A Radiation Hybrid Map of the Proximal Long Arm of Human Chromosome I I Containing the Multiple Endocrine Neoplasia Type I (MEN-I) and Bcl-L Disease Loci
Total Page：16
File Type：pdf, Size：1020Kb
Am. J. Hum. Genet. 49:1189-1196, 1991 A Radiation Hybrid Map of the Proximal Long Arm of Human Chromosome I I Containing the Multiple Endocrine Neoplasia Type I (MEN-I) and bcl-l Disease Loci Charles W. Richard Ill, * Donald A. WithersT Timothy C. Meeker,t Susanne Maurer, Glen A. Evans,11 Richard M. Myers,t§ and David R. Cox*I§ Departments of *Psychiatry, tMedicine, tPhysiology, and §Biochemistry and Biophysics, University of California, San Francisco; and IIMolecular Genetics Laboratory, The Salk Institute, La Jolla, CA Summary We describe a high-resolution radiation hybrid map of the proximal long arm of human chromosome 11 containing the bcl-1 and multiple endocrine neoplasia type 1 (MEN-1) disease gene loci. We used X-ray irradiation and cell fusion to generate a panel of 102 hamster-human somatic cell hybrids containing fragments of human chromosome 11. Sixteen human loci in the 11q12-13 region were mapped by statistical analysis of the cosegregation of markers in these radiation hybrids. The most likely order for these loci is CiNH-OSBP- (CD5 /CD20)-PGA-FTH1-COX8-PYGM-SEA-KRN1-(MTC/P1EH/HSTFI /INT2)-GST3-PPP1A. Our localization of the human protooncogene SEA between PYGM and INT2, two markers that flank MEN-1, suggests SEA as a potential candidate for the MEN-1 locus. We map two mitogenic fibroblast growth factor genes, HSTF1 and INT2, close to bcl-1, a mapping that is consistent with previously published data. Our map places the human leukocyte antigen genes CD5 and CD20 far from the bcl-1 locus, indicating that CD5 and CD20 expression is unlikely to be altered by bcl-1 rearrangements. PPP1A, which has been postulated as a MEN-1 candidate tumor suppressor gene, and GST3, a gene transcriptionally active in many human cancers, both map distal to the bcl-1 translocation cluster and the region containing MEN-1, and therefore are unlikely to be directly involved in bcl-1 or MEN-1. Introduction translocation, encompasses over 63 kb ofDNA (Tsuji- Much progress has been made in recent years in estab- moto et al. 1985; Rabbitts et al. 1988; Meeker et al. lishing the chromosomal location of cancer-causing 1989). MEN-1 is an autosomal dominant trait that genes, either by examination of chromosome re- predisposes individuals to neoplasms of the parathy- arrangements in leukemias or by linkage analysis and roid, pancreatic islets, and anterior pituitary. The tumor deletion analysis in familial cancers. The proxi- gene responsible for this syndrome has been localized mal long arm of human chromosome 11 (region by genetic linkage analysis to the area between 1 1q12- 11q12-13) contains at least two separate cancer dis- 13 flanking markers PGA and INT2 (Larsson et al. ease loci: bcl-1 and multiple endocrine neoplasia type 1988; Bale et al. 1989; Nakamura et al. 1989). Tumor 1 (MEN-1). The bcl-1 locus, defined as the chromo- deletion analysis of the smallest region of overlap has some 11 translocation breakpoint region in leukemia further narrowed the region to between markers and lymphoma cells carrying the t(11;14)(ql3;32) PYGM and Dl 15146 (Bystrom et al. 1990). By a com- bination of several mapping methods including in situ hybridization, meiotic mapping, and somatic cell hy- Received April 30, 1991; revision received July 22, 1991. brid