate. Various
concentrations of NRP1 were incubated in each well and the bound protein was
detected (Fig 3-1A). The binding of NRP1 to non-3-O-sulfated heparan sulfate was
just above the background signal. However, NRP1 bound robustly to both types of 3-
O-sulfated heparan sulfate with an apparent Kd of 14.69 nM and 12.36 nM for Hs3st-1
and Hs3st-2 modified heparan sulfate, respectively. At saturation, a similar amount of
NRP1 bound to both types of 3-O-sulfated heparan sulfate. Thus, NRP1 binding was Fighighly dependent3 on 3-O-sulfation but does not seem to differentiate between 3-O- a b
c d
Figure 3-1. Binding of proteins to 3-O-sulfated heparan sulfate. NRP1 (A), AT (B), FGF2 (C) or RAGE (D) binding to immobilized heparan sulfate. The data was analyzed by curve fitting. The data shown is averaged from three independent experiments ± S.E.M.
gD ELISA gD competition AT competition protamine competition
NRP1 oligomerization with defned oligos 98 sulfation installed by either Hs3st-1 or Hs3st-2. This contrasts with AT, which binds exclusively to Hs3st-1-modified heparan sulfate (Fig 3-1B, apparent Kd = 2.40 nM) and FGF2, which bound similarly to all types of heparan sulfate (Fig 3-1C, apparent
Kd ~ 2.4 nM). The affinity of RAGE binding was slightly enhanced on Hs3st-1 and -2 modified heparan sulfates with an apparent Kd of 15.63 and 14.16 nM, respectively, compared to 28.23 nM on the non-3-O-sulfated heparan sulfate (Fig 3-1D).
The binding of NRP1 to cell surface heparan sulfate was studied using CHO cell lines that are stably transduced with HS3ST-1 and HS3ST-2. Various concentrations of NRP1 were incubated with the CHO cells and binding was detected by flow cytometry (Fig 3-2A). NRP1 bound to the surface of each cell type although differences in the binding affinity were detected. The apparent Kd of NRP1 binding to unmodified CHO cells was six-fold higher than HS3ST-2 transduced CHO cells (230 nM versus 36.6 nM, respectively). The affinity of NRP1 for HS3ST-1 transduced cells was intermediate (Kd = 125 nM). The maximum binding of NRP1 to each of these cells was similar, suggesting that the addition of 3-O-sulfation enhanced the affinity of
NRP1 for preexisting heparan sulfate binding sites but did not produce any new binding sites. The binding of NRP1 to each of the cell surfaces, including CHO without 3-O-sulfation, was dependent on heparan sulfate, as enzymatic or genetic reduction of cell surface heparan sulfate, significantly reduced binding (P < 0.05, Fig
3-2B). The binding of FGF2 to the cell surface was equal on each of the CHO cell lines and was also sensitive to removal of cell surface heparan sulfate (P < 0.05, Fig 3-
2C). AT bound robustly to the HS3ST-1 transduced CHO cells while unmodified CHO cells showed very little binding (P < 0.05, Fig 3-2D). The binding of AT to HS3ST-2 99 Fig 4
a NRP1 b NRP1
c FGF2 d AT
e f g NRP1 FGF2
Figure 3-2. Binding of neuropilin-1 to the cell surface. (A) Binding of NRP1 to CHO-K1 and Hs3st-transduced CHO cells. The apparent KD and Bmax were calculated by curve fitting the data and the values are shown in the inset table ± S.E.M (n=4) (B) Binding of 300 nM NRP1 to CHO cells after treatment with heparin lyase III or in CHO mutants lacking heparan sulfate (pgsD). (n=3; *P < 0.05) (C, D) Binding of ~1 nM FGF2 (C) or 100 nM AT (D) to CHO cell surface. FGF2 binding was also determined after treatment with heparin lyase III or in CHO mutants lacking heparan sulfate. Data is averaged from at least three independent experiments. (*P < 0.05) (E) HS3ST expression in HeLa by qRT- PCR. Representative data is shown ± S.E.M. from three independent experiments. (F, G) Binding of 300 nM NRP1 (F) or ~1 nM FGF2 (G) to HeLa cell surface. shRNA mediated knockdown was performed on heparan sulfate sulfotransferases (NDST1 and HS3ST3A1).
100 transduced CHO cells was slightly elevated above unmodified CHO cells, a trend similar to the binding of AT on the affinity matrices.
HeLa cells do not express HS3ST-2 but do express several other 3-O- sulfotransferases, including HS3ST-1, HS3ST-3A, HS3ST-3B and HS3ST-4 (Fig 3-2E).
To verify the 3-O-sulfate dependence of NRP1 binding to cell surface heparan sulfate, shRNAs were used to knock down HS3ST-3A expression. The knock down of HS3ST-
3A likely resulted in a partial loss of 3-O-sulfation due to the expression of other
HS3STs. As a control, the heparan sulfate glucosaminyl N-deacetylase-N- sulfotransferase, NDST-1, was similarly knocked down, which drastically reduces the overall sulfation of heparan sulfate. Reduction of N-sulfation completely prevented binding of NRP1 while a partial reduction of 3-O-sulfation decreased binding of
NRP1 by about half (Fig 3-2F). The binding of FGF2 was not affected by reduction of
HS3ST-3A while reduction of NDST-1 strongly reduced binding (Fig 3-2G).
3.3.2 3-O-sulfate in semaphorin-3a induced growth cone collapse
NRP1 is a coreceptor with plexinA for Sema3a and plays an important role in axonal targeting and growth cone collapse. Since binding of NRP1 is modulated by 3-
O-sulfation, I hypothesized that Sema3a-stimulated growth cone collapse would be influenced by heparan sulfate 3-O-sulfation. To test this hypothesis, a growth cone collapse assay was set up using dorsal root ganglion (DRG) explants from E13.5 mouse embryos. Upon stimulation with nerve growth factor, axons extended from the explant with growth cones present at the end of each axon (Fig 3-3A). Treatment of the explants with Sema3a induced collapse of the growth cone (Fig 3-3B). As 101 previously demonstrated, this process is dependent on NRP1 as a monoclonal blocking antibody against the Sema3a binding site on NRP1 was able to completely prevent collapse (p < 0.001, Fig 3-3C). An equal concentration of a polyclonal blocking antibody against NRP1 also inhibited collapse, although to a lesser extent (p < 0.001,
Fig 3-3C). Growth cone collapse was also partially dependent on cell surface heparan sulfate. Pre-treatment of the explants with heparin lyase III, which cleaves heparan sulfate from the cell surface, reduced the sensitivity of the growth cones to Sema3a (p
< 0.001, Fig 3-3D). The effect of heparan sulfate was also demonstrated by adding heparin to the culture medium before adding Sema3a. The addition of heparin caused a reduction of growth cone collapse under all concentrations of Sema3a tested (Fig 3-
3E). Thus, growth cone collapse induced by Sema3a and dependent on NRP1 is modulated by heparan sulfate.
To investigate the influence of 3-O-sulfation on growth cone collapse, the assay was performed in the presence of three types of soluble dodecasaccharides that vary only in the presence of 3-O-sulfate. These oligosaccharides were chemoenzymatically synthesized in a controlled manner to produce highly sulfated, homogeneous products (Xu et al., 2011). One oligosaccharide was devoid of 3-O- sulfate. The other oligosaccharides carry a single AT-type 3-O-sulfate or an AT-type and a gD-type 3-O-sulfate. The oligosaccharides with 3-O-sulfation were more potent inhibitors of growth cone collapse. Using 30 ng/ml of Sema3a, the EC50 of the oligosaccharide with zero, one or two 3-O-sulfates was 5.42, 1.91 and 0.61 µg/ml, respectively (P < 0.0001, Fig 3-3F). 102
Figure 3-3. Axonal growth cone collapse modulated by 3-O-sulfation. (A, B) Representative images of growth cones from E13.5 DRG explants before (A) and after (B) Sema3a-induced collapse. (C) NRP1 blocking antibodies (10 µg/ml) in growth cone collapse with Sema3a (30 ng/ml). Data shown is the average ± S.E.M. over three independent experiments. (***P < 0.001) (D) Heparin lyase III treatment of cell surface heparan sulfate in growth cone collapse with Sema3a (30 ng/ml). Data shown is average ± S.E.M. over three independent experiments. (***P < 0.001) (E) Addition of heparin (100 µg/ml) to growth cone collapse assay. Data shown is the average ± S.E.M. of three independent experiments. The effect of heparin was significant (P < 0.05) at each concentration of Sema-3a. (F) Addition of 3-O-sulfated oligosaccharides to the growth cone collapse assay. Three identical oligosaccharides containing zero, one or two 3-O-sulfates were preincubated with the explants prior to treatment with 30 ng/ml Sema3a. Data shown is the average ± S.E.M. of the experiment performed in triplicate. The data was fit with a non-linear curve to calculate EC50 values (shown in inset with 95 percent confidence intervals). The EC50 values were statistically different (P < 0.0001). (G) Hs3st expression in E13.5 DRG by qRT-PCR. (*P < 0.05, **P < 0.01) DRG were dissected from six embryos of each genotype and analyzed by qPCR independently. Data shown is the average ± S.E.M. (H) Growth cone collapse assay in DRG from Hs3st-2+/+ (n = 9), Hs3st-2+/- (n = 11) and Hs3st-2-/- (n = 10) embryos. Effect of genotype was statistically significant by 2-way ANOVA (P < 0.0083) and post-hoc tests. (*P < 0.05) (I) Growth cone collapse assay in DRG from Hs3st-2+/- (n = 8) and Hs3st-2-/- (n = 9) embryos. Effect of genotype was statistically significant by 2-way ANOVA (P < 0.0006) and post-hoc test. (*P < 0.05).
