DOCSLIB.ORG

DNA Sequence of Baboon Highly Repeated

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
DNA Sequence of Baboon Highly Repeated Proc. Nati. Acad. Sci. USA Vol. 77, No. 4, pp. 2129-2133, April 1980 Genetics DNA sequence of baboon highly repeated DNA: Evidence for evolution by nonrandom unequal crossovers (satellite DNA/nucleosome/heterochromatin/primates) LAWRENCE DONEHOWER*t, CLEMENT FURLONGS, DAVID GILLESPIE*§, AND DAVID KURNITf1l *Section on Molecular Hybridization, Laboratory of Tumor Cell Biology, National Cancer Institute, Bethesda, Maryland 20205; and tCenter for Inherited Diseases, RG-20, University of Washington, Seattle, Washington 98195 Communicated by Arno G. Motulsky, December 26, 1979 ABSTRACT A highly repeated DNA was isolated from the be relevant to recent findings concerning the evolution and West African baboon (Papiopapio) as a 343-base-pair fragment plasticity of the eukaryotic genome. after digestion of total baboon DNA with the restriction endo- nuclease BamHI. The DNA sequence of this fragment was ob- tained by chemical cleavage methods and is compared with the MATERIALS AND METHODS DNA sequence of related highly repeated primate DNAs from African green monkey (Cercopithecus aethiops) and man. The Isolation of 343-Base-Pair Repeat from Baboon DNA. 343-base-pair baboon repeat consists of two related but noni- DNA from Papio papio (West African baboon) was isolated dentical wings of 172 and 171 base pairs, respectively. The ba- from frozen primate tissues by a modification (8) of Marmur's boon 172-base-pair wing shares more homology with the African method (9). Total Papio DNA was incubated with an excess of green monkey 172-base-pair repeat than with the baboon 171- the restriction endonuclease BamHIT (Bethesda Research base-pair wing. Comparison with the previously published Laboratories, Rockville, MD) (2-5 units per ug of DNA for 4 monkey and human DNA sequences indicates that: (i) All the DNA sequences apparently arose from a common ancestral hr at 370C) and the 343-base-pair repeat [denoted BABr sequence. (ii) Evolution of the primate DNA sequences can be (BamrHI)-1] was cut out and eluted from an 8% polyacrylamide explained by a model involving unequal crossovers at specific gel as described (8) or by electroelution in 45 mM Tris base/41 points within the repeated DNA, possibly mediated by the se- mM boric acid/1 mM EDTA/0.1% sodium dodecyl sulfate at quence 5'-AcC-3' or its invert 5:-CGTA9_3. (iii) There are alternating 100 mV for 8 hr. domains of conserved and divergent DNA sequences within DNA Sequence Determination. BABr (BamHI)-1 was la- each >170-base-pair wing sequence. Taken together, the DNA sequences of these primates suggest a model whereby highly beled at the 3' ends by adding 100 gCi (1 Ci = 3.7 X 1010 bec- repeated DNAs are established and evolve as a consequence of querels) of deoxyguanosine 5'-[a32P]triphosphate (2000-3000 unequal nonrandom exchanges of DNA duplexes. These ex- Ci/mmol; Amersham) to 15 Al containing 2.5 gg of purified changes may be mediated by short repeated nucleotide se- BABr (BamHI)-1 and 1.4 units of Klenow Escherichia coli quences and involve exchanges within and between the polymerase (large fragment) (Boehringer Mannheim) in Hin >170-base-pair wings. buffer (10 mm Tris-HCI, pH 7.4/50 mM NaCl/6.6 mM MgCl2/0. 