Human Papilloma Virus, Epstein-Barr Virus, and Herpes Simplex Virus

Home , Herpes simplex, Oral submucous fibrosis

gÉ à{x ÅxÅÉÜç Éy Åç wxtÜ `Éà{xÜ ‹‹

gÉ Åç wxtÜ Ytà{xÜ 9 YtÅ|Äç

List of original papers

This thesis is based on the following papers, which are referred to in the text by their Roman numerals.

I Jamshid Jalouli, Lars Sand, Bengt Gustavsson, Jan-M. Hirsch, Per-Anders Larsson. High-throughput DNA extraction from old paraffin-embedded biopsies. Biotechniques 1999;2: 334–8. II Lars Sand, Jamshid Jalouli, Per-Anders Larsson, Jan-M. Hirsch. Human papilloma viruses in oral lesions. Anticancer Research 2000;20:1183–8 III Jamshid Jalouli, Salah O. Ibrahim, Ravi Mehrotra, Miranda M. Jalouli, Dipak Sapkota, Per-Anders Larsson, Jan-M. Hirsch. Prevalence of viral (HPV, EBV, HSV) infections in oral submucous fibrosis and oral cancer from India. Acta Otolarynologica,May 5, 2010 [Epub ahead of print]. IV Jamshid Jalouli, Salah O. Ibrahim, Dipak Sapkota, Miranda M. Jalouli, Endre N. Vasstrand, Jan-M. Hirsch, Per-Anders Larsson. Presence of human papilloma virus, herpes simplex virus and Epstein-Barr virus in oral biopsies from Sudanese patients with regard to toombak use. Journal of Oral Pathology and Medicine, Jul 2, 2010 [Epub ahead of print].

Reprints were made with the permission of the journal publishers.

Other publications not included in this thesis

I Lars Sand, Jamshid Jalouli, Per-Anders Larsson, Bengt Magnusson, Jan-M. Hirsch. Presence of human papilloma viruses in intraosseous ameloblastom Journal of Oral and Maxillofacial Surgery 2000; 58: 1129-1134 II Lars Sand, Mats Wallström, Jamshid Jalouli, Per-Anders Larsson, Jan-M. Hirsch. Epstein – Barr virus and human papillomavirus in snuff-induced lesions of the oral mucosa. Acta Otolaryngologica 2000; 120: 880-884. III Lars Sand, Jamshid Jalouli, Per-Anders Larsson, Jan-M. Hirsch. Prevalence of Epstein-Barr virus in oral squamous cell carcinoma, oral lichen planus, and Normal oral mucosa. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002; 93: 586-92.

Contents

1. General background ...... 11 1.1 Malignant and premalignant oral lesions...... 11 1.1.1 Oral Cancer ...... 11 1.2 Oral sub-mucosa fibrosis (OSMF)...... 13 1.2.1 Oral leukoplakia (OL)...... 14 1.2.2 Oral lichen planus (OLP) ...... 15 1.3 Viruses ...... 16 1.3.1 Human papillomavirus (HPV) ...... 16 1.3.2 Epstein-Barr virus (EBV)...... 19 1.3.3 Herpes simplex virus type 1 (HSV-1)...... 21 1.4 Tobacco habits ...... 24 1.4.1 Snuff...... 25 1.4.2 Betel quid ...... 25 1.4.3 Toombak ...... 26 2. Aims of the study ...... 27 3. Materials and methods ...... 28 3.1 Population, patients, and sample collection...... 28 3.2 Cell and biopsy processing ...... 30 3.3 DNA extraction...... 30 3.4 PCR assay: single, semi-nested, and nested...... 33 3.5 Sequencing...... 34 3.6 Southern blot hybridization ...... 35 4. Statisics ...... 36 5. Results...... 37 5.1 Development of DNA extraction method (study I) ...... 37 5.2 HPV prevalence in oral lesions (studies II–IV) ...... 38 5.3 EBV-prevalence in oral lesions (studies III and IV)...... 38 5.4 HSV prevalence in oral lesions (studies III and IV)...... 38 5.5 The prevalence of viruses in various populations (studies II-IV).....39 5.6 Coexistence (studies III and IV) ...... 41 6. General discussion ...... 42 Summary...... 50

Summary in Swedish ...... 52 Acknowledgements...... 54 References...... 57

Abbreviations

AIDS Acquired immunodeficiency syndrome BL Burkitt’s lymphoma bp Base pair CMV Cytomegalovirus DNA Deoxyribonucleic acid EBV Epstein-Barr virus GMK Green monkey kidney cell HIV Human immunodeficiency virus HNSCC Head and neck squamous cell carcinoma HPV Human papillomavirus HSV-1 Herpes simplex virus 1 NK cell Natural killer cell NNN N ́-nitrosonornicotine NNK 4-(methylnitrosamine)-1-(3-pyridyl)-1-butanol NPC Nasopharyngeal carcinoma OHL Oral hairy leukoplakia OL Oral leukoplakia OLP Oral lichen planus OPC Oropharyngeal cancer OSCC Oral squamous cell carcinoma OSMF Oral submucous fibrosis PBC Peripheral blood cells PCR Polymerase chain reaction SCC Squamous cell carcinoma ST Smokeless tobacco TNM Tumor node metastasis classification TS Thymidylate synthase TSNAs Tobacco-specific nitrosamines

1. General background

1.1 Malignant and premalignant oral lesions 1.1.1 Oral Cancer Oral cancer is usually defined as a neoplastic disorder in the oral cavity, which includes the following areas: lip, buccal mucosa, lower and upper alveolar ridges, retromolar gingiva, oropharynx, floor of the mouth, hard palate, and the anterior two thirds of the tongue (1). Squamous cell carcinoma (SCC) is by far the most common epithelial malignancy in the oral cavity. SCCs and their variants constitute over 90% of oral malignancies. The continuum of SCC progresses from individual epithelial cell changes (atypia), to a generalized disturbance of the epithelium (dysplasia), then to carcinoma in situ, and finally to invasive SCC (2). Some tumors have an apparent “precancerous” state, often preceded by precancerous lesions such as leukoplakia, erythroplakia, lichen planus, and submucous fibrosis. The terms “precancer,” “precursor lesions,” “premalignant,” “intraepithelial neoplasia,” and “potentially malignant” have been used in the international literature to broadly describe clinical presentations that may have the potential to become cancer. They all convey the a priori assumption that there is uniformity in how individual patients and tissues behave. The termi- nology ought to reflect our best understanding of carcinogenesis in the oral mucosa, and to aspire to engender consistency in use. The latest WHO mo- nograph on head and neck tumors uses the term “epithelial precursor lesions” (3). Experience has taught us that certain cellular and tissue alterations are associated with malignancy and premalignancy. Altered cells appear more primitive than normal, and these changes are presumed to exemplify imma- ture or inappropriate differentiation, although pathologists typically refer to them as dysplasia or atypia. A key alteration of dysplastic epithelial cells is variation in the shape of the cells and nuclei. This pleomorphism is unusual outside of cancers and precancers. Premature production of keratin below the surface layer is another important alteration, but is much more commonly seen in oral carcinomas than in oral premalignancies. The detected risk of malignant transformation varies depending on whether one considers the presence of epithelial dysplasia, and there is need

11 for molecular markers to identify lesions with definite potential for malignant transformation. Oral epithelial dysplasia is subdivided into three prog- nostically significant categories: mild (grade I), moderate (grade II), and severe (grade III). Investigation has found that 20–35% of severely dysplastic lesions develop to carcinoma (4). Over 90% of OSCCs are preceded by a preexisting potentially malignant lesions (5). Although some primary tumors can be treated, many patients will develop second primary tumors, suggesting multifocal tumor development. Two major etiological factors in oral cavity SCC are social habits of tobacco use and alcohol consumption (6-7). According to an International Agency for Research on Cancer report (GLOBOCAN 2008) (8), oral cancer is the tenth most common cancer for men and fourteenth for both sexes in the world in terms of number of cases, accounting for approximately 480,000 new cases and mortality of 275,000 per year. In Sweden, the incidence of oral cancer is 869 and the mortality is 256 per year. In Sudan the incidence of oral cancer is 1547 and the mortality is 929 per year. In India the incidence of oral cancer is 118,424 and the mortality is 89,411 per year. Oral cancer in India is among the five most frequent cancers after cervical and breast cancer; among the oral tumors, 90% are SCC, which arises in the mucosal lining. This high incidence of oral cancers in India is due to the widespread habits of tobacco chewing and smoking (9-10). In Sweden and other western countries, the prevalence of oral cancer is higher for men than women, probably because men consume more alcohol and tobacco than do women (11). Rates in men are high in Western Europe (11.3 per 100,000), Southern Europe (9.2 per 100,000), South Asia (12.7 per 100,000), and southern Africa (11.1 per 100,000). In females, incidence is relatively high in southern Asia (8.3 per 100,000) (12). The etiology of epithelial cancer of the head and neck is considered to be a multifactorial, se- quential process that starts with premalignant lesions, such as oral leu- koplaika and oral lichen planus , and then progresses through mild, moderate, and severe degrees of dysplasia to carcinoma in situ and, finally, to invasive SCC (2). Four groups of genes are involved in the multiple genetic events of malignant cell transformation: oncogenes, tumor-suppressor genes, DNA repair genes, and DNA sequences that control apoptosis. The normal function of the p53 tumor-suppressor gene, located on the short arm of chromosome 17, is that of “guardian of the genome” (13). Damage to DNA is associated with nuclear accumulation of the p53 protein, presumably inducing growth arrest for repair or the induction of apoptotic cell death (14). Mutation in the p53 gene is frequently found in human cancer, and in 40–50% of SCC of the head and neck (15). These mutations likely result from carcinogen-induced DNA damage (16). Elevated p53 expression has been reported in patients having head and neck SCC and a history of heavy smoking (17) and heavy alcohol use (18) .

12 Of the 615,000 new cases of head and neck SCC reported worldwide in year 2000, fully 300,000 were occurred primarily in the oral cavity (19). In Af- rica, Sudan has a particularly high incidence of OSCC (11.60 for males and 6.91 for females) (20). OSCC has been found to demonstrate a non-uniform pattern of distribution, both geographically and demographically, an alarm- ing number of cases occurring in developing countries (21). This observation might reflect environmental, cultural, and/or habitual factors influencing the prevalence of this disease (22-23). The incidence is increasing, and when comparing the incidence of various cancer forms in adults in the western world today, oropharyngeal cancer ranks sixth. In some developing countries, almost 50% of patients in oncology departments suffer from cancer in the oral cavity, largely attributable to exposure to carcinogens, such as tobacco (24). OSCC predominately affects individuals of low socioeconomic status. This distribution is usually associated with tobacco use, heavy alcohol consumption, dietary deficiencies, and infections (25). The broad ethnic and climatic diversity of Sudan makes it in many ways a microcosm of Africa. Sudan is experiencing a burgeoning cancer epidemic that carries many challenges characteristic of developing countries. These include a high incidence of advanced, difficult-to-treat disease at presenta- tion, and a high cancer burden related to infectious diseases. To address this problem, Sudan has instituted a comprehensive national cancer control program focused on prevention, early detection, improved treatment, and pallia- tive care (26).

1.1.2 Oral sub-mucosa fibrosis (OSMF) Oral submucous fibrosis (OSMF) is a chronic potentially malignant disorder characterized by fibrosis of the lining mucosa of the upper digestive tract involving the oral cavity, oropharynx, and frequently the upper third of the esophagus. This is a chronic disease of the oral mucosa characterized, except in early forms, by inflammation and progressive fibrosis of the lamina pro- pria and deeper connective tissues, followed by stiffening of an otherwise yielding mucosa resulting in difficulty in opening the mouth (27). Different populations may display different sites of involvement in the mouth. In 1952, Schwartz (28) described five Indian women from Kenya with a condition of the oral mucosa involving the palate and the pillars of the face, which he called “atrophica idiopathica mucosa oris”; it was later termed OSMF by Joshi in 1953 (29). It is generally accepted today that areca nut (betel) quid plays a major role in the etiology of OSMF (30). This by now well-recognized oral precancerous condition, observed predominantly in the populations of India and in Southeast Asia, has been reported worldwide, for example, in Kenya, China, the UK, Saudi Arabia, and other parts of the world where Asians are migrating (31). Thus, the migration of endemic betel

13 quid chewers has made oral submucous fibrosis a public health issue in many parts of the world (32). Although Cox et al. demonstrated in a review article that nutritional deficiencies and immunological processes may play a part in OSMF pathogenesis, the available epidemiological evidence indicates that chewing betel quid is a important risk factor (33). The prevalence of OSMF ranges from 0.2– 1.2% in India (34). Over the years, the incidence of OSMF has increased in India, especially among the younger generation (2).

1.1.3 Oral leukoplakia (OL) Oral leukoplakia (OL) is a prevalent lesion of the oral mucosa with premalignant potential occurring worldwide. OL presents a white patch or plaque that cannot be rubbed off and cannot be characterized as a clinical entity; therefore, a process of exclusion establishes the diagnosis of the disease. The term leukoplakia implies only the clinical feature of a persistent, adherent white plaque; the term is therefore reserved for idiopathic lesions when investigation fails to reveal any cause. The term has absolutely no histologic connotation, although, inevitably, some form of disturbance of the surface epithelium is characteristic. Followup studies suggest that cancer is more likely to occur in individuals with idiopathic leukoplakia than in individuals without this condition, so idiopathic leukoplakia is considered a premalignant lesion. The etiology of most cases of OL is unknown (i.e., idiopathic); in other cases, the initiation of the condition may depend on extrinsic local factors and/or intrinsic predisposing factors. Factors most frequently blamed for the development of idiopathic leukoplakia include tobacco use, alcohol consumption, chronic irritation, candidiasis, vitamin deficiency, endocrine disturbances, and possibly a virus (35). The dose response relationship between tobacco and oral leukoplakia has been assessed in several studies (36). IARC claims in a 2004 report that all forms of tobacco use are major risk factors for oral leukoplakia, and a high frequency of leukoplakia is observed in populations with a high prevalence of tobacco use habits, particularly chewing, such as those in South and Southeast Asia (37). According to well-documented epidemiologic data for populations in Sweden, China, Japan, Malaysia, the USA, the UK, the Netherlands, and Germany, over the last thirty years, the prevalence of oral leukoplakia varies between 1.1% and 11.7%, with a mean of 2.9% (38-44). However, a systematic review found the pooled estimate of prevalence of leukoplakia to be 2.6% globally, finding no difference between geographical areas or between younger and older adults (45). In India, smoking habits display a varying association with locally prevalent tobacco habits, i.e., chewing, smoking, and mixed habits (e.g., chewing betel quid and bidi smoking). All habits were associated with the onset of oral leukoplakia, and the prevalence was considerably higher among the

14 tobacco-using groups than nonusers (46). In a case–control study from Kenya (36), the highest relative risk of leukoplakia was for smoking both unprocessed tobacco and cigarettes (47). Oral hairy leukoplakia (OHL) is a permissive EBV infection with abun- dant viral replication in the squamous epithelial cells of the lateral tongue border (48). OHL often develops in patients infected with the human immunodeficiency virus (HIV) and in people with other significant immunodefi- ciencies. OHL is a hyperproliferative lesion characterized histologically by intracellular edema, epithelial acanthosis, lack of inflammatory infiltrate, and hyperkeratosis. However, viral proteins characteristic of latent infection have also been detected in OHL lesions. There is a novel state of EBV infection with concurrent expression of replicative and latent proteins. It is probable that both replicative and latent proteins contribute to development and induce many of the histologic features of OHL, such as acanthosis and hyperproliferation (49).

1.1.4 Oral lichen planus (OLP) Lichen planus is a chronic inflammatory mucocutaneous condition that usually affects the skin, genitalia, and oral mucous membranes (50); its exact etiology is not known. Oral lichen planus (OLP) is aTcell-mediated autoim- mune disease, but its cause is unknown in most cases. The increased production of TH1 cytokines is a key and early event in LP; it is genetically induced, and genetic polymorphism of cytokines seems to govern whether lesions develop in the mouth alone or in the mouth and skin. Activated T cells are then attracted and migrate towards the oral epithelium, further attracted by intercellular adhesion molecules, by the upregulation of epithelial basement membrane extracellular matrix proteins (including collagen types IV and VII, laminin and integrins), and possibly by CXCR3 and CCR5 sig- naling pathways (51). Furthermore, there is evidence of a risk of malignant transformation in OLP, although the degree of risk is controversial (52). Several prospective studies (53-54) have reported OLP as having an increased potential for malignant development. Three studies, one of a Swed- ish population, using strict diagnostic criteria have demonstrated a significant risk of the malignant transformation of OLP to SCC (55-57). The reported transformation rates vary from 0% to 9%. If OLP underwent a malignant transformation, then OLP would be the major source of oral cancer in many parts of the world (58). It is reasonable to believe that the prevalence of OLP varies between different parts of the world (59).

15 1.2 Viruses 1.2.1 Human papillomavirus (HPV) The first evidence of the link between papillomavirus infection and cancer originated from studies of cancer induction by the cottontail rabbit papillomavirus in domestic rabbits and the subsequent elegant studies performed by Peyton Rous and his associates (60) on synergistic effects between these infectious carcinogens and chemical factors. The molecular analysis of papillomaviruses got off to a slow start. The viruses were first visualized with an electron microscope in 1949, and their circular double-stranded DNA genome was demonstrated in 1963 (61). The first evidence of biological functions of a member of this virus group originated from studies of bo- vine papillomaviruses (BPV). This virus was able to induce urinary bladder tumors in cattle, and found to be tumorigenic after inoculation into newborn hamsters, and transformed calf and murine cells in tissue culture (60). In humans, a detailed analysis of potentially oncogenic papillomaviruses began in the early 1970s, with the work of Stefania Jablonska in Warsaw, who considered a rare hereditary papillomatosis, epidermodysplasia verruci- formis “as a model in studies of papillomaviruses in oncogenesis” (60). In 1983, it was first suggested (62) that HPV might be the agent involved in the development of at least certain types of oral SCCs (63), and in 2007, the WHO stated that HPV was a cause of oral cancers (64).