103 Fig 5
a b c d
e f
g h
i
104
The effect of 3-O-sulfation was also investigated using a mouse deficient in
Hs3st-2 (Hasegawa and Wang, 2008). Previous work has shown that NRP1 and Hs3st-
2 are expressed in mammalian E14.5 DRG (Hasegawa and Wang, 2008; Kolodkin et al., 1997). To determine if any other 3-O-sulfotransferases were expressed, qPCR was performed on cDNA that was prepared from wild type DRG explants. Expression of
Hs3st-1, Hs3st-2 and Hs3st-5 was detected (Fig 3-3F). To test if genetic removal of 3-
O-sulfation affected NRP1 dependent growth cone collapse, Hs3st-2 mutant embryos were created by timed breedings of Hs3st-2+/- mice. These litters produced Hs3st-2 heterozygous and homozygous null embryos along with wild type littermates. The three genotypes were indistinguishable during gross dissection. Quantification of 3-O- sulfotransferase expression by qPCR confirmed the loss of Hs3st-2 expression in DRG from the heterozygous and homozygous null mouse (Fig 3-3F). Furthermore, no compensating increase in the expression of other 3-O-sulfotransferases was detected.
To perform the growth cone collapse assay, the DRG were collected from each embryo in the litter and cultured in independent wells. Growth cone collapse was induced using various concentrations of Sema3a. Genotyping was performed after the growth cone collapse assay so the investigator was blind to the genotypes of the embryos. The number of embryos of each genotype was roughly equal (+/+ = 9, +/- =
11, -/- = 10) and each litter contained all three genotypes. The partial loss of 3-O- sulfation via disruption of Hs3st-2 resulted in a partial reduction of growth cone collapse at nearly all concentrations examined. This change was statistically significant by 2-way ANOVA (p < 0.0083) and post hoc tests for 10 ng/ml and 50 ng/ml of Sema3a (p < 0.05, Fig 3-3G). At 10 ng/ml, the loss of Hs3st-2 decreased
105 collapse by 62 percent to nearly background levels. At 50 ng/ml, the loss of Hs3st-2 decreased collapse by 22 percent. The same experiment was performed by mating
Hs3st-2-/- with Hs3st-2+/- mice, which produced heterozygous and homozygous null embryos. The extent of collapse of Hs3st-2-/- explants compared to Hs3st-2+/- explants was reduced at all concentrations of Sema3a tested (Fig 3-3H). This effect of was statistically significant at 30 ng/ml Sema3a (p < 0.05) and overall by 2-way ANOVA
(p = 0.0006).
3.4 Discussion
NRP1 is a heparan sulfate binding protein with known function in axonal guidance in conjunction with semaphorins and plexins (He and Tessier-Lavigne, 1997;
Kolodkin et al., 1997; Mamluk et al., 2002). NRP1 was identified as a candidate 3-O- sulfate dependent ligand by fractionating serum over heparan sulfate affinity matrices
(Chapter 2). I have confirmed the dependence of NRP1 on 3-O-sulfation for high affinity binding to heparan sulfate using an ELISA with immobilized heparan sulfate and a cell surface binding assay. Furthermore, I have shown that an NRP1-dependent process, Sema3a-induced growth cone collapse, is modulated by 3-O-sulfation. These results validate my findings using the affinity matrices containing 3-O-sulfated heparan sulfate (Chapter 2) and suggest that 3-O-sulfation may play a role in axonal targeting during development.
Using immobilized heparan sulfate in an ELISA format, NRP1 binding to heparan sulfate depended almost entirely on 3-O-sulfation. Notably, NRP1 bound equally to heparan sulfate produced by Hs3st-1 and -2 even though these two 3-O-
106 sulfotransferases create distinct 3-O-sulfated motifs. Hs3st-1 installs a 3-O-sulfate adjacent to an uronic acid devoid of 2-O-sulfate (Liu et al., 1996) and Hs3st-2 preferentially installs a 3-O-sulfate adjacent to a 2-O-sulfated iduronic acid (Liu et al.,
1999). Higher order information about the substrates for these 3-O-sulfotransferases is currently unavailable. Mass spectrometry of the heparan sulfate used in this assay confirmed the difference of 3-O-sulfated motifs. Two possibilities can explain the behavior of NRP1 in this assay. (1) NRP1 may bind promiscuously to many heparan sulfate sequences containing a 3-O-sulfate group. (2) Hs3st-1 and -2 produce a similar
3-O-sulfated motif and NRP1 tolerates the difference of 2-O-sulfation on the uronic acid adjacent to the 3-O-sulfated glucosamine.
The requirement of 3-O-sulfation for high affinity binding to heparan sulfate was verified using a cell surface-binding assay. Unlike the ELISA assay, NRP1 bound to CHO cells in the absence of 3-O-sulfation, binding that was dependent on heparan sulfate. The affinity of NRP1, but not the Bmax, increased when the cells were transduced with either Hs3st-1 or -2. This finding suggests that the number of binding sites did not change but that the affinity of existing binding sites increased with the addition of 3-O-sulfation. Heparan sulfate may be cooperating with a cell surface receptor in a way that increases the apparent affinity of NRP1 for the cell surface when 3-O-sulfation is present. Indeed, NRP1 interacts with other cell surface proteins, including plexinA and VEGFR1 (Fuh et al., 2000; Janssen et al., 2012). NRP1 binding to HeLa cells was also modulated by 3-O-sulfation. HeLa express several Hs3sts including Hs3st-3a. Like Hs3st-2, Hs3st-3a installs 3-O-sulfation on a glucosamine adjacent to a 2-O-sulfated iduronic acid. Presumably, knockdown of Hs3st-3a only
107 partially reduces the 3-O-sulfation of cell surface heparan sulfate. An interesting possibility is that some of the other Hs3sts produce 3-O-sulfation that does not contribute to NRP1 binding. Such a result would demonstrate distinct roles for Hs3sts coexpressed in the same cell type, a finding that has been shown previously in cells of the Kupffer’s vesicle in zebrafish (Neugebauer et al., 2013).
During development, axonal targeting is achieved by the interaction of various chemotactic proteins with membrane bound receptors on the axonal growth cone.
NRP1 serves as a coreceptor with plexinA for Sema3a. Cells in the mammalian embryonic DRG express NRP1 (Kolodkin et al., 1997), Hs3st-1, -2 and -5. Growth cones on these neurons collapse in the presence of Sema3a (He and Tessier-Lavigne,
1997). NRP1-dependent growth cone collapse in these explants was reduced after the removal of cell surface heparan sulfate and after addition of soluble heparin.
Interestingly, a published report shows that Sema3a-induced growth cone collapse in
E15 DRG explants was enhanced by the addition of the same concentration of heparin
(De Wit et al., 2005). The reason for the discrepancy is unknown.
Soluble oligosaccharides and genetic experiments confirmed the role of 3-O- sulfation in NRP1-dependent growth cone collapse. 3-O-sulfated oligosaccharides were more potent inhibitors of growth cone collapse. Explants derived from Hs3st-2-/- embryos lack one of the three expressed 3-O-sulfotransferases and are likely partially deficient in 3-O-sulfation. This partial reduction in 3-O-sulfation resulted in a partial loss of sensitivity to Sema3a. Since NRP1 binds to heparan sulfate modified by Hs3st-
1, this isoform likely also contributes to Sema3a-induced growth cone collapse.
Further experiments are needed using explants derived from Hs3st-1-/- embryos to
108 confirm this hypothesis (HajMohammadi et al., 2003). Furthermore, DRG explants from Hs3st-1-/-/Hs3st-2-/- double null embryos might have more drastically reduced response to Sema3a. Another approach to investigate the role of 3-O-sulfation in
NRP1 dependent growth cone collapse involves the introduction of soluble heparan sulfate oligosaccharides with and without 3-O-sulfation. Structurally defined oligosaccharides that differ only in 3-O-sulfation are available for use in this assay and may confirm that 3-O-sulfation on soluble heparan sulfate can modulate collapse (Xu et al., 2011).