1 mM dithioerythritol). This resulted in the fill-in of A significant, but markedly variable, component of the eu- one unique labeled nucleotide to each of the 3' ends of the karyotic genome is comprised of highly repeated DNA se- BamHI cut. quences that are localized in constitutive heterochromatin, that After labeling, BABr (BamHI)-1 was split into two fragments are not transcribed, and for which quantitative variation within with the restriction enzyme Hph I (New England Biolabs) (10). a species (or among closely related species) is tolerated without The cleavage products were separated on an 8% gel and elec- major phenotypic effects (1, 2). Nucleic acid hybridization and troeluted, yielding fragments for DNA sequence determination DNA sequence studies demonstrate that, unlike the remainder that were each labeled at a single 3' terminus and were 200 and of the genome, these highly repeated DNAs tend to be com- 142 nucleotides long, respectively (Fig. 1). The DNA sequence prised of short simple sequences repeated in tandem with a high of these was the degree of quantitative variation both within and among eu- fragments obtained by using Maxam-Gilbert karyotic species. Molecular and cytogenetic evidence suggest procedure for chemical cleavage (11) [the G, A > C, C, C + T, a model whereby unequal double-strand exchanges associated and alternate G (methylene blue modification) (12) reactions with mitotic DNA replication result in the creation and am- were used]. Electrophoresis was carried out on 20%, 12%, and plification of these DNA sequences (1, 3-5). 8% polyacrylamide (11) gels that were 0.4 mm thick on a gel In this report, the DNA sequence is obtained for a baboon apparatus that accommodated gels up to 91 cm long (Riverside highly repeated DNA. Comparison of this DNA sequence with Scientific Enterprises, Seattle, WA). The DNA sequences ad- previously published related DNA sequences from African jacent to the BamHI and Hph I restriction sites were deter- green monkey (6) and man (7) is consistent with the above mined as follows. BABr (BamHIl)-1 was digested with HindIll unequal exchange model and suggests the additional constraint (Boehringer Mannheim) and labeled by using Klenow poly- that the exchanges are nonrandom, possibly mediated by a short merase to fill in the HindIll 3' termini selectively in the pres- specific nucleotide sequence. This model of unequal mitotic Abbreviation: BABr, (BamHI)-l, 343-base-pair repeat. exchanges mediated by short specific nucleotide sequences may f Current address: Laboratory of Tumor Virus Genetics, Building 41, Room D243, National Cancer Institute, Bethesda, MD 20205. The publication costs of this article were defrayed in part by page § Current address: H. L. Orlowitz Cancer Institute, Hahnemann charge payment. This article must therefore be hereby marked "ad- Medical College, Philadelphia, PA 19102. vertisement" in accordance with 18 U. S. C. §1734 solely to indicate ¶Current address: Children's Hospital Medical Center, Genetics Di- this fact. vision, 300 Longwood Avenue, Boston, MA 02115. 