mapping panels (Junien and McBride 1989), a Address for correspondence and reprints: Charles W. Richard number of genetic markers have been mapped to the III, M.D., Ph.D., Box 0554, HSE 1556, University of California, 1 1q12-13 region in the vicinity of bcl-1 and MEN-1. San Francisco, CA 94143-0554. i 1991 by The American Society of Human Genetics. All rights reserved. In many cases, however, the order of these markers 0002-9297/91 /4906-0006$02.00 and the distances between them are poorly defined. In 1189 1190 Richard et al. an effort to improve the map ofchromosome 11 in the published genomic or cDNA sequences. In caseswhere region of MEN-1 and bcl-1 we used radiation hybrid only cDNA sequences were available, primer se- (RH) mapping (Cox et al. 1990) to derive the in- quences were chosen from either the 3' or 5' untrans- termarker distances and order of 16 loci previously lated regions. Primer sequences for SEA were chosen assigned to human chromosome 11q12-13. The loci after sequencing a DNA fragment subcloned from a mapped include CD5 (antigen CD5), CD20 (antigen genomic SEA probe. MTC PCR primers were chosen CD20), C1NH (complement component 1 inhibitor), from sequences in the major translocation cluster of COX8 (cytochrome c oxidase subunit VIII), FTH1 the bcl-1 region (Tsujimoto et al. 1984, 1985). P1 1EH (ferritin heavy polypeptide-like 6), GST3 (glutathi- primers were chosen from a second translocation one-S-transferase 3, pi), HSTF1 (heparin secretory breakpoint sequence located 63 kb telomeric to the transforming protein 1), INT2 (murine mammary tu- MTC cluster (Meeker et al. 1989). Two sets ofHSTF1 mor virus integration site, v-int oncogene homolog), primers were used. Each 100-gl PCR reaction tube KRN1 (ultra-high sulfur keratin 1), OSBP (oxysterol- contained 250 ng genomic hybrid DNA, 67 mM Tris binding protein), PGA (pepsinogen A), PYGM (mus- HCl pH 8.8, 6.7 mM MgCl2, 16.6 mM (NH4)2SO4, cle glycogen phosphorylase), PPP1A (protein phos- 10 mM ,B-mercaptoethanol, 4% dimethyl sulfoxide phorylase 1), and two DNA probes (PilEH and (DMSO), 600 gM of each dNTP, 1 igM of each MTC) from the 63-kb bd-1 breakpoint region. primer, and 2 units of Taq polymerase (Perkin-Elmer- In the RH mapping procedure, a human-hamster Cetus). Thirty-five cycles of PCR were performed on hybrid cell line containing an intact single human a Perkin-Elmer-Cetus thermal cycler at 96°C for 30 s chromosome as the only human material is subjected of denaturation, various temperatures and times of to lethal X-irradiation breaking the chromosome into annealing (table 1), and 72°C for 90 s of extension. fragments and resulting in cell death. These irradiated Twenty microliters ofeach RH PCR amplification was cells are then fused to a nonirradiated recipient ham- electrophoresed through mixed agarose gels (2% Nu- ster cell line to rescue the human chromosomal frag- Sieve GTG agarose and 1% GTG agarose [FMC Bio- ments in viable RH cells. The presence or absence of products]) containing ethidium bromide (0.5 gg/ml). specific human DNA sequences in RHs is determined Each radiation hybrid was scored for the presence or either by Southern blot hybridization or by PCR-based absence of a specific human chromosome 11 marker assays. The relative order and distance between mark- by visual inspection of PCR-amplified DNA in ethid- ers is determined by a statistical algorithm that esti- ium stained gels. Formost loci, DNA from each hybrid mates the frequency of