The NRP1 signaling complex has been proposed to contain
NRP1/plexinA/Sema3a in a 2:2:2 ratio based on a crystal structure of the ternary complex. Since NRP1 is a heparan sulfate binding protein and NRP1-dependent growth cone collapse is influenced by heparan sulfate, it now seems reasonable to propose that 3-O-sulfated heparan sulfate is a fourth component that is also part of the complete signaling complex. The idea that heparan sulfate can facilitate complex formation is well established in systems such as FGF2/FGFR, where heparan sulfate binds to both FGF2 and FGFR (Schlessinger et al., 2000). Whether heparan sulfate also binds to Sema3a or plexinA to facilitate complex formation has not yet been determined.
In situ hybridization in the zebrafish brain shows distinct expression patterns for each of the Hs3sts (Cadwallader and Yost, 2006). Presumably similar patterns exist amongst different cell types and regions of the mammalian brain, although such detailed information is not currently available. It is also clear that the expression of the
Hs3sts varies during development (Hasegawa and Wang, 2008). We are beginning to
109 understand that the various Hs3sts install 3-O-sulfate at different positions in the heparan sulfate chain. Therefore, the spatially and temporally controlled expression of various 3-O-sulfotransferases in the brain provides rich glycan diversity in a position to influence neuronal patterning. I have demonstrated that NRP1 is influenced by 3-O- sulfation of heparan sulfate. It is interesting to speculate that heparan sulfate 3-O- sulfation may provide a sort of glycan sulfate code that contributes to axonal targeting in the developing nervous system via its interaction with NRP1 and possibly other axonal guidance proteins.
3.5 Methods
3.5.1 Reagents
Cell culture medium, N2 supplement, laminin and cell dissociation buffer were from Gibco. Poly-L-ornithine was from Sigma. The 1-step Turbo TMB-ELISA reagent was from Pierce. Recombinant human his-NRP1(b1b2) was kindly provided by Craig Vander Kooi (University of Kentucky). Purified AT was from Aniara and recombinant human FGF2 was from Shenandoah Biotechnology. The use of biotinylated-FGF2 has been described previously (Garner et al., 2008). For flow cytometry, the anti-his mAb was from Genscript, the anti-ATIII pAb was from R&D
Systems, the goat-anti-mouse AlexaFluor488 was from Molecular Probes, the donkey- anti-goat DyLight488 was from Jackson Immunoresearch Labs and the streptavidin-
PE was from eBioscience. For growth cone collapse assays, the blocking antibodies pAb-NRP1 and mAb-NRP1A were from R&D Systems or kindly provided by
Genentech (Pan et al., 2007), respectively. Nerve growth factor 2.5S was from
110
Invitrogen. Phalloidin-Alexa Fluor 488 was from Molecular Probes. TRIzol and
SuperScript III First Strand Synthesis kit were from Invitrogen and Power Sybr Green
PCR Master Mix was from Applied Biosystems. Chemoenzymatically synthesized oligosaccharides containing variable 3-O-sulfation were obtained from Jian Liu
(University of North Carolina).
3.5.2 Cell lines
CHO-K1 and CHO3.1 cell lines have been described previously (Zhang et al.,
2001). CHO cells were cultured in F12 medium with 10 percent FBS and 1 percent pen/strep. HeLa cells were from ATCC and were cultured in DMEM with 10 percent
FBS and 1 percent pen/strep. The knock-down HeLa cells were created by infection with lentivirus expressing shRNAs against HS3ST3A, NDST1 or the empty lentiviral expression vector (pSicoR-mCh) as described previously (Bassik et al., 2009). Stably transduced cells were selected with 2 µg/ml puromycin. The target sequences for the shRNAs were as follows: (5’ to 3’) HS3ST3A(315)-
TATACCCAGTCATAAAGTATAA, HS3ST3A(4721)-
AAGAGACAGTTTAATATTTGTGTT and NDST1(232)-
TCTCGGCCTACTACCTATATG.
3.5.3 Heparin binding plate ELISA
Heparan sulfate (400 ng) was immobilized overnight in each well of a heparin binding plate (BD Biosciences). The wells were blocked with PBST plus 1 percent
BSA for 1 hour at 37°C. Various concentrations of the protein ligand (50 µl) were
111 incubated in the wells for 1 hour at room temperature. The primary and HRP- conjugated secondary antibodies were incubated at room temperature for 1 hour or 30 minutes, respectively. Streptavidin-HRP (30 minutes) was used in conjunction with biotinylated-FGF2. HRP was detected using 1-step Turbo TMB-ELISA reagent followed by quenching with 1 N H2SO4 and quantification by A450. The amount of nonspecific binding to bare wells was subtracted at each concentration of ligand. A nonlinear regression was used to fit curves to the binding data and calculate an apparent kD and Bmax.
3.5.4 Flow cytometry
CHO cells were lifted using cell dissociation buffer and were incubated in suspension for 1 hour at 4°C with various concentrations of NRP1, 100 nM AT or ~1 nM biotinylated-FGF2. In some cases, cells were preincubated with 5 mU/ml heparin lyase III at 37°C for 20 minutes to remove cell surface heparan sulfate. Cell surface bound NRP1 was detected using 1 µg/ml THE His Tag mAb and 2.5 µg/ml goat-anti- mouse AlexaFluor488. Cells incubated with AT were subsequently incubated with 2
µg/ml anti-AT followed by 2.5 µg/ml donkey-anti-goat DyLight488. Cells incubated with biotinylated-FGF2 were subsequently incubated with 1:1000 streptavidin-PE.
HeLa with and without shRNA knockdown of HS3ST3A1 were similarly tested for cell surface binding of 30 nM NRP1 and ~1 nM biotinylated-FGF2. Flow cytometry was performed on a FACSCalibur (BD Biosciences) instrument and data was analyzed using FloJo (version 9.5.3). For binding of NRP1, a nonlinear regression was used to fit a curve to the binding data and calculate the apparent Kd and Bmax.
112
3.5.5 Mouse models
C57BL/6J mice were from The Jackson Laboratory. Hs3st2-hPLAP mice were provided by F. Wang (Hasegawa and Wang, 2008). These mice were backcrossed at least 5 generations to C57BL/6J and were genotyped as described previously
(Hasegawa and Wang, 2008). Mice were weaned at 3 weeks of age, maintained on a
12-hour light/12-hour dark cycle and fed water and standard rodent chow (Harlan
Tekland) ad libitum. All animals were housed in Association for Assessment and
Accreditation of Laboratory Animal Care-approved vivaria in the School of Medicine,
UCSD, following standards and procedures approved by the local Institutional Animal
Care and Use Committee (La Jolla, California, USA).
3.5.6 Growth cone collapse assay
Growth cone collapse in response to Sema3a was determined as previously described (Kapfhammer et al., 2007). Briefly, timed pregnancies were generated and embryos were harvested at E13.5. DRG explants were cultured overnight in
DMEM/F12 with N2 supplement and 20 ng/ml nerve growth factor 2.5S on poly-L- ornithine and laminin coated 48-well plates. Explants were treated with recombinant human Sema3a-Fc for 30 minutes at 37°C and then fixed with 4 % PFA/10 % sucrose in PBS. The explants were stained with Alexa Fluor 488-phalloidin and visualized on a DeltaVision Deconvolution microscope in the UCSD School of Medicine Light
Microscopy Facility. Growth cone collapse was quantified as a percentage of total growth cones. In some experiments, the explants were pretreated with 10 µg/ml pAb-
NRP1, 10 µg/ml mAb-NRP1A or 5 mU/ml heparin lyase III for 15 minutes before the
113 addition of Sema3a-Fc. In other experiments, 100 µg/ml heparin or various concentrations of dodecasaccharides were preincubated with the explants for 15 minutes before the addition of Sema3a-Fc. To create Hs3st2 mutant embryos, Hs3st-
2+/- mice were mated with Hs3st-2+/- or Hs3st-2-/- mice. DRG explants were dissected from each embryo individually and treated with various concentrations of Sema3a-Fc.
The extent of growth cone collapse was determined before genotyping the embryos so the observer was blind to the embryo genotype.
3.5.7 Quantitative PCR
DRG explants were dissected from Hs3st2+/+, Hs3st-2+/- and Hs3st-2-/- embryos at E13.5. mRNA was extracted from the explants using TRIzol and chloroform and then precipitated with isopropanol overnight at -20°C. cDNA was prepared from the mRNA using SuperScript III First-Stand Synthesis kit using random primers following the manufacturer’s instructions. qPCR was performed using Power
Sybr Green Master Mix following the manufacturer’s instructions. The expression of
TBP was used to normalize the expression of Hs3sts between samples. The primers used for qPCR were as follows: TBP fwr 5’-GAAGCTGCGGTACAATTCCAG-3’, rev 5’-CCCCTTGTACCCTTCACCAAT-3’; Hs3st-1 fwr 5’-
GAGAAGACACCCGCCTATTT-3’, rev 5’-TGATGGGTCCCTCAGGATAA-3’;
Hs3st-2 fwr 5’-TCATTGTGGGCGTCAAGAAAGG-3’, rev 5’-
TGACGAAATAGCTGGGCGTCTT-3’; Hs3st-3a fwr 5’-
GAGCACCAGTACTCCACTAAAC-3’, rev 5’-
GAAGGCCAAGTCTCAGTTCTATC-3’; Hs3st-3b fwr 5’-
114
GTAGGTCTGTGCTCGTTTACTC-3’, rev 5’- GAACATCTCTCCACCACTCAAT-
3’; Hs3st-4 fwr 5’- AAGGAAGGAAGGAAGGTGTATTT-3’, rev 5’-
AGATGCCAGAGCAGAAGTTTAT-3’; Hs3st-5 fwr 5’-
TTCAAACAGCAGGTGTGGCT-3’, rev 5’-TTCCGGAACTCATGCAGCAA-3’;
Hs3st-6 fwr 5’-TCCTGTTTGTAAGCGGTGAG-3’, rev 5’-
CCGTTTGAGACCCAGAAAGT-3’. These primers were validated against cDNA from multiple mouse tissues by testing for singular dissociation peaks and single sized reaction products.