2129 Downloaded by guest on September 26, 2021 2130 Genetics: Donehower et al. Proc. Natl. Acad. Sci. USA 77 (1980) BABr (BamHI)-1 Bam Hind Hph Hind Bam Hi ' I III *l i *III HI ~~~*_-3' 3' 5' / 343 ®\ Bam Hph I 142 Bam Bam Hind Hi Hi HI 60 Illl A* 200 Hind + Hind Hind Alu J III 172 III A/u I IIII 52 172 L A/u + Hind + 1 122 III Hind Bam T. * f I III HI4 117 FIG. 1. DNA sequence determination strategy. (a) The 343-base pair BABr (BAMHI)-1 fragment was end-labeled at the 3' ends and then cleaved with Hph I. Single-stranded 3'-end-labeled fragments of length 200 and 142 base pairs were thereby made available for sequence de- termination. Asterisks indicate the sites of 3'-end labeling. (b) BABr (BamHI)-l was cleaved with HindIII and then end-labeled with a protocol that filled in the 3' ends of the HindIII sites but left the BamHI ends unlabeled. This generated 60- and 117-base-pair fragments labeled at a single 3' end which were used directly for sequence determination towards the unlabeled BamHI sites. In addition, a 172-base-pair fragment labeled at both 3' ends was generated; this fragment was cleaved with Alu I and the sequence of the resulting 122-base-pair fragment which contained the Hph I recognition and cleavage sites (10) was determined. Taken together, the protocols in a and b allowed for sequence deter- mination of the entire 343-base-pair BABr (BamHI)-l fragment. ence of 50 ,uM dATP/50 AiM dGTP/50 ,uCi of deoxycytidine 1). The DNA sequence adjacent to the Hph I cleavage site was 5'-[a-32P]triphosphate (2000-3000 Ci/mmol; Amersham) (Fig. determined by establishing the sequence of the 122-base-pair 1). The BamHI termini were not labeled with [32P]dCTP, given fragment. Fig. 1 depicts this strategy schematically. Confir- the omission of dTTP from the reaction mixture. This proce- matory sequencing for the major portion of the sequence was dure generated 117- and 60-base-pair fragments labeled at a obtained by determining the sequence of the complementary single 3' terminus and a 172-base-pair fragment [equivalent to strand after labeling at the 5' end of BABr (BamHI)-l with the "Papio 2" wing (Fig. 2)] labeled at both 3' termini. After adenosine 5'-[y-32P]triphosphate by using the bacterial alkaline separation on an 8% gel and electroelution, the DNA sequence phosphatase-T4 polynucleotide kinase (Bethesda Research adjacent to the BamHI site was determined towards the (un- Laboratories, Rockville, MD) regimen of Maxam and Gilbert labeled) ends of the 117- and 60-base-pair fragments. The (11) and subsequent cleavage with Hph I or HindIII. The G, 172-base-pair fragment was cleaved with Alu I resulting in A > G, C, and C + T reactions outlined in ref. 11 were utilized labeled fragments 52 and 122 base-pairs in length which were to determine the sequence of the 5'-end-labeled Hph I frag- separated on an 8% polyacrylamide gel and electroeluted (Fig. ments of BABr (BamHI)-I. Hind Alu Mbo III I I Papio 1 AGCTTTCTGAGAAACTGCTTAGTGTTCTGTTAATTCATCTCACAGAGTTACATCTGTATTTCGTGGATCTCTTTGCTAGCCTTAT Papio 2 AGCTTTCTGAGAAACTTCTTTGTGTTCTGTGAAATCATCTCACAGAGTTACAGCTTTCCCCTCAAGAAGCCTTTCGCTAAGACAG Alu Hinf BamHI Hae Mbo I III Papio 1 TTCT GTGGAATCTGAGAACAGATATTTCGGATCCCTTTGAAGACTATAGGGCCAAAGGAAATATCCTCCGATAACAAAGAGAAAGA Papio 2 TTCTTGTGGAATTGGCAAAGT GATATTTGGAAGCCCATAGAGGGCTATGGT GAAAAAGGAAATATCCTCAGATGAAATCTG GAAAGA Hph I FIG. 2. Nucleotide sequence and restriction endonuclease map ofP. papio highly repeated DNA. The nucleotide sequence of the 343-base-pair highly repeated fragment of baboon DNA isolated after BamHI digestion [denoted BABr (BamHI)-1J is presented.