breakage between markers (0). was amplified and scored in two separate experiments. The greater the value of 0, the greater the distance between markers. Distance, expressed in centiRays Cell Lines and Culture Conditions (cRsooo), is calculated from 0 using a mapping func- Human-hamster, HPRT +, somatic cell hybrid J1 tion. (Kao et al., 1976) was maintained in Hams F-12 Using this RH mapping technique, we have derived medium supplemented by 10% FCS, 10,000 U a high-resolution map of 11q12-13 that places SEA penicillin/ml, and 1 tig streptomycin/ml (pen/strep). within the flanking markers for MEN-1 and confirms A Chinese hamster cell line deficient for hypoxanthine- the previously reported location of genes HSTF1 and guanine phosphoribosyltransferase (HPRT) activity, INT2 near the bcl-1 locus. 380-6, was maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FCS, and pen/strep. Material and Methods Generation of RH Cell Lines PCR Assays Human-hamster RH somatic cell lines were gener- PCR assays were developed to determine the pres- ated as described elsewhere (Cox et al. 1989). In brief, ence or absence of human chromosome 11 loci in RHs donor HPRT + J1 cells (containing chromosome 11 by designing oligonucleotide sequences that can be as the only human material) were lethally irradiated used to selectively amplify human but not hamster with 9,000 rads of X-rays and fused to HPRT- sequences. Oligonucleotide sequences specific for each deficient 380-6 hamster cells using polyethylene gly- of the 16 loci are summarized in table 1. Primer se- col. J1 x 380-6 RHs were selected by growth in HAT quences for most genes except SEA were chosen from medium (DMEM, 10% FCS, 100 gM hypoxanthine, Radiation Hybrid Map of 1lql2-13 1191 Table I PCR Primers and Amplification Conditions ANNEALING FRAG- CONDITIONS MENT SIZE Time Temperature Locus NAME (bp) PRIMER SEQUENCE (min) (OC) bcl-1 MTC ........... 82 GAGCTCCCTGAACACCTGGC 30 58 GAGGCTTTGTCCTACCATCC bcl-1 P11EH ......... 506 GGTGGGATCCAAGGGAAGTTGGTGC 60 55 TCCCGGATCCACAGCCTATTTCGGG CD5 ............. 431 AGAAGGATCCGCAGGGGTGGATGCT 30 64 ACTGGGATCCATGAGCAAAAAGCCG CD20 ............. 144 CTGAGGATCCAAGGCCTCAAATCTC 60 55 ACCGGATCCCTATCAGCGATTTCAT COX8 ............. 176 TCCCTCACACTGTGACCTGACCAGC 30 65 GGGGACCCCACCAAGCAGGGTCAGT C1NH ............. 428 CTGTGTGGGCTGACAGAGG 45 65 AGTGGTTTGGAGAGCATGG FTH1 ............. 173 GTCAAAAGACGCGGACAGAA 60 55 AATGGCGGGTGACAGGTGAA GST3 ............. 509 GAGGTTCAGTAAACACAGCC 60 63 TTAGCAAAGCAGAGCAGACC HSTF1 (set 1) ....... 549 CACCGATGAGTGCACGTTCAAGGAG 30 65 CAGACAGAGATGCTCCACGCCATAC HSTF1 (set 2) ....... 430 GCCCTTCCCTTCTCTAGTCC 30 60 GTTCCCCTTCTTGGTCTTCC INT2 ............. 251 CAGAGCTCCACGCCCAGTGATCTTT 30 65 AAGAGCTCTGGCTGCCCCAAGGAAC KRN1 ............. 228 AGTGGGAAACCTCAGGTAGCTCCCGA 30 65 CAGTTTGGCTCAGACATATGGGGGCA OSBP ............. 386 CAGAGCTTGCTCTGACTCTC 60 55 CATCCTCTGTCCTCTTCTCC PGA ............. 343 CCGAATCCCTGGACACTAAGCCAGG 30 65 AAAGTGGGCACAGGACAGAGGCCAG PPP1A ............. 109 CACACCACCCTGTGCCCCAGATGAT 30 65 AAGGTCCATGTTCCCCGTGACAGGT PYGM ............. 704 TGCTCATGCACCATGACCGGTGAGC 30 65 CCAAGAGAGTGTGACAGACTCAAGG SEA ............. 130 CTCAAGGCCAGGCATCACT 90 60 GGACTCTTCCATGCCAGTG 1 pM aminopterin, 12 gM thymidine, and pen/strep). One HPRT revertant was observed in 107 control The surviving cells received a functional HPRT gene 380-6 cells. Of 205 RHs, 171 were expanded as single from J1, together with nonselectively retained frag- colonies in HAT medium.