3.5.8 Statistics
Data analysis was performed using Prism (GraphPad, version 5.0d). Nonlinear regressions were used to fit curves and calculate apparent Kd and Bmax values. t-tests and ANOVA with post hoc tests were used for growth cone collapse assays. P values less than 0.05 were considered significant.
3.6 Acknowledgments
This chapter will be submitted for publication in conjunction with Chapter 2 and 4. The dissertation author was the primary author of this work with Emylie
Seamen, Roger Lawrence, Jian Liu and Jeffrey Esko as coauthors. I am grateful for the assistance of Craig Vander Kooi who provided recombinant NRP1. This work was supported by grants GM93131 and HL107150 (to J.D.E.), by training grant
T32CA067754 (to B.E.T.) and by F32CA156987 (to E.S) from the National Institutes of Health.
115
3.7 Literature cited
Bassik, M.C., R.J. Lebbink, L.S. Churchman, N.T. Ingolia, W. Patena, E.M. LeProust, M. Schuldiner, J.S. Weissman, and M.T. McManus. 2009. Rapid creation and quantitative monitoring of high coverage shRNA libraries. Nat Methods. 6:443-445.
Bennett, K.L., J. Bradshaw, T. Youngman, J. Rodgers, B. Greenfield, A. Aruffo, and P.S. Linsley. 1997. Deleted in colorectal carcinoma (DCC) binds heparin via its fifth fibronectin type III domain. The Journal of biological chemistry. 272:26940-26946.
Brose, K., K.S. Bland, K.H. Wang, D. Arnott, W. Henzel, C.S. Goodman, M. Tessier- Lavigne, and T. Kidd. 1999. Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell. 96:795-806.
Cadwallader, A.B., and H.J. Yost. 2006. Combinatorial expression patterns of heparan sulfate sulfotransferases in zebrafish: I. The 3-O-sulfotransferase family. Dev Dyn. 235:3423-3431.
Chen, H., A. Bagri, J.A. Zupicich, Y. Zou, E. Stoeckli, S.J. Pleasure, D.H. Lowenstein, W.C. Skarnes, A. Chedotal, and M. Tessier-Lavigne. 2000. Neuropilin-2 regulates the development of selective cranial and sensory nerves and hippocampal mossy fiber projections. Neuron. 25:43-56.
De Wit, J., F. De Winter, J. Klooster, and J. Verhaagen. 2005. Semaphorin 3A displays a punctate distribution on the surface of neuronal cells and interacts with proteoglycans in the extracellular matrix. Molecular and cellular neurosciences. 29:40-55. de Wit, J., and J. Verhaagen. 2007. Proteoglycans as modulators of axon guidance cue function. Adv Exp Med Biol. 600:73-89.
Fazeli, A., S.L. Dickinson, M.L. Hermiston, R.V. Tighe, R.G. Steen, C.G. Small, E.T. Stoeckli, K. Keino-Masu, M. Masu, H. Rayburn, J. Simons, R.T. Bronson, J.I. Gordon, M. Tessier-Lavigne, and R.A. Weinberg. 1997. Phenotype of mice lacking functional Deleted in colorectal cancer (Dcc) gene. Nature. 386:796-804.
Fuh, G., K.C. Garcia, and A.M. de Vos. 2000. The interaction of neuropilin-1 with vascular endothelial growth factor and its receptor flt-1. J Biol Chem. 275:26690- 26695.
Garner, O.B., Y. Yamaguchi, J.D. Esko, and V. Videm. 2008. Small changes in lymphocyte development and activation in mice through tissue-specific alteration of heparan sulphate. Immunology. 125:420-429.
Giger, R.J., J.F. Cloutier, A. Sahay, R.K. Prinjha, D.V. Levengood, S.E. Moore, S. Pickering, D. Simmons, S. Rastan, F.S. Walsh, A.L. Kolodkin, D.D. Ginty, and M.
116
Geppert. 2000. Neuropilin-2 is required in vivo for selective axon guidance responses to secreted semaphorins. Neuron. 25:29-41.
Gu, C., E.R. Rodriguez, D.V. Reimert, T. Shu, B. Fritzsch, L.J. Richards, A.L. Kolodkin, and D.D. Ginty. 2003. Neuropilin-1 conveys semaphorin and VEGF signaling during neural and cardiovascular development. Dev Cell. 5:45-57.
HajMohammadi, S., K. Enjyoji, M. Princivalle, P. Christi, M. Lech, D. Beeler, H. Rayburn, J.J. Schwartz, S. Barzegar, A.I. De Agostini, M.J. Post, R.D. Rosenberg, and N.W. Shworak. 2003. Normal levels of anticoagulant heparan sulfate are not essential for normal hemostasis. J Clin Invest. 111:989-999.
Hasegawa, H., and F. Wang. 2008. Visualizing mechanosensory endings of TrkC- expressing neurons in HS3ST-2-hPLAP mice. J Comp Neurol. 511:543-556.
He, Z., and M. Tessier-Lavigne. 1997. Neuropilin is a receptor for the axonal chemorepellent Semaphorin III. Cell. 90:739-751.
Henkemeyer, M., D. Orioli, J.T. Henderson, T.M. Saxton, J. Roder, T. Pawson, and R. Klein. 1996. Nuk controls pathfinding of commissural axons in the mammalian central nervous system. Cell. 86:35-46.
Hu, H. 2001. Cell-surface heparan sulfate is involved in the repulsive guidance activities of Slit2 protein. Nature neuroscience. 4:695-701.
Hussain, S.A., M. Piper, N. Fukuhara, L. Strochlic, G. Cho, J.A. Howitt, Y. Ahmed, A.K. Powell, J.E. Turnbull, C.E. Holt, and E. Hohenester. 2006. A molecular mechanism for the heparan sulfate dependence of slit-robo signaling. J Biol Chem. 281:39693-39698.
Inatani, M., F. Irie, A.S. Plump, M. Tessier-Lavigne, and Y. Yamaguchi. 2003. Mammalian brain morphogenesis and midline axon guidance require heparan sulfate. Science. 302:1044-1046.
Irie, F., M. Okuno, K. Matsumoto, E.B. Pasquale, and Y. Yamaguchi. 2008. Heparan sulfate regulates ephrin-A3/EphA receptor signaling. Proceedings of the National Academy of Sciences of the United States of America. 105:12307-12312.
Janssen, B.J., T. Malinauskas, G.A. Weir, M.Z. Cader, C. Siebold, and E.Y. Jones. 2012. Neuropilins lock secreted semaphorins onto plexins in a ternary signaling complex. Nature structural & molecular biology. 19:1293-1299.
Julien, F., A. Bechara, R. Fiore, H. Nawabi, H. Zhou, C. Hoyo-Becerra, M. Bozon, G. Rougon, M. Grumet, A.W. Puschel, J.R. Sanes, and V. Castellani. 2005. Dual functional activity of semaphorin 3B is required for positioning the anterior commissure. Neuron. 48:63-75.
117
Kantor, D.B., O. Chivatakarn, K.L. Peer, S.F. Oster, M. Inatani, M.J. Hansen, J.G. Flanagan, Y. Yamaguchi, D.W. Sretavan, R.J. Giger, and A.L. Kolodkin. 2004. Semaphorin 5A is a bifunctional axon guidance cue regulated by heparan and chondroitin sulfate proteoglycans. Neuron. 44:961-975.
Kapfhammer, J.P., H. Xu, and J.A. Raper. 2007. The detection and quantification of growth cone collapsing activities. Nature protocols. 2:2005-2011.
Kitsukawa, T., M. Shimizu, M. Sanbo, T. Hirata, M. Taniguchi, Y. Bekku, T. Yagi, and H. Fujisawa. 1997. Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice. Neuron. 19:995-1005.
Kolodkin, A.L., D.V. Levengood, E.G. Rowe, Y.T. Tai, R.J. Giger, and D.D. Ginty. 1997. Neuropilin is a semaphorin III receptor. Cell. 90:753-762.