Load more

Recommended publications
  • Mutation Detection & Analysis
    PRO55 G-Biosciences ♦ 1-800-628-7730 ♦ 1-314-991-6034 ♦ [email protected] A Geno Technology, Inc. (USA) brand name Mutation Detection & Analysis Teacher’s Guidebook (Cat. # BE-314) think proteins! think G-Biosciences www.GBiosciences.com MATERIALS INCLUDED WITH THE KIT ................................................................................ 3 CHECKLIST .......................................................................................................................... 3 SPECIAL HANDLING INSTRUCTIONS ................................................................................... 3 ADDITIONAL EQUIPMENT REQUIRED ................................................................................ 3 TIME REQUIRED ................................................................................................................. 3 OBJECTIVES ........................................................................................................................ 4 BACKGROUND ................................................................................................................... 4 POLYMERASE CHAIN REACTION .................................................................................... 5 RESTRICTION ENZYMES ................................................................................................. 8 TEACHER’S PRE EXPERIMENT SET UP .............................................................................. 11 PREPARE PCR AND RESTRICTION DIGESTION REAGENTS ............................................ 11
    [Show full text]
  • Structures of Restriction Endonuclease Hindiii in Complex with Its Cognate DNA and Divalent Cations
    Title Structures of restriction endonuclease HindIII in complex with its cognate DNA and divalent cations Author(s) Watanabe, Nobuhisa; Takasaki, Yozo; Sato, Chika; Ando, Shoji; Tanaka, Isao Acta Crystallographica. Section D, Biological Crystallography, 65(12), 1326-1333 Citation https://doi.org/10.1107/S0907444909041134 Issue Date 2009-12 Doc URL http://hdl.handle.net/2115/39986 Type article File Information watanabe_ActaCristD65.pdf Instructions for use Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP electronic reprint Acta Crystallographica Section D Biological Crystallography ISSN 0907-4449 Editors: E. N. Baker and Z. Dauter Structures of restriction endonuclease HindIII in complex with its cognate DNA and divalent cations Nobuhisa Watanabe, Yozo Takasaki, Chika Sato, Shoji Ando and Isao Tanaka Acta Cryst. (2009). D65, 1326–1333 Copyright c International Union of Crystallography Author(s) of this paper may load this reprint on their own web site or institutional repository provided that this cover page is retained. Republication of this article or its storage in electronic databases other than as specified above is not permitted without prior permission in writing from the IUCr. For further information see http://journals.iucr.org/services/authorrights.html Acta Crystallographica Section D: Biological Crystallography welcomes the submission of papers covering any aspect of structural biology, with a particular emphasis on the struc- tures of biological macromolecules and the methods used to determine them. Reports on new protein structures are particularly encouraged, as are structure–function papers that could include crystallographic binding studies, or structural analysis of mutants or other modified forms of a known protein structure. The key criterion is that such papers should present new insights into biology, chemistry or structure.
    [Show full text]
  • A Short History of the Restriction Enzymes Wil A
    Published online 18 October 2013 Nucleic Acids Research, 2014, Vol. 42, No. 1 3–19 doi:10.1093/nar/gkt990 NAR Breakthrough Article SURVEY AND SUMMARY Highlights of the DNA cutters: a short history of the restriction enzymes Wil A. M. Loenen1,*, David T. F. Dryden2,*, Elisabeth A. Raleigh3,*, Geoffrey G. Wilson3,* and Noreen E. Murrayy 1Leiden University Medical Center, Leiden, the Netherlands, 2EaStChemSchool of Chemistry, University of Edinburgh, West Mains Road, Edinburgh EH9 3JJ, Scotland, UK and 3New England Biolabs, Inc., 240 County Road, Ipswich, MA 01938, USA Received August 14, 2013; Revised September 24, 2013; Accepted October 2, 2013 ABSTRACT Type II REases represent the largest group of characterized enzymes owing to their usefulness as tools for recombinant In the early 1950’s, ‘host-controlled variation in DNA technology, and they have been studied extensively. bacterial viruses’ was reported as a non-hereditary Over 300 Type II REases, with >200 different sequence- phenomenon: one cycle of viral growth on certain specificities, are commercially available. Far fewer Type I, bacterial hosts affected the ability of progeny virus III and IV enzymes have been characterized, but putative to grow on other hosts by either restricting or examples are being identified daily through bioinformatic enlarging their host range. Unlike mutation, this analysis of sequenced genomes (Table 1). change was reversible, and one cycle of growth in Here we present a non-specialists perspective on import- the previous host returned the virus to its original ant events in the discovery and understanding of REases. form. These simple observations heralded the dis- Studies of these enzymes have generated a wealth of covery of the endonuclease and methyltransferase information regarding DNA–protein interactions and catalysis, protein family relationships, control of restric- activities of what are now termed Type I, II, III and tion activity and plasticity of protein domains, as well IV DNA restriction-modification systems.