Molecular biology The papillomaviruses, which replicate in the nucleus of squamous epithelial cells, belong to the papovavirus group, and are small, non-enveloped DNA viruses of a symmetrical icosahedral shape. Papillomavirus particles (52–55 nm in diameter) consist of a single molecule of double-stranded, circular DNA with approximately 8000 bp, contained in a capsid (spherical protein coat) composed of 72 capsomeres (repeating subunits of the capsid) (65). In a virus, only the genome is present, with no cellular machinery for replicat- ing the genome or manufacturing the capsid. The host cell must supply the necessary ingredients for the assembly of the viral components. Thus, a HPV virus reproduces by first adhering to and penetrating an epithelial cell. Fol- lowing insertion into the intercellular medium, the virus loses its capsid. The viral genome entering the nucleus produces the enzyme necessary to cut up the host DNA (the viral DNA is protected through a modification of its DNA). The remaining viral genes, having the capacity to code the cell’s structure and produce proteins, promote the cell’s replication of the virus’s own DNA, and all of the components that are part of the virus. These then assemble, giving origin to the capsid, tail, tail fibers, nucleic acid, and necessary enzymes, which together form, intracellularly, new duplicate viruses. In the last step, one of the viral genes directs the cell’s lysosome to release contents that digest the cell wall. The new viruses are then released, free to in-

16 fect other cells. When cellular death does not occur, chronic infection can probably succeed (66). HPV are a very large and heterogenous group of DNA viruses of which more than 100 types have already been identified. Based on the clinical behavior of HPV infections, the viruses can be grouped into high-risk (HR) and low-risk (LR) HPV types. HR-HPVs are associated with lesions that have a propensity to undergo carcinogenesis, and these viruses include types 16, 18, 31, 33, 35, 39, 45, and 52. These types are known to play an important role in epithelial carcinomas of the oral cavity and uterine cervix (67). HR-HPV-16 and HR-HPV-18 were declared human carcinogens by the International Agency for Research on Cancer (68)

Epidemiology Näsman et al. (69) demonstrated a parallel increase in the incidence of tonsillar cancer and the proportion of HPV-positive tonsillar cancer in the Stockholm area, this proportion being 23% in 1970, 68% in 2002, and 93% in 2007. Chaturvedi et al. (70) demonstrated that the proportion of OSCCs that are potentially HPV-related increased in the USA from 1973 to 2004. Pintos et al. (71) provided evidence supporting a strong causal association between HPV infection and tonsil-related cancers in Stockholm and Mont- real. The higher increase in the incidence of HPV-associated oropharyneal cancer (OPC) is also seen in developed countries, such as Sweden (69), Fin- land (72), and Czech Republic (73). In the USA, there is currently a growing incidence of HPV-associated OPC, perhaps due to changing sexual behavi- ors (70). In a systematic review of the detection of HPV-DNA in squamous- cell carcinoma of the head and neck, Kreimer et al. (74) found the prevalence of HPV to be only 24% in oral and 36% in OPC, which limits the proportion of cases attributable to this virus. Tonsil and OPC increased in male predominance between 1975 and 2004, despite reductions in smoking (75), and the estimated proportion of oral and oropharyngeal SCC attributable to HPV infection is 35%. Over 90% of HPV-positive oral cancers are HPV-16 positive (76).

Infection Infection with the human papillomavirus is an important co-factor in the development of oral carcinomas. Initially, HPV infects undifferentiated proliferative basal cells, which are capable of dividing (77). Once inside the host cell, viral DNA localizes into the nucleus and establishes itself as an episome with a low copy number (some 10–200 copies per cell). At this stage, the viral proteins E1, E2, E6, and E7 transcribed from the early promoter are expressed at a low level (78). After cell division, the daughter cells retaining the viral genome are pushed towards the suprabasal regions and begin to differentiate. This triggers a coordinated transcriptional cascade of the viral genome. Viral proteins, mainly E6 and E7, may disturb the normal terminal differentiation by stimulating cellular proliferation and DNA syn-

17 thesis by interfering with and inhibiting several cell cycle regulators to allow high-level amplification of the viral genome to at least 1000 copies/cell (79). The interactions of viral E6 and E7 proteins with p53 and pRB (80) are the best characterized interactions so far. The p53 protein, as a tumor suppressor, has a highly conserved role as “guardian of the genome,” and is central to cellular anti-cancer mechanisms (81). The tumor suppressor p53 can dic- tate cellular fate by initiating cell cycle arrest, promoting DNA repair, trig- gering apoptosis, and inducing growth arrest/senescence. Thus a direct mutation can alter or inactivate p53, and interactions with the oncogene products of oncogenic viruses (e.g., HPV) can also cause aberrations in p53 regulation (82). The late differentiation-dependent promoter is activated towards the epithelial surface, and the levels of viral proteins necessary for productive replication (i.e., E1, E2, E4, and E5) increase. After the onset of genome amplification, the capsid proteins L1 and L2 accumulate in mature epithelial cells. The assembly of infectious virions takes place in terminally differentiated cells of the upper epithelial layers, and the virions are shed to the environment as the cells are lost through desquamation. HPV infection precedes the development of HPV-positive OSCC (62, 64). A prospective study has found that increased OPC risk was observed more than 15 years after HPV exposure (64). Immuno suppression seems to be an increased risk factor for HPV-positive OSCC (62). Although evidence suggests that HPV-positive OSCC is the main cause of OSCC in nonsmokers and nondrinkers, the degree to which tobacco and/or alcohol use may help increase the risk of HPV-positive OSCC is unclear (62) and men generally have a higher incidence of oral HPV infection than do women (64). Human papillomavirus infection remains a prominent concern in both the research and medical fields. Sellors et al. (83) have clearly demonstrated that infection of the cervical epithelium with specific high-risk types of HPV plays a fundamental role in the development of cervical cancer, by causing precursor lesions and maintaining malignant growth. zur Hausen (84) demonstrated that HPV-16 plays the dominant role, followed by HPV-18. Of the numerous HPV viruses, HPV-16 is the type usually found in precancerous and cancerous lesions, followed by HPV-18. In fact, HPV-16 and HPV-18, along with 11 other virus types, are responsible for 90% of HPV infections (60). The state of the virus (i.e., whether it is maintained as an episome and not integrated, or is integrated into the host genome) seems to play an important role as well. During the normal HPV life cycle, viral DNA is maintained episomally in the nucleus of the affected cell, a state predominantly associated with “low-risk” HPV types such as HPV-6 and -11. A “hit and run” theory of HPV in oral carcinogenesis has also been proposed, suggesting that continual HPV presence is unnecessary for OSCC development (85). HPV- 16 and -18 are major risk factors for cervical adenocarcinoma (86); this pattern differs from that of OSCC, as HR-HPV vary widely.

18 1.2.2 Epstein-Barr virus (EBV) The Epstein-Barr virus (EBV), unlike other members of the human herpes virus family, was the first human tumor virus identified (87). EBV was initially seen by electron microscopy in lymphatic tissue culture cells derived from Burkitt’s lymphoma (88). Three other developments occurred in the late 1960s and early 1970s: a biological function of EBV infections was first identified in 1967 and 1968 (89), when these viral groups each revealed im- mortalizing activity of EBV-producing lethally X-irradiated Burkitt’s lymphoma cells for human lymphocyte preparations in co-cultivation experi- ments or of cell-free filtrates from an EBV-producing leukemic cell line. zur Hausen and Schulte-Holthausen (1970) demonstrated the persistence of EBV-DNA in a “virus-free” cell line, Raji, of Burkitt’s lymphoma origin. Shortly thereafter, the same group demonstrated the presence of EBV-DNA in biopsies from Burkitt’s lymphoma and from nasopharyngeal carcinomas (90). Three years later, it was demonstrated that EBV persists not only in cells of lymphatic origin, but also in epithelial nasopharyngeal carcinoma cells (91). Viral DNA persistence in Burkitt’s lymphomas was soon confirmed by Nonoyama and Pagano (1973), and in epithelial cells of nasopharyngeal carcinomas by Klein et al. (92).

Molecular Biology Two EBV subtypes have been identified, i.e., EBV-1 and EBV-2, differing in the genes coding for nuclear proteins EBNA-LP, 2,-3B, and -3C, with differences in the predicted amino acid sequence of between 28% and 47% (93). The human herpes virus family consists of three subfamilies, i.e., alpha, beta, and gamma. EBV belongs to the gamma subfamily, which is split into two genera, lymphocryptovirus and rhadinovirus. EBV is the prototype for the lymphocryptovirus because it latently infects B-lymphocytes (94). Like other herpes viruses, EBV has a toroid-shaped protein core, wrapped with DNA; a nucleocapsid with 162 capsomeres; a protein tegument between the nucleocapsid and the envelope; and an outer envelope with external glycoprotein spikes. The EBV stores its genome in the form of a linear, double- stranded, 172 kbp DNA molecule (95). In vivo, the infection is restricted to two target cells, the oro-nasopharyngeal or the salivary gland epithelium and B-cell lymphocytes (96).

Epidemiology EBV is one of the most common and widespread human viruses, infecting over 95% of people worldwide. Most healthy carriers are infected during childhood without any clinical symptoms. If the primary infection is delayed until adolescence or young adulthood, approximately 50% acquire infectious mononucleosis, a benign, self-limiting disease characterized by fever, sore

19 throat, tonsillitis, lymphadenopathy, and benign lymphoproliferation in peripheral blood. After acute infection with or without symptoms, latent EBV infection will persist lifelong. The high global prevalence of this infection has caused substantial problems in explaining its role in malignant diseases, specifically in view of the wide variation in geographic endemicity of some EBV-linked cancers (97). EBV infects individuals in all societies (98), even individuals in the most remote and isolated tribes, such as those in the Mela- nesian islands (99) and the Amazonian plateau (100). EBV infection takes place at a much lower age in primitive than in industrial societies, where there are significant differences in infection between socioeconomic classes (101). In Uganda (Africa), for example, all children under three years of age have been infected by EBV, whereas in Singapore (Asia), only 20% of children are EBV infected at that age (101). There are, however, geographic and/or racial differences in the type of EBV-associated disease that affects the population; for example, Chinese in Hong Kong and Singapore have a high incidence of nasopharyngeal carcinoma; Malays and Indo–Pakistanis have a low risk of nasopharyngeal carcinoma and Burkitt’s lymphoma; and Ugandans have a high prevalence of infectious mononucleosis (101). The virus has also been recognized as an important pathogen in individuals lacking cellular immunity because of genetic defects, immune suppression for organ transplantation, or loss of immune function due to HIV infection. In immune-suppressed patients, EBV causes a variety of proliferative disorders including AIDS-associated immunoblastic lymphomas, oral hairy leukoplakia, and an unusual tumor of muscle origin (leiomyosarcoma) in children with AIDS or those who are under immune suppression after liver transplantation (102). However, other factors may be important: specific failure of immune recognition, stimulation of B-cell proliferation by other infections or antigens, and/or acquisition of secondary genetic aberrations or mutations (103).

Infection EBV has the ability to establish a latent infection, which means a silent state of viral infection characterized by the low expression of viral genes and mi- nimal cytopathic effects or production of infectious virus. Epstein-Barr virus has been identified as the causative agent of infectious mononucleosis (104), a self-limiting lymphoproliferative disease, developing as the consequence of hyperproliferation of EBV-containing B cells and reactive T-cell response. The primary infection frequently occurs in the first years of life (99) and is often not noticed by the infected person. In young adults raised in a hygienically protected environment, primary EBV infection more often leads to sometimes severe symptoms of infectious mononucleosis. EBV enters the host through the oropharynx and is believed to initially infect either squamous epithelial cells or resting B cells at or near the surface of the tonsillar epithelia or other lymphoid organs in Waldeyer’s ring. Thus, EBV has de-

20 veloped a way to simultaneously access both B cells and squamous epithelial cells of the oropharynx. However, B cells are currently considered necessary and sufficient for EBV infection, while epithelial cells may be seen as helpful enhancers for transferring the virus to others, and for establishing latency in B cells (105). If an EBV-infected memory B cell differentiates to a plasma cell, the virus is released for further infectious spread (106). In most cases, transmission occurs orally via the saliva, leading to the original name of infectious mononucleosis, college or kissing disease (Hoagland 1955). EBV infection has been linked to several human malignancies, including B-cell lymphomas in immunocompromised patients, the endemic form of Burkitt’s lymphoma, nasopharyngeal cancer, a subset of Hodgkin’s lymphoma, nasal natural killer (NK)/T-cell lymphomas, and approximately 10% of gastric cancers (97). Although EBV was initially recognized as a B-lymphotropic virus, it has recently become clear that the virus can infect epithelial cells as well, probably depending on the production of specific glycoproteins, i.e., gHgL (107) or gp 110 (108). EBV gene products synthesized in latent infections are of particular interest in relation to the oncogenic properties of this virus. A number of gene products have been characterized that are expressed in specific tumors or in nontransformed, latently infected cells. Some of these share structural and functional homologies with cellular gene products, or interfere with the function of the latter. The nuclear EBNA-1 protein is consistently expressed; this is a sequence-specific DNA-binding phosphoprotein that plays a central role in the episomal maintenance of the EBV genome and is required for its DNA replication (109). EBV infects two types of target cells: epithelial cells in the oro/nasopharynx and/or salivary gland, and the B-lymphocytes (96). EBV is also suspected of infecting cervical epithelial cells (110). EBV is associated with infectious mononucleosis and oral hairy leukoplakia (non-malignant disorders) (111) and with Burkitt’s lymphoma and nasopharyngeal carcinoma (NPC), both of which are malignant disorders (90). EBV has been found in normal oral epithelium and in oral squamous cell carcinoma (112).

1.2.3 Herpes simplex virus type 1 (HSV-1) Herpes simplex virus infections are very common and affect a high percent- age of all human populations. In 1962, Schneweiss identified two serotypes, subsequently confirmed by Nahmoas and Dowdle (1968). Whereas HSV-1 is found predominantly in oropharyngeal infections, HSV-2 has a strong predi- lection for anogenital sites. Both types of viruses cause a large range of clinical symptoms. Their molecular biology and some clinical aspects of herpetic infections have been described extensively elsewhere (Roizman 1996). Additional experimental studies, however, seemed to support a possible role of HSV in human cancers. These originated in part from reports of HSV-DNA or RNA persistence in cervical cancer cells: in 1972, Frenkel et

21 al. and in 1973, Roizman and Frenkel, identified a fragment of HSV-2 in one cervical cancer biopsy and also analyzed transcripts of this DNA (97). The clinical manifestations of oral herpetic infections have been known for 250 years, though the causative agent was not identified as a herpes virus until the twentieth century.

Molecular biology Herpes simplex actually belongs to a family of eight related viruses, including herpes simplex virus types 1 (HSV-1) and 2 (HSV-2), varicella-zoster virus, Epstein-Barr virus, and cytomegalovirus. All of these organisms are double-stranded DNA viruses that affect the skin, mucous membranes, and, less frequently, the esophagus and brain. Like all herpes viruses, herpes simplex virus (HSV) type1 (HSV-1) and the closely related HSV type 2 (HSV-2) have enveloped, spherical virions. The genome of HSV-1 is densely packaged in a liquid-crystalline, phage-like manner in a 100-nm icosahedral capsid (113). Herpes simplex virus type 1 (HSV-1) is an important pathogen that causes a variety of clinical manifestations in humans. It has the ability to remain latent in host neurons for life, and can reactivate to cause lesions at or near the site of initial infection. One of the major features of HSV infection is the ability of the virus to remain latent in the sensory ganglia. Following HSV infection, viral replication occurs in the oral or genital mucosa and the virus enters sensory nerve endings innervating the mucosal membranes. Reactivation from the latent state results in productive infection that ultimately leads to the lytic (productive) destruction of distal epithelial cells. During the lytic cycle of the virus in cultured cells, regulation of HSV-1 replication occurs mainly at the transcriptional level and involves the coordination of three phases of gene expression. This process involves condensation of the chromatin on the lytic gene promoters followed by inactivation (114-115). The activation from the latent state can be triggered by external stimulus and results in axonal trans- portation of the virus back to the epithelium, leading to either clinical lesions or subclinical shedding.

Epidemiology Herpes simplex virus type 1 (HSV-1) infects 40–80% of people worldwide and can cause potentially fatal meningoencephalitis in adults or disseminated infection in neonates, in addition to common mucocutaneous disease. After inoculation of the skin or mucous membrane, HSV-1 is transported along sensory axons in a retrograde direction to the neuronal cell body, where it establishes lifelong latent infection. Periodic reactivation results in HSV-1 being transported in an anterograde direction to nerve terminals, where it causes recurrent clinical disease or asymptomatic viral shedding (116). In- fection with herpes simplex viruses (HSV) is very common worldwide. In European countries, the estimated prevalence of HSV-1, determined by

22 means of antibody measurements, varies between 60% and 90% in the general population (117). Since many people are infected with HSV without clinically overt symptoms, most epidemiological studies are based on serological data. As HSV-2 has a tropism for genital mucosa, HSV-2 antibodies are considered to reflect genital infection, while HSV-1 antibodies can be associated with both oral and genital infection. In a study from the USA investigating genital isolates collected from college students, it was noted that HSV-1 accounted for 78% of all genital isolates in 2001, versus 31% of the isolates in 1993 (118). In addition, in the USA, the prevalence of HSV-1 infection tends to increase in a roughly linear fashion with increasing age, the greatest rate of acquisition occurring during childhood and adolescence (119). The prevalence of HSV- 1 exceeds 40% by age 15 years and rises to 60–90% in older adults. Recent data from several European countries indicate that the prevalence of HSV-1 infection dropped from 34% to 24% among 10–14-year-olds in the 1999s (120). For many adolescents and adults in Europe and the USA, sexual activity is the means of initial exposure, resulting in an increase in genital herpes infections caused by HSV-1. A Swedish study found that 6% of such infections were due to HSV-1, while 94% of recurrent genital herpes were found to be due to HSV-2 (121).