Kolodkin, A.L., and M. Tessier-Lavigne. 2011. Mechanisms and molecules of neuronal wiring: a primer. Cold Spring Harbor perspectives in biology. 3.
Liu, J., N.W. Shworak, L.M. Fritze, J.M. Edelberg, and R.D. Rosenberg. 1996. Purification of heparan sulfate D-glucosaminyl 3-O-sulfotransferase. The Journal of biological chemistry. 271:27072-27082.
Liu, J., N.W. Shworak, P. Sinay, J.J. Schwartz, L. Zhang, L.M. Fritze, and R.D. Rosenberg. 1999. Expression of heparan sulfate D-glucosaminyl 3-O-sulfotransferase isoforms reveals novel substrate specificities. J Biol Chem. 274:5185-5192.
Mamluk, R., Z. Gechtman, M.E. Kutcher, N. Gasiunas, J. Gallagher, and M. Klagsbrun. 2002. Neuropilin-1 binds vascular endothelial growth factor 165, placenta growth factor-2, and heparin via its b1b2 domain. J Biol Chem. 277:24818-24825.
Matsumoto, Y., F. Irie, M. Inatani, M. Tessier-Lavigne, and Y. Yamaguchi. 2007. Netrin-1/DCC signaling in commissural axon guidance requires cell-autonomous expression of heparan sulfate. The Journal of neuroscience : the official journal of the Society for Neuroscience. 27:4342-4350.
Neugebauer, J.M., A.B. Cadwallader, J.D. Amack, B.W. Bisgrove, and H.J. Yost. 2013. Differential roles for 3-OSTs in the regulation of cilia length and motility. Development. 140:3892-3902.
Orioli, D., M. Henkemeyer, G. Lemke, R. Klein, and T. Pawson. 1996. Sek4 and Nuk receptors cooperate in guidance of commissural axons and in palate formation. The EMBO journal. 15:6035-6049.
Pan, Q., Y. Chanthery, W.C. Liang, S. Stawicki, J. Mak, N. Rathore, R.K. Tong, J. Kowalski, S.F. Yee, G. Pacheco, S. Ross, Z. Cheng, J. Le Couter, G. Plowman, F. Peale, A.W. Koch, Y. Wu, A. Bagri, M. Tessier-Lavigne, and R.J. Watts. 2007.
118
Blocking neuropilin-1 function has an additive effect with anti-VEGF to inhibit tumor growth. Cancer cell. 11:53-67.
Pellet-Many, C., P. Frankel, H. Jia, and I. Zachary. 2008. Neuropilins: structure, function and role in disease. Biochem J. 411:211-226.
Plump, A.S., L. Erskine, C. Sabatier, K. Brose, C.J. Epstein, C.S. Goodman, C.A. Mason, and M. Tessier-Lavigne. 2002. Slit1 and Slit2 cooperate to prevent premature midline crossing of retinal axons in the mouse visual system. Neuron. 33:219-232.
Sahay, A., M.E. Molliver, D.D. Ginty, and A.L. Kolodkin. 2003. Semaphorin 3F is critical for development of limbic system circuitry and is required in neurons for selective CNS axon guidance events. The Journal of neuroscience : the official journal of the Society for Neuroscience. 23:6671-6680.
Schlessinger, J., A.N. Plotnikov, O.A. Ibrahimi, A.V. Eliseenkova, B.K. Yeh, A. Yayon, R.J. Linhardt, and M. Mohammadi. 2000. Crystal structure of a ternary FGF- FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Molecular cell. 6:743-750.
Serafini, T., S.A. Colamarino, E.D. Leonardo, H. Wang, R. Beddington, W.C. Skarnes, and M. Tessier-Lavigne. 1996. Netrin-1 is required for commissural axon guidance in the developing vertebrate nervous system. Cell. 87:1001-1014.
Serafini, T., T.E. Kennedy, M.J. Galko, C. Mirzayan, T.M. Jessell, and M. Tessier- Lavigne. 1994. The netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans UNC-6. Cell. 78:409-424.
Vander Kooi, C.W., M.A. Jusino, B. Perman, D.B. Neau, H.D. Bellamy, and D.J. Leahy. 2007. Structural basis for ligand and heparin binding to neuropilin B domains. Proceedings of the National Academy of Sciences of the United States of America. 104:6152-6157.
Vitriol, E.A., and J.Q. Zheng. 2012. Growth cone travel in space and time: the cellular ensemble of cytoskeleton, adhesion, and membrane. Neuron. 73:1068-1081.
Wang, K.H., K. Brose, D. Arnott, T. Kidd, C.S. Goodman, W. Henzel, and M. Tessier-Lavigne. 1999. Biochemical purification of a mammalian slit protein as a positive regulator of sensory axon elongation and branching. Cell. 96:771-784.
Xu, Y., S. Masuko, M. Takieddin, H. Xu, R. Liu, J. Jing, S.A. Mousa, R.J. Linhardt, and J. Liu. 2011. Chemoenzymatic synthesis of homogeneous ultralow molecular weight heparins. Science. 334:498-501.
Yaron, A., P.H. Huang, H.J. Cheng, and M. Tessier-Lavigne. 2005. Differential requirement for Plexin-A3 and -A4 in mediating responses of sensory and sympathetic neurons to distinct class 3 Semaphorins. Neuron. 45:513-523.
119
Zhang, L., R. Lawrence, J.J. Schwartz, X. Bai, G. Wei, J.D. Esko, and R.D. Rosenberg. 2001. The effect of precursor structures on the action of glucosaminyl 3- O-sulfotransferase-1 and the biosynthesis of anticoagulant heparan sulfate. The Journal of biological chemistry. 276:28806-28813.
Chapter 4
Conclusions and Future Directions
4.1 Summary
The function of 3-O-sulfation is poorly understood, partly because the proteins that bind to this modification are largely unknown. A method was established to identify proteins that bind to 3-O-sulfated heparan sulfate, which led to the identification of several such proteins in serum. Discovery of these ligands suggests that 3-O-sulfation may regulate many physiological processes by providing high affinity binding sites for several heparan sulfate binding proteins. In particular, 3-O- sulfation enhanced the binding of neuropilin-1 (NRP1) to heparan sulfate and modulated neuronal growth cone collapse. Further work is needed to improve upon the affinity fractionation efforts and to characterize the role of 3-O-sulfation in NRP1- driven biology. This work serves as a springboard for discovery and characterization of other ligands whose biological properties might be enhanced by 3-O-sulfation.
4.2 Protein fractionation on 3-O-sulfated affinity matrices
Based on the presence of a large family of 3-O-sulfotransferases, I hypothesized that there are unidentified proteins that rely on 3-O-sulfation of heparan sulfate for binding and activity. With the objective of developing a general method to identify 3-O-sulfate dependent ligands, affinity matrices were prepared containing heparan sulfate modified by the 3-O-sulfotransferases Hs3st-1 and -2 (Fig. 2-1A).
These affinity matrices were validated by structural analysis of the modified heparan
120 121 sulfate (Fig. 2-1E) and by the binding of control ligands to the resins (Fig. 2-1I).
Fractionation of serum on the matrices revealed twelve potential 3-O-sulfate dependent proteins (Table 2-1). These proteins are involved in diverse physiological processes including angiogenesis (NRP1 (Pan et al., 2007)), neuronal patterning
(NRP1 (Gu et al., 2003) and amyloid beta (Billnitzer et al., 2013; Tyan et al., 2012)), coagulation (coagulation factor V (Nesheim et al., 1979), XIII (Ariens et al., 2002) and HABP2 (Romisch et al., 1999a; Romisch et al., 1999b)) and progression of
Alzheimer’s disease (amyloid beta (Masters et al., 1985) and clusterin (Narayan et al.,
2012)). Furthermore, these findings indicate that there are likely many other 3-O- sulfate dependent proteins that can be discovered using this methodology.
Historically, the Hs3sts have been subcategorized as AT-type or gD-type based on the homology of their sulfotransferase domains (Lawrence et al., 2007) and their ability to create the antithrombin binding site or the HSV1 glycoprotein D (gD) binding site (Liu and Pedersen, 2007). AT- and gD-type Hs3sts also differ in their substrate specificities (Liu et al., 1999). Unlike antithrombin, none of the candidate proteins identified in serum distinguished between the AT-type heparan sulfate created by Hs3st-1 and the gD-type heparan sulfate created by Hs3st-2 (Table 2-1). Instead they bound similarly to both types of 3-O-sulfated heparan sulfate. Assays of NRP1 binding to immobilized in vitro modified heparan sulfate (Fig. 3-1) and cell surface heparan sulfate on HS3ST transduced CHO cells confirmed this finding (Fig. 3-2). The indifference of these proteins for the type of 3-O-sulfation is curious given the large number of Hs3sts and their differing substrate specificities. Conceivably, Hs3st-1 and
Hs3st-2 might produce similar 3-O-sulfated sequences in addition to the classic AT-
122 type and gD-type binding sites. Alternatively, the carbohydrate recognition domain in
NRP1 may be somewhat promiscuous with respect to the sulfated sugar residues that flank the 3-O-sulfated glucosamine unit. The discovery of more proteins that rely on
3-O-sulfation may reveal proteins that prefer 3-O-sulfation created by a particular
Hs3st. Indeed, genetic studies in the Zebrafish have demonstrated that various gD-type
Hs3sts expressed in the same cell type are not interchangeable (Neugebauer et al.,
2013).