    [Show full text]
  • Promiscuous Restriction Is a Cellular Defense Strategy That Confers Fitness
    Promiscuous restriction is a cellular defense strategy PNAS PLUS that confers fitness advantage to bacteria Kommireddy Vasua, Easa Nagamalleswaria, and Valakunja Nagarajaa,b,1 aDepartment of Microbiology and Cell Biology, Indian Institute of Science, Bangalore 560012, India; and bJawaharlal Nehru Centre for Advanced Scientific Research, Bangalore 560064, India Edited by Werner Arber, der Universitat Basel, Basel, Switzerland, and approved March 20, 2012 (received for review November 22, 2011) Most bacterial genomes harbor restriction–modification systems, ognition and cofactor utilization, whereas the cognate MTase is encoding a REase and its cognate MTase. On attack by a foreign very site-specific (14). In addition to its recognition sequence, DNA, the REase recognizes it as nonself and subjects it to restric- GGTACC, the enzyme binds and cleaves a number of noncanoni- tion. Should REases be highly specific for targeting the invading cal sequences (i.e., TGTACC, GTTACC, GATACC, GGAACC, foreign DNA? It is often considered to be the case. However, when GGTCCC, GGTATC, GGTACG, GGTACT), with the binding bacteria harboring a promiscuous or high-fidelity variant of the affinity ranging from 8 to 35 nM (14, 15). Accordingly, many of fi REase were challenged with bacteriophages, tness was maximal these sites are cleaved efficiently with kcat values varying from 0.06 − − under conditions of catalytic promiscuity. We also delineate pos- to 0.15 min 1 vs. 4.3 min 1 for canonical sites (15). The promis- sible mechanisms by which the REase recognizes the chromosome cuous activity of the enzyme is directed by a number of cofactors. as self at the noncanonical sites, thereby preventing lethal dsDNA In the presence of the physiological levels of Mg2+, the most breaks.
    [Show full text]
  • NF1) Pseudogenes on Chromosomes 2, 14 and 22
    European Journal of Human Genetics (2000) 8, 209–214 © 2000 Macmillan Publishers Ltd All rights reserved 1018–4813/00 $15.00 y www.nature.com/ejhg ARTICLE Mechanism of spreading of the highly related neurofibromatosis type 1 (NF1) pseudogenes on chromosomes 2, 14 and 22 Mirjam Luijten1, YingPing Wang2, Blaine T Smith2, Andries Westerveld1, Luc J Smink3, Ian Dunham3, Bruce A Roe2 and Theo JM Hulsebos1 1Department of Human Genetics, Academic Medical Center, University of Amsterdam, The Netherlands; 2Department of Chemistry and Biochemistry, University of Oklahoma, Norman, OK, USA; 3Sanger Centre, Wellcome Trust Genome Campus, Hinxton Hall, Cambridge, UK Neurofibromatosis type 1 (NF1) is a frequent hereditary disorder that involves tissues derived from the embryonic neural crest. Besides the functional gene on chromosome arm 17q, NF1-related sequences (pseudogenes) are present on a number of chromosomes including 2, 12, 14, 15, 18, 21, and 22. We elucidated the complete nucleotide sequence of the NF1 pseudogene on chromosome 22. Only the middle part of the functional gene but not exons 21–27a, encoding the functionally important GAP-related domain of the NF1 protein, is presented in this pseudogene. In addition to the two known NF1 pseudogenes on chromosome 14 we identified two novel variants. A phylogenetic tree was constructed, from which we concluded that the NF1 pseudogenes on chromosomes 2, 14, and 22 are closely related to each other. Clones containing one of these pseudogenes cross-hybridised with the other pseudogenes in this subset, but did not reveal any in situ hybridisation with the functional NF1 gene or with NF1 pseudogenes on other chromosomes.