Infection HSV skin infections are usually located in the labial, genital, or anorectal areas. Of the two serotypes, HSV-1 infection is primarily pharyngeal and HSV-2 infection is primarily genital, though HSV-1 has been found in genital lesions and HSV-2 in oral lesions. Facial herpes may also affect the trige- minal ganglion, while genital herpes can involve the sacral ganglion perma- nently infect their target cells. Herpes simplex infection generally occurs in two phases: the initial, primary infection, followed by secondary, recurrent disease at the same site. In the first phase, the virus spreads by close person- to-person contact with lesions or mucosal secretions (e.g., saliva or cervical discharge) as well as via respiratory droplets. Contrary to previous belief, the virus can be transmitted during asymptomatic periods, although the risk of transmission is higher during symptomatic reactivation. Once the virus is transmitted, incubation takes 2–10 days; the virus then spreads to regional lymph nodes, causing tender lymphadenopathy (122). Though HSV-1 infections are frequently asymptomatic, they can produce a variety of signs and symptoms. These include oral or perioral lesions, ocular infections, congeni- tal skin lesions, genital skin or mucous membrane lesions, and serious sys- temic illnesses such as encephalitis and neonatal disease. Infection transmission occurs worldwide, equally between the sexes, and without seasonal variation. In the USA, there are estimated to be approximately 500,000 primary infections per annum (123). While infection is life-long, it is rarely fatal in the immunocompetent host, producing either asymptomatic or mild

23 clinical disease. HSV-1, one of eight closely related human herpes viruses, is among the most common infectious agents in humans (124). In a study of hamsters, Stich et al. (125) demonstrated that snuff significantly enhanced herpes simplex virus–associated development of microinvasive SCC in cheek pouch epithelium. In a study of rats, Larsson et al. (126) demonstrated that HSV-1 and snuff interact in the development of malignant lesions, and Hirsch et al. (127) demonstrated that the incidence of malignant tumors was significantly higher in rats exposed to snuff and HSV/snuff than in control animals.

1.3 Tobacco habits The International Agency for Research on Cancer (IARC) confirmed that smoking various forms of tobacco (e.g., cigarettes, cigars, and pipes) is carcinogenic to humans. Other forms of tobacco, known as smokeless tobacco (ST), are also reported to be associated with an increased risk of developing OSCC. ST products contain a large array of carcinogens, although the actual number found is smaller than in cigarette smoke (128). There are two main types of ST: chewing tobacco and snuff. Chewing tobacco in the form of loose leaf, cut, or shredded tobacco is universally available. Snuff for oral application, “dipping,” or sucking is dry or moist and is commercially available as loose or as portion bag-packed products. Some regulations exist regarding sales and distribution. Finely powdered tobacco marketed as dry snuff is used nasally by a few population groups. World- wide, various names are used to denote ST products: plug, gutkha, khiwam, khaini, iq'milk, zarda, naswar, nass, chimo, toombak, shamma, gudhaku, gul, mishri, maras, and moist snus. Smokeless tobacco is used in different forms in different parts of the world and approximately 150 million people use it worldwide (129). All smokeless tobacco products contain nicotine, a potent addictive substance. Tobacco contains high levels of tobacco-specific nitrosamines (TSNAs), which are the major carcinogens in the several forms of smokeless tobacco used around the world. Studies in India, Pakistan, and Sudan have reported large increases in the risk of oral cancer related to the use of various smokeless tobacco products (129). Benzo[a]pyrene and other polycyclic aromatic carcinogens (PAHs) are the most important carcinogenic agents in cigarette smoke; in unburnt tobacco, however, nitrosamines are the strongest carcinogens (130). The metabolites of nitrosamines, particularly nitrosonornicotine (NNN) and 4-(methylnitrosamine)- 1-(3-pyridyl)-1-butane (NNK), are found locally in the saliva of ST users and in their body fluids. These agents are known to cause toxic effects, particularly cancer (130) and other cellular and DNA changes, either at the local placement sites or indirectly and systemically. Epidemiological evidence of a signifi-

24 cantly increased risk of oral cancer in ST users was recently reviewed (128). Even ST products that are claimed to be low in nitrosamines likely raise the risk of oral cancer among users by up to 30% (131).

1.3.1 Snuff Among the high-income countries, Sweden has the highest per capita consumption of smokeless tobacco, predominantly in the form of oral moist snuff. Swedish snuff (snus) contains lower levels of some harmful substances, for example, nitrosamines, than do many brands available in North America and some low-income countries (132). Hirsch et al. (133) reported eight oral cancer cases among Swedish snuff dippers: seven of these were elderly males who had used snuff for longer than 20 years (an additional four cancers cases have been documented; personal communication, Dr. Hirsch). Their cancers developed at exactly the location where the snuff was placed, mostly on the upper vestibulum, and all were pathologically confirmed as SCCs. Zatterstrom et al. (134) described another case of well-differentiated oral carcinoma in a 90-year-old Swedish man who had been a habitual snuff- dipper for 70 years. In a population-based prospective study, Rossaar et al. provided suggestive evidence that snus-related risks cannot be lightly ig- nored, evidence inconsistent with claims that the use of Scandinavian moist snus is without demonstrable risk (135). In a study of the interactive effect of Swedish snuff and Sudanese toombak on human oral cells, Costea el al. demonstrated that toombak has greater potential to induce abnormal development of normal mucosa than does Swedish snuff (136). In a population- based case–control study in southern Sweden, Rosenquist et al. (137) demonstrated that both tobacco smoking and alcohol consumption are risk factors for oral and oropharyngeal SCC, and that using Swedish moist snuff had no effect on the risk.

1.3.2 Betel quid Betel quid/areca nut use has long been common in South and Southeast Asia and the Asia Pacific region and is common among migrant communities in Africa, Europe, and North America. Because of its ancient history, its use is socially acceptable throughout society, including by women and, quite often, children. Areca nut (usually incorporated into betel quid) is the fourth most common psychoactive substance in the world, after caffeine, alcohol, and nicotine, being used by several hundred million people. In its most basic form, betel quid is a combination of betel leaf, areca nut, and slaked lime (aqueous calcium hydroxide paste). A major change in betel quid/areca nut use occurred in India when an industrially manufactured mixture of areca nut, lime, a catechin-containing substance, sandalwood fra- grance, and tobacco was introduced to the market in small aluminum foil

25 sachets. This product was termed gutka, while the same product without tobacco was termed pan masala. It is now well accepted that the use of areca nut causes oral submucous fibrosis (OSMF) (138). According to IARC, there is evidence of the carcinogenic risk of chewing betel quid with or without tobacco (128). When betel is chewed, it produces mild psychoactive and cholinergic effects. It prompts copious production of a blood-red saliva that can stain oral structures. After years of chewing, the teeth may become red-brown to near- ly black. Betel use is associated with oral leukoplakia, submucous fibrosis, and SCC (139).

1.3.3 Toombak In Sudan, smokeless tobacco (ST) is usually used in a form of oral dipping tobacco, locally called toombak, that was introduced over 400 years ago (140). Toombak is not chewed but dipped and retained between the gums and the lips, cheeks, or floor of the mouth, and sucked slowly for approximately 10–15 min (141). The tobacco used for manufacturing toombak is Nicotiana rustica, and the fermented ground powder is mixed with an aqueous sodium bicarbonate solution. The resulting product is processed into a loose moist form with a strong aroma, and its use is widespread in the country; popular brands of toombak are Saute’, El-sanf, Wad Amari, and Sultan El-kaif (141). Sudanese snuff or toombak differs from the types of snuff used in Scandinavia and the USA in terms of tobacco species, fermentation, aging, manufacturing methods, pH, moisture, and nitrosamine content (141). The factors of toombak believed to have significant adverse health consequences, particularly in terms of addiction and oral cancer development, are its pH and high levels of tobacco-specific nitrosamines (TSNAs) (141). Toombak has a pH range of 8–11, with a moisture content of 6–60%, nicotine content of 8–102 mg/g dry weight, and TSNA contents in micrograms, i.e., Ń-nitrosonornicotine (NNN), 420–1550 µg/g; 4-(methyl-nitrosamine)-1- (3-pyridyl)-1-butanone (NNK), 620–7870 µg/g; N-nitrosoanatabine (NAT) 20–290 µg/g (140). TSNAs, particularly NNN and NNK are found in the saliva and body fluids of toombak dippers (141-143). Compared with snuff from Sweden and the USA, toombak contains 100-fold higher levels of TSNAs (130). Toombak dippers develop a clinically and histologically characteristic lesion at the site of dipping. Researchers have demonstrated that the use of toombak plays a significant role in the etiology of oral SCCs, the tobacco- specific nitrosamines present in toombak possibly acting as principal carcinogens (140, 144-145). In addition to play a major role in the etiology of oral cancer toombak is suspected to be associated with neoplasm of salivary glands (20, 146-147).

26 2. Aims of the study

There is clear evidence that viruses can cause malignant cell transformation, including oral cancer. Exposure to the lifestyle factors tobacco and alcohol are also closely related to the transition of normal tissue to malignancy. This series of studies investigates the prevalence of the virus infection and tobacco exposure risk factors, with a special focus on HPV, EBV, and HSV-1 and various non-smoked tobacco-using habits. We compared tissue samples from the two countries, India and Sudan, from two continents having documented high incidence of intra oral cancer, with specimens from Sweden, with its known low incidence of oral cancer. Each region has, in addition to smoking, unique non-smoked tobacco habits with documented carcinogenic effects. These countries also typify areas of low and high socioeconomic living conditions with their expected impact on disease development.

The specific aims of the included studies are:

I To develop and optimize a rapid, reliable technique for DNA extraction from archival paraffin-embedded biopsies that would minimize contamination risk and the loss of biopsy material and that would produce adequate DNA for PCR analysis.

II To study the presence of human papillomavirus (HPV) in a Swedish population with varying oral lesions.

III To study the prevalence of viral (i.e., HPV, HSV, and EBV) infections in patients from India diagnosed with OSMF and OSCC.

IV To study the prevalence of viral (i.e., HPV, EBV, and HSV) infections in Sudanese dippers of N-nitrosamine-rich toombak.

27 3. Materials and methods

3.1 Population, patients, and sample collection

Study I The objective of this paper was to elaborate and optimize a method for DNA extraction from archival tissue biopsies. The results were not analyzed with regard to the patients’ previous inferred tobacco-use history, lesions, or diseases. Archival formaldehyde-fixed and paraffin-embedded biopsies of 24 oral cancers, 10 colon cancers, two breast cancers, 10 normal interstitial mucosa, and six anal warts were obtained from the Department of Pathology, Sahlgrenska University Hospital/Östra (Gothenburg, Sweden) and the De- partment of Oral and Maxillofacial Surgery, University of Uppsala (Upp- sala, Sweden). Distilled water, fresh colon cancer biopsies, extracts of cultured HeLa cells, and housekeeper gene β-actin were used as controls.

Study II This study of virus prevalence in various oral lesions was performed on a Swedish cohort of patients. The study included 53 patients (33 men and 20 women, mean age 62.0 ± 15.2 years), of whom 24 had oral SCC (18 men and 6 women, mean age 66.8 ± 16.8 years), seven had oral leukoplakia, one of which was dysplastic (5 men and 2 women, mean age 60.4 ± 14.3 years), and 22 had OLP (10 men and 12 women, mean age 57.3 ± 12.7 years). All patients were asked to complete a questionnaire that focused on their tobacco- and alcohol-use habits over the last five years. The control group consisted of 12 patients (6 men and 6 women, mean age 56.8 ± 14.6 years), attending the same clinics, with clinically healthy oral mucosa, no or only moderate alcohol consumption, and no tobacco-use habits. All patients were referred to the Department of Oral & Maxillofacial Surgery, Faculty of Odontology, Sahlgrenska Academy at Gothenburg University (Gothenburg, Sweden) and the Department of Surgical Sciences, Oral & Maxillofacial Surgery, University Hospital (Uppsala, Sweden). The specimens were fixed in 4% neutral buffered formalin solution, embedded in paraffin.

Study III This prevalence study of HPV, EBV, and HSV in patients with OSMF and OSCC from India was performed using paraffin-embedded biopsies.The

28 study was conducted in 12 OSMF patients and 62 OSCC patients, all from Allahabad in northern India. The patients were interviewed regarding their oral habits, such as betel chewing, smokeless tobacco use, tobacco smoking, and years of usage.The material was obtained from patients after obtaining informed consent and in accordance with the Helsinki Declaration.

Study IV This study obtained paraffin-embedded biopsies for study of HPV, EBV, and HSV infections in Sudanese toombak dippers. The study subjects were recruited from three groups. The first group consisted of healthy toombak users (n = 150) and healthy non-toombak-using (n = 25) citizens of Khartoum, Sudan, with clinically healthy oral mucosa who volunteered to participate. The second group consisted of biopsies from toombak users (n = 25) and non-toombak users (n = 6) with dysplasia. The third group of study subjects consisted of biopsies from oral cancer patients in Sudan who were toombak users (n = 145) and non-toombak users (n =72). Groups 2 and 3 were referred to the Oral Surgery Department of the Khartoum Teaching Dental Hospital (Khartoum, Sudan), where biopsies were obtained and later made available from the Department of Oral Pathology of the same dental hospital. The material was collected in connection with interviews regarding tobacco- use habits and in connection with consultations regarding oral health problems. The material was obtained from patients after obtaining informed consent and in accordance with the Helsinki Declaration.

Table 1. Patient characteristics, tobacco-use habits, and diagnoses (studies II-IV) Sweden India Sudan N N N Total number of samples 65 74 423 Female 26 15 94 Male 39 59 329 Age (year mean ± SD) 62.0 ± 15.2 49.4 ± 12.5 53.9 ± 12.9 Tobacco-use 51 74 320 Diagnosis OSCC 24 62 217 OSMF - 12 - OL 7 - - OLP 22 - - Dysplasia - - 31 Clinical healthy 12 - 175

29 The methods used in this work are described in detail in the studies I–IV.

3.2 Cell and biopsy processing The cells from the biopsy brushes were suspended in tubes containing 10% phosphate-buffered saline (PBS). The participants subsequently gargled with saline, and the suspension obtained was added to the same tube, which was centrifuged twice at 1000 rpm for 5 min; the supernatant was collected and frozen at –70°C until used for DNA extraction. Surgical biopsies were obtained under local or general anesthesia. The biopsy specimens were fixed in 4% neutral buffered formalin solution and then embedded in paraffin. The material was obtained from patients after obtaining informed consent and in accordance with the Helsinki Declaration.

3.3 DNA extraction Several factors affect the results of DNA analysis and PCR form paraffin- embedded specimens; type of fixative is known to be the most important such factor (148). There are five central components of a PCR: oligonucleo- tide primers, DNA polymerase, reaction buffer (including MgCl2), dNTP, and target DNA. Except for the target DNA, all other components are available from commercial suppliers (149). Template DNA provides the source of DNA to be amplified. As template DNA is the only reaction component that can be supplied by the individual user, it has been identified as a major source of variability in many PCR applications. The quality, quantity, and purity of target DNA can all influence the reaction results (149). Molecular studies of fresh tissues may be quite easy to perform, since good-quality DNA or RNA can usually be extracted from them. DNA obtained from old material, however, is often impure and of low molecular weight; it may contain many single-strand nicks and breaks, making it difficult to analyze. Furthermore, the available tissue biopsies are often very small. The most frequently used method to preserve human tissue is fixation in formalin, followed by paraffin embedding. Paraffin (wax) is made from petroleum products and consists mainly of carbon hydrates with a molecular formula of C20H40. These carbon hydrates are dissolvable in benzene, xylene, chloroform, and ether but not in water, acetone, or ethanol. Paraffin is colorless or white, having a density of 0.90 g/L and a melting point of 50–57°C (150). Since paraffin interferes with subsequent PCR, thorough dewaxing is mandatory. In study I, the incubation time for proteinase K was brief, only 15 min, but sufficient for our PCR applications. We specifically developed a method to extract DNA from small amounts of tissue. Extraction of DNA from

30 small, limited quantities of tissue can be unreliable, produce poor yields, and become excessively contaminated with external DNA. In study I, we applied our knowledge of DNA extraction to improve and optimize extraction from paraffin-embedded tissues. A QIAquick spin column (QIAGEN GmbH, Germany) was put into a 1.5-mL eppendorf tube (Fig. 1). A 5-µm wide of the paraffin-embedded biopsy was put into the column, 250 µL of xylene was added, and the tube was put into a 60°C water bath for 5 min. The tube was centrifuged for 30 s at 12800 × g and the column was moved into a new tube; 250 µL of 99.5% ethanol was added, and the tube was centrifuged for 30 s at 12800 × g, after which 50 µL of acetone was added, drop by drop, and the tube was centrifuged again for 30 s at 12800 × g. The column was moved into a new tube, 200 µL of digestion buffer (50 mM Tris, pH 8.5; 1.0 mM EDTA; 0.5% Tween 20) and 2 µL of proteinase K were added, and the tube was put into a 55°C water bath for 15 min. The tube was then centrifuged for 5 s at 12,800 × g to transfer the DNA solution to the tube, and the column was subsequently discarded. The tube was heated to 95°C for 7 min to inactivate the proteinase K. The extracted DNA was pooled and finally stored at –20°C. To maximize the amount of DNA extracted from the sample, this last step can be repeated a second time, as follows: The column is put into a new tube with 150 µL of digestion buffer and 1 µL of proteinase K; the tube is then put into a 55°C water bath for 10 min, after which it is centrifuged for 5 s at 12800 × g. The DNA solution is then in the new tube and the column can be discarded. The tube is finally heated again to 95°C for 7 min to inactivate the proteinase K.