4.3 Future directions for affinity fractionation
Affinity matrices containing heparan sulfate modified by Hs3st-1 and -2 were produced and recent efforts have yielded an affinity matrix containing Hs3st-3a modified heparan sulfate. Having resins with heparan sulfate modified by each of the
Hs3sts will allow discrimination of proteins that distinguish between 3-O-sulfation created by the different Hs3sts, especially the multiple gD-type Hs3sts. To achieve this goal, methods to efficiently produce milligram quantities of Hs3st-4, -5 and -6 are needed. Additionally, selection of CHO-S cells for increased secretion of heparan sulfate would facilitate affinity matrix production.
The limiting factor for the production of affinity matrices is the low efficiency of coupling heparan sulfate to the resins. A number of different resins were tested for their ability to immobilize heparan sulfate, but non-specific binding of serum proteins to many of these resins was unsatisfactory. Of the resins with low background binding, cyanogen bromide activated (CNBr)-Sepharose proved the most effective for immobilization (Fig. 2-1F). Still, only ~15 percent of CHO heparan sulfate could be
123 immobilized using this chemistry. CNBr-Sepharose binds to heparan sulfate via primary amines. In heparan sulfate, these groups are present on N-unsubstituted glucosamines, which comprise ~1 percent of CHO heparan sulfate disaccharides
(Lawrence et al., 2007) and potentially in peptide stubs covalently attached to the reducing end of the chain. Because beta elimination of the chains did not affect the extent of coupling, immobilization via the amine groups of unsubstituted glucosamine residues may be the dominant mechanism. Indirectly, this would argue that ≤15 percent of the chains contain N-unsubstituted glucosamine units. The paucity of free amines explains why a large amount of heparan sulfate was refractory to immobilization using CNBr-Sepharose. Increasing the number of free amines in the heparan sulfate chain, e.g. by partial hydrazinolysis (Shaklee and Conrad, 1984), would likely improve the efficiency of immobilization. However, this would alter the structure of the chains in ways that might affect binding of protein ligands. The enzymatic addition of a single unsubstituted or orthogonally blocked glucosamine to the nonreducing end of the heparan sulfate chain is one possible way to introduce a novel functionality to the chain without perturbing its overall structure (Chen et al.,
2006). This approach is currently being tested in collaboration with Jian Liu
(University of North Carolina).
Heparan sulfate contains a number of other reactive groups that could also be used to couple the polysaccharide to an affinity matrix (reviewed in (Murugesan et al.,
2008)). Reductive amination by Schiff’s base formation and sodium cyanoborohydride reduction is frequently used to couple the reducing end of the chain to an organic primary amine (Osmond et al., 2002). Hydrazide containing resins also couple heparin
124 via the reducing end. Pilot experiments using these types of activated resins showed unsatisfactory background binding of proteins. However, it should be possible to couple a bifunctional linker to the reducing end, e.g. diamines (for reductive amination
(Osmond et al., 2002)), aminooxy (Zeng et al., 2009) and hydrazide groups (Zhi et al.,
2006). Another approach is to activate the carboxylate groups of the uronic acids using a carbodiimide and couple them directly to a linker with a primary amine (Osmond et al., 2002). Since carboxylic acids are prevalent in heparan sulfate, a carefully controlled reaction using this chemistry might facilitate immobilization.
In spite of the difficulty of immobilizing heparan sulfate, sufficient resin was obtained to fractionate animal sera, which led to the successful identification of several proteins that bind to 3-O-sulfated heparan sulfate. Bodily fluids, like serum, provide rich sources of soluble protein. Other fluids of sufficient abundance that could be readily investigated include cerebral spinal fluid, amniotic fluid, wound fluid and synovial fluid. Extracellular protein extracted from tissue sources may also reveal 3-
O-sulfate dependent ligands. Attempts were made to recover extracellular protein from brain, kidney and spleen by Dounce homogenization or collagenase digestion. These preparations were contaminated with nucleic acid binding proteins, which dominated the proteomic results. Gentler techniques are needed to extract extracellular protein from tissue without disrupting cellular membranes. A simple technique that has been used to specifically recover extracellular proteins from the brain involves soaking the whole organ in isotonic buffer (Hofstein et al., 1983). This technique is currently being explored and may be applied to other organs as well. Conditioned cell culture medium can also be used as a source of soluble protein. HeLa cells, HEK293 cells,
125 primary neuronal cells and human embryonic stem cells can be cultured in serum free media and the conditioned medium can be fractionated on the affinity matrices.
4.4 3-O-sulfate modulates axonal growth cone collapse
Since NRP1 relies on 3-O-sulfate for high affinity binding to heparan sulfate, I hypothesized that 3-O-sulfate modulates NRP1 dependent biological processes. In the development of the nervous system, the coordinated effects of various chemorepulsive and chemoattractive proteins drive axonal targeting (Kolodkin and Tessier-Lavigne,
2011). NRP1 acts as a coreceptor with plexinA for the chemorepulsive protein semaphorin-3a (Sema3a) (He and Tessier-Lavigne, 1997; Kolodkin et al., 1997). The holoreceptor complex likely contains NRP1/plexinA/Sema3a in a 2:2:2 ratio (Janssen et al., 2012). The essential role of NRP1 in mammalian development is demonstrated by the NRP1 knockout mouse, which has severe defects of the nervous system (Gu et al., 2003; Kitsukawa et al., 1997). The axonal growth cone contains the cellular machinery that responds to Sema3a and a growth cone collapse assay in embryonic dorsal root ganglia (DRG) explants is commonly used as an experimental model for this process. Growth cone collapse of soluble oligosaccharides was enhanced by 3-O- sulfation. DRG from E13.5 mice express Hs3st-1, -2 and -5. Using the Hs3st-2 mutant mouse (Hasegawa and Wang, 2008), I also showed that genetic reduction of 3-O- sulfation attenuates growth cone collapse in response to Sema3a (Fig. 3-3G, H). The loss of collapse was incomplete, likely because the remaining Hs3sts compensate for the loss of Hs3st-2. To expand on these findings, growth cone collapse is being assessed in DRG neurons derived from Hs3st-1-/- mice and mice lacking both Hs3st-1
126 and Hs3st-2. Heparan sulfate likely exerts this effect by facilitating the formation of the holoreceptor signaling complex via the interaction of 3-O-sulfate with NRP1, although the data does not formally exclude the possibility that heparan sulfate might also interact with plexinA or Sema3a.
4.5 Future directions for 3-O-sulfate modulating neuropilin-1 function
An effect of 3-O-sulfation on axonal growth cone collapse suggests that there may be axonal targeting defects in mutant mice deficient in 3-O-sulfation. Mice with a brain specific genetic disruption of heparan sulfate synthesis have severe brain morphological defects including guidance errors in major commissural tracts (Inatani et al., 2003). Hs3st-1 and -2 mutant mice have a much more subtle disruption of heparan sulfate synthesis and have no gross neurological deficits as manifest by overt behavioral changes (HajMohammadi et al., 2003; Hasegawa and Wang, 2008).
Neurological phenotypes might be subtle in single mutants given the redundant expression of other Hs3sts. Axonal targeting is often examined by injecting lipophilic dyes in the eye as axonal tracers across the optic chiasm or major commissure tracts
(for examples (Matsumoto et al., 2007; Plump et al., 2002)). The NRP1 mutant mouse exhibits embryonic defects in cranial, spinal and limb neuronal patterning and in the corpus callosum (Gu et al., 2003; Kitsukawa et al., 1997). Hs3st-2 is expressed in many compartments of the nervous system including the DRG, olfactory bulb and trigeminal ganglia (Hasegawa and Wang, 2008; Lawrence et al., 2007). Any of these structures are reasonable candidates for finding an axonal targeting defect. However, the coexpression of multiple Hs3sts may mask the loss of any one Hs3st. Therefore,
127 compound mutants in multiple Hs3sts may be required to detect a change in targeting.
To date, only Hs3st-1 (HajMohammadi et al., 2003), -2 (Hasegawa and Wang, 2008),
-3a and -3b (Matthew Hoffman, unpublished results) mice have been created but no studies on compound mutants have been reported.
Axonal targeting defects result in miswiring of the nervous system. Therefore, disruption of axonal targeting by a reduction of 3-O-sulfation may result in subtle yet discernable behavioral phenotypes. Since Hs3st-2 is expressed in the DRG, olfactory bulb and trigeminal ganglia (Lawrence et al., 2007), a loss of Hs3st-2 may affect circuitry arising from these structures. Hs3st-2 in the DRG is expressed in cutaneous low-threshold mechanosensory and proprioceptive mechanosensory neurons
(Hasegawa and Wang, 2008). A defect in these neurons may result in a loss of tactile sensation and proprioception. Defects in tactile sensation may be detected using a von
Frey Hair test (Chaplan et al., 1994). A loss of proprioception may be detected by a gait analysis (Clarke and Still, 1999) or air-righting test (Vorhees et al., 1994).