    [Show full text]
  • Anza Restriction Enzyme Cloning System Complete, One-Buffer System— for Beautifully Simple Cloning Cloning Has Never Been Simpler
    Anza Restriction Enzyme Cloning System Complete, one-buffer system— for beautifully simple cloning Cloning has never been simpler Finally, forget the frustrations of finding compatible buffers and sorting through protocols for your restriction enzyme digests—start getting reliable results for your downstream experiments. The Invitrogen™ Anza™ Restriction Enzyme Cloning System is a complete system, comprised of: DNA modifying enzymes 128 restriction enzymes + 5 DNA modifying enzymes Anza T4 DNA Ligase Master Mix Anza Thermosensitive All Anza™ restriction enzymes work together cohesively and are fully functional Alkaline Phosphatase with the single Anza™ buffer. Anza T4 Polynucleotide Kinase The system offers: Anza DNA Blunt End Kit • One buffer for all restriction enzymes Anza DNA End Repair Kit • One digestion protocol for all DNA types • Complete digestion in 15 minutes • Overnight digestion without star activity Convenient buffer formats All Anza restriction enzymes come with an Anza 10X Buffer and an Anza 10X Red Buffer to give you the flexibility you require. The red buffer includes a density reagent containing red and yellow tracking dyes that migrate with 800 bp DNA fragments and faster than the 10 bp DNA fragments, respectively, in a 1% agarose gel. This eliminates tedious dye addition steps prior to gel loading and is compatible with downstream applications.* * For applications that require analysis by fluorescence excitation, Anza 10X Buffer is recommended, as the Anza 10X Red Buffer may interfere with some fluorescence measurements. 2 A one-buffer system Eliminate the frustration of trying to find compatible buffers for all your enzymes. All Anza restriction enzymes allow for complete digestion using a single Anza buffer.
    [Show full text]
  • 2019-20 NEB Catalog Technical Reference
    Reference Appendix Technical Support – Featured Tools & for scientists, by scientists Resources As a partner to the scientific community, New England Biolabs is committed to Optimizing Restriction Enzyme Reactions providing top quality tools and scientific expertise. This philosophy still stands, 290 and has led to long-standing relationships with many of our fellow scientists. Performance Chart for NEB's commitment to scientists is the same regardless of whether or not they 293 Restriction Enzymes purchase product from NEB: their ongoing research is supported by our catalog, Troubleshooting Guide website and technical staff. 349 for Cloning NEB's technical support model is unique as it utilizes most of the scientists at NEB. Several of our product lines have designated technical support scientists 334 Methylation Sensitivity assigned to servicing customers in those application areas. Any questions regarding a product could be dealt with by one of the technical support Guidelines for scientists, the product manager who manufactures it, the product development 337 PCR Optimization scientist who optimizes it, or a researcher who uses the product in their daily Cleavage Close to the research. As such, customers are supported by scientists and often experts in 343 End of DNA Fragments the product or its application. To access technical support: 288 Online Interactive Tools Call 1-800-632-7799 (Monday – Friday: 9:00 am - 6:00 pm EST) Submit an online form at www.neb.com/techsupport View NEB TV Episode #22 Email [email protected] to learn more about our Technical Support program. International customers can contact a local NEB subsidiary or distributor. For more information see inside back cover.
    [Show full text]
  • Targeting Mutations to the Plastidial Psba Gene of Chlamydomonas
    www.nature.com/scientificreports OPEN Targeting mutations to the plastidial psbA gene of Chlamydomonas reinhardtii without Received: 15 January 2019 Accepted: 3 April 2019 direct positive selection Published: xx xx xxxx Volha Shmidt1, David Kaftan 1,2, Avigdor Scherz3 & Avihai Danon3 Targeting mutations to specifc genomic loci is invaluable for assessing in vivo the efect of these changes on the biological role of the gene in study. Here, we attempted to introduce a mutation that was previously implicated in an increased heat stability of the mesophilic cyanobacterium Synechocystis sp. PCC6803 via homologous recombination to the psbA gene of Chlamydomonas reinhardtii. For that, we established a strategy for targeted mutagenesis that was derived from the efcient genome- wide homologous-recombination-based methodology that was used to target individual genes of Saccharomyces cerevisiae. While the isolated mutants did not show any beneft under elevated temperature conditions, the new strategy proved to be efcient for C. reinhardtii even in the absence of direct positive selection. Te unicellular green alga Chlamydomonas reinhardtii has served as a primary platform for studies of photosyn- thesis in eukaryotes1–3, thus, making it a favorable target for studying the phenotypic consequences of the muta- tions in the D1 protein. D1 is encoded by the chloroplast psbA gene that has two identical copies in C. reinhardtii located in the inverted repeats4. Te C. reinhardtii psbA gene contains 4 introns that increase the size of the C. reinhardtii psbA gene up to roughly 7 kb4,5 and, in turn, complicate its genetic manipulation. Te modifcation of C. reinhardtii plastome is facilitated by an efcient homologous recombination6 that similarly to Saccharomyces cerevisiae7 and the moss Physcomitrella patens8 enables the targeting of exogenous homologous DNA to specifc sites in the chloroplast or nuclear genomes.