31 32

Paraffin-embedded Column Xylene + Wather bath 12800xg tissue 60 °C, 5 min 30 sec

Ethanol + 12800xg 30 sec

Acetone + 12800xg 30 sec

DNA Heated 12800xg Wather bath Digestion buffer 95 °C, 7 min 5 sec 55 °C, 15 min + Proteinase K Figure 1. Schematic of the DNA extraction method (study I) using the QIAquick spin column. All de-waxing and DNA extraction steps are performed in the same column, which minimizes the risk of material loss and contamination.

3.4 PCR assay: single, semi-nested, and nested The polymerase chain reaction (PCR) assay is a technique that offers several advantages over other methods. It requires only a small quantity of biological material and can detect the viral presence in “early” infections. PCR detection of HPV, EBV, and HSV is highly sensitive and specific, and can supplement the detection of clinical manifestations of virus-associated oral lesions (151). The PCR assay was optimized for several parameters, such as the annealing temperatures of primer pairs, primer concentration, MgCl2 concentration, Taq polymerase concentration, and number of cycles for first- and second- round PCR, to obtain best results with HPV-DNA, EBV-DNA, and HSV- DNA. In principle, each physical and chemical component of PCR can be modi- fied to produce a potential increase in yield, specificity, or sensitivity; these factors, however, are not independent of each other (152). In clinical studies, PCR techniques using either consensus primers or type-specific primers have been employed to elucidate the importance of the various HPV genotypes. The amplification of the 450-bp fragment of HPV-DNA included in the open reading frame of the L1 region was performed using degenerate primers, namely, MY09 and MY11, which cover a broad spectrum of HPV types. The primer pair MY9 and MY11 is most frequently used for amplification strategies in clinical samples (153), and the most widely used HPV-DNA consensus primers for both genital and oral samples, and have been used to discover the most common types of HPV in oral mucosa (i.e., types 6, 11, 16, and 18) (154). The choice of primer annealing temperature is probably the most critical factor in designing a high-specificity PCR. If the temperature is too high, no annealing occurs, but if it is too low, nonspecific annealing will increase dramatically (152, 155). For most assays, the optimum amount of Taq DNA polymerase is 0.5–2.5 units. Increased enzyme concentrations sometimes lead to decreased specificity (152). Nested and semi-nested PCRs often quite successfully reduce or eliminate unwanted products while dramatically increasing sensitivity (156). An initial set of primers straddling the DNA segment of interest is first amplified under standard conditions. Spurious products are frequently primed with one or both primers and contain irrelevant sequences internally. An aliquot of the reaction product mixture is then subjected to an additional round of amplification using primers complementary to the sequences internal to the first set of primers. Only the legitimate product should be amplified in this second round. This approach is often successful, even if the de-

33 sired product is initially below the level of detection by ethidium bromide staining and in the presence of visible spurious bands. Thus, semi-nested PCR, in which a second primer is internal to only one end of the target segment, can be equally effective (157). To check the quality of DNA samples, a 254-bp sequence of housekeeper gene β-globin was amplified as an internal control.

Table 2. Primer sequences used in the semi-nested and nested PCR techniques to detect EBV-DNA, HSV-DNA, HPV-DNA, HR-HPV-16, and HR-HPV-18. Target Product primer sequence gene size (bp) EBV EBNA-1 209 EBV-1 5’ATC GTG GTC AAG GAG GTT CC 3’ EBV-2 5’ACT CAA TGG TGT AAG ACG AC 3’ EBV-3 5’AAG GAG GGT GGT TTC GAA AC 3’ EBV-4 5’AGA CAA TGC ACT CCC TTA GC 3’ HSV D 142 HSV-1 5’TGC TCC TAC AAC AAG TC 3’ HSV-2 5’CGG TGC TCC AGG ATA AA 3’ HSV-3 5’ATC CGA ACG CAG CCC CGC TG 3’ HSV-4 5’ TCT CCG TCC AGT CGT TTA TCT TC 3’ HPV L-1 450 MY-11 5’GCM CAG GGW CAT AAY AAT GG 3’ MY-9 5’ CGT CCM ARR GGA WAC TGA T3’ M = A + C, R = A + G, W = A + T, Y = C HR-HPV-16 E6 120 5’TCA AAA GCC ACT GTG TCC TG 3’ 5’ CGT GTT CTT GAT GAT CTG CA 3’ HR-HPV-18 E6 100 5’ACCTAATGAAAAACGACGA3’ 5’ CGT CGT TGG AGT CGT TCC TG 3’ HPV probes GP1/GP2 5’ CTGTGGTAGATACCACWCGCAGTA3’ 5’ CCTGTTGTTGATACTACACACGCAGTAC3’ TS 221 5’ CCAACGTCACACAACCATGTGGTC3’ 5’ GGAGTTGACCAACTGCAAAGAGTG 3’ β-actin-1 254 5’ GTGCTTTGATGGAAGTTGAGGTAG 3’ β-actin-2 5’ GAGCGGGAAATCGTGCGTGACATT 3’

3.5 Sequencing DNA sequencing based on separating fluorescently labeled DNA fragments is a tremendous tool for understanding diseases, gene regulation, and meta- bolic pathway reconstruction. The advent of automated high-throughput DNA sequencing methods has greatly enabled genome sequencing strategies, culminating in determination of the entire human genome (158). In studies III and IV, PCR products from HSV, EBV, and HPV were se- quenced with fluorescent dye-labeled dideoxynucleotides and cycle sequencing methods using the BigDye Terminator Cycle Sequencing Kit (PE Ap- plied Biosystems,USA). Sequencing products were purified of unincorporated dye-labeled dideoxynucleotides by processing them through Centri-Sep spin columns (PE Applied Biosystems). Sequence analysis was

34 automatically performed on the ABI PRISM™ 310 Genetic Analyzer and ABI PRISM ®377 DNA Sequencer (PE Applied Biosystems). For DNA versus DNA comparison, the Basic Local Alignment Search Tool (BLAST; http://blast.ncbi.nlm.nih.gov/Blast.cgi) program is typically used to find identical sequence regions in a database. We used this database to find the homology of the HPV-, EBV-, and HSV-positive PCR products, and found 100% homology.

3.6 Southern blot hybridization Southern blot hybridization (SBH) has been used in diagnosing many human diseases at the molecular level. Nucleic acid hybridization is a process in which complementary single strands of nucleic acids combine to form a stable double-stranded nucleic acid molecule. In study II, SBH with labeled HPV probes was used to detect specific HPV-DNA sequences and confirm the HPV-DNA PCR results obtained with the HPV consensus primers. The main disadvantages of SBH compared with PCR are low sensitivity, large amounts of cellular DNA required, and greater expense (159). How- ever, despite these drawbacks, SBH is useful for confirming PCR results, especially in the case of paraffin-embedded tissue samples, in which background amplification bands may preclude interpretation of data from ethidium bromide staining (160).

35 4. Statisics

In study II, the Chi-square test was used to investigate the difference in HPV prevalence between controls and tobacco and/or alcohol users, and a repeated-measure ANOVA was used to compare continuous tobacco-use and alcohol-use data. In studies III and IV, the Chi-square test was used to evaluate statistically significant differences in the genotypic frequency of HPV, EBV, and HSV viral infections in the studied populations. Since the studied populations and tissue procurement methods were not standardized between the studied groups, we have refrained from statistically analyzing the differences between these populations and patient groups. The Statistical Package for the Social Sciences (SPSS for Windows, version16.0; SPSS Inc., USA) was used for statistically analyzing the clinical variables. In all analyses, the p-values were considered significantly different if p < 0.05. For description of the data, mean values and 95% confidence intervals (CI) were calculated.

36 5. Results

5.1 Development of DNA extraction method (study I) All analyzed biopsies were positive for housekeeping gene β-actin and the thymidylate synthase (TS) gene after DNA isolation with one round of proteinase K digestion. TS and β-actin genes were successfully amplified from the oldest biopsy in the study, a 36-year old breast cancer biopsy. PCR with HPV consensus primers revealed an HPV prevalence in oral biopsies, con- sistent with previously published results. PCR assays on the six anal papil- lomas were positive for TS, β-actin, and HPV. DNA extraction was performed three times for each biopsy, and the amount of DNA increased as measured spectrophotometrically. The second extraction increased the amount of harvested DNA by a mean of 41.7 ± 21.2% (± standard devia- tion), and the third extraction resulted in an average 5.0 ± 3.7% increase in harvested DNA. When a skilled laboratory technician executed the described DNA extraction method, 10 samples could be conveniently processed simultaneously, and the first round of extraction was completed within 25 min. When three rounds of DNA extraction were used, the procedure required 50 min. When samples from the 24 OSCC biopsies were extracted, using the presented method, the average DNA concentration was 228.8 ±120.8 µg/mL, comparable to DNA extractions using the classical method (161), with an average DNA yield of 232.7 ± 120.0 µg/mL.

Figure 2. Nusieve agarose gel (3%) electrophoresis of HPV-DNA PCR products. Columns 1, 2, and 4 show positive samples, columns 3 and 5 negative samples, column 6 molecular the weight marker (fast Ruler, DNA ladder, Middle range, fermen- tas), column 7 the positive control: Hela cell lines (ATCC no. CCL 2), and Column 8 the negative control: PCR reaction mix without DNA.

37 5.2 HPV prevalence in oral lesions (studies II–IV) In study II, 11 of the 53 (20.8%) patients were HPV positive, with 6 of 22 (27.3%) OLP patients being HPV positive, as well as 2 of 7 (29.6%) LP patients, and 3 of 24 (12.5%) OSCC patients. The differences in HPV prevalence between the OSCC, OLP, and LP subgroups were not statistically significant. All 12 control patients were HPV negative. The PCR results using HPV consensus primers were confirmed by subsequent southern blot hybridization with consensus probes. In study III, HPV-DNA was detected in 11 of 12 (91%) of OSMF samples, versus in 15 of 62 (24%) OSCC samples. These differences were statistically significant for HPV (p = 0.00002). In study IV, HPV-DNA was detected in 60 (40%) of the brush biopsies from the toombak users, 17 (68%) of the samples from nonusers, 39 (27%) of the biopsies from oral cancer lesions in toombak users, and 15 (21%) of the samples from nonusers. HPV was not detected in any sample exhibiting dysplasia.

5.3 EBV-prevalence in oral lesions (studies III and IV) In study III, EBV-DNA was detected in 3 of 12 (25%) OSMF samples versus 18 of 62 (29%) OSCC samples. In study IV, EBV was detected in 97 (65%) of the brush biopsies from toombak users, 21 (84%) of the samples from nonusers, 8 (32%) of the biopsies from toombak users with dysplasia, 4 (67%) of samples from nonusers, 53 (37%) of the biopsies from toombak users with oral cancer lesions, and 16 (22%) of samples from nonusers. The differences between groups in terms of tobacco exposure and virus prevalence are not comparable, as the groups were not random samples of the population, but recruited from different patient groups.

5.4 HSV prevalence in oral lesions (studies III and IV) In study III, HSV-DNA was found in 1 of 12 (8%) OSMF samples versus 3 of 62 (5%) OSCC samples. These differences were not statistically significant for HSV (p = 0.515). In study IV, HSV-DNA was detected in 44 (29%) of the brush biopsies from toombak users, 6 (24%) of the samples from nonusers, 2 (8%) of the biopsies from toombak users with dysplasia, 1(17%) of the samples from nonusers with dysplasia, 15 (10%) of the biopsies from oral cancer lesions in toombak users, and 5(7%) of the samples from nonusers. The difference between groups in terms of tobacco exposure and virus prevalence is not

38 comparable, as the groups were not random samples of the population, but recruited from different patient groups. Analyses indicated no significant difference in the frequency of HPV or HSV, while the prevalence of EBV was significantly higher in toombak- using OSCC patients. We also compared the distribution of HPV, HSV, and EBV prevalence in groups I and II. No statistically significant differences in virus prevalence were found in patients with dysplasia. In patients with clinically normal oral mucosa (based on brush biopsies), we found a significantly increased prevalence of HPV and EBV in non-toombak users, whereas prevalence of HSV did not differ.

5.5 The prevalence of viruses in various populations (studies II-IV) The prevalence of HPV, EBV, and HSV in Sweden, India, and Sudan are summarized in fig. 3, which presents the results (%) of studies II–IV.

Figure 3. The presence (%) of HPV-DNA, HSV-DNA, and EBV-DNA in oral tissue from three populations from Sweden, India, and Sudan.

40 5.6 HPV typing (studies II and III) In study II, 6 samples were positive for HPV-18, 3 for HPV-16, and 3 for HPV-6/11; the 3 samples positive for HPV-16 were also positive for HPV- 6/11. Two of the samples, found to be positive with the consensus primers, were found to be negative with all three type-specific primers. Of the 3 HPV-positive OSCC samples, 1 was positive for HPV-18 and 1 for HPV-16 and -6/11;1 sample was negative for all type-specific primers. Of the 6 HPV- positive OLP samples, 5 were positive for HPV-18, but 1 was negative for all type specific primers. The 2 HPV-positive leukoplakias were positive for both HPV-16 and -6/11. In study III, the frequency of HPV-16 DNA was 50% (6/12) in the OSMF and 11% (7/62) in the OSCC samples, while the frequency of HPV-18 DNA was 17% (2/12) in the OSMF and 5% (3/62) in the OSCC samples.

5.7 Coexistence (studies III and IV) In study III, HPV and EBV coexisted in 17% (2/12) of the OSMF group and 13% (8/62) of the cancer group. In study IV, more than one virus was detected in 45% (68/150) of the brush biopsy samples from toombak users, 68% (17/25) of the samples from nonusers, 16% (23/145) of the samples from toombak users with OSCC, and 11% (8/72) of the samples from nonusers with OSCC (see Table 3).

Table 3. Distribution of coexistence of viral infections in brush biopsies from healthy oral mucosa and OSCC patients from Sudan and in OSMF and OSCC patients from India. Sudan India Healthy OSCC OSMF OSCC Tobacco habits Yes No Yes No Yes Yes Samples (N) 150 25 145 72 12 62 Viral DNA (%) HPV+EBV+HSV 9 4 2 3 0 0 HPV + HSV 1 8 2 0 0 0 HPV + EBV 25 48 10 7 17 13 HSV + EBV 11 8 2 1 0 0

41 6. General discussion

Cancer of the oral cavity is the 10th most frequent cancer for men and 14th for both sexes world wide (8) and is increasing. This is partly ascribed infection with human papillomavirus (HPV), particularly type 16 and 18 which is increasing in those diagnosed with malignancy and they do not present the traditional risk factors. This new and rapidly growing younger group where males slightly outnumber females is infected with the same type of virus responsible for most cervical cancers. Oral cancer in this group tends to develop in the Waldeyer's tonsillar ring. Recent data suggest that the disease from this particular etiology have some slight survival advantage. However, survival rates for oropharyngeal cancer (OPC) is poor although it varies widely depending on the original location, and the extent of the disease. The use of tobacco is common and the use of non smoked tobacco is growing popularity due to intensive marketing word wide. This together with the fact that more people are infected with the sexually transmitted virus means that the health care providers face a new and difficult situation in preventive medicine. Therefore more studies are needed in order to clarify the different aspects of virus involvement.

The health of the oral mucosa is affected by the general health of the individual and the nutritional status plus factors such as exposure to microorgan- isms, chemical, thermal, and mechanical agents. This is summarized by Bundgaard et al. (162) and Rosenquist et al. (163) who underlined that oral cancer is a lifestyle-related disease to a great extent and demonstrated a clear relationship between marital status, inadequate dental situation not acceptable oral hygiene and oral cancer . In this thesis exposure to viral infection in relation to tobacco consumption has been studied in three different cohorts of patients with regard to oral cancer and premalignant lesions. Genetic susceptibility and socioeconomic status were not similar for the samples and the difference in results between the three populations investigated may be related to these and other factors. Geographic/regional variations in the prevalence of pre-cancer and cancer support the opinion that the socio-cultural lifestyles of a population play an important role in the etiology and pathogenesis of oral cancers (164). Dietary habits are an important expression of socioeconomic status or life style. Cur-

42 rent reviews of studies conducted in the last two decades had presented evidence towards the possible protective effects of some nutrients (165-166). Many studies have found that high fruit and vegetable intake was associated with significantly decreased risk of oral cancer (167-169). An accumulation of evidence suggests that vitamin A, C and E and carotenoid (in particular beta-carotene) may decrease the incidence of epithelial cancer (170). Other protective roles of micronutrients are modulation of carcinogen metabolism which affects cell transformation and cell differentiation. They may also inhibit cell proliferation, oncogene expression, immune function and inhibition of endogenous carcinogen formation. These factors are also relevant in tobacco users. Pamuk et al. (171) has shown that tobacco users have lower plasma concentrations of carotenoids and beta-carotene than non tobacco habitués. Body mass index has also been related to OSCC both as a risk factor for and a marker of the disease. It has also been reported that the relation between BMI and oral cancers differ between tobacco users and non tobacco users (172-173). Numerous studies have been published on the prevalence of oral cancer in different countries and populations within countries but the influence of exogenous factors compared to familial and genetic factors is not fully elucidated (174). Exposure to life style factors as a cause of oral cancer is well accepted and investigated. Part of the life style is exposure to infectious agents and its etiological role in tumor development is also convincing [for review see zur Hausen (60) ]. Virus as a cause of cancer has attracted particular interest for specific tumors for example cervical cancer. A parallel explanation for oral malignancies has been put forward. However the importance of virus in head and neck cancer is less well established although constantly more data is evolving (175). Specifically the possible interaction between virus, smokeless tobacco and other exogenous factors in the development of oral cancer is still not clarified although it has been shown that tobacco interact with the virus replicative cycle from attachment to host cell to DNA formation, and suggested that this plays a part in malignant cell transformation [ for review see Larsson (176)]. It has been suggested that virus may represent an alterna- tive pathway in carcinogenesis in the absence of tobacco and alcohol habits, and without any obvious predisposing genetic defect (177). It is evident that the role of viral infection, the specific identification of tissues that harbour these viruses and the way virus persist in normal and tumour tissues are not fully elucidated (178). The studies presented in paper II-IV have focused on identification of viral genome in healthy oral mucosa, possibly premalignant lesions and OSCC. There are clear limitations in our material when investigating the prevalence of HPV, EBV and HSV. The patients with oral lesions were selected among patients with clinical symptoms and the control patients in paper IV constitutes a selected cohort of citizens in the city of Khartoum and we do not have knowledge about the patient’s socioeconomic status, nutritional

43 status, previous health history nor family relations. The patient groups from Sweden, Sudan and India also differ in lifestyle and live under different socioeconomic conditions. It has previously been pointed out in a population- based case-control study from southern Sweden that poor oral hygiene and inadequate dental status are independent risk factors for OSCC and OPC , irrespective of tobacco and alcohol consumption (163). The use of different methods for sample collection, use of paraffin embedded tissues and brush biopsies also influence the possibility of comparing virus prevalence in the three studies (II-IV). This makes it ambiguous to consider the results repre- sentative for the total situation in these three countries but the results indicate differences in the prevalence of HPV, EBV and HSV in oral lesions and normal oral mucosa. In Sweden, population registers and cancer registers covering the whole population are available. This makes Sweden well suited for studies with a case – control design. Collection of materials from population-based registers lowers the risk of selection bias. On the other hand population register are also extremely insufficient with regard to information on relevant health history of affected patients.