Aberrant targeting in the olfactory bulb may give rise to an olfaction disorder, which can be detected by testing for habituation to and discrimination of odors (Yang and
Crawley, 2009). Again, compound mutants may be required to uncover a phenotype.
In addition to its role in neuronal patterning, NRP1 also acts as a coreceptor for
VEGF with VEGFR2, which plays roles in vasculogenesis and angiogenesis. The importance of NRP1 in vasculogenesis is illustrated by severe cardiovascular defects in addition to its neuronal defects in the NRP1 knockout mouse (Kawasaki et al.,
1999). An antibody that blocks the VEGF binding site on NRP1 was able to reduce blood vessel formation in a mouse tumor model, which supports a role for NRP1 in
128 angiogenesis (Pan et al., 2007). Heparan sulfate 3-O-sulfation may modulate angiogenesis or vasculogenesis via its interaction with NRP1. Indeed, recent studies have shown epigenetic modulation of Hs3st expression plays a role in cancer progression (Bui et al., 2010; Miyamoto et al., 2003). If true, 3-O-sulfated oligosaccharides with high affinity for NRP1 might prove useful as an antiangiogenic therapy.
To purify a product with high affinity for NRP1, oligosaccharides modified by
Hs3st-1 and -2 could be fractionated over immobilized NRP1. The chemical structure of this oligosaccharide could then be determined using exoglycosidases and mass spectrometry techniques. This approach has been used previously to characterize an oligosaccharide that binds to HSV-1 gD (Liu et al., 2002). This analysis may reveal that NRP1 binds with high affinity to multiple oligosaccharides that differ in structure, but that have in common the 3-O-sulfated glucosamine unit. Alternatively, each Hs3st isozyme may produce the same high affinity oligosaccharide that differs from the conventional AT-type and gD-type oligosaccharides. In this regard it would be interesting to examine whether other Hs3sts can produce binding sites for NRP1. In either case, a high affinity oligosaccharide can be synthesized by chemoenzymatic methods (Xu et al., 2011) and tested for inhibitory activity in tumor angiogenesis models (Pan et al., 2007). A high affinity structure that contains gD-type rather than
AT-type 3-O-sulfation would be therapeutically advantageous, as it would avoid altering hemostasis (Casu et al., 2008). This oligosaccharide could also be used in crystallization studies to further characterize the role of 3-O-sulfate in mediating high affinity binding to NRP1 (Vander Kooi et al., 2007).
129
4.6 Concluding remarks
My efforts to identify proteins that are influenced by 3-O-sulfate are just the beginning of a broader research program aimed at understanding this rare, but fascinating modification of heparan sulfate. As more proteins are uncovered that rely on 3-O-sulfate for binding to heparan sulfate, the physiological functions of 3-O- suflation will come to light. It then becomes important to understand how the installation of 3-O-sulfate is regulated in ways that drive these functions. The expression of seven mammalian Hs3sts is exquisitely regulated in time and space
(Cadwallader and Yost, 2006; Kuberan et al., 2004; Mochizuki et al., 2008). However, other than reports that Hs3sts are epigenetically misregulated in several cancers
(Miyamoto et al., 2003), little is known about the mechanisms that direct expression of the Hs3sts. A much-needed area of research involves identifying the signaling pathways, transcription factors, enhancer and promoter sequences and post- translational modifications that regulate the transcription, translation and activity of the Hs3sts.
Differences in the regulation of Hs3st expression may partially explain the existence of seven Hs3sts. Another explanation is that each Hs3st may install 3-O- sulfation in a different context. In other words, the various Hs3sts may have different substrate specificities. AT-type and gD-type Hs3sts differ in their substrate specificities at the disaccharide level (Liu et al., 1999). However, the need for six gD- type Hs3sts is curious unless their substrate specificities differ in higher order oligosaccharides. In the past, structural analysis of 3-O-sulfated sequences has relied on studying the products generated by Hs3sts acting on heparan sulfate derived from
130 natural sources, an inherently heterogeneous pool of polysaccharides (Liu et al., 1999).
The complexity of the resulting products obfuscated any analysis of higher order oligosaccharides by HPLC and LC/MS methods. Groups are now becoming proficient in chemical and enzymatic synthesis of structurally defined oligosaccharides, which can serve as test substrates for the various Hs3sts (Nguyen et al., 2012; Xu et al.,
2011). This approach will give a much clearer view of the role of oligosaccharide precursor structures in the activity of the Hs3sts.
Heparan sulfate 3-O-sulfation is a relatively rare modification yet accumulating evidence indicates that it plays important physiological functions. My efforts to identify proteins that rely on 3-O-sulfate provide biochemical information that indicates additional physiological functions. Clearly much more work is needed to fully appreciate this modification. Fortunately, the tools and resources needed to address these challenging questions are now becoming available, which should generate increased interest in 3-O-sulfation and provide many insights into this fascinating modification.
4.7 Acknowledgements
This chapter will be submitted for publication in conjunction with Chapter 2 and 3. The dissertation author was the primary author of this work with Emylie
Seamen, Roger Lawrence, Jian Liu and Jeffrey Esko as coauthors. This work was supported by grants GM93131 and HL107150 (to J.D.E.), by training grant
T32CA067754 (to B.E.T.) and by F32CA156987 (to E.S) from the National Institutes of Health.
131
4.8 Literature cited
Ariens, R.A., T.S. Lai, J.W. Weisel, C.S. Greenberg, and P.J. Grant. 2002. Role of factor XIII in fibrin clot formation and effects of genetic polymorphisms. Blood. 100:743-754.
Billnitzer, A.J., I. Barskaya, C. Yin, and R.G. Perez. 2013. APP independent and dependent effects on neurite outgrowth are modulated by the receptor associated protein (RAP). Journal of neurochemistry. 124:123-132.
Bui, C., M. Ouzzine, I. Talhaoui, S. Sharp, K. Prydz, M.W. Coughtrie, and S. Fournel- Gigleux. 2010. Epigenetics: methylation-associated repression of heparan sulfate 3-O- sulfotransferase gene expression contributes to the invasive phenotype of H-EMC-SS chondrosarcoma cells. Faseb J. 24:436-450.
Cadwallader, A.B., and H.J. Yost. 2006. Combinatorial expression patterns of heparan sulfate sulfotransferases in zebrafish: I. The 3-O-sulfotransferase family. Dev Dyn. 235:3423-3431.
Casu, B., I. Vlodavsky, and R.D. Sanderson. 2008. Non-anticoagulant heparins and inhibition of cancer. Pathophysiol Haemost Thromb. 36:195-203.
Chaplan, S.R., F.W. Bach, J.W. Pogrel, J.M. Chung, and T.L. Yaksh. 1994. Quantitative assessment of tactile allodynia in the rat paw. Journal of neuroscience methods. 53:55-63.
Chen, M., A. Bridges, and J. Liu. 2006. Determination of the substrate specificities of N-acetyl-d-glucosaminyltransferase. Biochemistry. 45:12358-12365.
Clarke, K.A., and J. Still. 1999. Gait analysis in the mouse. Physiology & behavior. 66:723-729.
Gu, C., E.R. Rodriguez, D.V. Reimert, T. Shu, B. Fritzsch, L.J. Richards, A.L. Kolodkin, and D.D. Ginty. 2003. Neuropilin-1 conveys semaphorin and VEGF signaling during neural and cardiovascular development. Dev Cell. 5:45-57.
HajMohammadi, S., K. Enjyoji, M. Princivalle, P. Christi, M. Lech, D. Beeler, H. Rayburn, J.J. Schwartz, S. Barzegar, A.I. De Agostini, M.J. Post, R.D. Rosenberg, and N.W. Shworak. 2003. Normal levels of anticoagulant heparan sulfate are not essential for normal hemostasis. J Clin Invest. 111:989-999.
Hasegawa, H., and F. Wang. 2008. Visualizing mechanosensory endings of TrkC- expressing neurons in HS3ST-2-hPLAP mice. J Comp Neurol. 511:543-556.
He, Z., and M. Tessier-Lavigne. 1997. Neuropilin is a receptor for the axonal chemorepellent Semaphorin III. Cell. 90:739-751.
132
Hofstein, R., G. Hesse, and V.E. Shashoua. 1983. Proteins of the extracellular fluid of mouse brain: extraction and partial characterization. J Neurochem. 40:1448-1455.
Inatani, M., F. Irie, A.S. Plump, M. Tessier-Lavigne, and Y. Yamaguchi. 2003. Mammalian brain morphogenesis and midline axon guidance require heparan sulfate. Science. 302:1044-1046.