    [Show full text]
  • Torsional Stress Induces an S1 Nuclease-Hypersensitive Site Within
    Proc. Nati. Acad. Sci. USA Vol. 82, pp. 4018-4022, June 1985 Biochemistry Torsional stress induces an S1 nuclease-hypersensitive site within the promoter of the Xenopus laevis oocyte-type 5S RNA: gene : (gene expression/transcription factor/DNA-protein interaction) WANDA F. REYNOLDS AND JOEL M. GOTTESFELD Department of Molecular Biology, Research Institute of Scripps Clinic, 10666 North Torrey Pines Road, La Jolla, CA 92037 Communicated by James Bonner, February 22, 1985 ABSTRACT The internal promoter of the Xenopus laevis gene promoter adopts an S1 nuclease sensitive conformation oocyte-type 5S RNA gene is preferentially cleaved by S1 and in supercoiled DNA. This altered conformation may be Bal-31 nucleases in plasmid DNA. S1 nuclease sensitivity is similarly induced or stabilized by TFIIIA in linear DNA. largely dependent on supercoiling; however, Bal-31 cleaves These findings provide a clear correlation between an S1 within the 5S RNA gene in linear as well as in supercoiled DNA. nuclease-sensitive conformation and a promoter element. The S1 nuclease-hypersensitive site is centered at position +48-52 of the gene at the 5' boundary of the promoter. A METHODS DNase I-hypersensitive site is induced at this position upon DNAs. For DNase I "footprint" analysis, pXlo 3'A+56 binding of the transcription factor, TFIIIA, specific for the 5S was digested with EcoRI and end-labeled with polynucleotide RNA gene. The somatic-type 5S RNA gene promoter is not kinase (Bethesda Research Laboratories) and ['y-32P]ATP. preferentially cleaved by S1 nuclease or Bal-31 nuclease in The DNA was secondarily digested with HindIII and the supercoiled DNA, nor does TFIIIA induce a DNase I site at 530-bp fragment containing the gene was isolated by poly- position +50.
    [Show full text]
  • A Genome-Wide 3C-Method for Characterizing the Three
    Methods xxx (2012) xxx–xxx Contents lists available at SciVerse ScienceDirect Methods journal homepage: www.elsevier.com/locate/ymeth Review Article A genome-wide 3C-method for characterizing the three-dimensional architectures of genomes ⇑ Zhijun Duan a,b, , Mirela Andronescu c, Kevin Schutz d, Choli Lee c, Jay Shendure c, Stanley Fields b,c,e, ⇑ ⇑ William S. Noble c, , C. Anthony Blau a,b,c, a Institute for Stem Cell and Regenerative Medicine, University of Washington, USA b Department of Medicine, University of Washington, USA c Department of Genome Sciences, University of Washington, USA d Graduate Program in Molecular and Cellular Biology, University of Washington, USA e Howard Hughes Medical Institute Seattle, WA 98195-8056, USA article info abstract Article history: Accumulating evidence demonstrates that the three-dimensional (3D) organization of chromosomes Available online xxxx within the eukaryotic nucleus reflects and influences genomic activities, including transcription, DNA replication, recombination and DNA repair. In order to uncover structure-function relationships, it is nec- Keywords: essary first to understand the principles underlying the folding and the 3D arrangement of chromosomes. Chromatin Chromosome conformation capture (3C) provides a powerful tool for detecting interactions within and Chromosome between chromosomes. A high throughput derivative of 3C, chromosome conformation capture on chip Chromosome conformation capture (3C) (4C), executes a genome-wide interrogation of interaction partners for a given locus. We recently devel- Chromosome conformation capture on chip oped a new method, a derivative of 3C and 4C, which, similar to Hi-C, is capable of comprehensively iden- (4C) Genome architecture tifying long-range chromosome interactions throughout a genome in an unbiased fashion.