To study virus prevalence in tumor tissue the development of PCR was a major improvement. Initially the method required DNA samples of high quality i.e. fresh tissue samples. Following the development of molecular biology during the last decade’s extraction methods for DNA from archival material has evolved. The most frequently used method to preserve human tissue is fixation in formalin, followed by paraffin-embedding. This treatment and storage of DNA might affect its stability (164). Previously available techniques to extract DNA from paraffin-embedded tissues were time- consuming and often resulted in fragmented DNA, which is difficult to analyze with PCR (179). The initial paper in this thesis presents an improved method for DNA extraction. The ambition was also to speed up the method for extraction of DNA. The previous methods required overnight procedures for the DNA extraction and the risk for contamination DNA was relative extensive (180-181). The elaborated method was also reliable for extraction of DNA from “old” biopsies. The human thymidylate synthase (TS) gene and the “housekeeping gene” β-actin were successfully amplified from the oldest biopsy, a 36-year old breast cancer biopsy. DNA extraction was fast and smooth, taking less than 30 minutes and multiple biopsies can conveniently be processed simultaneously. The risk of DNA fragmentation caused by rough extraction procedures was reduced. Maximum length of DNA fragment to be amplified was 450 bp with the HPV consensus primers MY09/MY 11 but amplification of DNA as long as 959 bp is possible (182). The extraction is performed in a microporous spin-column (QIA quickTM column-QIAGEN), originally designed to purify amplified PCR product

44 from agarose gels which reduces the risk for contamination and the risk for loss of material related to use of pellet-supernatant procedures (181). The results reveal that the quality of DNA extracted with the presented method is acceptable for most PCR procedures and that material from a 5-µm section and one 15-min round of digestion is sufficient for most PCR applications. High DNA quality and DNA content is important for the rate of detection of viral infection with PCR based methods which today are widely used also in the clinical setting (151, 153, 183-186) . Biopsies were obtained with the brush biopsy technique or the traditional scalpel biopsy technique which is considered the reliable method for diagnosing oral mucosal lesions preceded of a thorough clinical examination (187). The oral brush biopsy was developed to detect potentially malignant or malignant changes of the epithelium (188). The goal of the brush biopsy is to provide a highly sensitive and specific technique that is faster, less invasive, simpler to perform and less painful than a scalpel or punch biopsy. It is perhaps more suitable when doing field studies since less equipment and resources are needed. However the cells from the brushes have to centrifuged, collected and frozen until used for DNA extraction. It must be taken in to consideration the possibility of false negative and positive rate for the brush biopsies that might affected our result. Brush tissue biopsies were collected from healthy volunteer toombak users (n = 150) and non-users (n = 25) in Khartoum as part of a screening of healthy subjects. Potter et al. (189) reported a false negative rate of at least 3.5%. When the technique, is used as a screening test a comparison with other screening tests, such as breast or prostate cancer should be made. It seems then that the sensitivity is sufficient, while directed toward clinically obvious pathologic changes, the re- quirement for accuracy is much higher. Kujan et al. (190-191) concluded that “no robust evidence exists” to suggest that brush biopsy for screening of OSCC or potentially malignant lesions is either beneficial or harmful.

Presented data (figure 3) indicate that HPV is more prevalent in the potentially malignant lesions in India, OSMF (91%) and Sweden, OL + OLP (28%) than in OSCC in India (24%) and in Sweden (12.5%). In healthy samples from Sudanese non tobacco users more HPV infection was seen (68%) than in premalignant lesions in Sweden (28.6%, 27.3 %) and in the healthy Sweden samples (0%) while DNA was note detected at all in premalignant lesions from Sudan (0%). The prevalence of HPV in Sudanese brush biopsies from healthy toombak users was 40% and whereas no HPV was found in biopsies from Swedish snuff dippers with normal mucosa. There are several possible explanations. As mentioned earlier brush biopsies as used in study IV is associated with false positive as well as negative diagnosis but is unclear to what extent (189). The OSCC patients were older in all

45 three populations compared to the clinically healthy or the precancerous groups and secular variation over time in the incidence of viral infection may affect the prevalence. It is also possible that it is due to the inhibition of virus replication of smokeless tobacco as shown previously for HSV by Hirsch et al. (127). This is also supported by Salah et al. (144) that could not detect HPV genome in biopsies from Sudanese toombak dippers. In addition Hilmi et al.(192) in the international congress i Khartoum 2008, suggested that smokeless tobacco might have an antiviral effect that may inhibit HPV infections. The absence of HPV in biopsies from Swedish snuff-dippers and the lower prevalence of HPV in brush biopsies from toombak users in Sudan may also support such a conclusion. A previous study by Zhang et al.(68) have shown that HPV infection is a common event in the normal oral mucosa but their results are based on both tobacco and non tobacco users. We do not know “true prevalence” of HPV in Sweden, India and Sudan. Further studies with regard to possible antiviral effect against HPV of snuff, toombak and other substances in tobacco and the impact of this mechanism in the development of oral premalignant lesions and OSCC are necessary. TSNA in both smoked and smokeless tobacco are implicated as DNA- damaging agents in the aerodigestive tract and exposure to TSNAs most probably damages DNA also in HPV induced malignancies, but the extent of DNA damage in cellular and viral DNA in these malignancies is unclear (193). This issue is complex and not yet clarified. Even if we don’t know the exact role of HPV infection in the development of oral cancer, it is a major risk factor particularly in tumors that involve the lymphatic tissue in the lingual and palatine tonsils within the oropharynx (69, 194). In biopsies from Indian patients with the premalignant lesion OSMF we see a high prevalence of HPV (91%) and of these 55% were of the high risk HPV-16 type. Näsman et al. (175) have recently reported that HPV and particularly HPV16, play an important role for the increased incidence of tonsillar cancer. More than 90% of all tonsil cancer in the Stockholm area is HPV-positive and the prevalence of HPV in cancer tissue has increased during the last 40 years. Result from these studies in Stockholm also indicates a better prognosis for the HPV positive tumors which imply other mechanisms for tumor development than in tumors that are not related to HPV infection. Experimental and epidemiological data also support the concept that disturbed the immunoregulation in combination with HPV infection contribute to increased risk for cervical cancer (60). It is possible that these circumstances may be relevant for the high prevalence of HPV in OSMF. Another possible contributing factor is that microlesions in the surface epithelium in OSMF patients allow the virus to penetrate and DNA to integrate into the genome of the cells in the spinous and basal cell layers. This is supported by the fact that HPV 16 immortalized keratinocytes do not exhibit any tumorigenic activity in nude mice unless previously exposed to tobacco-specific carcinogens or other chemicals (195). In addition

46 we know that smoking and alcohol are documented etiological factors for tonsillar cancer and betel quid for OSMF. Even if it has been postulated that tobacco chemicals may have an antiviral effect on HPV as well as DNA damaging effect also on the viral genome other mechanisms may be related to the high prevalence of HPV in cancers and premalignat lesions. It is possible that tobacco chemicals promote HPV infections in these patients. Ac- cording to a recent publication from IARC cervical cancer is one of the most frequent cancers in Sudan and it is very closely related to HPV infection (8). These data support the high prevalence of HPV also in healthy non toombak using Sudanese.

The prevalence of HSV-1 in the OSCC patients in Sudan was twice that of India but low in both groups. No significant differences were seen comparing malignant and premalignat samples. Hirsch et al. (127) previously suggested that recurrent HSV-1 infection in association with snuff exposure is involved in the development of OSCC, but this could not be substantiated interpreting the data from the present studies. Observing the data from Sudan it was evident that prevalence of HSV was almost three times in brush biopsies from healthy Sudanes as in OSCC tissue biopsies. This result was unex- pected as previous reports from our group in a animal study that have demonstrated that antibody titers against HSV were significantly higher in the cancer patients (126). In a report by Nahmias et al. (196) over 40,000 sera were investigated from five continents, showing that HSV–serology is a marker for both socioeconomic status and sexual behavior. It was found that the HSV-1 seroprevalence among adults, in selected population, was up to 85 % in Africa and Latin America. The spread was related to lower socioeconomic standard. In a review by Smith et al. (119) the HSV-1 seroprevalence was also found to be high worldwide and increased in a roughly linear fashion with age. In most countries the majority was infected during childhood and adolescence. It has also noted that antibodies against HSV-1 were more common in the black than in the white population. With regard to these finding and our knowledge about HSV latency and reactivation, the low prevalence of HSV is intriguing. A putative antiviral effect of toombak is not a plausible explanation for this as the prevalence of HSVDNA was even lower in non toombak users.

The overall prevalence of EBV is high in Sudan compared to Sweden. It is not surprising that the EBV prevalence is high in Sudan considering that more than 90 % of the population has been infected in many countries on the continent. There is also the well known association between EBV and Bur-

47 kitt´s B-cell lymphoma (197). In addition chronic infection with EBV is involved in the development of hepatocellular carcinoma and nasopharyngeal carcinoma (198). The role of EBV infection in OSCC and oral premalignant lesions have been studied previously with somewhat contradictory results. In a previous study by Sand et al.(199) biopsies from Swedish patients with OSCC and oral lichen planus (OLP) patients had an increased prevalence of EBVcompared with what was found in healthy oral mucosa. In snuff-induced lesions no increased EBV positivity was found. Neither smoking, alcohol consumption nor increased age seems to increase EBV infection (199). The study by Sand et al. was performed with the same PCR technique that was used in the paper II and IV but with other primers (199-200). Prae- torius et al.(201) studied the presence of EBV in 24 snuff-induced lesions in a Danish population with the less sensitive in situ hybridization technique, and reported no EBV- positive specimens. Horiuchi et al. (202) found EBV in 5.3% of oral leukoplakias and increased EBV positivity in dysplastic lesions. They propose three possible explanations: 1. EBV infection may be involved in the carcinogenesis of oral squamous cell epithelium. 2. EBV easily infects squamous cell carcinoma cells. 3. EBV exists coincidentally in cancer cells with no biological role.

Cruz et al. (203) found 77.8% EBV positivity in premalignant lesions and increased EBV positivity in OSCC when compared with clinically normal oral mucosa. D'Costa et al. (204) detected EBV in 25 of 103 (25%) OSCC, 13 of 100 (13%) oral lesions, 3 of 76 (4%) clinically normal mucosa samples and 10 of 141 (7%) peripheral blood cells (PBC).The results indicate the same trend as we see and that EBV may contribute as one of the multiple factors in oral cancers, in a certain proportion of Indian patients. The Swedish data presented in paper II is coherent with these earlier reports whereas the data from Sudan in paper IV are contradictory. The prevalence of virus in brush biopsies from the normal mucosa was extremely high with lower values in the dysplastic lesions and even lower in OSCC patients. There was no significant difference with regard to toombak use or not. The results are interesting and further studies are necessary regarding the importance of EBV infection in OSCC.

In the studies from Sudan and India, co-infection with two or three viruses and co-existence were observed. The highest prevalence was found in patients with normal mucosa who were infected with both EBV and HPV and to a lesser extent with HPV and HSV. Co-infection with all three viruses, HPV, EBV and HSV was also found but in less than 10% of these individuals. In the biopsies from India only co-infection with EBV and HSV was

48 seen. The most probable explanation for this co-infection is that it reflects the prevalence of the individual viruses but other mechanisms with pathoge- netic importance can not be ruled out (205-206). A another study by Tung et al. (207) reported the co-existence of EBV and "high risk" HPV-16 or HPV- 18 infection and that this may be an important factor in the pathogenesis of nasopharyngeal carcinoma. In a study carried out in Lebanon, combined HPV+HSV-1 infection were associated with a greater risk of developing cervical carcinoma than infection with only one of these viruses (208-209). Currently, the role of high-risk HPV and EBV co-infections in human oral cancers, particularly nasopharyngeal carcinomas, remain uncertain because of the limited number of investigations (207).

49 Summary

Tobacco habits, alcohol consumption and virus infections are considered to be the main risk factors of oral cancer. Especially HR HPV is in focus as the major cause of the increase in oral cancer incidence in western countries. Based on a solid international network, potentially malignant as well as malignant specimens were collected from three different countries from three different continents, India (Asia), Sudan (Africa), and Sweden (Europe). India and Sudan have a high incidence of oral cancer ascribed the non smoked tobacco habits, betel quid chewing and the snuff dipping habit called toombak. The use of snuff is common in Sweden and snuff induced lesion do develop in to cancer. The most important part of this work is the opportunity to investigate three different populations, representing less privileged and privileged populations, exposed to three different types of non smoked tobacco habits. We developed a rapid and reliable protocol for DNA extraction to handle archival material or fresh paraffin imbedded specimens; both can be used in a wider outreach for oral health research. This eliminates some technical problems associated with handling of biopsies in connection with health research directed towards remote communities. In Sweden, we examined the possible etiological role of HPV, tobacco and alcohol in oral lesions but found no evidence that the oncogenic types of HPV16-18 together with tobacco/alcohol consumption take part in malignant cell transformation. An association between HPV infections and development of oral lesions was demonstrated but the pathogenic influence of HPV infection was not clarified. These data from Sweden constituted an important base for comparison of the possible role of viruses and tobacco in malignant cell transformation investigating samples from India and Sudan. Interesting we observed higher incidence of virus infection in potentially malignant than in malignant lesions, approximately 29 % in leukoplakias and lichen planus in Sweden, and in Sudan 40% of the toombak users and particularly high yields (91%) of HPV DNA in oral submucous fibrosis (OSMF) from India.

50 Notable is that we could neither in India nor in Sudan or Sweden, find any evidence that tobacco exposure and presence of virus DNA jointly increased the incidence of malignancies. In Sweden 13% were HPV positive of the most alcohol and tobacco exposed cancer patients while in India and Sudan oral cancer patients with tobacco habits were infected in approximately 25%. We do not know the impact of these viruses for development of OSCC which has been suggested in previous studies based on serologic data. It has been suggested that tobacco chemicals may have an antiviral effect and it is possible that virus interact with other oncogenic factors in the development of OSCC. It might be speculated that the difference in composition of the tobacco products used and the practice of the habit is an important factor. Previous studies have also reported HPV prevalence rates in oral cancer varying from 0-100% and this broad variation in HPV detection rate may be explained by the different methods used for HPV detection (153, 210- 211). This emphasizes the importance of methodological development and the superior sensitivity of PCR based methods for virus detection. It is however important that the DNA quality is adequate and uniform when PCR technology is applied. With the presented method for DNA extraction variation can be minimized which increase the reliability of the presented prevalence data. The high prevalence of HPV DNA in India in OSMF also indicates that ethnicity may play a role alone or in combination with the betel quid habit that paws the rode for virus infection. It is not obvious that tobacco and viruses interact in the development of oral cancer. It might be two different pathways involved; development of malignancies induced by tobacco specific carcinogens in a classical multi- step process and a virus induced transformation in the lymphatic tissues intra orally. One key issue to further study is the effect of tobacco mutagens on the virus propagation, and the effects on the regulating proteins controlling the process of morphologic transformation of the target tissue in the oral cavity.