Janssen, B.J., T. Malinauskas, G.A. Weir, M.Z. Cader, C. Siebold, and E.Y. Jones. 2012. Neuropilins lock secreted semaphorins onto plexins in a ternary signaling complex. Nature structural & molecular biology. 19:1293-1299.
Kawasaki, T., T. Kitsukawa, Y. Bekku, Y. Matsuda, M. Sanbo, T. Yagi, and H. Fujisawa. 1999. A requirement for neuropilin-1 in embryonic vessel formation. Development. 126:4895-4902.
Kitsukawa, T., M. Shimizu, M. Sanbo, T. Hirata, M. Taniguchi, Y. Bekku, T. Yagi, and H. Fujisawa. 1997. Neuropilin-semaphorin III/D-mediated chemorepulsive signals play a crucial role in peripheral nerve projection in mice. Neuron. 19:995-1005.
Kolodkin, A.L., D.V. Levengood, E.G. Rowe, Y.T. Tai, R.J. Giger, and D.D. Ginty. 1997. Neuropilin is a semaphorin III receptor. Cell. 90:753-762.
Kolodkin, A.L., and M. Tessier-Lavigne. 2011. Mechanisms and molecules of neuronal wiring: a primer. Cold Spring Harbor perspectives in biology. 3.
Kuberan, B., M. Lech, J. Borjigin, and R.D. Rosenberg. 2004. Light-induced 3-O- sulfotransferase expression alters pineal heparan sulfate fine structure. A surprising link to circadian rhythm. J Biol Chem. 279:5053-5054.
Lawrence, R., T. Yabe, S. Hajmohammadi, J. Rhodes, M. McNeely, J. Liu, E.D. Lamperti, P.A. Toselli, M. Lech, P.G. Spear, R.D. Rosenberg, and N.W. Shworak. 2007. The principal neuronal gD-type 3-O-sulfotransferases and their products in central and peripheral nervous system tissues. Matrix Biol. 26:442-455.
Liu, J., and L.C. Pedersen. 2007. Anticoagulant heparan sulfate: structural specificity and biosynthesis. Appl Microbiol Biotechnol. 74:263-272.
Liu, J., Z. Shriver, R.M. Pope, S.C. Thorp, M.B. Duncan, R.J. Copeland, C.S. Raska, K. Yoshida, R.J. Eisenberg, G. Cohen, R.J. Linhardt, and R. Sasisekharan. 2002. Characterization of a heparan sulfate octasaccharide that binds to herpes simplex virus type 1 glycoprotein D. J Biol Chem. 277:33456-33467.
Liu, J., N.W. Shworak, P. Sinay, J.J. Schwartz, L. Zhang, L.M. Fritze, and R.D. Rosenberg. 1999. Expression of heparan sulfate D-glucosaminyl 3-O-sulfotransferase isoforms reveals novel substrate specificities. J Biol Chem. 274:5185-5192.
133
Masters, C.L., G. Simms, N.A. Weinman, G. Multhaup, B.L. McDonald, and K. Beyreuther. 1985. Amyloid plaque core protein in Alzheimer disease and Down syndrome. Proceedings of the National Academy of Sciences of the United States of America. 82:4245-4249.
Matsumoto, Y., F. Irie, M. Inatani, M. Tessier-Lavigne, and Y. Yamaguchi. 2007. Netrin-1/DCC signaling in commissural axon guidance requires cell-autonomous expression of heparan sulfate. The Journal of neuroscience : the official journal of the Society for Neuroscience. 27:4342-4350.
Miyamoto, K., K. Asada, T. Fukutomi, E. Okochi, Y. Yagi, T. Hasegawa, T. Asahara, T. Sugimura, and T. Ushijima. 2003. Methylation-associated silencing of heparan sulfate D-glucosaminyl 3-O-sulfotransferase-2 (3-OST-2) in human breast, colon, lung and pancreatic cancers. Oncogene. 22:274-280.
Mochizuki, H., K. Yoshida, Y. Shibata, and K. Kimata. 2008. Tetrasulfated disaccharide unit in heparan sulfate: enzymatic formation and tissue distribution. J Biol Chem. 283:31237-31245.
Murugesan, S., J. Xie, and R.J. Linhardt. 2008. Immobilization of heparin: approaches and applications. Curr Top Med Chem. 8:80-100.
Narayan, P., A. Orte, R.W. Clarke, B. Bolognesi, S. Hook, K.A. Ganzinger, S. Meehan, M.R. Wilson, C.M. Dobson, and D. Klenerman. 2012. The extracellular chaperone clusterin sequesters oligomeric forms of the amyloid-beta(1-40) peptide. Nature structural & molecular biology. 19:79-83.
Nesheim, M.E., J.B. Taswell, and K.G. Mann. 1979. The contribution of bovine Factor V and Factor Va to the activity of prothrombinase. The Journal of biological chemistry. 254:10952-10962.
Neugebauer, J.M., A.B. Cadwallader, J.D. Amack, B.W. Bisgrove, and H.J. Yost. 2013. Differential roles for 3-OSTs in the regulation of cilia length and motility. Development. 140:3892-3902.
Nguyen, T.K., S. Arungundram, V.M. Tran, K. Raman, K. Al-Mafraji, A. Venot, G.J. Boons, and B. Kuberan. 2012. A synthetic heparan sulfate oligosaccharide library reveals the novel enzymatic action of d-glucosaminyl 3-O-sulfotransferase-3a. Mol Biosyst. 8:609-614.
Osmond, R.I., W.C. Kett, S.E. Skett, and D.R. Coombe. 2002. Protein-heparin interactions measured by BIAcore 2000 are affected by the method of heparin immobilization. Analytical biochemistry. 310:199-207.
Pan, Q., Y. Chanthery, W.C. Liang, S. Stawicki, J. Mak, N. Rathore, R.K. Tong, J. Kowalski, S.F. Yee, G. Pacheco, S. Ross, Z. Cheng, J. Le Couter, G. Plowman, F.
134
Peale, A.W. Koch, Y. Wu, A. Bagri, M. Tessier-Lavigne, and R.J. Watts. 2007. Blocking neuropilin-1 function has an additive effect with anti-VEGF to inhibit tumor growth. Cancer cell. 11:53-67.
Plump, A.S., L. Erskine, C. Sabatier, K. Brose, C.J. Epstein, C.S. Goodman, C.A. Mason, and M. Tessier-Lavigne. 2002. Slit1 and Slit2 cooperate to prevent premature midline crossing of retinal axons in the mouse visual system. Neuron. 33:219-232.
Romisch, J., A. Feussner, S. Vermohlen, and H.A. Stohr. 1999a. A protease isolated from human plasma activating factor VII independent of tissue factor. Blood coagulation & fibrinolysis : an international journal in haemostasis and thrombosis. 10:471-479.
Romisch, J., S. Vermohlen, A. Feussner, and H. Stohr. 1999b. The FVII activating protease cleaves single-chain plasminogen activators. Haemostasis. 29:292-299.
Shaklee, P.N., and H.E. Conrad. 1984. Hydrazinolysis of heparin and other glycosaminoglycans. The Biochemical journal. 217:187-197.
Tyan, S.H., A.Y. Shih, J.J. Walsh, H. Maruyama, F. Sarsoza, L. Ku, S. Eggert, P.R. Hof, E.H. Koo, and D.L. Dickstein. 2012. Amyloid precursor protein (APP) regulates synaptic structure and function. Molecular and cellular neurosciences. 51:43-52.
Vander Kooi, C.W., M.A. Jusino, B. Perman, D.B. Neau, H.D. Bellamy, and D.J. Leahy. 2007. Structural basis for ligand and heparin binding to neuropilin B domains. Proceedings of the National Academy of Sciences of the United States of America. 104:6152-6157.
Vorhees, C.V., K.D. Acuff-Smith, M.S. Moran, and D.R. Minck. 1994. A new method for evaluating air-righting reflex ontogeny in rats using prenatal exposure to phenytoin to demonstrate delayed development. Neurotoxicology and teratology. 16:563-573.
Xu, Y., S. Masuko, M. Takieddin, H. Xu, R. Liu, J. Jing, S.A. Mousa, R.J. Linhardt, and J. Liu. 2011. Chemoenzymatic synthesis of homogeneous ultralow molecular weight heparins. Science. 334:498-501.
Yang, M., and J.N. Crawley. 2009. Simple behavioral assessment of mouse olfaction. Current protocols in neuroscience / editorial board, Jacqueline N. Crawley ... [et al.]. Chapter 8:Unit 8 24.
Zeng, Y., T.N. Ramya, A. Dirksen, P.E. Dawson, and J.C. Paulson. 2009. High- efficiency labeling of sialylated glycoproteins on living cells. Nat Methods. 6:207-209.
Zhi, Z.L., A.K. Powell, and J.E. Turnbull. 2006. Fabrication of carbohydrate microarrays on gold surfaces: Direct attachment of nonderivatized oligosaccharides to hydrazide-modified self-assembled monolayers. Anal Chem. 78:4786-4793.