    [Show full text]
  • And Assignment of the Chromosomal Locus (Human Serum Proteins/Proteinase Inhibitors/Human Chromosome Mapping/Thiol Ester Bond) CHEN-CHEN KAN*, ELLEN Solomont, K
    Proc. Nati. Acad. Sci. USA Vol. 82, pp. 2282-2286, April 1985 Biochemistry Nucleotide sequence of cDNA encoding human a2-macroglobulin and assignment of the chromosomal locus (human serum proteins/proteinase inhibitors/human chromosome mapping/thiol ester bond) CHEN-CHEN KAN*, ELLEN SOLOMONt, K. TERTIA BELTt, AILEEN C. CHAIN*, LYNNE R. HIORNSt, AND GEORG FEY* *Department of Immunology, Research Institute of Scripps Clinic, 10666 North Torrey Pines Road, La Jolla, CA 92037; tImperial Cancer Research Funds Laboratory, P.O. Box 123, Lincoln's Inn Fields, London WC2A 3PX, England; and tDepartment of Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QU, England Communicated by Frank J. Dixon, December 6, 1984 ABSTRACT Six a2-macroglobulin (a2M) cDNA clones ester sites are conserved. These observations led to the pro- were isolated from a human liver cDNA library by using syn- posal that the C3, C4, and a2M genes are derived from a thetic oligonucleotides as hybridization probes. One of these, common ancestral gene (16). The sequences of murine and pa2M1, carries a 4.6-kilobase-pair insert, which was se- human C3 and human C4 and partial cDNA sequences of quenced. The insert contains the coding sequences for the ma- murine C4 have recently been determined (17-21). Compari- ture a2M polypeptide (1451 amino acids) and for a 23-amino son of human a2M with murine C3 revealed a 25% overall acid signal peptide at the NH2 terminus of the precursor pro- sequence homology (17, 18, 22), supporting the proposal of a2M. At the 3' end of the insert a poly(A) addition signal A-A- their common evolutionary origin.
    [Show full text]
  • Biotechnology Explorer™ Restriction Digestion and Analysis of Lambda DNA Kit Instruction Manual
    Biotechnology Explorer™ Restriction Digestion and Analysis of Lambda DNA Kit Instruction Manual Catalog #166-0002EDU explorer.bio-rad.com The kit is packaged and shipped as two modules. Open the modules immediately upon receipt and store components at –20°C, 4°C, or room temperature as indicated. Duplication of any part of this document is permitted for classroom use only. For Technical Service Call Your Local Bio-Rad Office, or in the U.S., Call 1-800-4BIORAD (1-800-424-6723) A Complete Teaching Guide Developed over 5 years, Biotechnology Explorer kits and curricula have been written for teachers by teachers, and have been extensively field-tested in a broad range of classroom settings from high school through the undergraduate level. Easy-to-use Biotechnology Explorer kits are the perfect way to bring the excitement of biotechnology into the classroom. Each kit contains an innovative step-by-step protocol, which makes it the perfect choice for both experienced and beginning teachers. The curriculum contained within the manual for each kit makes our products unique. Each kit contains its own curriculum manual which is divided into a Teacher’s Guide and Student Manual. The Teacher’s Guide contains background information and lecture topics that will enable each teacher, whether experienced or a newcomer to biotechnology, to prepare and design lectures and lessons which can precede the actual labs. This advance preparation will ensure that the labs run smoothly and that the students will understand the concepts behind each laboratory. The manual also contains a section on the laboratory setup, complete with detailed procedures and graphic diagrams to assist you in the advance preparation for the laboratories.
    [Show full text]