51 Summary in Swedish

Humant papillomvirus (HPV), Epstein-Barr virus (EBV) och Herpes virus typ1(HSV-1) i munhålan är orsaken till en hög morbiditet över hela världen. Man tror att de flesta orala skivepitelcancrar utvecklas som en flerstegs process genom kumulativa genetiska förändringar i munslemhinnans epitelcel- ler. HPV, EBV och HSV DNA-integration i det humana genomet är sanno- likt associerat med uttryck av onkogener och nedreglering av tumörsupressorgener i ett tidigt stadium av skivepitelcancer. En ökad incidens av skivepitelcancer i en population orsakas till stor del av populationens tobaksvanor som är en känd riskfaktor. Olika typer av virus är sedan tidigare associerade med vissa typer av maligna tumörer. HPV´s, EBV´s och HSV´s carcinogena effekter i humant epitel är välkända sedan tidigare. Oral cancer är enligt WHO den 10:e vanligaste cancern i världen för men och den 14:e för både könen. Incidensen av oral cancer uppvisar en stor lo- kal variation och ökar i vissa delar av världen. Flerstegsmodellen av carci- nogenes är vida accepterad och innebär en stegvis förändring från premalig- na lesioner till metastaserande cancer. Oral leukoplaki (OL), oral lichen planus (OLP) och oral submukös fibros (OSMF) anses vara precancerösa förändringar och är av särskilt intresse. Baserat på antagandet att virus och tobak orsakar malign celltransformation, inklusive oral cancer, undersökte vi virusprevalensen tillsammans med to- baksexposition. Vi undersökte specifikt HPV, EBV, samt HSV-1 i patienter med förekommande tobaksbruk, på fr.a. icke rökande patienter. Vi tog vävnadsprover på patienter i två länder från olika kontinenter med dokumenterat hög incidens av oral cancer, Indien och Sudan. Dessa jämför- des med vävnadsprover från Sverige som har en dokumenterat låg incidens av oral cancer. Varje region har sina egna, utöver rökning, unika tobaksva- nor med dokumenterad cancereffekt. Dessa regioner har också områden med såväl låga som höga socioekonomiska levnadsförhållanden med sin förvän- tade påverkan på sjukdomsutvecklingen. Den studerade populationen bestod av såväl tobaksanvändare som icke tobaksanvändare. Dessa bestod av patienter med oral skivepitelcancer (Indi- en, Sudan och Sverige), OSMF (Indien), OLP (Sverige) och OL med och utan dysplasi, och snusinducerade lesioner (Sverige och Sudan). Vi utveck- lade även en smidig metod för DNA-extraktion från gamla formalin-fixerade parafininbäddade biopsier. Detta gjorde att vi inte var begränsade till färska biopsier. Vi använde oss dessutom av s.k. ”brush biopsies” från Sudan. Vi-

52 rusprevalensen undersöktes med PCR/DNA-sekvensering och Southern blot hybridisering. Vi fann att såväl HPV som EBV prevalensen var högst hos biopsierna från normal vävnad och att prevalensen minskar i dysplastiska och maligna lesioner. Det faktum att virusprevalensen minskar ju mer den neoplastiska utvecklingen fortskrider, kräver vidare studier. Dock var de svenska proven ett undantag där HPV prevalensen i oral cancer var högre än i frisk vävnad. Även skillnaden mellan HPV prevalensen i OSMF (91%) och oral cancer (24%) är slående och mekanismerna bakom detta bör utredas vidare.

53 Acknowledgements

This work was initiated at the Faculty of medicine, Department of Surgical Sciences; Oral & Maxillofacial Surgery, Uppsala University, Uppsala, Swe- den. I would like to take this opportunity to express my sincere gratitude to everyone who has contributed in various ways to complete this thesis. With- out the help and support this thesis would never have been completed. In particular I wish to express my thanks to:

Professor Jan–M. Hirsch, my main supervisor. I am deeply grateful for magnanimously giving me a chance to be your PhD- student. I am grateful that you believed in me to join your research group. For your valuable support and continuous advice during this long process. For your never ending energy, enthusiasm, patience and truly inspiration. For sharing your great knowledge in this interesting research area. Also giving me the opportunity to develop the project and work independently. You have always asked good critical questions and forced me to change my way of thinking. I would not say that was an easy process – it was sometimes exhausting- but in the end it provided useful lessons and I have always felt inspired and encouraged to move on with my studies after our discussions and developed my ability to think critically. It has been an honor to have you as my supervisor. Associate Professor Per-Anders Larsson, I have been very happy to have you as my co-supervisor. For constructive advice and your excellent help in preparing manuscripts and my thesis. In scientific writing with quickness, intelligence and a great enthusiasm and for your genuine interest. I don’t know how I would have managed without you.

To both of you, thank you for believing in me and giving me so much lati- tude. Also, thanks for scrutinizing my manuscripts over and over again and coming up with new and better ideas each time! Always brilliant suggestions for improvement.

Professor Bengt Magnusson my co-supervisor, without your generous help it would not have been possible.I am deeply grateful for giving me the opportunity to accomplish this thesis in your department “Oral Pathology, Uni-

54 versity of Gothenburg ”. For all your friendly support, stimulating discussions and for providing laboratory facilities. Dr Lars Sand, my co-supervisor and friend, for reading the thesis and adding valuable comments, enthusiasm, encouragement during my thesis work, for supportive e-mails, for your energy, engagement, and warmth, that has inspired and pushed me forward. For constant support and guidance on all levels during this journey and for many moments of fun to be remem- bered always. Associate Professor Salah O. Ibrahim, For your time, prompt feedback, interest and availability for this project. For always taking time to read my manuscripts and provide me with constructive criticism, and invaluable comments and suggestions on manuscripts.For making it possible for me and Miranda to visit your research group and laboratory in Bergen. Professor Lars Wiklund, Head Department of Surgical Sciences, for fi- nancial support and the administrative staff at the department, Karin Jo- hansson, Elisabeth Bergqvist, Siv Utterberg, Siv Andersson and Ewa Sjögren, for friendly support and for helping during my studies.

Research laboratory technician Stina Olsson, for your helpful discussions on methodology, organization in the lab and generous support over many years.Thank you very much for all advices, giving discussions and moral support through good times and bad. Your positive attitude has helped me even through the hard times. You have a unique ability to give relevant advice.

My co-authors, Dr Dipak Sapkota, Dr Ravi Mehrotra, Professor Endre N. Vasstrand, for great help with manuscript improvements, good cooperation, providing material for this study, and interest in the scientific writing.

Professor Gunnar Dahlén, Head of Oral microbiology, Gothenburg Uni- versity, for friendly generous support and for providing help with the laboratory facilities.

Research laboratory technician Susanne Blomqvist and Gunilla Hjort, for always being helpful and friendly and for being an excellent technical resource, excellent technical assistance and letting me share your lab experi- ences. For all the help with technical problems in the laboratory, for your positive mind and good collaboration throughout the years.

Per-Olof Blomstrand, IT-coordinator, Clinic of odontology, Gothenburg University, always being helpful and friendly, for all your help with the IT- related issues and computer assistance.

Dr Mats Wallström, for friendly support and encouragement.

55 Professor Bengt Gustavsson, for providing laboratory facilities.

I would like to thank my friends: Dag Linwik, for unconditional friendship and understanding through all these years and for immense support and for always reminding me what is important in life. For all your help and for meeting all my queries with a smile. For always wanting the best for me. For fun discussions, kindness and great sense of humour, best friend one could ever ask for. Kevork Sarkis Artin, for supporting conversations, joyful friendship. For your support and interest in my project and believing in me.

Finally, I want to thanks my beloved family: Miranda, my lovely wife and co-author, without your endless love and support I never would have made it to the end. Thank you for supporting me when I needed it the most. For encouragement throughout these years, for always being there, listening and giving constructive advices, for excellent laboratory skill and with help with manuscript improvements. Elina our dearest daughter and M.D student, for proofreading this thesis, for your support and encouragement. Always supporting me, and being there whenever I needed you. For mental support and helping me setting sufficient boundaries when needed. Daniel, our dearest son, for support and understanding in my situation and your help with the daily routines.

56 References

1. Collins SL. Squamous cell carcinoma of the oral cavity, oropharynx, pharyngeal wall and nasopharynx. In: Ballenger J, JB Snow J, editors. Otorhinolaryngology Head and Neck Surgery. 15th ed. Philadelphia: Williams & Wilkins; 1996. p. 249-368. 2. Hong WK, Lippman SM, Wolf GT. Recent advances in head and neck cancer--larynx preservation and cancer chemoprevention: the Seventeenth Annual Richard and Hinda Rosenthal Foundation Award Lecture. Cancer Res. 1993 Nov 1;53(21):5113-20. 3. Barnes L, International Agency for Research on Cancer, World Health Organization. Pathology and genetics of head and neck tumours. Lyon: IARC Press; 2005. 4. Research TMCfD. Oral precancer:dysplasia, molecular biology and microbiology. MFCenter; 1998 [cited 2010 Maj 14]; Available from: http://www.maxillofacialcenter.com/precancerDysplasia.html. 5. Noonan VL, Kabani S. Diagnosis and management of suspicious lesions of the oral cavity. Otolaryngol Clin North Am. 2005 Feb;38(1):21-35, vii. 6. Binnie WH, Rankin KV, Mackenzie IC. Etiology of oral squamous cell carcinoma. J Oral Pathol. 1983 Feb;12(1):11-29. 7. Proia NK, Paszkiewicz GM, Nasca MA, Franke GE, Pauly JL. Smoking and smokeless tobacco-associated human buccal cell mutations and their association with oral cancer--a review. Cancer Epidemiol Biomarkers Prev. 2006 Jun;15(6):1061-77. 8. IARC. Cancer incidence and mortality worldwide in 2008: World health organization, http://globocan.iarc.fr/2008. 9. Das BR, Nagpal JK. Understanding the biology of oral cancer. Med Sci Monit. 2002 Nov;8(11):RA258-67. 10. Gupta PC. Mouth cancer in India: a new epidemic? J Indian Med Assoc. 1999 Sep;97(9):370-3. 11. Nylander K, Nilsson P, Mehle C, Roos G. p53 mutations, protein expression and cell proliferation in squamous cell carcinomas of the head and neck. Br J Cancer. 1995 Apr;71(4):826-30. 12. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin. 2005 Mar-Apr;55(2):74-108. 13. Lane DP. Cancer. p53, guardian of the genome. Nature. 1992 Jul 2;358(6381): 15-6. 14. Koh JY, Cho NP, Kong G, Lee JD, Yoon K. p53 mutations and human papillomavirus DNA in oral squamous cell carcinoma: correlation with apoptosis. Br J Cancer. 1998 Aug;78(3):354-9. 15. Schildt E-B. Etiology of oral cancer. Umeå: University of Umeå-Sweden; 1998. 16. Yin XY, Smith ML, Whiteside TL, Johnson JT, Herberman RB, Locker J. Abnormalities in the p53 gene in tumors and cell lines of human squamous-cell carcinomas of the head and neck. Int J Cancer. 1993 May 8;54(2):322-7.

57 17. Ibrahim SO, Johannessen AC, Idris AM, Hirsch JM, Vasstrand EN, Magnusson B, et al. Immunohistochemical detection of p53 in non-malignant and malignant oral lesions associated with snuff dipping in the Sudan and Sweden. Int J Cancer. 1996 Dec 11;68(6):749-53. 18. Robinson M, Sloan P, Shaw R. Refining the diagnosis of oropharyngeal squamous cell carcinoma using human papillomavirus testing. Oral Oncol. 2010 Jul;46(7):492-6. 19. Kademani D. Oral cancer. Mayo Clin Proc. 2007 Jul;82(7):878-87. 20. Idris AM, Ahmed HM, Mukhtar BI, Gadir AF, el-Beshir EI. Descriptive epidemiology of oral neoplasms in Sudan 1970-1985 and the role of toombak. Int J Cancer. 1995 Apr 10;61(2):155-8. 21. Ferlay J, Autier P, Boniol M, Heanue M, Colombet M, Boyle P. Estimates of the cancer incidence and mortality in Europe in 2006. Ann Oncol. 2007 Mar;18 (3):581-92. 22. Day TA, Davis BK, Gillespie MB, Joe JK, Kibbey M, Martin-Harris B, et al. Oral cancer treatment. Curr Treat Options Oncol. 2003 Feb;4(1):27-41. 23. Copper MP, Tan IB, Oppelaar H, Ruevekamp MC, Stewart FA. Meta-tetra (hydroxyphenyl)chlorin photodynamic therapy in early-stage squamous cell carcinoma of the head and neck. Arch Otolaryngol Head Neck Surg. 2003 Jul; 129(7):709-11. 24. Sudbo J. Novel management of oral cancer: a paradigm of predictive oncology. Clin Med Res. 2004 Nov;2(4):233-42. 25. Hashibe M, Jacob BJ, Thomas G, Ramadas K, Mathew B, Sankaranarayanan R, et al. Socioeconomic status, lifestyle factors and oral premalignant lesions. Oral Oncol. 2003 Oct;39(7):664-71. 26. Hamad HM. Cancer initiatives in Sudan. Ann Oncol. 2006 Jun;17 Suppl 8: viii32-viii6. 27. Pindborg JJ, Barmes D, Roed-Petersen B. Epidemiology and histology of oral leukoplakia and leukoedema among Papuans and New Guineans. Cancer. 1968 Aug;22(2):379-84. 28. Schwrtz J. Atrophia idiopathica (tropica) mucosa oris. Demonstrated at the 11th international dental congress; London1952. 29. Joshi SG. Fibrosis of the palate and pillars. Indian J Otolaryngol 1953;4(1). 30. Babu S, Bhat RV, Kumar PU, Sesikaran B, Rao KV, Aruna P, et al. A comparative clinico-pathological study of oral submucous fibrosis in habitual chewers of pan masala and betelquid. J Toxicol Clin Toxicol. 1996;34(3): 317-22. 31. Shah B, Lewis MA, Bedi R. Oral submucous fibrosis in a 11-year-old Bangladeshi girl living in the United Kingdom. Br Dent J. 2001 Aug 11;191 (3):130-2. 32. Paul RR, Mukherjee A, Dutta PK, Banerjee S, Pal M, Chatterjee J, et al. A novel wavelet neural network based pathological stage detection technique for an oral precancerous condition. J Clin Pathol. 2005 Sep;58(9):932-8. 33. Cox SC, Walker DM. Oral submucous fibrosis. A review. Aust Dent J. 1996 Oct;41(5):294-9. 34. IARC. Oral submucous fibrosis (OSF). Lyon, France: World health organization (WHO)2010. 35. Soukos N. Oral Leukoplakia, Idiopathic emedicine from webMD; 2008 [updated Feb, 7, 2008; cited 2010 Maj 14]; medscapes continually updated clinical reference]. Available from: http://emedicine.medscape.com/article/ 853864-overview

58 36. Baric JM, Alman JE, Feldman RS, Chauncey HH. Influence of cigarette, pipe, and cigar smoking, removable partial dentures, and age on oral leukoplakia. Oral Surg Oral Med Oral Pathol. 1982 Oct;54(4):424-9. 37. IARC. Betel-quid and Areca-nut Chewing and Some Areca-nut-derived Nitrosamines. Lyon, France2004. 38. Axell T. Occurrence of leukoplakia and some other oral white lesions among 20,333 adult Swedish people. Community Dent Oral Epidemiol. 1987 Feb;15 (1):46-51. 39. Downer MC, Evans AW, Hughes Hallet CM, Jullien JA, Speight PM, Zakrzewska JM. Evaluation of screening for oral cancer and precancer in a company headquarters. Community Dent Oral Epidemiol. 1995 Apr;23(2):84-8. 40. Hogewind WF, van der Waal I. Prevalence study of oral leukoplakia in a selected population of 1000 patients from The Netherlands. Community Dent Oral Epidemiol. 1988 Oct;16(5):302-5. 41. Ikeda N, Ishii T, Iida S, Kawai T. Epidemiological study of oral leukoplakia based on mass screening for oral mucosal diseases in a selected Japanese population. Community Dent Oral Epidemiol. 1991 Jun;19(3):160-3. 42. Kleinman DV, Swango PA, Niessen LC. Epidemiologic studies of oral mucosal conditions--methodologic issues. Community Dent Oral Epidemiol. 1991 Jun;19(3):129-40. 43. Szabo G, Klenk G, Veer A, Nemeth Z. Correlation of the combination of alcoholism and smoking with the occurrence of cancer in the oral cavity. A screening study in an endangered population. Mund Kiefer Gesichtschir. 1999 May;3(3):119-22. 44. Zain RB, Ikeda N, Razak IA, Axell T, Majid ZA, Gupta PC, et al. A national epidemiological survey of oral mucosal lesions in Malaysia. Community Dent Oral Epidemiol. 1997 Oct;25(5):377-83. 45. Petti S. Pooled estimate of world leukoplakia prevalence: a systematic review. Oral Oncol. 2003 Dec;39(8):770-80. 46. Banoczy J, Gintner Z, Dombi C. Tobacco use and oral leukoplakia. J Dent Educ. 2001 Apr;65(4):322-7. 47. Macigo FG, Mwaniki DL, Guthua SW. The association between oral leukoplakia and use of tobacco, alcohol and khat based on relative risks assessment in Kenya. Eur J Oral Sci. 1995 Oct;103(5):268-73. 48. Greenspan JS, Greenspan D, Lennette ET, Abrams DI, Conant MA, Petersen V, et al. Replication of Epstein-Barr virus within the epithelial cells of oral "hairy" leukoplakia, an AIDS-associated lesion. N Engl J Med. 1985 Dec 19; 313(25):1564-71. 49. Webster-Cyriaque J, Middeldorp J, Raab-Traub N. Hairy leukoplakia: an unusual combination of transforming and permissive Epstein-Barr virus infections. J Virol. 2000 Aug;74(16):7610-8. 50. Al-Hashimi I, Schifter M, Lockhart PB, Wray D, Brennan M, Migliorati CA, et al. Oral lichen planus and oral lichenoid lesions: diagnostic and therapeutic considerations. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2007 Mar; 103 Suppl:S25 e1-12. 51. Scully C, Carrozzo M. Oral mucosal disease: Lichen planus. Br J Oral Maxillofac Surg. 2008 Jan;46(1):15-21. 52. Lodi G, Scully C, Carrozzo M, Griffiths M, Sugerman PB, Thongprasom K. Current controversies in oral lichen planus: report of an international consensus meeting. Part 2. Clinical management and malignant transformation. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2005 Aug;100(2):164-78.

59 53. Camisa C, Hamaty FG, Gay JD. Squamous cell carcinoma of the tongue arising in lichen planus: a case report and review of the literature. Cutis. 1998 Oct;62(4):175-8. 54. Chainani-Wu N, Silverman S, Jr., Lozada-Nur F, Mayer P, Watson JJ. Oral lichen planus: patient profile, disease progression and treatment responses. J Am Dent Assoc. 2001 Jul;132(7):901-9. 55. Gandolfo S, Richiardi L, Carrozzo M, Broccoletti R, Carbone M, Pagano M, et al. Risk of oral squamous cell carcinoma in 402 patients with oral lichen planus: a follow-up study in an Italian population. Oral Oncol. 2004 Jan;40(1): 77-83. 56. Holmstrup P, Thorn JJ, Rindum J, Pindborg JJ. Malignant development of lichen planus-affected oral mucosa. J Oral Pathol. 1988 May;17(5):219-25. 57. Rodstrom PO, Jontell M, Mattsson U, Holmberg E. Cancer and oral lichen planus in a Swedish population. Oral Oncol. 2004 Feb;40(2):131-8. 58. van der Meij EH, Schepman KP, Smeele LE, van der Wal JE, Bezemer PD, van der Waal I. A review of the recent literature regarding malignant transformation of oral lichen planus. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1999 Sep;88(3):307-10. 59. Scully C, Beyli M, Ferreiro MC, Ficarra G, Gill Y, Griffiths M, et al. Update on oral lichen planus: etiopathogenesis and management. Crit Rev Oral Biol Med. 1998;9(1):86-122. 60. zur Hausen H. Infections Causing Human Cancer. Weinheim Chichester: Wiley-VCH; John Wiley [distributor]; 2006. 61. Crawford LV, Crawford EM. A Comparative Study of Polyoma and Papilloma Viruses. Virology. 1963 Oct;21:258-63. 62. Mannarini L, Kratochvil V, Calabrese L, Gomes Silva L, Morbini P, Betka J, et al. Human Papilloma Virus (HPV) in head and neck region: review of literature. Acta Otorhinolaryngol Ital. 2009 Jun;29(3):119-26. 63. Syrjanen K, Syrjanen S, Lamberg M, Pyrhonen S, Nuutinen J. Morphological and immunohistochemical evidence suggesting human papillomavirus (HPV) involvement in oral squamous cell carcinogenesis. Int J Oral Surg. 1983 Dec; 12(6):418-24. 64. Chaturvedi A, L.G. M, , . Human Papillomavirus and Head and Neck Cancer. In: Olshan AF, editor. Epidemiology, Pathogenesis, and Prevention of Head and Neck Cancer New York2010. 65. Shah K, Howley P. Papillomaviruses. In: Fields BN, Knipe DM, Howley PM, editors. Fields Virology Philadelphia: Lippincott-Raven; 1996. p. 2077-109. 66. Orth G, Lambert P, Fllores E, Heino P, Song S. Papillomaviruses-human. In: Granoff A, Webster RG, editors. Encyclopedia of virology. 2. ed. San Diego, Calif. ; London: Academic; 1999. p. 1105-20. 67. Luo CW, Roan CH, Liu CJ. Human papillomaviruses in oral squamous cell carcinoma and pre-cancerous lesions detected by PCR-based gene-chip array. Int J Oral Maxillofac Surg. 2007 Feb;36(2):153-8. 68. Zhang ZY, Sdek P, Cao J, Chen WT. Human papillomavirus type 16 and 18 DNA in oral squamous cell carcinoma and normal mucosa. Int J Oral Maxillofac Surg. 2004 Jan;33(1):71-4. 69. Nasman A, Attner P, Hammarstedt L, Du J, Eriksson M, Giraud G, et al. Incidence of human papillomavirus (HPV) positive tonsillar carcinoma in Stockholm, Sweden: an epidemic of viral-induced carcinoma? Int J Cancer. 2009 Jul 15;125(2):362-6.

60 70. Chaturvedi AK, Engels EA, Anderson WF, Gillison ML. Incidence trends for human papillomavirus-related and -unrelated oral squamous cell carcinomas in the United States. J Clin Oncol. 2008 Feb 1;26(4):612-9. 71. Pintos J, Black MJ, Sadeghi N, Ghadirian P, Zeitouni AG, Viscidi RP, et al. Human papillomavirus infection and oral cancer: a case-control study in Montreal, Canada. Oral Oncol. 2008 Mar;44(3):242-50. 72. Syrjanen S. HPV infections and tonsillar carcinoma. J Clin Pathol. 2004 May; 57(5):449-55. 73. Tachezy R, Klozar J, Salakova M, Smith E, Turek L, Betka J, et al. HPV and other risk factors of oral cavity/oropharyngeal cancer in the Czech Republic. Oral Dis. 2005 May;11(3):181-5. 74. Kreimer AR, Clifford GM, Boyle P, Franceschi S. Human papillomavirus types in head and neck squamous cell carcinomas worldwide: a systematic review. Cancer Epidemiol Biomarkers Prev. 2005 Feb;14(2):467-75. 75. Cook MB, Dawsey SM, Freedman ND, Inskip PD, Wichner SM, Quraishi SM, et al. Sex disparities in cancer incidence by period and age. Cancer Epidemiol Biomarkers Prev. 2009 Apr;18(4):1174-82. 76. Mayne S, Morse D, Winn D. Cancers of the oral cavity and pharynx. In: Schottenfeld D, Fraumeni JF, editors. Cancer epidemiology and prevention 3. ed. New York: Oxford University Press; 2006. p. 674-96. 77. Howley PM, Lowy DR. Virology. 4. ed. Fields BN, Knipe DM, Howley PM, Griffin DE, editors. Philadelphia: Lippincott Williams & Wilkins; 2001. 78. Doorbar J, Kenneth R. Biology of papillomavirus replication in infected epithelium. Future Virology 2007;2(6):13. 79. Munger K, Howley PM. Human papillomavirus immortalization and transformation functions. Virus Res. 2002 Nov;89(2):213-28. 80. Nagpal JK, Patnaik S, Das BR. Prevalence of high-risk human papilloma virus types and its association with P53 codon 72 polymorphism in tobacco addicted oral squamous cell carcinoma (OSCC) patients of Eastern India. Int J Cancer. 2002 Feb 10;97(5):649-53. 81. Levav-Cohen Y, Goldberg Z, Zuckerman V, Grossman T, Haupt S, Haupt Y. C-Abl as a modulator of p53. Biochem Biophys Res Commun. 2005 Jun 10; 331(3):737-49. 82. Fridman JS, Lowe SW. Control of apoptosis by p53. Oncogene. 2003 Dec 8;22 (56):9030-40. 83. Sellors JW, Sankaranarayanan R. Colposcopy and Treament on Cervical Intraepithelial Neoplasia:A Beginner's Manual. Lyon2003. 84. zur Hausen H. Viruses in human cancers. Eur J Cancer. 1999 Aug;35(8): 1174-81. 85. Sugerman PB, Shillitoe EJ. The high risk human papillomaviruses and oral cancer: evidence for and against a causal relationship. Oral Dis. 1997 Sep;3(3): 130-47. 86. Nicol AF, Nuovo GJ, Dillner J. A summary of the 25th International Papillomavirus Conference 2009: vaccines, screening, epidemiology and therapeutics. J Clin Virol. 2010 Mar;47(3):208-15. 87. Bonnez W. Papillomavirus. In: Whitley RJ, Hayden FG, Richman DD, editors. Clinical virology. New York: Churchill Livingstone; 1997. p. 569-611. 88. Epstein MA, Achong BG, Barr YM. Virus Particles in Cultured Lymphoblasts from Burkitt's Lymphoma. Lancet. 1964 Mar 28;1(7335):702-3. 89. Pope JH, Horne MK, Scott W. Transformation of foetal human keukocytes in vitro by filtrates of a human leukaemic cell line containing herpes-like virus. Int J Cancer. 1968 Nov 15;3(6):857-66.

61 90. zur Hausen H, Schulte-Holthausen H, Klein G, Henle W, Henle G, Clifford P, et al. EBV DNA in biopsies of Burkitt tumours and anaplastic carcinomas of the nasopharynx. Nature. 1970 Dec 12;228(5276):1056-8. 91. Wolf H, zur Hausen H, Becker V. EB viral genomes in epithelial nasopharyngeal carcinoma cells. Nat New Biol. 1973 Aug 22;244(138):245-7. 92. Klein G, Giovanella BC, Lindahl T, Fialkow PJ, Singh S, Stehlin JS. Direct evidence for the presence of Epstein-Barr virus DNA and nuclear antigen in malignant epithelial cells from patients with poorly differentiated carcinoma of the nasopharynx. Proc Natl Acad Sci U S A. 1974 Dec;71(12):4737-41. 93. Sample J, Young L, Martin B, Chatman T, Kieff E, Rickinson A. Epstein-Barr virus types 1 and 2 differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes. J Virol. 1990 Sep;64(9):4084-92. 94. Pillai MR, Phanidhara A, Kesari AL, Nair P, Nair MK. Cellular manifestations of human papillomavirus infection in the oral mucosa. J Surg Oncol. 1999 May;71(1):10-5. 95. Rickinson AB, Kieff E. Epstein-Barr virus. In: Fields BN, Knipe DM, Howley PM, editors. Fields Virology 3. ed. Philadelphia: Lippincott-Raven; 1996. p. 2397-446. 96. Syrjanen S. Viral infections in oral mucosa. Scand J Dent Res. 1992 Feb;100 (1):17-31. 97. zur Hausen H. Herpesviruses and Oncogenesis. Infections Causing Human Cancer. Weinheim Chicheste: Wiley-VCH ; John Wiley [distributor]; 2006. p. 44-5. 98. Tischendorf P, Shramek GJ, Balagtas RC, Deinhardt F, Knospe WH, Noble GR, et al. Development and persistence of immunity to Epstein-Barr virus in man. J Infect Dis. 1970 Nov;122(5):401-9. 99. Lang DJ, Garruto RM, Gajdusek DC. Early acquisition of cytomegalovirus and Epstein-Barr virus antibody in several isolated Melanesian populations. Am J Epidemiol. 1977 May;105(5):480-7. 100. Black FL, Woodall JP, Evans AS, Liebhaber H, Henle G. Prevalence of antibody against viruses in the Tiriyo, an isolated Amazon tribe. Am J Epidemiol. 1970 Apr;91(4):430-8. 101. G. d-T. Role of Epestein - barr virus in human diseases : infectious mononucleosis, Burkitt' s lymphoma and nasopharyngeal carcinoma In: Klein G, editor. Viral oncology New York,1980. p. 769-97. 102. Babcock GJ, Hochberg D, Thorley-Lawson AD. The expression pattern of Epstein-Barr virus latent genes in vivo is dependent upon the differentiation stage of the infected B cell. Immunity. 2000 Oct;13(4):497-506. 103. Rickinson AB, Kieff E. Epstein-Barr Virus In: Fields BN, Knipe DM, Griffin DE, editors. Fields Virology 4. ed. Philadelphia: Lippincott-Raven; 2001. p. 2575-627. 104. Henle G, Henle W, Diehl V. Relation of Burkitt's tumor-associated herpes-ytpe virus to infectious mononucleosis. Proc Natl Acad Sci U S A. 1968 Jan;59(1): 94-101. 105. Borza CM, Hutt-Fletcher LM. Alternate replication in B cells and epithelial cells switches tropism of Epstein-Barr virus. Nat Med. 2002 Jun;8(6):594-9. 106. Thorley-Lawson DA. EBV the prototypical human tumor virus--just how bad is it? J Allergy Clin Immunol. 2005 Aug;116(2):251-61; quiz 62. 107. Borza CM, Morgan AJ, Turk SM, Hutt-Fletcher LM. Use of gHgL for attachment of Epstein-Barr virus to epithelial cells compromises infection. J Virol. 2004 May;78(10):5007-14.

62 108. Neuhierl B, Feederle R, Hammerschmidt W, Delecluse HJ. Glycoprotein gp110 of Epstein-Barr virus determines viral tropism and efficiency of infection. Proc Natl Acad Sci U S A. 2002 Nov 12;99(23):15036-41. 109. Middleton T, Sugden B. Retention of plasmid DNA in mammalian cells is enhanced by binding of the Epstein-Barr virus replication protein EBNA1. J Virol. 1994 Jun;68(6):4067-71. 110. Naher H, Gissmann L, Freese UK, Petzoldt D, Helfrich S. Subclinical Epstein-Barr virus infection of both the male and female genital tract--indication for sexual transmission. J Invest Dermatol. 1992 May;98(5):791-3. 111. Saito I, Nishimura S, Kudo I, Fox RI, Moro I. Detection of Epstein-Barr virus and human herpes virus type 6 in saliva from patients with lymphoproliferative diseases by the polymerase chain reaction. Arch Oral Biol. 1991;36(11):779-84. 112. Mao EJ, Smith CJ. Detection of Epstein-Barr virus (EBV) DNA by the polymerase chain reaction (PCR) in oral smears from healthy individuals and patients with squamous cell carcinoma. J Oral Pathol Med. 1993 Jan;22(1):12-7. 113. Wagner EK, Sandri-Goldin RM. Herpes simplex viruses: molecular biology. In: Mahy, Regenmartel V, H.V. M, editors. Desk encyclopedia of General Virology: Academic press; 2008. p. 460-8. 114. Cliffe AR, Knipe DM. Herpes simplex virus ICP0 promotes both histone removal and acetylation on viral DNA during lytic infection. J Virol. 2008 Dec;82(24):12030-8. 115. Knipe DM, Cliffe A. Chromatin control of herpes simplex virus lytic and latent infection. Nat Rev Microbiol. 2008 Mar;6(3):211-21. 116. Roizman B, Sears AE. Herpes simplex viruses and their replication. In: Fields BN, Knipe DM, Howley PM, Chanock RM, editors. Fields virology. 3rd ed. Philadelphia: Lippincott-Raven; 1996. p. 2231-95. 117. van Benthem BH, Spaargaren J, van Den Hoek JA, Merks J, Coutinho RA, Prins M. Prevalence and risk factors of HSV-1 and HSV-2 antibodies in European HIV infected women. Sex Transm Infect. 2001 Apr;77(2):120-4. 118. Roberts CM, Pfister JR, Spear SJ. Increasing proportion of herpes simplex virus type 1 as a cause of genital herpes infection in college students. Sex Transm Dis. 2003 Oct;30(10):797-800. 119. Smith JS, Robinson NJ. Age-specific prevalence of infection with herpes simplex virus types 2 and 1: a global review. J Infect Dis. 2002 Oct 15;186 Suppl 1:S3-28. 120. Vyse AJ, Gay NJ, Slomka MJ, Gopal R, Gibbs T, Morgan-Capner P, et al. The burden of infection with HSV-1 and HSV-2 in England and Wales: implications for the changing epidemiology of genital herpes. Sex Transm Infect. 2000 Jun;76(3):183-7. 121. Lowhagen GB, Tunback P, Andersson K, Johannisson G. Recurrent genital herpes in a population attending a clinic for sexually transmitted diseases. Acta Derm Venereol. 2001 Jan-Feb;81(1):35-7. 122. Fleming DT, McQuillan GM, Johnson RE, Nahmias AJ, Aral SO, Lee FK, et al. Herpes simplex virus type 2 in the United States, 1976 to 1994. N Engl J Med. 1997 Oct 16;337(16):1105-11. 123. Scott DA, Coulter WA, Lamey PJ. Oral shedding of herpes simplex virus type 1: a review. J Oral Pathol Med. 1997 Nov;26(10):441-7. 124. Langenberg AG, Corey L, Ashley RL, Leong WP, Straus SE. A prospective study of new infections with herpes simplex virus type 1 and type 2. Chiron HSV Vaccine Study Group. N Engl J Med. 1999 Nov 4;341(19):1432-8.

63 125. Stich JE, Li KK, Chun YS, Weiss R, Park NH. Effect of smokeless tobacco on the replication of herpes simplex virus in vitro and on production of viral lesions in hamster cheek pouch. Arch Oral Biol. 1987;32(4):291-6. 126. Larsson PA, Johansson SL, Vahlne A, Hirsch JM. Snuff tumorigenesis: effects of long-term snuff administration after initiation with 4-nitroquinoline-N-oxide and herpes simplex virus type 1. J Oral Pathol Med. 1989 Apr;18(4):187-92. 127. Hirsch JM, Johansson SL, Vahlne A. Effect of snuff and herpes simplex virus-1 on rat oral mucosa: possible associations with the development of squamous cell carcinoma. J Oral Pathol. 1984 Feb;13(1):52-62. 128. IARC, Cancer IAfRo. Smokeless tobacco and some tobacco-specific N-Nitrosamines. Lyon-France2007. 129. Scenihr. Health effects of smokeless tobacco products preliminary report: Health&Consumer Protection Directorate-General june 2007. 130. Cogliano V, Straif K, Baan R, Grosse Y, Secretan B, El Ghissassi F. Smokeless tobacco and tobacco-related nitrosamines. Lancet Oncol. 2004 Dec; 5(12):708. 131. Levy DT, Mumford EA, Cummings KM, Gilpin EA, Giovino G, Hyland A, et al. The relative risks of a low-nitrosamine smokeless tobacco product compared with smoking cigarettes: estimates of a panel of experts. Cancer Epidemiol Biomarkers Prev. 2004 Dec;13(12):2035-42. 132. Foulds J, Ramstrom L, Burke M, Fagerstrom K. Effect of smokeless tobacco (snus) on smoking and public health in Sweden. Tob Control. 2003 Dec;12(4): 349-59. 133. Hirsch JM, Sloberg K, Adell R, Zaterstrom U, Wallstrom M. Snuff induced cancer in Sweden. In: Proceedings of 3rd International Conference on smokeless tobacco. Stockholm-Sweden 2002. 134. Zatterstrom UK, Svensson M, Sand L, Nordgren H, Hirsch JM. Oral cancer after using Swedish snus (smokeless tobacco) for 70 years - a case report. Oral Dis. 2004 Jan;10(1):50-3. 135. Roosaar A, Johansson AL, Sandborgh-Englund G, Axell T, Nyren O. Cancer and mortality among users and nonusers of snus. Int J Cancer. 2008 Jul 1;123 (1):168-73. 136. Costea DE, Lukandu O, Bui L, Ibrahim MJ, Lygre R, Neppelberg E, et al. Adverse effects of Sudanese toombak vs. Swedish snuff on human oral cells. J Oral Pathol Med. 2010 Feb;39(2):128-40. 137. Rosenquist K. Risk factors in oral and oropharyngeal squamous cell carcinoma: a population-based case-control study in southern Sweden. Swed Dent J Suppl. 2005(179):1-66. 138. Gupta PC, Ray CS. Epidemiology of betel quid usage. Ann Acad Med Singapore. 2004 Jul;33(4 Suppl):31-6. 139. Norton SA. Betel: consumption and consequences. J Am Acad Dermatol. 1998 Jan;38(1):81-8. 140. Ahmed HG, Mahgoob RM. Impact of Toombak dipping in the etiology of oral cancer: gender-exclusive hazard in the Sudan. J Cancer Res Ther. 2007 Apr-Jun;3(2):127-30. 141. Idris AM, Ibrahim SO, Vasstrand EN, Johannessen AC, Lillehaug JR, Magnusson B, et al. The Swedish snus and the Sudanese toombak: are they different? Oral Oncol. 1998 Nov;34(6):558-66. 142. Idris AM, Nair J, Ohshima H, Friesen M, Brouet I, Faustman EM, et al. Unusually high levels of carcinogenic tobacco-specific nitrosamines in Sudan snuff (toombak). Carcinogenesis. 1991 Jun;12(6):1115-8.

64 143. Idris AM, Nair J, Friesen M, Ohshima H, Brouet I, Faustman EM, et al. Carcinogenic tobacco-specific nitrosamines are present at unusually high levels in the saliva of oral snuff users in Sudan. Carcinogenesis. 1992 Jun;13(6):1001-5. 144. Ibrahim SO, Vasstrand EN, Johannessen AC, Idris AM, Magnusson B, Nilsen R, et al. Mutations of the p53 gene in oral squamous-cell carcinomas from Sudanese dippers of nitrosamine-rich toombak and non-snuff-dippers from the Sudan and Scandinavia. Int J Cancer. 1999 May 17;81(4):527-34. 145. Ibrahim SO, Lillehaug JR, Dolphine O, Johnson NW, Warnakulasuriya KA, Vasstrand EN. Mutations of the cell cycle arrest gene p21WAF1, but not the metastasis-inducing gene S100A4, are frequent in oral squamous cell carcinomas from Sudanese toombak dippers and non-snuff-dippers from the Sudan, Scandinavia, USA and UK. Anticancer Res. 2002 May-Jun;22(3):1445-51. 146. Idris AM, Prokopczyk B, Hoffmann D. Toombak: a major risk factor for cancer of the oral cavity in Sudan. Prev Med. 1994 Nov;23(6):832-9. 147. Elbeshir EI, Abeen HA, Idris AM, Abbas K. Snuff dipping and oral cancer in Sudan: a retrospective study. Br J Oral Maxillofac Surg. 1989 Jun;27(3):243-8. 148. Shibata D. Extraction of DNA from paraffin-embedded tissue for analysis by polymerase chain reaction: new tricks from an old friend. Hum Pathol. 1994 Jun;25(6):561-3. 149. Hughes S, Moody A. PCR. Bloxham: Scion Publishing; 2006. 150. Windholz M. The Merc index: An encyclopedia of chemicals, Drugs, and Biologicals. 10 ed. Rahway: Merc & Co., P.O.Box 2000 1983. 151. Webster-Cyriaque J, Edwards RH, Quinlivan EB, Patton L, Wohl D, Raab-Traub N. Epstein-Barr virus and human herpesvirus 8 prevalence in human immunodeficiency virus-associated oral mucosal lesions. J Infect Dis. 1997 Jun;175(6):1324-32. 152. BM. PCR Applications Manual. Mannheim: Boehringer Mannheim GmbH, Biochemica.; 1995. 153. Remmerbach TW, Brinckmann UG, Hemprich A, Chekol M, Kuhndel K, Liebert UG. PCR detection of human papillomavirus of the mucosa: comparison between MY09/11 and GP5+/6+ primer sets. J Clin Virol. 2004 Aug;30(4):302-8. 154. Wright D, Manos M. Sample preparation from paraffin-embedded tissues. In: Innis MA, Gelfand DH, Sninsky TJ, White TJ, editors. PCR Protocols, A Guide to Methods and Applications. San Diego, California: ACADEMIC PRESS,INC; 1990. p. 153-8. 155. Roux KH. Optimization and troubleshooting in PCR. PCR methods and application. 1995;4(5):9. 156. Zimmermann K, Pischinger K, Mannhalter JW. Nested primer PCR detection limits of HIV-1 in the background of increasing numbers of lysed cells. Biotechniques. 1994 Jul;17(1):18-20. 157. Zhang XY, Ehrlich M. Detection and quantitation of low numbers of chromosomes containing bcl-2 oncogene translocations using semi-nested PCR. Biotechniques. 1994 Mar;16(3):502-7. 158. Rapley R, Walker JM. Molecular biomethods handbook. 2. ed. Totowa, NJ: Humana Press; 2008. 159. Niv A, Sion-Vardi N, Gatot A, Nash M, Fliss DM. Identification and typing of human papillomavirus (HPV) in squamous cell carcinoma of the oral cavity and oropharynx. J Laryngol Otol. 2000 Jan;114(1):41-6. 160. Zehbe I, Rylander E, Strand A, Wilander E. Use of Probemix and OmniProbe biotinylated cDNA probes for detecting HPV infection in biopsy specimens from the genital tract. J Clin Pathol. 1993 May;46(5):437-40.

65 161. Wright DK, Manos MM. Sample preparation from paraffin-embedded tissues. In: Innis MA, Gelfand DH, Sninsky TJ, White TJ, editors. PCR protocols, A guide to methods and applications. San Diego, California: Academic Press , Inc; 1990. p. 153-8. 162. Bundgaard T, Wildt J, Frydenberg M, Elbrond O, Nielsen JE. Case-control study of squamous cell cancer of the oral cavity in Denmark. Cancer Causes Control. 1995 Jan;6(1):57-67. 163. Rosenquist K, Wennerberg J, Schildt EB, Bladstrom A, Goran Hansson B, Andersson G. Oral status, oral infections and some lifestyle factors as risk factors for oral and oropharyngeal squamous cell carcinoma. A population-based case-control study in southern Sweden. Acta Otolaryngol. 2005 Dec;125(12):1327-36. 164. Yang YY, Koh LW, Tsai JH, Tsai CH, Wong EF, Lin SJ, et al. Involvement of viral and chemical factors with oral cancer in Taiwan. Jpn J Clin Oncol. 2004 Apr;34(4):176-83. 165. Enwonwu CO, Meeks VI. Bionutrition and oral cancer in humans. Crit Rev Oral Biol Med. 1995;6(1):5-17. 166. Garewal H. Antioxidants in oral cancer prevention. Am J Clin Nutr. 1995 Dec; 62(6 Suppl):1410S-6S. 167. Franceschi S, Favero A, Conti E, Talamini R, Volpe R, Negri E, et al. Food groups, oils and butter, and cancer of the oral cavity and pharynx. Br J Cancer. 1999 May;80(3-4):614-20. 168. Levi F, Pasche C, La Vecchia C, Lucchini F, Franceschi S, Monnier P. Food groups and risk of oral and pharyngeal cancer. Int J Cancer. 1998 Aug 31;77 (5):705-9. 169. Lissowska J, Pilarska A, Pilarski P, Samolczyk-Wanyura D, Piekarczyk J, Bardin-Mikollajczak A, et al. Smoking, alcohol, diet, dentition and sexual practices in the epidemiology of oral cancer in Poland. Eur J Cancer Prev. 2003 Feb;12(1):25-33. 170. Du X, Squier CA, Kremer MJ, Wertz PW. Penetration of N-nitrosonornicotine (NNN) across oral mucosa in the presence of ethanol and nicotine. J Oral Pathol Med. 2000 Feb;29(2):80-5. 171. Pamuk ER, Byers T, Coates RJ, Vann JW, Sowell AL, Gunter EW, et al. Effect of smoking on serum nutrient concentrations in African-American women. Am J Clin Nutr. 1994 Apr;59(4):891-5. 172. Franceschi S, Dal Maso L, Levi F, Conti E, Talamini R, La Vecchia C. Leanness as early marker of cancer of the oral cavity and pharynx. Ann Oncol. 2001 Mar;12(3):331-6. 173. Nieto A, Sanchez MJ, Martinez C, Castellsague X, Quintana MJ, Bosch X, et al. Lifetime body mass index and risk of oral cavity and oropharyngeal cancer by smoking and drinking habits. Br J Cancer. 2003 Nov 3;89(9):1667-71. 174. Johnson NW, Warnakulasuriy S, Tavassoli M. Hereditary and environmental risk factors; clinical and laboratory risk matters for head and neck, especially oral, cancer and precancer. Eur J Cancer Prev. 1996 Feb;5(1):5-17. 175. Nasman A, Attner P, Hammarstedt L, Du J, Eriksson M, Giraud G, et al. Incidence of human papillomavirus (HPV) positive tonsillar carcinoma in Stockholm, Sweden: an epidemic of viral-induced carcinoma? Int J Cancer. 2009 Jul 15;125(2):362-6. 176. Larsson P-A. A study on interactions of herpes simplex virus and tobacco-with special reference to tumor development. Gothenburg: Gothenburg; 1990. 177. Scully C. Oral squamous cell carcinoma; from an hypothesis about a virus, to concern about possible sexual transmission. Oral Oncol. 2002 Apr;38(3):227-34.

66 178. Efstathiou S, Preston CM. Towards an understanding of the molecular basis of herpes simplex virus latency. Virus Res. 2005 Aug;111(2):108-19. 179. Isola J, DeVries S, Chu L, Ghazvini S, Waldman F. Analysis of changes in DNA sequence copy number by comparative genomic hybridization in archival paraffin-embedded tumor samples. Am J Pathol. 1994 Dec;145(6):1301-8. 180. Jackson DP, Hayden JD, Quirke P. Extraction of nucleic acid from fresh and archival material. In: McPherson MJ, Quirke P, Taylor GR, editors. PCR : a practical approach. Oxford: IRL Press; 1991. p. 29-50. 181. Wright DK, Manos.M.M. Sample Preparation from Paraffin-Embedded Tissues. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR protocols : a guide to methods and applications San Diego: Academic Press; 1990. 182. Akalu A, Reichardt JK. A reliable PCR amplification method for microdissected tumor cells obtained from paraffin-embedded tissue. Genet Anal. 1999 Dec 15;15(6):229-33. 183. Church JD, Jones D, Flys T, Hoover D, Marlowe N, Chen S, et al. Sensitivity of the ViroSeq HIV-1 genotyping system for detection of the K103N resistance mutation in HIV-1 subtypes A, C, and D. J Mol Diagn. 2006 Sep;8(4):430-2; quiz 527. 184. Moody A. An introduction to the polymerase chain reaction. In: Hughes S, Moody A, editors. PCR. Bloxham: Scion Publishing; 2006. 185. Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol. 1986;51 Pt 1:263-73. 186. Yang S, Rothman RE. PCR-based diagnostics for infectious diseases: uses, limitations, and future applications in acute-care settings. Lancet Infect Dis. 2004 Jun;4(6):337-48. 187. Trullenque-Eriksson A, Munoz-Corcuera M, Campo-Trapero J, Cano-Sanchez J, Bascones-Martinez A. Analysis of new diagnostic methods in suspicious lesions of the oral mucosa. Med Oral Patol Oral Cir Bucal. 2009 May;14(5):E210-6. 188. Sciubba J. Oral Brush Biopsy With Computer-Assisted Analysis. webmed professional; 2003 [cited 2009 18 feb]; Available from: http://emedicine.medscape.com/article/1079861-overview. 189. Potter TJ, Summerlin DJ, Campbell JH. Oral malignancies associated with negative transepithelial brush biopsy. J Oral Maxillofac Surg. 2003 Jun;61(6): 674-7. 190. Kujan O, Glenny AM, Duxbury J, Thakker N, Sloan P. Evaluation of screening strategies for improving oral cancer mortality: a Cochrane systematic review. J Dent Educ. 2005 Feb;69(2):255-65. 191. Kujan O, Glenny AM, Oliver RJ, Thakker N, Sloan P. Screening programmes for the early detection and prevention of oral cancer. Cochrane Database Syst Rev. 2006;3:CD004150. 192. Hilmi ZA, Idris AM, Elwali NA, Fadl Al Mola IM, Hassan Khamees A. Detection of human papillomavirus in oral squamous cell carcinomas in Sudan International congress on environment, immune-mediated disease an cancer: Lessons from developing and developed countries; Khartoum, Sudan: Lofarma S.p.A., Viale Cassala 40, 20143 Milano, Italy; 2008. 193. Nair J, Ohshima H, Nair UJ, Bartsch H. Endogenous formation of nitrosamines and oxidative DNA-damaging agents in tobacco users. Crit Rev Toxicol. 1996; 26(2):149-61. 194. Herrero R, Castellsague X, Pawlita M, Lissowska J, Kee F, Balaram P, et al. Human papillomavirus and oral cancer: the International Agency for Research on Cancer multicenter study. J Natl Cancer Inst. 2003 Dec 3;95(23):1772-83.

67 195. Tsantoulis PK, Kastrinakis NG, Tourvas AD, Laskaris G, Gorgoulis VG. Advances in the biology of oral cancer. Oral Oncol. 2007 Jul;43(6):523-34. 196. Nahmias AJ, Lee FK, Beckman-Nahmias S. Sero-epidemiological and -sociological patterns of herpes simplex virus infection in the world. Scand J Infect Dis Suppl. 1990;69:19-36. 197. WHO. Initiative for vaccine research; Epstein-Barr virus: World health organization;http://www.who.int/vaccine_research/diseases/viral_cancers/en/ index1.html2010. 198. WHO. World health report 2004:changing history. Geneva2004. 199. Sand LP, Jalouli J, Larsson PA, Hirsch JM. Prevalence of Epstein-Barr virus in oral squamous cell carcinoma, oral lichen planus, and normal oral mucosa. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2002 May;93(5):586-92. 200. Sand L, Wallstrom M, Jalouli J, Larsson PA, Hirsch JM. Epstein-Barr virus and human papillomavirus in snuff-induced lesions of the oral mucosa. Acta Otolaryngol. 2000 Oct;120(7):880-4. 201. Praetorius F, SyrjaÈ nen S, Padayachee A, Pindborg J, editors. Human papillomavirus and snuff-induced oral leukoplakias. The Ninth International Papillomavirus; 1990; Heidelberg , Germany. 202. Horiuchi K, Mishima K, Ichijima K, Sugimura M, Ishida T, Kirita T. Epstein-Barr virus in the proliferative diseases of squamous epithelium in the oral cavity. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1995 Jan;79(1): 57-63. 203. Cruz I, Van den Brule AJ, Steenbergen RD, Snijders PJ, Meijer CJ, Walboomers JM, et al. Prevalence of Epstein-Barr virus in oral squamous cell carcinomas, premalignant lesions and normal mucosa--a study using the polymerase chain reaction. Oral Oncol. 1997 May;33(3):182-8. 204. D'Costa J, Saranath D, Sanghvi V, Mehta AR. Epstein-Barr virus in tobacco-induced oral cancers and oral lesions in patients from India. J Oral Pathol Med. 1998 Feb;27(2):78-82. 205. Bouda M, Gorgoulis VG, Kastrinakis NG, Giannoudis A, Tsoli E, Danassi-Afentaki D, et al. "High risk" HPV types are frequently detected in potentially malignant and malignant oral lesions, but not in normal oral mucosa. Mod Pathol. 2000 Jun;13(6):644-53. 206. Buyru N, Tigli H, Dalay N. P53 codon 72 polymorphism in breast cancer. Oncol Rep. 2003 May-Jun;10(3):711-4. 207. Tung YC, Lin KH, Chu PY, Hsu CC, Kuo WR. Detection of human papilloma virus and Epstein-Barr virus DNA in nasopharyngeal carcinoma by polymerase chain reaction. Kaohsiung J Med Sci. 1999 May;15(5):256-62. 208. Allander T, Andreasson K, Gupta S, Bjerkner A, Bogdanovic G, Persson MA, et al. Identification of a third human polyomavirus. J Virol. 2007 Apr;81(8):4130-6. 209. Finan RR, Musharrafieh U, Almawi WY. Detection of Chlamydia trachomatis and herpes simplex virus type 1 or 2 in cervical samples in human papilloma virus (HPV)-positive and HPV-negative women. Clin Microbiol Infect. 2006 Sep;12(9):927-30. 210. Castro TP, Bussoloti Filho I. Prevalence of human papillomavirus (HPV) in oral cavity and oropharynx. Braz J Otorhinolaryngol. 2006 Mar-Apr;72(2):272-82. 211. Chaudhary AK, Singh M, Sundaram S, Mehrotra R. Role of human papillomavirus and its detection in potentially malignant and malignant head and neck lesions: updated review. Head Neck Oncol. 2009;1(1):22.